| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Production1
*
Department of Immunology and Medical Zoology,
Laboratory of Host Defenses, Institute for Advanced Medical Sciences, and
Department of Biochemistry, Hyogo College of Medicine, Nishinomiya, Hyogo, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production from T, B, and NK cells. Furthermore, IL-18 and
IL-12 synergize for IFN- production from Th1 cells, although this
combination fails to affect Th2 cells. In this study, we show that
IL-12 and IL-18 promptly and synergistically induce T and B cells to
develop into IFN--producing cells without engaging their Ag
receptors. We also studied the mechanism underlying differences
in IL-18 responsiveness between Th1 and Th2 cells. Pretreatment of T or
B cells with IL-12 rendered them responsive to IL-18, which induces
cell proliferation and IFN- production. These IL-12-stimulated cells
had both high and low affinity IL-18R and an increased IL-18R mRNA
expression. In particular, IL-12-stimulated T cells strongly and
continuously expressed IL-18R mRNA. However, when T cells developed
into Th1 cells after stimulation with anti-CD3 and IL-12, they
lowered this IL-12-induced-IL-18R mRNA expression. Then, such T cells
showed a dominant response to anti-CD3 by IFN- production when
they were subsequently stimulated with anti-CD3 and IL-18. In
contrast, Th2 cells did not express IL-18R mRNA and failed to produce
IFN- in response to anti-CD3 and IL-18, although they produced a
substantial amount of IFN- in response to anti-CD3 and IL-12.
However, when Th1 and Th2 cells were stimulated with anti-CD3,
IL-12, and IL-18, only the Th1 cells markedly augmented IFN-
production in response to IL-18, suggesting that IL-18 responsiveness
between Th1 and Th2 cells resulted from their differential expression
of IL-18R. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production by Th1 cells, T cells, and B
cells, in collaboration with IL-12 (1, 4, 5, 6, 7), and by cloned NK cells
without help from IL-12 (8). In addition, IL-18 augments Fas ligand
expression on cloned Th1 cells and NK cells in vitro and on liver
lymphocytes in vivo (8, 9, 10). CD4+ T helper cells can be divided into Th1 and Th2 cells on the basis of their cytokine profile (11, 12, 13). Their development depends on the mode of priming: IL-12 and IL-4 induce differentiation of naive T cells toward Th1 or Th2 cells, respectively (14, 15, 16, 17, 18, 19, 20, 21). IL-18 shares some of its biologic activities with IL-12, although the primary structures of the two cytokines show no homology (1). Importantly, these two factors show fundamental difference in their ability to induce Th1 cells: IL-12 induces naive CD4+ T cells to develop into Th1 cells in vivo and in vitro (18, 19, 22), whereas IL-18 cannot effect this development (5, 23, 24).
IL-18 by itself does not induce IFN- production by T cells and B
cells. However, as we have reported, IL-12 and IL-18 promptly and
synergistically induce anti-CD3-stimulated T cells or
anti-CD40-stimulated B cells to develop into highly
IFN--producing cells (6), suggesting the possibility that IL-12
induces IL-18R on T cells or B cells. Indeed, using an IL-12-responsive
cloned Th1 cells, 2D6, we were able to reveal that 2D6 cells maintained
with IL-12 or IL-2 exhibited differential IL-18 responsiveness and that
the former expressed IL-18R (25). Furthermore, IL-18 stimulates other
cloned Th1 cells to proliferate and to produce IL-2,
granulocyte/macrophage CSF, and IL-2R
, whereas IL-18 has no effect
on Th2 cells (7). In this study, we investigated the mechanism whereby
IL-18 and IL-12 synergize for IFN- production by T cells or B cells
without engaging their Ag receptors. We also studied the mechanism
underlying the differences in IL-18 responsiveness between Th1 cells
and Th2 cells.
Recently, human IL-18R has been purified and characterized (26). Its
internal amino acid sequence completely matched that of human
IL-1R-related protein
(IL-1Rrp),3 the ligand of
which is unknown to date (27). IL-18R resembles the type 1 IL-1R and
transduces a signal that activates IL-1R-associated kinase (IRAK) and
induces nuclear translocation of NF-
B (23, 26). Since the DNA
sequence of murine IL-1Rrp is available, we have cloned murine
IL-1Rrp (murine IL-18R) by PCR. Using this cDNA as a probe, we examined
the regulation of IL-18R mRNA in T cells and B cells by IL-12. We also
measured the number and affinity of IL-18R on both T and B cells
stimulated with IL-12 in vitro. Furthermore, we examined the action of
anti-CD3 on the expression of IL-18R. Finally, we examined whether
differential responsiveness of Th1 and Th2 cells to IL-18 results from
preferential expression of IL-18R on Th1 cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Virus-free BALB/c mice, 8 to 12 wk of age, were obtained from
Shizuoka Laboratory Animal Center (Shizuoka, Japan). Recombinant mouse
IFN-, IL-12, and IL-18 were kindly provided by Hayashibara
Biochemical Laboratories (Okayama, Japan). Mouse rIL-4 was obtained and
purified from a recombinant baculovirus (AcMNPV.IL-4) prepared in our
laboratory. Anti-CD3 Ab (145-2C11, hamster IgG2a directed against the
-chain) (28) and goat anti-mouse IgM Ab were prepared and used
for cell stimulation and/or fluorocytometric analysis. FITC-rat
anti-mouse B220 (RA3-6B2), FITC-rat anti-mouse Mac-1 (M1/70),
FITC-goat anti-mouse IgM, and phycoerythrin-rat anti-mouse
IL-2R ß-chain (TMß1) were purchased from PharMingen (San Diego,
CA). Cyclosporin A (CsA) was a generous gift of Sandoz (Basel,
Switzerland).
Culture medium
RPMI 1640 supplemented with 10% FBS (HyClone, Logan, UT), 2-ME (50 µM), L-glutamine (2 mM), penicillin (100 U/ml), streptomycin (100 µg/ml), and sodium pyruvate (1 mM) was used as the culture medium.
B and T cell preparation
Highly purified splenic B cells were prepared from BALB/c mice pretreated with anti-asialo GM1, which was used to eliminate NK cells in vivo (29), followed by passage of spleen cells over a Sephadex G10 column and two rounds of complement-mediated lysis of T cells with monoclonal anti-Lyt1.2 and anti-Thy1.2 Abs. This procedure routinely yields cells that are >99% surface IgM, B220, as well as Ia-positive and <1% CD3-positive. Highly purified splenic T cells were prepared from anti-asialo GM1-treated mice by passing their spleen cells through a nylon wool column, followed by treatment of resultant cells with 10 µg/ml of FITC-anti-B220 and FITC-Mac-1 for 30 min at 4°C on a turning wheel. The cells were then washed twice and resuspended with magnetic beads coated with sheep anti-FITC Abs (Advanced Magnetics, Cambridge, MA). Cells that had bound magnetic beads were depleted by two rounds of exposure to a magnetic field. The residual cells were collected and washed twice, yielding 98% CD3-positive cells.
Cell cultures for IFN- production and cell proliferation
Splenic T cells (2 x 105/0.2 ml/well) were
cultured alone or stimulated with immobilized anti-CD3 (10 µg/ml
for coating), IL-12, and IL-18 (160 pg/ml to 100 ng/ml), either alone
or in various combinations, in 96-well plates for 72 h. Splenic B
cells (2 x 105/0.2 ml/well) were cultured alone or
stimulated with anti-IgM (5 µg/ml), IL-12, and IL-18 (160 pg/ml
to 100 ng/ml), either alone or in various combinations, in 96-well
plates for 72 h. Supernatants in triplicate cultures were measured
for their IFN- content by ELISA. In some experiments, T cells or B
cells (4 x 107) were stimulated with 20 ng/ml of
IL-12 in 24-cm2 flask in a total 8-ml vol for 72 h,
then collected, washed well, and subsequently stimulated with IL-18
(156 pg/ml to 40 ng/ml) for 72 h. After incubation, supernatants
in triplicate cultures were measured for their IFN- content by
ELISA. IL-18-induced DNA synthesis was measured by adding 1 µCi of
[3H]thymidine during the final 16 h.
Induction of Th1 or Th2 cells
Th1 and Th2 cells were induced by stimulating naive splenic T
cells (5 x 106) with 10 U/ml of IL-2 plus immobilized
anti-CD3 (10 µg/ml for coating) in the presence of 20 ng/ml of
IL-12 or 1000 U/ml of IL-4, respectively, in a 6-well plate in a total
3-ml vol. After 72 h of priming, IL-12-induced Th1 cells or
IL-4-induced Th2 cells (2 x 105/0.2 ml/well) were
recultured with immobilized anti-CD3 for 48 h. Their
supernatants were measured for IFN- or IL-4 content by ELISA or
CT.4S, an IL-4-dependent cell line (30). In some experiments, the
priming period was shortened to 3 h.
Induction of IL-18R
T cells (4 x 107) or B cells (4 x 107) were stimulated with 20 ng/ml of IL-12 in 24-cm2 flask in a total 8-ml vol for 3 to 72 h. After incubation, these variously stimulated cells were used for preparation of RNA and a 125I-IL-18 binding study.
Radiolabeled IL-18 binding assay
IL-18 was radiolabeled with Enzymobeads (Bio-Rad Laboratories, Richmond, CA). The specific activity of 125I-IL-18 was 3736 cpm/ng. A binding assay was performed as described by Robb et al. (31) and detailed in our previous report (32). The specific binding was calculated by subtracting the background binding observed in the presence of a 200-fold molar excess of unlabeled IL-18. The dissociation constant (Kd) and number of binding sites were calculated from Scatchard plots.
Analysis of expression of IL-18R mRNA
Cytoplasmic RNA was prepared using the guanidinium method as described previously (33). As positive controls for IL-18R, RNA extracted from cloned hepatic NK cells (5E3) (10) was used. For Northern blot analysis, RNA (20 µg/lane) was electrophoresed though a 1% agarose/formaldehyde gel and blotted onto a nitrocellulose-Nytran (Schleicher and Schuel, Inc., Keene, NH) membrane. Since the internal amino acid sequence of human IL-18R is identical to that of IL-1Rrp (26) and the DNA sequence of murine IL-1Rrp has already been published (27), we cloned murine IL-1Rrp (IL-18R) by PCR. IL-1Rrp is a recently cloned protein bearing a strong resemblance to type 1 IL-1R, T1/ST2, and IL-1R accessory protein (Acp) (27). Using this cDNA as a probe, we measured the expression of IL-18R mRNA. We also measured expression of type I IL-1R, type II IL-1R mRNA, IL-1R Acp, IL-12R ß1, or IL-12R ß2 by RT-PCR. mRNAs were amplified by a modified standard RT-PCR amplification procedure as described in our previous paper (33). Primer sequences were as follows: IL-18R: sense, CGTGACAAGCAGAGATGTTG, antisense, ATGTTGTCGTCTCCTTCCTG; type I IL-1R: sense, TCTTTGGTTTGTACCTGCCA, antisense, TATTACTCGTGTGACCGGAT; type II IL-1R: sense, GATCAAATGTCTGTGGAACT, antisense, ATGATGCTGGTATTGTCTCC; IL-1R Acp: sense, GAAGTACAACTACAGCACTG, antisense, AAGTGACCGATGGTTTGACA; IL-12R ß1: sense, GCAAACACATCACCTTCCTCCTGC, antisense, GTGTGTCACCTTGGCAGGATC; IL-12R ß2: sense, GGCACAGACTGTTAGAGAATGCTC, antisense, TGCAGAAGCGCCTTTTGAGTTGGC; and ß-actin: sense, GATGACGATATCGCTGCG CTG, antisense, GTACGACCAGAGGCATACAGG. cDNAs were amplified for 35 cycles, each composed of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s (IL-18R, type I IL-1R, type II IL-1R, and IL-1R Acp) or 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min (IL-12R ß1, IL-12R ß2, and ß-actin), with a further extension at 72°C for 7 min. At the end of 35 cycles, samples were stored at 4°C until analyzed. After amplification, PCR products were separated by electrophoresis in 1% agarose gels and visualized by UV light illumination.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production from T
cells and B cells
We first compared the ability of IL-12 and IL-18 to induce
IFN- production from T cells (
98% CD3+) in the
presence or absence of anti-CD3. A representative IL-12 and/or
IL-18 stimulation experiment is illustrated in Figure 1
, A and B. A very
low level IFN- production was obtained as a result of stimulation
with IL-12 or IL-12 plus immobilized anti-CD3 for 72 h. This
induction was strongly enhanced by IL-18, although IL-18 or IL-18 plus
anti-CD3 did not induce any IFN- production. Levels of IFN-
in the culture supernatants of T cells stimulated with IL-12 plus IL-18
in the presence or absence of anti-CD3 revealed that anti-CD3
partially but significantly inhibited IFN- production
(p < 0.01). Furthermore, addition of CsA (1 to
1000 ng/ml), capable of blocking anti-CD3-induced translocation of
cytoplasmic nuclear factor of activated T cells (NFAT) (34),
significantly (p < 0.01) enhanced IFN-
production (Fig. 1C), substantiating further the capacity of
anti-CD3 to inhibit IFN- production from T cells. We also
stimulated B cells with IL-12 and/or IL-18 for 3 days and then
measured IFN- production. As we have reported previously (6), B
cells (99% IgM+) showed dose-dependent IFN-
production in response to IL-12 and IL-18 (Fig. 1D). Since
anti-CD3 down-regulates T cell IFN- production, we separately
examined the effect of anti-IgM stimulation on B cells. We found
that, in sharp contrast to the action of anti-CD3, anti-IgM
stimulation did not affect IFN- production by B cells stimulated
with IL-12 and IL-18 (data not shown).
|
during this priming period (Fig. 1
A)
and require anti-CD3 challenge to produce IFN- in the subsequent
culture. Interestingly, as noted above, naive T cells stimulated with
anti-CD3, IL-12, and IL-18 strikingly produced IFN- (Fig. 1A) but no IL-4 and IL-5 (data not shown) during this 72-h
culture. Further kinetic study revealed that they produced a comparable
level of IFN- within 48 h. Thus, stimulation of naive T cells
with anti-CD3, IL-12, and IL-18 promptly induces them to
develop into Th1 cells and to produce IFN--producing cells in the
same culture.
Because NK cells produce IFN- in response to IL-12 and/or IL-18 (8, 35), we sought to assess any possible contamination with NK cells by
FACS analysis and found no B220-IL-2Rß+
cells (NK cells) in freshly purified T cells or B cells from
anti-asialo GM1-treated mice (data not shown). Recently, IL-12R
ß2, a second component of the IL-12R, was identified and cloned (36).
IL-12R ß2 is not expressed by naive resting CD4+ T cells
(Mel-14+ CD4+ T cells from TCR-transgenic mice)
and requires Ag activation for its expression (37). However, freshly
purified T cells and B cells expressed IL-12R ß2 when examined by
RT-PCR and responded to IL-12 by up-regulation of IL-12R ß1 (Fig. 1E). This difference may be explained by the difference
between Mel-14+ CD4+ T cells from
TCR-transgenic mice (37) and freshly purified splenic T cells from
nontransgenic mice.
T cells or B cells stimulated with IL-12 are competent to respond
to IL-18 by IFN- production
The requirement for IL-12 and IL-18 for high level IFN-
production suggests that IL-12 makes T cells or B cells sensitive to
IL-18. Therefore, we stimulated T cells or B cells with IL-12 for
72 h, then collected, washed, and subsequently stimulated them
with IL-18 for 48 h. Since 20 ng/ml of IL-12 and IL-18 maximally
induced IFN- production from T cells or B cells (Fig. 1), we used
this amount of IL-12 for the stimulation of T cells or B cells. As
shown in Figure 2, these T cells or B
cells showed dose-dependent proliferation and IFN- production in
response to IL-18. In contrast, IL-18-pretreated T cells or B cells did
not increase IFN- production as a result of subsequent stimulation
with IL-12 (data not shown). These results show that T cells or B cells
stimulated with IL-12 for 72 h and then washed became competent to
respond to IL-18 by IFN- production and cell proliferation. IL-18
has been shown to induce IL-2 production from Th1 clones (7). We tested
whether IL-18 induced proliferation of IL-12-stimulated T cells by
causing them to produce IL-2. We found that addition of Abs against
IL-2R ß-chains did not inhibit their proliferation (data not
shown).
|
Expression of IL-18R on IL-12-stimulated T cells and B cells
Because concentrations of 440 pM (8 ng/ml) or greater of
IL-18 were required to obtain maximal IFN- production, we examined
the number and affinity of IL-18R on T cells or B cells before and
after stimulation with IL-12 for 72 h. T cells or B cells cultured
by themselves did not specifically bind 125I-IL-18, whereas
T cells or B cells cultured with IL-12 alone had the capacity to
specifically bind 125I-IL-18. As shown in Figure 3A, the shape of the Scatchard
plot obtained from the binding study is consistent with the presence of
high affinity and low affinity IL-18R binding sites. Measurement of
binding of 125I-IL-18 on IL-12-stimulated T and B cells
revealed that they expressed 405 high affinity IL-18R
(Kd = 430 pM)/5500 low affinity IL-18R
(Kd = 31.4 nM) and 160 high affinity IL-18R
(Kd = 457 pM)/2340 low affinity IL-18R
(Kd = 93.6 nM), respectively. These results
taken together indicate that IL-12 induces high and low affinity IL-18R
and that such IL-12-stimulated T cells or B cells exhibit the capacity
to proliferate and to produce IFN- in response to IL-18.
|
B, T cells cultured by themselves expressed very little
IL-18R mRNA, whereas T cells cultured with IL-12 for 72 h clearly
did. B cells cultured with IL-12 for 72 h also clearly expressed
IL-18R mRNA. In this experiment, we used mRNA extracted from cloned
hepatic NK cells (5E3) (10) as a positive control for IL-18R mRNA. We
also examined mRNA expression of IL-1R type 1, IL-1R type 2, and IL-1R
Acp. No mRNAs except IL-18R mRNA were up-regulated by IL-12 stimulation
(Fig. 3B). Anti-CD3 stimulation down-regulated IL-18R mRNA expression in IL-12-stimulated T cells
Development of naive CD4+ T cells into Th1 or Th2
cells depends on their mode of priming (14, 15, 16, 17, 18, 19, 20, 21). Induction of Th1 cells
in vitro requires stimulation of T cells with anti-CD3 and IL-12
for 72 to 96 h (18). However, as shown in Figure 1A,
anti-CD3 stimulation partially but significantly
(p < 0.01) inhibited the capacity of IL-12 and
IL-18 to induce IFN- production from T cells. Furthermore, CsA
significantly (p < 0.01) diminished this
inhibitory action of anti-CD3 (Fig. 1C). To understand
this inhibitory mechanism of anti-CD3, we compared the levels of
expression of IL-18R mRNA in T cells that had been stimulated with
IL-12 in the presence or absence of anti-CD3 for 3 to 72 h or
with anti-CD3 and IL-12 in the presence or absence of CsA for
72 h. As shown in Figure 4A, IL-18R mRNA expression was
detectable at 3 to 72 h after stimulation with IL-12. In contrast,
the expression of IL-18R mRNA was only transiently detectable at 3
h after stimulation with anti-CD3 and IL-12, after which
time this expression rapidly declined. However, CsA markedly
abrogated this inhibitory action of anti-CD3 (Fig. 4A).
Thus, IL-12 stimulation continuously up-regulated IL-18R mRNA in T
cells and its protein product (Fig. 3), whereas anti-CD3
stimulation down-regulated this IL-12-induced IL-18R mRNA expression in
T cells at 6 h and thereafter, leading to markedly diminished
expression of IL-18R as measured by binding with 125I-IL-18
(data not shown).
|
in response to IL-18, we
restimulated these pretreated T cells with anti-CD3 and/or IL-18
for 48 h (Fig. 4B). T cells pretreated with
anti-CD3 and IL-12 for 3 to 24 h produced a substantial amount
of IFN- in response to IL-18, suggesting that these T cells
expressed IL-18R. However, when they developed into Th1 cells after
stimulation with anti-CD3 and IL-12 for 48 to 72 h, they
showed a dominant response to anti-CD3 by production of IFN- in
response to anti-CD3 and IL-18. In contrast, T cells pretreated
with IL-12 in the absence of anti-CD3 for 24 h or 72 h
produced similar level of IFN- in response to IL-18. However, as
these T cells failed to produce IFN- in response to anti-CD3
(Fig. 4B), these IL-12-stimulated T cells were not Th1
cells. These results, taken together, indicated that signaling
through CD3 plays an important role in the down-regulation of IL-18R
mRNA and the induction of commitment of naive T cells into Th1 cells.
However, CsA markedly abrogated this down-regulation of IL-18R mRNA by
anti-CD3 and enhanced the IFN- production induced by IL-18 (Fig. 1C). Thus, when the T cells developed into Th1 cells, they
diminished their IL-18R expression and gradually became less
sensitive to IL-18 stimulation. However, since these T cells
transiently but strongly expressed IL-18R mRNA and presumably sustained
IL-18R expression in some period after stimulation with anti-CD3
and IL-12, they showed conspicuous IFN- production in
response to IL-18. Preferential expression of IL-18R mRNA in IL-12-induced Th1 cells
IL-18 and IL-12 synergize for IFN- production from Th1 clones,
whereas this combination fails to affect Th2 cells (7). To understand
the mechanism underlying this difference in IL-18 responsiveness
between Th1 and Th2 cells, we tested whether IL-18R mRNA is
preferentially expressed in Th1 cells. For this purpose, we induced
naive T cells to develop into Th1 cells or Th2 cells by stimulating
them with anti-CD3 and IL-12 (20 ng/ml) or IL-4 (1000 U/ml) for
72 h, respectively (Fig. 5). Since
we could not detect or detected meagerly expressed IL-18R mRNA in T
cells stimulated with anti-CD3 and IL-12 for 72 h by Northern
blot analysis (Fig. 4A), we performed RT-PCR analysis for
this detection. As shown in Figure 5B, only the T cells
stimulated with anti-CD3 and IL-12 for 72 h clearly expressed
IL-18R mRNA.
|
in response to anti-CD3 and IL-12 and/or IL-18. Again,
after developing into Th1 cells, these Th1 cells diminished
their responsiveness to IL-18 and predominantly responded to
anti-CD3 by IFN- production when they were subsequently
stimulated with anti-CD3 plus IL-18. As expected, Th2 cells did not
produce IFN- in response to anti-CD3 plus IL-18. However, when
Th1 cells and Th2 cells were stimulated with anti-CD3, IL-12, and
IL-18, only the Th1 cells showed a further augmentation of IFN-
production in response to IL-18 stimulation, suggesting that
differences in IL-18 responsiveness between Th1 and Th2 cells resulted
from their differential expression of IL-18R. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in response to IL-18. Pretreatment of T
cells or B cells with IL-12 rendered them responsive to IL-18 by
activation of STAT4 and induction of IL-18R. However, these
IL-12-stimulated T cells did not produce IFN- in response to
anti-CD3. Thus, T cells stimulated with IL-12 and IL-18 promptly
and strikingly produce IFN- without their TCR engagement and Th1
development. We also showed that when T cells developed into Th1 cells
after stimulation with anti-CD3 and IL-12, they lowered
IL-12-induced IL-18R mRNA expression but gained the capacity to respond
predominantly to anti-CD3 by IFN- production in response
to anti-CD3 and IL-18. In contrast, Th2 cells did not express
IL-18R mRNA and showed no IL-18 responsiveness. Moreover, we showed
that when Th1 cells and Th2 cells were stimulated with anti-CD3,
IL-12, and IL-18, only Th1 cells showed a further augmentation of
IFN- production in response to IL-18, strongly indicating that the
differences in IL-18 responsiveness between Th1 and Th2 cells
resulted from their differential expression of IL-18R.
IL-12-stimulated T cells or B cells express both high and low affinity
IL-18R (Fig. 3), whereas COS-1 cells transfected with IL-18R (IL-1Rrp)
cDNA express only low affinity IL-18R (26). There are two possibilities
that may account for this discrepancy. First, high affinity IL-18R
consists of two chains: one is an IL-18-binding subunit (IL-1Rrp) found
in Hodgkin’s lymphoma cells that were used for preparation of
IL-18R (IL-1Rrp) and the other is a missing subunit that exists in
IL-12-stimulated T or B cells in association with IL-1Rrp to form high
affinity IL-18R. Second, high affinity IL-18R may be a homodimer of
IL-1Rrp, although this possibility is very slight, because COS-1 cells
transfected with IL-18R (IL-1Rrp) cDNA express only low affinity IL-18R
(26). We need further study to elucidate the second chain of high
affinity IL-18R.
As shown in Figure 3B, stimulation of T cells or B cells
with IL-12 induces an increase in the expression of IL-18R mRNA without
affecting the expression of IL-1R or IL-1R Acp. These IL-12-stimulated
T cells rapidly and continuously expressed IL-18R mRNA (Fig. 4A) and produced IFN- in response to IL-18 (Figs. 2 and 4B), while they showed no response to IL-1 stimulation (our
unpublished observation). Importantly, these T cells did not belong to
Th1 cells because they could not produce IFN- in response to
anti-CD3 (Fig. 4B). However, T cells stimulated with
IL-12 and IL-18 without anti-CD3 produce IFN- more strikingly
than T cells stimulated with anti-CD3, IL-12, and IL-18 (Fig. 1).
Recently, we observed that IL-12 synergizes with IL-18 for IFN-
production from spleen cells of SCID mice lacking T cells and B cells
but having NK cells that constitutively express IL-18R and IL-12R mRNA
(our unpublished observation). Like these NK cells, T cells produce
IFN- in response to IL-12 and IL-18 without their TCR engagement or
development into Th1 cells. Furthermore, B cells also produce IFN-
in response to IL-12 and IL-18 (6). The physiologic relevance of these
IFN--producing T cells and B cells is uncertain. However, since they
promptly and strikingly produce IFN- in response to IL-12 and IL-18
without developing into memory cells such as Th1 cells, they may play
an important role as potent host defensive cells in the innate immune
response. However, since these IL-12-stimulated T cells were highly
resistant to CsA treatment, it may be important to consider the
presence of these IL-12 plus IL-18-stimulated cells in the treatment of
some immunologic disorders with CsA.
The signal transduction pathways, after the activation of the receptors
for IL-12 and IL-18, are quite complicated. IL-12 stimulation activates
STAT4 (38, 39, 40, 41). Indeed, IL-12-pretreated T cells showed tyrosine
phosphorylation of STAT4 even after 2 h of starvation, whereas
IL-18 stimulation did not phosphorylate any members of STAT family.
Recently, Matsumoto et al. (42) reported that IL-18 activates NF-B
in murine Th1 cells. More recently, Robinson et al. (23) proved that,
like IL-1, IL-18 activates IRAK and NF-B. Thus, we assume that
NF-B and STAT4 synergize to activate the IFN- promotor, resulting
in a striking level of production of IFN- by T cells.
As shown in Figure 4, T cells gained the Th1 phenotype even at 48
h after stimulation with anti-CD3 and IL-12, because they produced
IFN- in response to subsequent stimulation with anti-CD3 for
48 h. However, T cells stimulated with anti-CD3 and IL-12 for
72 h did not produce IFN- during this period (Fig. 1A), although they produced IFN- in response to
stimulation with anti-CD3 or anti-CD3 and IL-12 in the
subsequent culture (Figs. 4 and 5). To our surprise, such a two-step
culture was not required for induction of IFN- production by T cells
stimulated with anti-CD3, IL-12, and IL-18. As shown in Figure 1, IL-12 and IL-18 synergistically induced IFN- production by T cells
in the presence and absence of anti-CD3 within 72 h. Thus,
stimulation with anti-CD3, IL-12, and IL-18 induces Th1 cell
development and IFN- production in the same culture.
In contrast to the IL-12-stimulated T cells that continuously expressed
high level of IL-18R mRNA, T cells stimulated with anti-CD3, IL-12,
and IL-18 only transiently expressed high level of IL-18R mRNA at
3 h (Fig. 4A). Furthermore, we demonstrated that when T
cells develop into Th1 cells, they diminished their IL-18R expression
and gradually became less sensitive to IL-18 but showed a dominant
response to anti-CD3 by production of IFN- in response to
anti-CD3 and IL-18 (Fig. 4B). Moreover, treatment with
CsA enhanced IFN- production by T cells in response to anti-CD3,
IL-12, and IL-18 presumably by inhibiting the action of anti-CD3 to
down-regulate IL-18R mRNA (Fig. 4A). Thus, CD3-transduced
signaling plays an important role in the down-regulation of IL-18R and
the induction of naive T cells to develop into Th1 cells. Nevertheless,
when naive T cells were stimulated with anti-CD3, IL-12, and IL-18,
they were strikingly able to produce IFN- in response to
IL-18 (Fig. 1A). It is intriguing to assume that
anti-CD3 and IL-12 increased the number of cells entering into the
G1 phase of the cell cycle and augmented IL-18R mRNA at
3 h. Therefore, IL-18 in collaboration with IL-12
strikingly enhanced IFN- production by these T cells. Furthermore,
IL-18 enhanced the number of cells entering into the S phase of the
cell cycle. Thus, anti-CD3, IL-12, and IL-18 may strikingly
induce T cell IFN- production, first by induction of IL-18R-positive
cells and then by subsequent IL-18-dependent cell cycle progression,
leading to striking IFN- production.
We examined the expression of IL-18R mRNA in Th1 cells and Th2 cells
that had been induced by stimulation of naive T cells for 72 h
with anti-CD3 and IL-12 or IL-4, respectively. We found that only
Th1 cells express IL-18R mRNA (Fig. 5B). When Th1 cells and
Th2 cells were restimulated with anti-CD3, IL-12, and IL-18, only
Th1 cells augmented IFN- production in response to additional IL-18
stimulation (Fig. 5C). Stimulation of Th1 cells with
anti-CD3, IL-12, and IL-18 may induce them to recycle and to
produce more IFN-; IL-12-dependent induction of IL-18R was followed
by binding of IL-18 to this up-regulated IL-18R, whereas Th2 cells may
be insensitive to such action, although they produced IFN- in
response to anti-CD3 and IL-12 (37, 43, 44, 45). In this study,
we have shown two distinct IFN- induction pathways: one is an IL-12-
and IL-18-dependent pathway, without induction of Th1 cells; and the
other is an anti-CD3-, IL-12-, and IL-18-dependent pathway, with
induction of Th1 cells. This first pathway is especially important,
because T cells produce IFN- without TCR engagement by Ag or
anti-CD3.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kenji Nakanishi, Department of Immunology and Medical Zoology, Hyogo College of Medicine, 1-1, Mukogawa-cho, Nishinomiya, Hyogo, 663-8501 Japan. E-mail address:
3 Abbreviations used in this paper: IL-1Rrp, IL-1R-related protein; IRAK, IL-1R-associated kinase; CsA, cyclosporin A; Kd, dissociation constant; Acp, accessory protein.
Received for publication February 17, 1998. Accepted for publication June 2, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production by T cells. Nature 378:88.[Medline]
inducing factor mediated by interleukin-1ß converting enzyme. Science 275:206.-inducing factor and regulates LPS-induced IFN- production. Nature 386:617.
-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
production from activated B cells. Proc. Natl. Acad. Sci. USA 94:3948.-inducing factor (IGIF) is a costimulatory factor on the activation of Th1 but not Th2 cells and exerts its effect independently of IL-12. J. Immunol. 158:1541.[Abstract]
- and FasL-mediated hepatotoxic pathways in endotoxin-induced liver injury. J. Immunol. 159:3961.[Abstract]
-inducing factor, a novel cytokine, enhances fas ligand mediated cytotoxity of murine T helper 1 cells. Cell. Immunol. 173:230.[Medline]
-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
ß T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. USA 89:6065. production and activates IRAK and NFB. Immunity 7:571.[Medline]
-inducing factor in enhanced production of IFN-. J. Immunol. 159:2125. and ß chains in IL-2-driven B-cell growth. Proc. Natl. Acad. Sci. USA 89:3551.B in murine T helper type 1 cells. Biochem. Biophys. Res. Commun. 234:454.[Medline]
production is cytokine-dependent. Proc. Natl. Acad. Sci. USA 94:3189.) production during differentiation of human T helper (Th) cells and transient IFN- production in established Th2 cell clones. J. Exp. Med. 179:1273. transcription and protein synthesis in human CD4+ allergen-specific Th2 T cell clones. Int. Immunol. 6:1091.This article has been cited by other articles:
|
|
 |
|
  M. P. Longhi, C. Trumpfheller, J. Idoyaga, M. Caskey, I. Matos, C. Kluger, A. M. Salazar, M. Colonna, and R. M. Steinman Dendritic cells require a systemic type I interferon response to mature and induce CD4+ Th1 immunity with poly IC as adjuvant J. Exp. Med., July 6, 2009; 206(7): 1589 - 1602. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Y. Wan and R. A. Flavell How Diverse--CD4 Effector T Cells and their Functions J Mol Cell Biol, May 28, 2009; (2009) mjp001v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. S. Haring and J. T. Harty Interleukin-18-Related Genes Are Induced during the Contraction Phase but Do Not Play Major Roles in Regulating the Dynamics or Function of the T-Cell Response to Listeria monocytogenes Infection Infect. Immun., May 1, 2009; 77(5): 1894 - 1903. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yamada, J. Hamuro, A. Fukushima, T. Ohteki, K. Terai, Y. Iwakura, H. Yagita, and S. Kinoshita MHC-Matched Corneal Allograft Rejection in an IFN-{gamma}/IL-17-Independent Manner in C57BL/6 Mice Invest. Ophthalmol. Vis. Sci., May 1, 2009; 50(5): 2139 - 2146. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Wu, M. L. Craft, P. Wang, K. R. Wyburn, G. Chen, J. Ma, B. Hambly, and S. J. Chadban IL-18 Contributes to Renal Damage after Ischemia-Reperfusion J. Am. Soc. Nephrol., December 1, 2008; 19(12): 2331 - 2341. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. P. Carroll, V. Paunovic, and M. Gadina Signalling, inflammation and arthritis: Crossed signals: the role of interleukin-15 and -18 in autoimmunity Rheumatology, September 1, 2008; 47(9): 1269 - 1277. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Kondo, T. Yoshimoto, K. Yasuda, S. Futatsugi-Yumikura, M. Morimoto, N. Hayashi, T. Hoshino, J. Fujimoto, and K. Nakanishi Administration of IL-33 induces airway hyperresponsiveness and goblet cell hyperplasia in the lungs in the absence of adaptive immune system Int. Immunol., June 1, 2008; 20(6): 791 - 800. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Robertson, J. M. Kirkwood, T. F. Logan, K. M. Koch, S. Kathman, L. C. Kirby, W. N. Bell, L. M. Thurmond, J. Weisenbach, and M. M. Dar A Dose-Escalation Study of Recombinant Human Interleukin-18 Using Two Different Schedules of Administration in Patients with Cancer Clin. Cancer Res., June 1, 2008; 14(11): 3462 - 3469. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-J. Hong, J. R. Wickstrum, H.-W. Yeh, and M. J. Parmely Toll-Like Receptor 2 Controls the Gamma Interferon Response to Francisella tularensis by Mouse Liver Lymphocytes Infect. Immun., November 1, 2007; 75(11): 5338 - 5345. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Yoshimoto, T. Yoshimoto, K. Yasuda, J. Mizuguchi, and K. Nakanishi IL-27 Suppresses Th2 Cell Development and Th2 Cytokines Production from Polarized Th2 Cells: A Novel Therapeutic Way for Th2-Mediated Allergic Inflammation J. Immunol., October 1, 2007; 179(7): 4415 - 4423. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Hayashi, T. Yoshimoto, K. Izuhara, K. Matsui, T. Tanaka, and K. Nakanishi T helper 1 cells stimulated with ovalbumin and IL-18 induce airway hyperresponsiveness and lung fibrosis by IFN-{gamma} and IL-13 production PNAS, September 11, 2007; 104(37): 14765 - 14770. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Foster, K. Andreadou, L. Jamieson, P.M. Preshaw, and J.J. Taylor VIP Inhibits P. gingivalis LPS-induced IL-18 and IL-18BPa in Monocytes Journal of Dental Research, September 1, 2007; 86(9): 883 - 887. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. R. de Arquer, R. Pena, C. Cabrera, G. Coma, R. Ruiz-Hernandez, R. Guerola, B. Clotet, L. Ruiz, J. A. Este, M. L. Calle, et al. Skewed expression and up-regulation of the IL-12 and IL-18 receptors in resting and activated CD4 T cells from HIV-1-infected patients J. Leukoc. Biol., July 1, 2007; 82(1): 72 - 78. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Imanishi, H. Hara, S. Suzuki, N. Suzuki, S. Akira, and T. Saito Cutting Edge: TLR2 Directly Triggers Th1 Effector Functions J. Immunol., June 1, 2007; 178(11): 6715 - 6719. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Srinivasan, R.-M. Salazar-Gonzalez, M. Jarcho, M. M. Sandau, L. Lefrancois, and S. J. McSorley Innate Immune Activation of CD4 T Cells in Salmonella-Infected Mice Is Dependent on IL-18 J. Immunol., May 15, 2007; 178(10): 6342 - 6349. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Wannamaker, R. Davies, M. Namchuk, J. Pollard, P. Ford, G. Ku, C. Decker, P. Charifson, P. Weber, U. A. Germann, et al. (S)-1-((S)-2-{[1-(4-Amino-3-chloro-phenyl)-methanoyl]-amino}-3,3-dimethyl-butanoyl)-pyrrolidine-2-carboxylic acid ((2R,3S)-2-ethoxy-5-oxo-tetrahydro-furan-3-yl)-amide (VX-765), an Orally Available Selective Interleukin (IL)-Converting Enzyme/Caspase-1 Inhibitor, Exhibits Potent Anti-Inflammatory Activities by Inhibiting the Release of IL-1beta and IL-18 J. Pharmacol. Exp. Ther., May 1, 2007; 321(2): 509 - 516. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Nakae, Y. Iwakura, H. Suto, and S. J. Galli Phenotypic differences between Th1 and Th17 cells and negative regulation of Th1 cell differentiation by IL-17 J. Leukoc. Biol., May 1, 2007; 81(5): 1258 - 1268. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. S. Way, C. Havenar-Daughton, G. A. Kolumam, N. N. Orgun, and K. Murali-Krishna IL-12 and Type-I IFN Synergize for IFN-{gamma} Production by CD4 T Cells, Whereas Neither Are Required for IFN-{gamma} Production by CD8 T Cells after Listeria monocytogenes Infection J. Immunol., April 1, 2007; 178(7): 4498 - 4505. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Tellides and J. S. Pober Interferon-{gamma} Axis in Graft Arteriosclerosis Circ. Res., March 16, 2007; 100(5): 622 - 632. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Wickstrum, K.-J. Hong, S. Bokhari, N. Reed, N. McWilliams, R. T. Horvat, and M. J. Parmely Coactivating Signals for the Hepatic Lymphocyte Gamma Interferon Response to Francisella tularensis Infect. Immun., March 1, 2007; 75(3): 1335 - 1342. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. C. Lewis and C. A. Dinarello Responses of IL-18- and IL-18 receptor-deficient pancreatic islets with convergence of positive and negative signals for the IL-18 receptor PNAS, November 7, 2006; 103(45): 16852 - 16857. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. I. Chaudhry, T. P. Kingham, G. Plitas, S. C. Katz, J. R. Raab, and R. P. DeMatteo Combined Stimulation with Interleukin-18 and CpG Induces Murine Natural Killer Dendritic Cells to Produce IFN-{gamma} and Inhibit Tumor Growth Cancer Res., November 1, 2006; 66(21): 10497 - 10504. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Robertson, J. W. Mier, T. Logan, M. Atkins, H. Koon, K. M. Koch, S. Kathman, L. N. Pandite, C. Oei, L. C. Kirby, et al. Clinical and biological effects of recombinant human interleukin-18 administered by intravenous infusion to patients with advanced cancer. Clin. Cancer Res., July 15, 2006; 12(14): 4265 - 4273. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Maxwell, R. Yadav, R. J. Rossi, C. E. Ruby, A. D. Weinberg, H. L. Aguila, and A. T. Vella IL-18 Bridges Innate and Adaptive Immunity through IFN-{gamma} and the CD134 Pathway J. Immunol., July 1, 2006; 177(1): 234 - 245. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ishikawa, T. Yoshimoto, and K. Nakanishi Contribution of IL-18-induced innate T cell activation to airway inflammation with mucus hypersecretion and airway hyperresponsiveness Int. Immunol., June 1, 2006; 18(6): 847 - 855. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. R. Coward, A. Marei, A. Yang, M. M. Vasa-Nicotera, and S. C. Chow Statin-Induced Proinflammatory Response in Mitogen-Activated Peripheral Blood Mononuclear Cells through the Activation of Caspase-1 and IL-18 Secretion in Monocytes J. Immunol., May 1, 2006; 176(9): 5284 - 5292. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Park, S. W. Lee, Y. B. Park, and S. K. Lee Serum cytokine profiles and their correlations with disease activity in Takayasu's arteritis Rheumatology, May 1, 2006; 45(5): 545 - 548. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Skarsvik, J. Puranen, J. Honkanen, M. Roivainen, J. Ilonen, H. Holmberg, J. Ludvigsson, and O. Vaarala Decreased in vitro type 1 immune response against coxsackie virus b4 in children with type 1 diabetes. Diabetes, April 1, 2006; 55(4): 996 - 1003. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. A Dinarello Interleukin 1 and interleukin 18 as mediators of inflammation and the aging process Am. J. Clinical Nutrition, February 1, 2006; 83(2): 447S - 455S. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Tortorella, I. Stella, G. Piazzolla, V. Cappiello, O. Simone, A. Pisconti, and S. Antonaci Impaired Interleukin-12-Dependent T-Cell Functions During Aging: Role of Signal Transducer and Activator of Transcription 4 (STAT4) and Suppressor of Cytokine Signaling 3 (SOCS3). J. Gerontol. A Biol. Sci. Med. Sci., February 1, 2006; 61(2): 125 - 135. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-i. Yamanaka, R. Clark, R. Dowgiert, D. Hurwitz, M. Shibata, B. E. Rich, K. Hirahara, D. A. Jones, S. Eapen, H. Mizutani, et al. Expression of Interleukin-18 and Caspase-1 in Cutaneous T-Cell Lymphoma Clin. Cancer Res., January 15, 2006; 12(2): 376 - 382. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Harris, S. Goodrich, K. Mohrs, M. Mohrs, and F. E. Lund Cutting Edge: The Development of IL-4-Producing B Cells (B Effector 2 Cells) Is Controlled by IL-4, IL-4 Receptor {alpha}, and Th2 Cells J. Immunol., December 1, 2005; 175(11): 7103 - 7107. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S G Baidya and Q-T Zeng Helper T cells and atherosclerosis: the cytokine web Postgrad. Med. J., December 1, 2005; 81(962): 746 - 752. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Sasaki, T. Yoshimoto, H. Maruyama, T. Tegoshi, N. Ohta, N. Arizono, and K. Nakanishi IL-18 with IL-2 protects against Strongyloides venezuelensis infection by activating mucosal mast cell-dependent type 2 innate immunity J. Exp. Med., September 6, 2005; 202(5): 607 - 616. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Tanaka, M. Sato, T. Onitsuka, H. Kamata, and Y. Yokomizo Inflammatory Cytokine Gene Expression in Different Types of Granulomatous Lesions during Asymptomatic Stages of Bovine Paratuberculosis Vet. Pathol., September 1, 2005; 42(5): 579 - 588. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Fernandez-Lago, A. Orduna, and N. Vizcaino Reduced interleukin-18 secretion in Brucella abortus 2308-infected murine peritoneal macrophages and in spleen cells obtained from B. abortus 2308-infected mice J. Med. Microbiol., June 1, 2005; 54(6): 527 - 531. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. D. Finkelman, M. Yang, C. Perkins, K. Schleifer, A. Sproles, J. Santeliz, J. A. Bernstein, M. E. Rothenberg, S. C. Morris, and M. Wills-Karp Suppressive Effect of IL-4 on IL-13-Induced Genes in Mouse Lung J. Immunol., April 15, 2005; 174(8): 4630 - 4638. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Papadakis, D. Zhu, J. L. Prehn, C. Landers, A. Avanesyan, G. Lafkas, and S. R. Targan Dominant Role for TL1A/DR3 Pathway in IL-12 plus IL-18-Induced IFN-{gamma} Production by Peripheral Blood and Mucosal CCR9+ T Lymphocytes J. Immunol., April 15, 2005; 174(8): 4985 - 4990. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J.L. Stuyt, M. G. Netea, I. Verschueren, C. A. Dinarello, B. J. Kullberg, and J. W.M. van der Meer Interleukin-18 does not modulate the acute-phase response Innate Immunity, April 1, 2005; 11(2): 85 - 88. [Abstract] [PDF]
|
|
|
|
 |
|
 F. Pages, J. Galon, G. Karaschuk, D. Dudziak, M. Camus, V. Lazar, S. Camilleri-Broet, C. Lagorce-Pages, S. Lebel-Binay, G. Laux, et al. Epstein-Barr virus nuclear antigen 2 induces interleukin-18 receptor expression in B cells Blood, February 15, 2005; 105(4): 1632 - 1639. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Schleicher, A. Hesse, and C. Bogdan Minute numbers of contaminant CD8+ T cells or CD11b+CD11c+ NK cells are the source of IFN-{gamma} in IL-12/IL-18-stimulated mouse macrophage populations Blood, February 1, 2005; 105(3): 1319 - 1328. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Sun, M. Walsh, A. V. Villarino, L. Cervi, C. A. Hunter, Y. Choi, and E. J. Pearce TLR Ligands Can Activate Dendritic Cells to Provide a MyD88-Dependent Negative Signal for Th2 Cell Development J. Immunol., January 15, 2005; 174(2): 742 - 751. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Kusaba, P. Ghosh, R. Derin, M. Buchholz, C. Sasaki, K. Madara, and D. L. Longo Interleukin-12-induced Interferon-{gamma} Production by Human Peripheral Blood T Cells Is Regulated by Mammalian Target of Rapamycin (mTOR) J. Biol. Chem., January 14, 2005; 280(2): 1037 - 1043. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Mavropoulos, G. Sully, A. P. Cope, and A. R. Clark Stabilization of IFN-{gamma} mRNA by MAPK p38 in IL-12- and IL-18-stimulated human NK cells Blood, January 1, 2005; 105(1): 282 - 288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-P. Raue, J. D. Brien, E. Hammarlund, and M. K. Slifka Activation of Virus-Specific CD8+ T Cells by Lipopolysaccharide-Induced IL-12 and IL-18 J. Immunol., December 1, 2004; 173(11): 6873 - 6881. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. HAILU, T. VAN DER POLL, N. BERHE, and P. A. KAGER ELEVATED PLASMA LEVELS OF INTERFERON (IFN)-{gamma}, IFN-{gamma} INDUCING CYTOKINES, AND IFN-{gamma} INDUCIBLE CXC CHEMOKINES IN VISCERAL LEISHMANIASIS Am J Trop Med Hyg, November 1, 2004; 71(5): 561 - 567. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S-M Dai, K Nishioka, and K Yudoh Interleukin (IL) 18 stimulates osteoclast formation through synovial T cells in rheumatoid arthritis: comparison with IL1{beta} and tumour necrosis factor {alpha} Ann Rheum Dis, November 1, 2004; 63(11): 1379 - 1386. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kinoshita, T. Yamagata, Y. Nozaki, M. Sugiyama, S. Ikoma, M. Funauchi, and A. Kanamaru Blockade of IL-18 Receptor Signaling Delays the Onset of Autoimmune Disease in MRL-Faslpr Mice J. Immunol., October 15, 2004; 173(8): 5312 - 5318. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Friebe, A. Siegling, S. Friederichs, H.-D. Volk, and O. Weber Immunomodulatory Effects of Inactivated Parapoxvirus Ovis (Orf Virus) on Human Peripheral Immune Cells: Induction of Cytokine Secretion in Monocytes and Th1-Like Cells J. Virol., September 1, 2004; 78(17): 9400 - 9411. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Akhiani, K. Schon, and N. Lycke Vaccine-Induced Immunity against Helicobacter pylori Infection Is Impaired in IL-18-Deficient Mice J. Immunol., September 1, 2004; 173(5): 3348 - 3356. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-K. Lee, S.-H. Kim, E. C. Lewis, T. Azam, L. L. Reznikov, and C. A. Dinarello Differences in signaling pathways by IL-1{beta} and IL-18 PNAS, June 8, 2004; 101(23): 8815 - 8820. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Matsumura, H. Hayashi, T. Takii, C. F. Thorn, A. S. Whitehead, J.-i. Inoue, and K. Onozaki TGF-{beta} down-regulates IL-1{alpha}-induced TLR2 expression in murine hepatocytes J. Leukoc. Biol., June 1, 2004; 75(6): 1056 - 1061. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Papadakis, J. L. Prehn, C. Landers, Q. Han, X. Luo, S. C. Cha, P. Wei, and S. R. Targan TL1A Synergizes with IL-12 and IL-18 to Enhance IFN-{gamma} Production in Human T Cells and NK Cells J. Immunol., June 1, 2004; 172(11): 7002 - 7007. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. DeVoti, B. M. Steinberg, D. W. Rosenthal, L. Hatam, A. Vambutas, A. L. Abramson, M. J. Shikowitz, and V. R. Bonagura Failure of Gamma Interferon but Not Interleukin-10 Expression in Response to Human Papillomavirus Type 11 E6 Protein in Respiratory Papillomatosis Clin. Vaccine Immunol., May 1, 2004; 11(3): 538 - 547. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Esteban, A. A. Nuara, and R. M. L. Buller Interleukin-18 and glycosaminoglycan binding by a protein encoded by Variola virus J. Gen. Virol., May 1, 2004; 85(5): 1291 - 1299. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Towne, K. E. Garka, B. R. Renshaw, G. D. Virca, and J. E. Sims Interleukin (IL)-1F6, IL-1F8, and IL-1F9 Signal through IL-1Rrp2 and IL-1RAcP to Activate the Pathway Leading to NF-{kappa}B and MAPKs J. Biol. Chem., April 2, 2004; 279(14): 13677 - 13688. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Chitnis, A. D. Salama, M. J. Grusby, M. H. Sayegh, and S. J. Khoury Defining Th1 and Th2 Immune Responses in a Reciprocal Cytokine Environment In Vivo J. Immunol., April 1, 2004; 172(7): 4260 - 4265. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S Finotto, J Siebler, M Hausding, M Schipp, S Wirtz, S Klein, M Protschka, A Doganci, H A Lehr, C Trautwein, et al. Severe hepatic injury in interleukin 18 (IL-18) transgenic mice: a key role for IL-18 in regulating hepatocyte apoptosis in vivo Gut, March 1, 2004; 53(3): 392 - 400. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Sugimoto, Y. Ishikawa, T. Yoshimoto, N. Hayashi, J. Fujimoto, and K. Nakanishi Interleukin 18 Acts on Memory T Helper Cells Type 1 to Induce Airway Inflammation and Hyperresponsiveness in a Naive Host Mouse J. Exp. Med., February 17, 2004; 199(4): 535 - 545. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Schroder, P. J. Hertzog, T. Ravasi, and D. A. Hume Interferon-{gamma}: an overview of signals, mechanisms and functions J. Leukoc. Biol., February 1, 2004; 75(2): 163 - 189. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kaser, S. Kaser, N. C. Kaneider, B. Enrich, C. J. Wiedermann, and H. Tilg Interleukin-18 attracts plasmacytoid dendritic cells (DC2s) and promotes Th1 induction by DC2s through IL-18 receptor expression Blood, January 15, 2004; 103(2): 648 - 655. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Airoldi, L. Raffaghello, C. Cocco, R. Guglielmino, S. Roncella, F. Fedeli, C. Gambini, and V. Pistoia Heterogeneous Expression of Interleukin-18 and Its Receptor in B-Cell Lymphoproliferative Disorders Deriving from Naive, Germinal Center, and Memory B Lymphocytes Clin. Cancer Res., January 1, 2004; 10(1): 144 - 154. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Gutzmer, K. Langer, S. Mommert, M. Wittmann, A. Kapp, and T. Werfel Human Dendritic Cells Express the IL-18R and Are Chemoattracted to IL-18 J. Immunol., December 15, 2003; 171(12): 6363 - 6371. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Durali, M.-G. de Goer de Herve, J. Giron-Michel, B. Azzarone, J.-F. Delfraissy, and Y. Taoufik In human B cells, IL-12 triggers a cascade of molecular events similar to Th1 commitment Blood, December 1, 2003; 102(12): 4084 - 4089. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Fantuzzi, N. K. Banda, C. Guthridge, A. Vondracek, S.-H. Kim, B. Siegmund, T. Azam, J. A. Sennello, C. A. Dinarello, and W. P. Arend Generation and characterization of mice transgenic for human IL-18-binding protein isoform a J. Leukoc. Biol., November 1, 2003; 74(5): 889 - 896. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. W. Gobel, K. Schneider, B. Schaerer, I. Mejri, F. Puehler, S. Weigend, P. Staeheli, and B. Kaspers IL-18 Stimulates the Proliferation and IFN-{gamma} Release of CD4+ T Cells in the Chicken: Conservation of a Th1-Like System in a Nonmammalian Species J. Immunol., August 15, 2003; 171(4): 1809 - 1815. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Gherardi, J. C. Ramirez, and M. Esteban IL-12 and IL-18 act in synergy to clear vaccinia virus infection: involvement of innate and adaptive components of the immune system J. Gen. Virol., August 1, 2003; 84(8): 1961 - 1972. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Plitz, P. Saint-Mezard, M. Satho, S. Herren, C. Waltzinger, M. de Carvalho Bittencourt, M. H. Kosco-Vilbois, and Y. Chvatchko IL-18 Binding Protein Protects Against Contact Hypersensitivity J. Immunol., August 1, 2003; 171(3): 1164 - 1171. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E.-M. Boneberg and T. Hartung Febrile Temperatures Attenuate IL-1{beta} Release by Inhibiting Proteolytic Processing of the Proform and Influence Th1/Th2 Balance by Favoring Th2 Cytokines J. Immunol., July 15, 2003; 171(2): 664 - 668. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Bream, R. E. Curiel, C.-R. Yu, C. E. Egwuagu, M. J. Grusby, T. M. Aune, and H. A. Young IL-4 synergistically enhances both IL-2- and IL-12-induced IFN-{gamma} expression in murine NK cells Blood, July 1, 2003; 102(1): 207 - 214. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Wu, P. Sakorafas, R. Miller, D. McCarthy, S. Scesney, R. Dixon, and T. Ghayur IL-18 Receptor {beta}-Induced Changes in the Presentation of IL-18 Binding Sites Affect Ligand Binding and Signal Transduction J. Immunol., June 1, 2003; 170(11): 5571 - 5577. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Fairweather, S. Yusung, S. Frisancho, M. Barrett, S. Gatewood, R. Steele, and N. R. Rose IL-12 Receptor {beta}1 and Toll-Like Receptor 4 Increase IL-1{beta}- and IL-18-Associated Myocarditis and Coxsackievirus Replication J. Immunol., May 1, 2003; 170(9): 4731 - 4737. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ito, A. Matejuk, C. Hopke, H. Drought, J. Dwyer, A. Zamora, S. Subramanian, A. A. Vandenbark, and H. Offner Transfer of Severe Experimental Autoimmune Encephalomyelitis by IL-12- and IL-18-Potentiated T Cells Is Estrogen Sensitive J. Immunol., May 1, 2003; 170(9): 4802 - 4809. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yoshimoto, B. Min, T. Sugimoto, N. Hayashi, Y. Ishikawa, Y. Sasaki, H. Hata, K. Takeda, K. Okumura, L. Van Kaer, et al. Nonredundant Roles for CD1d-restricted Natural Killer T Cells and Conventional CD4+ T Cells in the Induction of Immunoglobulin E Antibodies in Response to Interleukin 18 Treatment of Mice J. Exp. Med., April 21, 2003; 197(8): 997 - 1005. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Kikawada, D. M. Lenda, and V. R. Kelley IL-12 Deficiency in MRL-Faslpr Mice Delays Nephritis and Intrarenal IFN-{gamma} Expression, and Diminishes Systemic Pathology J. Immunol., April 1, 2003; 170(7): 3915 - 3925. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. de Fost, R. A. Hartskeerl, M. R. Groenendijk, and T. van der Poll Interleukin 12 in Part Regulates Gamma Interferon Release in Human Whole Blood Stimulated with Leptospira interrogans Clin. Vaccine Immunol., March 1, 2003; 10(2): 332 - 335. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kambayashi, E. Assarsson, A. E. Lukacher, H.-G. Ljunggren, and P. E. Jensen Memory CD8+ T Cells Provide an Early Source of IFN-{gamma} J. Immunol., March 1, 2003; 170(5): 2399 - 2408. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Gracie, S. E. Robertson, and I. B. McInnes Interleukin-18 J. Leukoc. Biol., February 1, 2003; 73(2): 213 - 224. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. K. Takahashi, T. Morichika, H. Iwagaki, T. Yoshino, R. Tamura, S. Saito, S. Mori, T. Akagi, N. Tanaka, and M. Nishibori Effect of {beta}2-Adrenergic Receptor Stimulation on Interleukin-18-Induced Intercellular Adhesion Molecule-1 Expression and Cytokine Production J. Pharmacol. Exp. Ther., February 1, 2003; 304(2): 634 - 642. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. H. Qureshi, A. G. Harmsen, and B. A. Garvy IL-10 Modulates Host Responses and Lung Damage Induced by Pneumocystis carinii Infection J. Immunol., January 15, 2003; 170(2): 1002 - 1009. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Harandi, K. Eriksson, and J. Holmgren A Protective Role of Locally Administered Immunostimulatory CpG Oligodeoxynucleotide in a Mouse Model of Genital Herpes Infection J. Virol., December 20, 2002; 77(2): 953 - 962. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Symons, E. Adams, D. C. Tscharke, P. C. Reading, H. Waldmann, and G. L. Smith The vaccinia virus C12L protein inhibits mouse IL-18 and promotes virus virulence in the murine intranasal model J. Gen. Virol., November 1, 2002; 83(11): 2833 - 2844. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kimura, K. Kakimi, S. Wieland, L. G. Guidotti, and F. V. Chisari Interleukin-18 Inhibits Hepatitis B Virus Replication in the Livers of Transgenic Mice J. Virol., October 2, 2002; 76(21): 10702 - 10707. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Dreher, M. Kok, C. Obregon, S. G. Kiama, P. Gehr, and L. P. Nicod Salmonella virulence factor SipB induces activation and release of IL-18 in human dendritic cells J. Leukoc. Biol., October 1, 2002; 72(4): 743 - 751. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Morinobu, M. Gadina, W. Strober, R. Visconti, A. Fornace, C. Montagna, G. M. Feldman, R. Nishikomori, and J. J. O'Shea STAT4 serine phosphorylation is critical for IL-12-induced IFN-gamma production but not for cell proliferation PNAS, September 17, 2002; 99(19): 12281 - 12286. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Konishi, H. Tsutsui, T. Murakami, S. Yumikura-Futatsugi, K.-i. Yamanaka, M. Tanaka, Y. Iwakura, N. Suzuki, K. Takeda, S. Akira, et al. IL-18 contributes to the spontaneous development of atopic dermatitis-like inflammatory skin lesion independently of IgE/stat6 under specific pathogen-free conditions PNAS, August 20, 2002; 99(17): 11340 - 11345. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ariel, D. Novick, M. Rubinstein, C. A. Dinarello, O. Lider, and R. Hershkoviz IL-12 and IL-18 induce MAP kinase-dependent adhesion of T cells to extracellular matrix components J. Leukoc. Biol., July 1, 2002; 72(1): 192 - 198. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. B. Smeltz, J. Chen, R. Ehrhardt, and E. M. Shevach Role of IFN-{gamma} in Th1 Differentiation: IFN-{gamma} Regulates IL-18R{alpha} Expression by Preventing the Negative Effects of IL-4 and by Inducing/Maintaining IL-12 Receptor {beta}2 Expression J. Immunol., June 15, 2002; 168(12): 6165 - 6172. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Arnold, C. Wasem, P. Juillard, P. Graber, I. Cima, C. Frutschi, S. Herren, S. Jakob, S. Alouani, C. Mueller, et al. IL-18-independent cytotoxic T lymphocyte activation and IFN-{gamma} production during experimental acute graft-versus-host disease Int. Immunol., May 1, 2002; 14(5): 503 - 511. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L.-P. Ho, M. Davis, A. Denison, F. T. Wood, and A. P. Greening Reduced Interleukin-18 Levels in BAL Specimens From Patients With Asthma Compared to Patients With Sarcoidosis and Healthy Control Subjects* Chest, May 1, 2002; 121(5): 1421 - 1426. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. P. Singh, S.-i. Kashiwamura, P. Rao, H. Okamura, A. Mukherjee, and V. S. Chauhan The Role of IL-18 in Blood-Stage Immunity Against Murine Malaria Plasmodium yoelii265 and Plasmodium bergheiANKA J. Immunol., May 1, 2002; 168(9): 4674 - 4681. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-H. Kim, T. Azam, D. Novick, D.-Y. Yoon, L. L. Reznikov, P. Bufler, M. Rubinstein, and C. A. Dinarello Identification of Amino Acid Residues Critical for Biological Activity in Human Interleukin-18 J. Biol. Chem., March 22, 2002; 277(13): 10998 - 11003. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Shimoda, H. Tsutsui, K. Aoki, K. Kato, T. Matsuda, A. Numata, K. Takase, T. Yamamoto, H. Nukina, T. Hoshino, et al. Partial impairment of interleukin-12 (IL-12) and IL-18 signaling in Tyk2-deficient mice Blood, March 15, 2002; 99(6): 2094 - 2099. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Fujimaki, K. Nohara, T. Kobayashi, K. Suzuki, K. Eguchi-Kasai, S. Tsukumo, M. Kijima, and C. Tohyama Effect of a Single Oral Dose of 2,3,7,8-Tetrachlorodibenzo-p-dioxin on Immune Function in Male NC/Nga Mice Toxicol. Sci., March 1, 2002; 66(1): 117 - 124. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or with 20
ng/ml of IL-12 (•) in 24-cm2 flasks in a total 8-ml
volume for 72 h. A, Binding assays were performed
as described by Robb et al. (30) and detailed in our previous reports
(31). One of three independent binding experiments, which provided
identical results, was presented. Number of bound
125I-IL-18 molecules per cell is plotted on the abscissa,
and the ratio of bound 125I-IL-18 molecules over free
concentration of 125I-IL-18 is plotted on the ordinate.
B, Total RNA was extracted, and IL-18R mRNA was measured
by RT-PCR. mRNA expression of IL-1R type 1, IL-1R type II, and IL-1R
Acp was also examined. As positive controls for IL-18R mRNA, mRNA
extracted from cloned hepatic NK cells (5E3) (10) was used.
