The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshimoto, T.
Right arrow Articles by Nakanishi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshimoto, T.
Right arrow Articles by Nakanishi, K.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 1998, 161: 3400-3407.
Copyright © 1998 by The American Association of Immunologists

IL-12 Up-Regulates IL-18 Receptor Expression on T Cells, Th1 Cells, and B Cells: Synergism with IL-18 for IFN-{gamma} Production1

Tomohiro Yoshimoto*,{dagger}, Kiyoshi Takeda{ddagger}, Takashi Tanaka{ddagger}, Kazunobu Ohkusu*, Shin-ichiro Kashiwamura{dagger}, Haruki Okamura{dagger}, Shizuo Akira{ddagger} and Kenji Nakanishi2,*,{dagger}

* Department of Immunology and Medical Zoology, {dagger} Laboratory of Host Defenses, Institute for Advanced Medical Sciences, and {ddagger} Department of Biochemistry, Hyogo College of Medicine, Nishinomiya, Hyogo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-18 is a product of macrophages and with IL-12 strikingly induces IFN-{gamma} production from T, B, and NK cells. Furthermore, IL-18 and IL-12 synergize for IFN-{gamma} production from Th1 cells, although this combination fails to affect Th2 cells. In this study, we show that IL-12 and IL-18 promptly and synergistically induce T and B cells to develop into IFN-{gamma}-producing cells without engaging their Ag receptors. We also studied the mechanism underlying differences in IL-18 responsiveness between Th1 and Th2 cells. Pretreatment of T or B cells with IL-12 rendered them responsive to IL-18, which induces cell proliferation and IFN-{gamma} production. These IL-12-stimulated cells had both high and low affinity IL-18R and an increased IL-18R mRNA expression. In particular, IL-12-stimulated T cells strongly and continuously expressed IL-18R mRNA. However, when T cells developed into Th1 cells after stimulation with anti-CD3 and IL-12, they lowered this IL-12-induced-IL-18R mRNA expression. Then, such T cells showed a dominant response to anti-CD3 by IFN-{gamma} production when they were subsequently stimulated with anti-CD3 and IL-18. In contrast, Th2 cells did not express IL-18R mRNA and failed to produce IFN-{gamma} in response to anti-CD3 and IL-18, although they produced a substantial amount of IFN-{gamma} in response to anti-CD3 and IL-12. However, when Th1 and Th2 cells were stimulated with anti-CD3, IL-12, and IL-18, only the Th1 cells markedly augmented IFN-{gamma} production in response to IL-18, suggesting that IL-18 responsiveness between Th1 and Th2 cells resulted from their differential expression of IL-18R.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-18 is a product of activated macrophages or Kupffer cells (1, 2, 3). Like IL-1ß, this new cytokine is synthesized as a precursor protein that requires cleavage with the IL-1ß-converting enzyme (ICE) for activity (1, 2, 3). IL-18 induces IFN-{gamma} production by Th1 cells, T cells, and B cells, in collaboration with IL-12 (1, 4, 5, 6, 7), and by cloned NK cells without help from IL-12 (8). In addition, IL-18 augments Fas ligand expression on cloned Th1 cells and NK cells in vitro and on liver lymphocytes in vivo (8, 9, 10).

CD4+ T helper cells can be divided into Th1 and Th2 cells on the basis of their cytokine profile (11, 12, 13). Their development depends on the mode of priming: IL-12 and IL-4 induce differentiation of naive T cells toward Th1 or Th2 cells, respectively (14, 15, 16, 17, 18, 19, 20, 21). IL-18 shares some of its biologic activities with IL-12, although the primary structures of the two cytokines show no homology (1). Importantly, these two factors show fundamental difference in their ability to induce Th1 cells: IL-12 induces naive CD4+ T cells to develop into Th1 cells in vivo and in vitro (18, 19, 22), whereas IL-18 cannot effect this development (5, 23, 24).

IL-18 by itself does not induce IFN-{gamma} production by T cells and B cells. However, as we have reported, IL-12 and IL-18 promptly and synergistically induce anti-CD3-stimulated T cells or anti-CD40-stimulated B cells to develop into highly IFN-{gamma}-producing cells (6), suggesting the possibility that IL-12 induces IL-18R on T cells or B cells. Indeed, using an IL-12-responsive cloned Th1 cells, 2D6, we were able to reveal that 2D6 cells maintained with IL-12 or IL-2 exhibited differential IL-18 responsiveness and that the former expressed IL-18R (25). Furthermore, IL-18 stimulates other cloned Th1 cells to proliferate and to produce IL-2, granulocyte/macrophage CSF, and IL-2R{alpha}, whereas IL-18 has no effect on Th2 cells (7). In this study, we investigated the mechanism whereby IL-18 and IL-12 synergize for IFN-{gamma} production by T cells or B cells without engaging their Ag receptors. We also studied the mechanism underlying the differences in IL-18 responsiveness between Th1 cells and Th2 cells.

Recently, human IL-18R has been purified and characterized (26). Its internal amino acid sequence completely matched that of human IL-1R-related protein (IL-1Rrp),3 the ligand of which is unknown to date (27). IL-18R resembles the type 1 IL-1R and transduces a signal that activates IL-1R-associated kinase (IRAK) and induces nuclear translocation of NF-{kappa}B (23, 26). Since the DNA sequence of murine IL-1Rrp is available, we have cloned murine IL-1Rrp (murine IL-18R) by PCR. Using this cDNA as a probe, we examined the regulation of IL-18R mRNA in T cells and B cells by IL-12. We also measured the number and affinity of IL-18R on both T and B cells stimulated with IL-12 in vitro. Furthermore, we examined the action of anti-CD3 on the expression of IL-18R. Finally, we examined whether differential responsiveness of Th1 and Th2 cells to IL-18 results from preferential expression of IL-18R on Th1 cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and reagents

Virus-free BALB/c mice, 8 to 12 wk of age, were obtained from Shizuoka Laboratory Animal Center (Shizuoka, Japan). Recombinant mouse IFN-{gamma}, IL-12, and IL-18 were kindly provided by Hayashibara Biochemical Laboratories (Okayama, Japan). Mouse rIL-4 was obtained and purified from a recombinant baculovirus (AcMNPV.IL-4) prepared in our laboratory. Anti-CD3 Ab (145-2C11, hamster IgG2a directed against the {epsilon}-chain) (28) and goat anti-mouse IgM Ab were prepared and used for cell stimulation and/or fluorocytometric analysis. FITC-rat anti-mouse B220 (RA3-6B2), FITC-rat anti-mouse Mac-1 (M1/70), FITC-goat anti-mouse IgM, and phycoerythrin-rat anti-mouse IL-2R ß-chain (TMß1) were purchased from PharMingen (San Diego, CA). Cyclosporin A (CsA) was a generous gift of Sandoz (Basel, Switzerland).

Culture medium

RPMI 1640 supplemented with 10% FBS (HyClone, Logan, UT), 2-ME (50 µM), L-glutamine (2 mM), penicillin (100 U/ml), streptomycin (100 µg/ml), and sodium pyruvate (1 mM) was used as the culture medium.

B and T cell preparation

Highly purified splenic B cells were prepared from BALB/c mice pretreated with anti-asialo GM1, which was used to eliminate NK cells in vivo (29), followed by passage of spleen cells over a Sephadex G10 column and two rounds of complement-mediated lysis of T cells with monoclonal anti-Lyt1.2 and anti-Thy1.2 Abs. This procedure routinely yields cells that are >99% surface IgM, B220, as well as Ia-positive and <1% CD3-positive. Highly purified splenic T cells were prepared from anti-asialo GM1-treated mice by passing their spleen cells through a nylon wool column, followed by treatment of resultant cells with 10 µg/ml of FITC-anti-B220 and FITC-Mac-1 for 30 min at 4°C on a turning wheel. The cells were then washed twice and resuspended with magnetic beads coated with sheep anti-FITC Abs (Advanced Magnetics, Cambridge, MA). Cells that had bound magnetic beads were depleted by two rounds of exposure to a magnetic field. The residual cells were collected and washed twice, yielding 98% CD3-positive cells.

Cell cultures for IFN-{gamma} production and cell proliferation

Splenic T cells (2 x 105/0.2 ml/well) were cultured alone or stimulated with immobilized anti-CD3 (10 µg/ml for coating), IL-12, and IL-18 (160 pg/ml to 100 ng/ml), either alone or in various combinations, in 96-well plates for 72 h. Splenic B cells (2 x 105/0.2 ml/well) were cultured alone or stimulated with anti-IgM (5 µg/ml), IL-12, and IL-18 (160 pg/ml to 100 ng/ml), either alone or in various combinations, in 96-well plates for 72 h. Supernatants in triplicate cultures were measured for their IFN-{gamma} content by ELISA. In some experiments, T cells or B cells (4 x 107) were stimulated with 20 ng/ml of IL-12 in 24-cm2 flask in a total 8-ml vol for 72 h, then collected, washed well, and subsequently stimulated with IL-18 (156 pg/ml to 40 ng/ml) for 72 h. After incubation, supernatants in triplicate cultures were measured for their IFN-{gamma} content by ELISA. IL-18-induced DNA synthesis was measured by adding 1 µCi of [3H]thymidine during the final 16 h.

Induction of Th1 or Th2 cells

Th1 and Th2 cells were induced by stimulating naive splenic T cells (5 x 106) with 10 U/ml of IL-2 plus immobilized anti-CD3 (10 µg/ml for coating) in the presence of 20 ng/ml of IL-12 or 1000 U/ml of IL-4, respectively, in a 6-well plate in a total 3-ml vol. After 72 h of priming, IL-12-induced Th1 cells or IL-4-induced Th2 cells (2 x 105/0.2 ml/well) were recultured with immobilized anti-CD3 for 48 h. Their supernatants were measured for IFN-{gamma} or IL-4 content by ELISA or CT.4S, an IL-4-dependent cell line (30). In some experiments, the priming period was shortened to 3 h.

Induction of IL-18R

T cells (4 x 107) or B cells (4 x 107) were stimulated with 20 ng/ml of IL-12 in 24-cm2 flask in a total 8-ml vol for 3 to 72 h. After incubation, these variously stimulated cells were used for preparation of RNA and a 125I-IL-18 binding study.

Radiolabeled IL-18 binding assay

IL-18 was radiolabeled with Enzymobeads (Bio-Rad Laboratories, Richmond, CA). The specific activity of 125I-IL-18 was 3736 cpm/ng. A binding assay was performed as described by Robb et al. (31) and detailed in our previous report (32). The specific binding was calculated by subtracting the background binding observed in the presence of a 200-fold molar excess of unlabeled IL-18. The dissociation constant (Kd) and number of binding sites were calculated from Scatchard plots.

Analysis of expression of IL-18R mRNA

Cytoplasmic RNA was prepared using the guanidinium method as described previously (33). As positive controls for IL-18R, RNA extracted from cloned hepatic NK cells (5E3) (10) was used. For Northern blot analysis, RNA (20 µg/lane) was electrophoresed though a 1% agarose/formaldehyde gel and blotted onto a nitrocellulose-Nytran (Schleicher and Schuel, Inc., Keene, NH) membrane. Since the internal amino acid sequence of human IL-18R is identical to that of IL-1Rrp (26) and the DNA sequence of murine IL-1Rrp has already been published (27), we cloned murine IL-1Rrp (IL-18R) by PCR. IL-1Rrp is a recently cloned protein bearing a strong resemblance to type 1 IL-1R, T1/ST2, and IL-1R accessory protein (Acp) (27). Using this cDNA as a probe, we measured the expression of IL-18R mRNA. We also measured expression of type I IL-1R, type II IL-1R mRNA, IL-1R Acp, IL-12R ß1, or IL-12R ß2 by RT-PCR. mRNAs were amplified by a modified standard RT-PCR amplification procedure as described in our previous paper (33). Primer sequences were as follows: IL-18R: sense, CGTGACAAGCAGAGATGTTG, antisense, ATGTTGTCGTCTCCTTCCTG; type I IL-1R: sense, TCTTTGGTTTGTACCTGCCA, antisense, TATTACTCGTGTGACCGGAT; type II IL-1R: sense, GATCAAATGTCTGTGGAACT, antisense, ATGATGCTGGTATTGTCTCC; IL-1R Acp: sense, GAAGTACAACTACAGCACTG, antisense, AAGTGACCGATGGTTTGACA; IL-12R ß1: sense, GCAAACACATCACCTTCCTCCTGC, antisense, GTGTGTCACCTTGGCAGGATC; IL-12R ß2: sense, GGCACAGACTGTTAGAGAATGCTC, antisense, TGCAGAAGCGCCTTTTGAGTTGGC; and ß-actin: sense, GATGACGATATCGCTGCG CTG, antisense, GTACGACCAGAGGCATACAGG. cDNAs were amplified for 35 cycles, each composed of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s (IL-18R, type I IL-1R, type II IL-1R, and IL-1R Acp) or 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min (IL-12R ß1, IL-12R ß2, and ß-actin), with a further extension at 72°C for 7 min. At the end of 35 cycles, samples were stored at 4°C until analyzed. After amplification, PCR products were separated by electrophoresis in 1% agarose gels and visualized by UV light illumination.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-18 and IL-12 synergistically induce IFN-{gamma} production from T cells and B cells

We first compared the ability of IL-12 and IL-18 to induce IFN-{gamma} production from T cells (~98% CD3+) in the presence or absence of anti-CD3. A representative IL-12 and/or IL-18 stimulation experiment is illustrated in Figure 1Go, A and B. A very low level IFN-{gamma} production was obtained as a result of stimulation with IL-12 or IL-12 plus immobilized anti-CD3 for 72 h. This induction was strongly enhanced by IL-18, although IL-18 or IL-18 plus anti-CD3 did not induce any IFN-{gamma} production. Levels of IFN-{gamma} in the culture supernatants of T cells stimulated with IL-12 plus IL-18 in the presence or absence of anti-CD3 revealed that anti-CD3 partially but significantly inhibited IFN-{gamma} production (p < 0.01). Furthermore, addition of CsA (1 to 1000 ng/ml), capable of blocking anti-CD3-induced translocation of cytoplasmic nuclear factor of activated T cells (NFAT) (34), significantly (p < 0.01) enhanced IFN-{gamma} production (Fig. 1GoC), substantiating further the capacity of anti-CD3 to inhibit IFN-{gamma} production from T cells. We also stimulated B cells with IL-12 and/or IL-18 for 3 days and then measured IFN-{gamma} production. As we have reported previously (6), B cells (~99% IgM+) showed dose-dependent IFN-{gamma} production in response to IL-12 and IL-18 (Fig. 1GoD). Since anti-CD3 down-regulates T cell IFN-{gamma} production, we separately examined the effect of anti-IgM stimulation on B cells. We found that, in sharp contrast to the action of anti-CD3, anti-IgM stimulation did not affect IFN-{gamma} production by B cells stimulated with IL-12 and IL-18 (data not shown).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 1. IL-12 and IL-18 synergize for IFN-{gamma} production from T cells or B cells. A–C, Splenic T cells (2 x 105/0.2 ml/well) were cultured alone or stimulated with immobilized anti-CD3 (10 µg/ml for coating), IL-12, and IL-18 (160 pg/ml–100 ng/ml), either alone or in various combinations in the presence or absence of CsA (~1000 ng/ml), in 96-well plates for 72 h. {dagger}, Anti-CD3 significantly inhibited IFN-{gamma} production by T cells stimulated with 4, 20, or 100 ng/ml of IL-12 at 4, 20, or 100 ng/ml of IL-18 (p < 0.01). *, CsA significantly enhanced IFN-{gamma} production by T cells stimulated with anti-CD3, IL-12 (20 ng/ml), and IL-18 (20 ng/ml) (p < 0.01). D, Splenic B cells (2 x 105/0.2 ml/well) were cultured alone or stimulated with IL-12 and/or IL-18 (160 pg/ml–100 ng/ml) in 96-well plates for 72 h. Culture supernatants were harvested and tested for production of IFN-{gamma} by ELISA. Results are mean ± 1 SD. E, Demonstration of IL-12R mRNA in freshly prepared T cells and B cells. One microgram of total RNAs from T cells or B cells cultured by themselves or with IL-12 (20 ng/ml) for 72 h was amplified by RT-PCR.

 
Naive T cells develop into Th1 cells after stimulation with anti-CD3 and IL-12 for 3 or 4 days (18). However, these Th1 cells cannot produce IFN-{gamma} during this priming period (Fig. 1GoA) and require anti-CD3 challenge to produce IFN-{gamma} in the subsequent culture. Interestingly, as noted above, naive T cells stimulated with anti-CD3, IL-12, and IL-18 strikingly produced IFN-{gamma} (Fig. 1GoA) but no IL-4 and IL-5 (data not shown) during this 72-h culture. Further kinetic study revealed that they produced a comparable level of IFN-{gamma} within 48 h. Thus, stimulation of naive T cells with anti-CD3, IL-12, and IL-18 promptly induces them to develop into Th1 cells and to produce IFN-{gamma}-producing cells in the same culture.

Because NK cells produce IFN-{gamma} in response to IL-12 and/or IL-18 (8, 35), we sought to assess any possible contamination with NK cells by FACS analysis and found no B220-IL-2Rß+ cells (NK cells) in freshly purified T cells or B cells from anti-asialo GM1-treated mice (data not shown). Recently, IL-12R ß2, a second component of the IL-12R, was identified and cloned (36). IL-12R ß2 is not expressed by naive resting CD4+ T cells (Mel-14+ CD4+ T cells from TCR-transgenic mice) and requires Ag activation for its expression (37). However, freshly purified T cells and B cells expressed IL-12R ß2 when examined by RT-PCR and responded to IL-12 by up-regulation of IL-12R ß1 (Fig. 1GoE). This difference may be explained by the difference between Mel-14+ CD4+ T cells from TCR-transgenic mice (37) and freshly purified splenic T cells from nontransgenic mice.

T cells or B cells stimulated with IL-12 are competent to respond to IL-18 by IFN-{gamma} production

The requirement for IL-12 and IL-18 for high level IFN-{gamma} production suggests that IL-12 makes T cells or B cells sensitive to IL-18. Therefore, we stimulated T cells or B cells with IL-12 for 72 h, then collected, washed, and subsequently stimulated them with IL-18 for 48 h. Since 20 ng/ml of IL-12 and IL-18 maximally induced IFN-{gamma} production from T cells or B cells (Fig. 1Go), we used this amount of IL-12 for the stimulation of T cells or B cells. As shown in Figure 2Go, these T cells or B cells showed dose-dependent proliferation and IFN-{gamma} production in response to IL-18. In contrast, IL-18-pretreated T cells or B cells did not increase IFN-{gamma} production as a result of subsequent stimulation with IL-12 (data not shown). These results show that T cells or B cells stimulated with IL-12 for 72 h and then washed became competent to respond to IL-18 by IFN-{gamma} production and cell proliferation. IL-18 has been shown to induce IL-2 production from Th1 clones (7). We tested whether IL-18 induced proliferation of IL-12-stimulated T cells by causing them to produce IL-2. We found that addition of Abs against IL-2R {alpha}ß-chains did not inhibit their proliferation (data not shown).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2. IL-18 induced IL-12-stimulated T cells or B cells to produce IFN-{gamma} and to proliferate. T cells or B cells initially cultured at 5 x 106/ml (8 ml/flask) with IL-12 (20 ng/ml) for 72 h were collected, washed, and recultured at 2 x 105/0.2 ml/well (A) or 5 x 104/0.2 ml/well (B) with various amounts of IL-18 (0.156–40 ng/ml) for 48 h for induction of IFN-{gamma} production (A) or for induction of proliferation (B), respectively. Results are mean ± 1 SD of triplicate cultures.

 
Since IL-12 activates STAT4 (38, 39, 40, 41), we examined tyrosine phosphorylation of the STAT family in T cells that had been cultured with IL-12 (20 ng/ml) for 72 h, followed by 2 h of starvation and then stimulation with IL-12 or IL-18 (20 ng/ml) for 30 min. IL-12-stimulated T cells expressed tyrosine phosphorylation of STAT4 even with 2 h of starvation, and IL-12 stimulation enhanced this expression. However, IL-18 failed to enhance and activate any STAT (data not shown), although STAT proteins were detectable by Western blot analysis (data not shown), indicating that known members of the STAT family are not involved in IL-18 signaling and that activation of STAT4 might be important for rendering T cells or B cells to be responsive to IL-18.

Expression of IL-18R on IL-12-stimulated T cells and B cells

Because concentrations of 440 pM (8 ng/ml) or greater of IL-18 were required to obtain maximal IFN-{gamma} production, we examined the number and affinity of IL-18R on T cells or B cells before and after stimulation with IL-12 for 72 h. T cells or B cells cultured by themselves did not specifically bind 125I-IL-18, whereas T cells or B cells cultured with IL-12 alone had the capacity to specifically bind 125I-IL-18. As shown in Figure 3GoA, the shape of the Scatchard plot obtained from the binding study is consistent with the presence of high affinity and low affinity IL-18R binding sites. Measurement of binding of 125I-IL-18 on IL-12-stimulated T and B cells revealed that they expressed 405 high affinity IL-18R (Kd = 430 pM)/5500 low affinity IL-18R (Kd = 31.4 nM) and 160 high affinity IL-18R (Kd = 457 pM)/2340 low affinity IL-18R (Kd = 93.6 nM), respectively. These results taken together indicate that IL-12 induces high and low affinity IL-18R and that such IL-12-stimulated T cells or B cells exhibit the capacity to proliferate and to produce IFN-{gamma} in response to IL-18.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 3. Induction of IL-18R on T cells and B cells by IL-12 stimulation. Forty million splenic T cells or B cells were cultured alone ({circ}) or with 20 ng/ml of IL-12 (•) in 24-cm2 flasks in a total 8-ml volume for 72 h. A, Binding assays were performed as described by Robb et al. (30) and detailed in our previous reports (31). One of three independent binding experiments, which provided identical results, was presented. Number of bound 125I-IL-18 molecules per cell is plotted on the abscissa, and the ratio of bound 125I-IL-18 molecules over free concentration of 125I-IL-18 is plotted on the ordinate. B, Total RNA was extracted, and IL-18R mRNA was measured by RT-PCR. mRNA expression of IL-1R type 1, IL-1R type II, and IL-1R Acp was also examined. As positive controls for IL-18R mRNA, mRNA extracted from cloned hepatic NK cells (5E3) (10) was used.

 
We next examined the capacity of IL-12 to induce an increase in the expression of IL-18R mRNA in splenic T or B cells. As shown in Figure 3GoB, T cells cultured by themselves expressed very little IL-18R mRNA, whereas T cells cultured with IL-12 for 72 h clearly did. B cells cultured with IL-12 for 72 h also clearly expressed IL-18R mRNA. In this experiment, we used mRNA extracted from cloned hepatic NK cells (5E3) (10) as a positive control for IL-18R mRNA. We also examined mRNA expression of IL-1R type 1, IL-1R type 2, and IL-1R Acp. No mRNAs except IL-18R mRNA were up-regulated by IL-12 stimulation (Fig. 3GoB).

Anti-CD3 stimulation down-regulated IL-18R mRNA expression in IL-12-stimulated T cells

Development of naive CD4+ T cells into Th1 or Th2 cells depends on their mode of priming (14, 15, 16, 17, 18, 19, 20, 21). Induction of Th1 cells in vitro requires stimulation of T cells with anti-CD3 and IL-12 for 72 to 96 h (18). However, as shown in Figure 1GoA, anti-CD3 stimulation partially but significantly (p < 0.01) inhibited the capacity of IL-12 and IL-18 to induce IFN-{gamma} production from T cells. Furthermore, CsA significantly (p < 0.01) diminished this inhibitory action of anti-CD3 (Fig. 1GoC). To understand this inhibitory mechanism of anti-CD3, we compared the levels of expression of IL-18R mRNA in T cells that had been stimulated with IL-12 in the presence or absence of anti-CD3 for 3 to 72 h or with anti-CD3 and IL-12 in the presence or absence of CsA for 72 h. As shown in Figure 4GoA, IL-18R mRNA expression was detectable at 3 to 72 h after stimulation with IL-12. In contrast, the expression of IL-18R mRNA was only transiently detectable at 3 h after stimulation with anti-CD3 and IL-12, after which time this expression rapidly declined. However, CsA markedly abrogated this inhibitory action of anti-CD3 (Fig. 4GoA). Thus, IL-12 stimulation continuously up-regulated IL-18R mRNA in T cells and its protein product (Fig. 3Go), whereas anti-CD3 stimulation down-regulated this IL-12-induced IL-18R mRNA expression in T cells at 6 h and thereafter, leading to markedly diminished expression of IL-18R as measured by binding with 125I-IL-18 (data not shown).



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 4. Kinetics of induction of IL-18R mRNA and IFN-{gamma} production by IL-12. Splenic T cells (5 x 106) were cultured alone or with 20 ng/ml of IL-12 in 6-well plates in a total 3-ml vol, either with immobilized anti-CD3 (10 µg/ml) or not, for 3 to 72 h or with anti-CD3 and IL-12 in the presence or absence of CsA (~50 ng/ml) for 72 h. After initial culture, cells were washed and A, mRNAs were extracted and examined for their expression of IL-18R mRNA by Northern blot analysis or B, recultured at 2 x 105/0.2 ml/well with medium alone or IL-18 (20 ng/ml) in 96-well plates either coated with anti-CD3 (10 µg/ml) or not for 48 h. Culture supernatants were harvested and tested for production of IFN-{gamma} by ELISA. Results are mean ± 1 SD.

 
To show that this diminished IL-18R mRNA in T cells resulted in their diminished capacity to produce IFN-{gamma} in response to IL-18, we restimulated these pretreated T cells with anti-CD3 and/or IL-18 for 48 h (Fig. 4GoB). T cells pretreated with anti-CD3 and IL-12 for 3 to 24 h produced a substantial amount of IFN-{gamma} in response to IL-18, suggesting that these T cells expressed IL-18R. However, when they developed into Th1 cells after stimulation with anti-CD3 and IL-12 for 48 to 72 h, they showed a dominant response to anti-CD3 by production of IFN-{gamma} in response to anti-CD3 and IL-18. In contrast, T cells pretreated with IL-12 in the absence of anti-CD3 for 24 h or 72 h produced similar level of IFN-{gamma} in response to IL-18. However, as these T cells failed to produce IFN-{gamma} in response to anti-CD3 (Fig. 4GoB), these IL-12-stimulated T cells were not Th1 cells. These results, taken together, indicated that signaling through CD3 plays an important role in the down-regulation of IL-18R mRNA and the induction of commitment of naive T cells into Th1 cells. However, CsA markedly abrogated this down-regulation of IL-18R mRNA by anti-CD3 and enhanced the IFN-{gamma} production induced by IL-18 (Fig. 1GoC). Thus, when the T cells developed into Th1 cells, they diminished their IL-18R expression and gradually became less sensitive to IL-18 stimulation. However, since these T cells transiently but strongly expressed IL-18R mRNA and presumably sustained IL-18R expression in some period after stimulation with anti-CD3 and IL-12, they showed conspicuous IFN-{gamma} production in response to IL-18.

Preferential expression of IL-18R mRNA in IL-12-induced Th1 cells

IL-18 and IL-12 synergize for IFN-{gamma} production from Th1 clones, whereas this combination fails to affect Th2 cells (7). To understand the mechanism underlying this difference in IL-18 responsiveness between Th1 and Th2 cells, we tested whether IL-18R mRNA is preferentially expressed in Th1 cells. For this purpose, we induced naive T cells to develop into Th1 cells or Th2 cells by stimulating them with anti-CD3 and IL-12 (20 ng/ml) or IL-4 (1000 U/ml) for 72 h, respectively (Fig. 5Go). Since we could not detect or detected meagerly expressed IL-18R mRNA in T cells stimulated with anti-CD3 and IL-12 for 72 h by Northern blot analysis (Fig. 4GoA), we performed RT-PCR analysis for this detection. As shown in Figure 5GoB, only the T cells stimulated with anti-CD3 and IL-12 for 72 h clearly expressed IL-18R mRNA.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 5. Up-regulated IL-18R mRNA expression in IL-12-induced Th1 cells but not in IL-4-induced Th2 cells. Splenic T cells (5 x 106) were cultured with 10 U/ml of IL-2 plus immobilized anti-CD3 (10 µg/ml) in the presence or absence of 20 ng/ml of IL-12 or 1000 U/ml of IL-4 in 6-well plates in a total 3-ml vol for 72 h. After initial priming, cells were washed and recultured at 2 x 105/0.2 ml/well with immobilized anti-CD3 in the presence or absence of IL-12 and/or IL-18 for 48 h for induction of cytokine production (A and C), or they were immediately examined by RT-PCR for expression of IL-18R mRNA (B).

 
We finally compared the ability of Th1 and Th2 cells to produce IFN-{gamma} in response to anti-CD3 and IL-12 and/or IL-18. Again, after developing into Th1 cells, these Th1 cells diminished their responsiveness to IL-18 and predominantly responded to anti-CD3 by IFN-{gamma} production when they were subsequently stimulated with anti-CD3 plus IL-18. As expected, Th2 cells did not produce IFN-{gamma} in response to anti-CD3 plus IL-18. However, when Th1 cells and Th2 cells were stimulated with anti-CD3, IL-12, and IL-18, only the Th1 cells showed a further augmentation of IFN-{gamma} production in response to IL-18 stimulation, suggesting that differences in IL-18 responsiveness between Th1 and Th2 cells resulted from their differential expression of IL-18R.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We showed that resting T cells or B cells do not express IL-18R and fail to produce IFN-{gamma} in response to IL-18. Pretreatment of T cells or B cells with IL-12 rendered them responsive to IL-18 by activation of STAT4 and induction of IL-18R. However, these IL-12-stimulated T cells did not produce IFN-{gamma} in response to anti-CD3. Thus, T cells stimulated with IL-12 and IL-18 promptly and strikingly produce IFN-{gamma} without their TCR engagement and Th1 development. We also showed that when T cells developed into Th1 cells after stimulation with anti-CD3 and IL-12, they lowered IL-12-induced IL-18R mRNA expression but gained the capacity to respond predominantly to anti-CD3 by IFN-{gamma} production in response to anti-CD3 and IL-18. In contrast, Th2 cells did not express IL-18R mRNA and showed no IL-18 responsiveness. Moreover, we showed that when Th1 cells and Th2 cells were stimulated with anti-CD3, IL-12, and IL-18, only Th1 cells showed a further augmentation of IFN-{gamma} production in response to IL-18, strongly indicating that the differences in IL-18 responsiveness between Th1 and Th2 cells resulted from their differential expression of IL-18R.

IL-12-stimulated T cells or B cells express both high and low affinity IL-18R (Fig. 3Go), whereas COS-1 cells transfected with IL-18R (IL-1Rrp) cDNA express only low affinity IL-18R (26). There are two possibilities that may account for this discrepancy. First, high affinity IL-18R consists of two chains: one is an IL-18-binding subunit (IL-1Rrp) found in Hodgkin’s lymphoma cells that were used for preparation of IL-18R (IL-1Rrp) and the other is a missing subunit that exists in IL-12-stimulated T or B cells in association with IL-1Rrp to form high affinity IL-18R. Second, high affinity IL-18R may be a homodimer of IL-1Rrp, although this possibility is very slight, because COS-1 cells transfected with IL-18R (IL-1Rrp) cDNA express only low affinity IL-18R (26). We need further study to elucidate the second chain of high affinity IL-18R.

As shown in Figure 3GoB, stimulation of T cells or B cells with IL-12 induces an increase in the expression of IL-18R mRNA without affecting the expression of IL-1R or IL-1R Acp. These IL-12-stimulated T cells rapidly and continuously expressed IL-18R mRNA (Fig. 4GoA) and produced IFN-{gamma} in response to IL-18 (Figs. 2Go and 4GoB), while they showed no response to IL-1 stimulation (our unpublished observation). Importantly, these T cells did not belong to Th1 cells because they could not produce IFN-{gamma} in response to anti-CD3 (Fig. 4GoB). However, T cells stimulated with IL-12 and IL-18 without anti-CD3 produce IFN-{gamma} more strikingly than T cells stimulated with anti-CD3, IL-12, and IL-18 (Fig. 1Go). Recently, we observed that IL-12 synergizes with IL-18 for IFN-{gamma} production from spleen cells of SCID mice lacking T cells and B cells but having NK cells that constitutively express IL-18R and IL-12R mRNA (our unpublished observation). Like these NK cells, T cells produce IFN-{gamma} in response to IL-12 and IL-18 without their TCR engagement or development into Th1 cells. Furthermore, B cells also produce IFN-{gamma} in response to IL-12 and IL-18 (6). The physiologic relevance of these IFN-{gamma}-producing T cells and B cells is uncertain. However, since they promptly and strikingly produce IFN-{gamma} in response to IL-12 and IL-18 without developing into memory cells such as Th1 cells, they may play an important role as potent host defensive cells in the innate immune response. However, since these IL-12-stimulated T cells were highly resistant to CsA treatment, it may be important to consider the presence of these IL-12 plus IL-18-stimulated cells in the treatment of some immunologic disorders with CsA.

The signal transduction pathways, after the activation of the receptors for IL-12 and IL-18, are quite complicated. IL-12 stimulation activates STAT4 (38, 39, 40, 41). Indeed, IL-12-pretreated T cells showed tyrosine phosphorylation of STAT4 even after 2 h of starvation, whereas IL-18 stimulation did not phosphorylate any members of STAT family. Recently, Matsumoto et al. (42) reported that IL-18 activates NF-{kappa}B in murine Th1 cells. More recently, Robinson et al. (23) proved that, like IL-1{alpha}, IL-18 activates IRAK and NF-{kappa}B. Thus, we assume that NF-{kappa}B and STAT4 synergize to activate the IFN-{gamma} promotor, resulting in a striking level of production of IFN-{gamma} by T cells.

As shown in Figure 4Go, T cells gained the Th1 phenotype even at 48 h after stimulation with anti-CD3 and IL-12, because they produced IFN-{gamma} in response to subsequent stimulation with anti-CD3 for 48 h. However, T cells stimulated with anti-CD3 and IL-12 for 72 h did not produce IFN-{gamma} during this period (Fig. 1GoA), although they produced IFN-{gamma} in response to stimulation with anti-CD3 or anti-CD3 and IL-12 in the subsequent culture (Figs. 4Go and 5Go). To our surprise, such a two-step culture was not required for induction of IFN-{gamma} production by T cells stimulated with anti-CD3, IL-12, and IL-18. As shown in Figure 1Go, IL-12 and IL-18 synergistically induced IFN-{gamma} production by T cells in the presence and absence of anti-CD3 within 72 h. Thus, stimulation with anti-CD3, IL-12, and IL-18 induces Th1 cell development and IFN-{gamma} production in the same culture.

In contrast to the IL-12-stimulated T cells that continuously expressed high level of IL-18R mRNA, T cells stimulated with anti-CD3, IL-12, and IL-18 only transiently expressed high level of IL-18R mRNA at 3 h (Fig. 4GoA). Furthermore, we demonstrated that when T cells develop into Th1 cells, they diminished their IL-18R expression and gradually became less sensitive to IL-18 but showed a dominant response to anti-CD3 by production of IFN-{gamma} in response to anti-CD3 and IL-18 (Fig. 4GoB). Moreover, treatment with CsA enhanced IFN-{gamma} production by T cells in response to anti-CD3, IL-12, and IL-18 presumably by inhibiting the action of anti-CD3 to down-regulate IL-18R mRNA (Fig. 4GoA). Thus, CD3-transduced signaling plays an important role in the down-regulation of IL-18R and the induction of naive T cells to develop into Th1 cells. Nevertheless, when naive T cells were stimulated with anti-CD3, IL-12, and IL-18, they were strikingly able to produce IFN-{gamma} in response to IL-18 (Fig. 1GoA). It is intriguing to assume that anti-CD3 and IL-12 increased the number of cells entering into the G1 phase of the cell cycle and augmented IL-18R mRNA at 3 h. Therefore, IL-18 in collaboration with IL-12 strikingly enhanced IFN-{gamma} production by these T cells. Furthermore, IL-18 enhanced the number of cells entering into the S phase of the cell cycle. Thus, anti-CD3, IL-12, and IL-18 may strikingly induce T cell IFN-{gamma} production, first by induction of IL-18R-positive cells and then by subsequent IL-18-dependent cell cycle progression, leading to striking IFN-{gamma} production.

We examined the expression of IL-18R mRNA in Th1 cells and Th2 cells that had been induced by stimulation of naive T cells for 72 h with anti-CD3 and IL-12 or IL-4, respectively. We found that only Th1 cells express IL-18R mRNA (Fig. 5GoB). When Th1 cells and Th2 cells were restimulated with anti-CD3, IL-12, and IL-18, only Th1 cells augmented IFN-{gamma} production in response to additional IL-18 stimulation (Fig. 5GoC). Stimulation of Th1 cells with anti-CD3, IL-12, and IL-18 may induce them to recycle and to produce more IFN-{gamma}; IL-12-dependent induction of IL-18R was followed by binding of IL-18 to this up-regulated IL-18R, whereas Th2 cells may be insensitive to such action, although they produced IFN-{gamma} in response to anti-CD3 and IL-12 (37, 43, 44, 45). In this study, we have shown two distinct IFN-{gamma} induction pathways: one is an IL-12- and IL-18-dependent pathway, without induction of Th1 cells; and the other is an anti-CD3-, IL-12-, and IL-18-dependent pathway, with induction of Th1 cells. This first pathway is especially important, because T cells produce IFN-{gamma} without TCR engagement by Ag or anti-CD3.


    Acknowledgments
 
We thank Hayashibara Biochemical Laboratories Inc. for providing us with recombinant murine IL-12 and IL-18 and for very helpful discussions.


    Footnotes
 
1 This study is supported by a Grant-in-Aid for Scientific Research; a Hitech Research Center Grant from the Ministry of Education, Science, and Culture of Japan; and CREST (Core Research for Evolutional Science and Technology) of the Japan Science and Technology Corporation. Back

2 Address correspondence and reprint requests to Dr. Kenji Nakanishi, Department of Immunology and Medical Zoology, Hyogo College of Medicine, 1-1, Mukogawa-cho, Nishinomiya, Hyogo, 663-8501 Japan. E-mail address: Back

3 Abbreviations used in this paper: IL-1Rrp, IL-1R-related protein; IRAK, IL-1R-associated kinase; CsA, cyclosporin A; Kd, dissociation constant; Acp, accessory protein. Back

Received for publication February 17, 1998. Accepted for publication June 2, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. H., Okamura, H. Tsutsui, T. Komatsu, M. Yutsudo, A. Hakura, T. Tanimoto, K. Torigoe, T. Okura, Y. Nukada, K. Hattori, et al 1995. Cloning of a new cytokine that induces IFN-{gamma} production by T cells. Nature 378:88.[Medline]
  2. Y., Gu, K. Kuida, H. Tsutsui, G. Ku, K. Hsiao, M. A. Fleming, N. Hayashi, K. Higashino, H. Okamura, K. Nakanishi, et al 1997. Activation of interferon-{gamma} inducing factor mediated by interleukin-1ß converting enzyme. Science 275:206.[Abstract/Free Full Text]
  3. Ghayur, T., S. Banerjee, M. Hugunin, D. Butler, L. Herzog, A. Carter, L. Quintal, L. Sekut, R. Talanian, M. Paskind, W. Wong, R. Kamen, D. Tracey, H. Allen. 1997. Caspase-1 processed IFN-{gamma}-inducing factor and regulates LPS-induced IFN-{gamma} production. Nature 386:617.
  4. S., Ushio, M. Namba, T. Okura, K. Hattori, Y. Nukada, K. Akita, F. Tanabe, K. Konishi, M. Micallef, M. Fujii, et al 1996. Cloning of the cDNA for human IFN-{gamma}-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
  5. Matsui, K., T. Yoshimoto, H. Tsutsui, Y. Hyodo, N. Hayashi, K. Hiroishi, N. Kawada, H. Okamura, K. Nakanishi, K. Higashino. 1997. Propionibacterium acnes treatment diminishes CD4+NK1.1+ T cells but induces type 1 T cells in the liver by induction of IL-12 and IL-18 production from Kupffer cells. J. Immunol. 159:97.[Abstract]
  6. Yoshimoto, T., H. Okamura, Y. Tagawa, Y. Iwakura, K. Nakanishi. 1997. Interleukin 18 together with interleukin 12 inhibits IgE production by induction of interferon-{gamma} production from activated B cells. Proc. Natl. Acad. Sci. USA 94:3948.[Abstract/Free Full Text]
  7. Kohno, K., J. Kataoka, T. Ohtsuki, Y. Suemoto, I. Okamoto, M. Usui, M. Ikeda, M. Kurimoto. 1997. IFN-{gamma}-inducing factor (IGIF) is a costimulatory factor on the activation of Th1 but not Th2 cells and exerts its effect independently of IL-12. J. Immunol. 158:1541.[Abstract]
  8. Tsutsui, H., K. Matsui, N. Kawada, Y. Hyodo, N. Hayashi, H. Okamura, K. Higashino, K. Nakanishi. 1997. IL-18 accounts for both TNF-{alpha}- and FasL-mediated hepatotoxic pathways in endotoxin-induced liver injury. J. Immunol. 159:3961.[Abstract]
  9. Dao, T., K. Ohashi, T. Kayano. 1996. Interferon-{gamma}-inducing factor, a novel cytokine, enhances fas ligand mediated cytotoxity of murine T helper 1 cells. Cell. Immunol. 173:230.[Medline]
  10. Tsutsui, H., K. Nakanishi, K. Matsui, K. Higashino, H. Okamura, Y. Miyazawa, K. Kaneda. 1996. Interferon-{gamma}-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
  11. Mosmann, T. R., H. Cherwinski, M. W. Bond, M. A. Giedlin, R. L. Coffman. 1986. Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 136:2348.[Abstract]
  12. Sher, A., R. L. Coffman. 1992. Regulation of immunity to parasites by T cells and T cell-derived cytokines. Annu. Rev. Immunol. 10:385.[Medline]
  13. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
  14. Swain, S. L., A. D. Weinberg, M. English, G. Huston. 1990. IL-4 directs the development of Th2-like helper effectors. J. Immunol. 145:3796.[Abstract]
  15. Le Gros, G., S. Z. Ben-Sasson, R. A. Seder, F. D. Finkelman, W.E. Paul. 1990. Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro: IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells. J. Exp. Med. 172:921.[Abstract/Free Full Text]
  16. Seder, R. A., W. E. Paul, M. M. Davis, B. Fazekas de St. Groth.. 1992. The presence of interleukin 4 during in vitro priming determines the lymphokine-producing potential of CD4+ T cells from T cell receptor transgenic mice. J. Exp. Med. 176:1091.[Abstract/Free Full Text]
  17. Hsieh, C. S., A. B. Heimberger, J. S. Gold, A. O’Garra, K. M. Murphy. 1992. Differential regulation of T helper phenotype development by interleukins 4 and 10 in an {alpha}ß T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. USA 89:6065.[Abstract/Free Full Text]
  18. Seder, R. A., R. Gazzinelli, A. Sher, W. E. Paul. 1993. Interleukin 12 acts directly on CD4+ T cells to enhance priming for interferon gamma production and diminishes interleukin 4 inhibition of such priming. Proc. Natl. Acad. Sci. USA 90:10188.[Abstract/Free Full Text]
  19. Hsieh, C. S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, K. M. Murphy. 1993. Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science 260:547.[Abstract/Free Full Text]
  20. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635.[Medline]
  21. O’Garra, A., K. M. Murphy. 1994. Role of cytokines in determining T-lymphocyte function. Curr. Opin. Immunol. 6:458.[Medline]
  22. Trinchieri, G.. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific and adaptive immunity. Annu. Rev. Immunol. 13:251.[Medline]
  23. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, S. Menon, R. Kastelein, F. Bazan, A. O’Garra. 1997. IGIF dose not drive Th1 development but synergizes with IL-12 for Interferon-{gamma} production and activates IRAK and NF{kappa}B. Immunity 7:571.[Medline]
  24. Takeda, K., H. Tsutsui, T. Yoshimoto, O. Adachi, N. Yoshida, T. Kishimoto, O. Okamura, K. Nakanishi, S. Akira. 1998. Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity 8:383.[Medline]
  25. Ahn, H.-J., S. Maruo, M. Tomura, J. Mu, T. Hamaoka, K. Nakanishi, S. Clark, M. Kurimoto, H. Okamura, H. Fujiwara. 1997. A mechanism underlying synergy between IL-12 and IFN-{gamma}-inducing factor in enhanced production of IFN-{gamma}. J. Immunol. 159:2125.[Abstract/Free Full Text]
  26. Torigoe, K., S. Ushio, T. Okura, S. Kobayashi, M. Taniai, T. Kinikata, T. Murakami, O. Sanou, H. Kojima, M. Fuji, T. Ohta, M. Ikeda, H. Ikegami, M. Kurimoto. 1997. Purification and characterization of the human Interleukin-18 (hIL-18) receptor. J. Biol. Chem. 272:25737.[Abstract/Free Full Text]
  27. Parnet, P., K. E. Garka, T. P. Bonnet, S. K. Dower, J. E. Sim. 1996. IL-1Rrp is a novel receptor-like molecule similar to the type I Interleukin-1 receptor and its homologues T1/ST2 and IL-1R Acp. J. Biol. Chem. 271:3967.[Abstract/Free Full Text]
  28. Leo, O., M. Foo, D. H. Sachs, L. E. Samelson, J. A. Bluestone. 1987. Identification of a monoclonal antibody specific for a murine T3 polypeptide. Proc. Natl. Acad. Sci. USA 84:1374.[Abstract/Free Full Text]
  29. Nakanishi, K., S. Hirose, T. Yoshimoto, H. Ishizashi, K. Hiroishi, T. Tanaka, T. Kono, M. Miyasaka, T. Taniguchi, K. Higashino. 1992. Role and regulation of interleukin (IL)-2 receptor {alpha} and ß chains in IL-2-driven B-cell growth. Proc. Natl. Acad. Sci. USA 89:3551.[Abstract/Free Full Text]
  30. Hu-Li, J., J. Ohara, C. Watson, W. Tsang, W. E. Paul. 1989. Derivation of a T cell line that is highly responsive to IL-4 and IL-2 (CT.4R) and of an IL-2 hyporesponsive mutant of that line (CT.4S). J. Immunol. 142:800.[Abstract]
  31. Robb, R. J., A. Munk, K. A. Smith. 1981. T cell growth factor receptors: quantitation, specificity, and biological relevance. J. Exp. Med. 154:1455.[Abstract/Free Full Text]
  32. Nakanishi, K., T. Hashimoto, K. Hiroishi, K. Matsui, T. Yoshimoto, H. 3. Morse, J. Furuyama, T. Hamaoka, K. Higashino, W. E. Paul. 1987. Demonstration of up-regulated IL 2 receptor expression on an in vitro cloned BCL1 subline. J. Immunol. 138:1817.[Abstract]
  33. Yoshimoto, T., W. E. Paul. 1994. CD4pos, NK1.1pos T cells promptly produce Interleukin 4 in response to in vivo challenge with anti-CD3. J. Exp. Med. 179:1285.[Abstract/Free Full Text]
  34. Emmel, E. A., C. L. Verweij, D. B. Durand, K. M. Higgins, E. Lacy, G. R. Crabtree. 1989. Cyclosporin A specifically inhibits function of nuclear proteins involved in T cell activation. Science 246:1617.[Abstract/Free Full Text]
  35. Zhang, T., K. Kawakami, M. H. Qureshi, H. Okamura, M. Kurimoto, A. Saito. 1997. Interleukin-12 (IL-12) and IL-18 synergistically induce the fungicidal activity of murine peritoneal exudate cells against Cryptococcus neoformans through production of gamma interferon by natural killer cells. Infect. Immun. 65:3594.[Abstract]
  36. Presky, D. H., Y. Hong, L. J. Minetti, A. O. Chua, N. Nabavi, C-Y. Wu, M. K. Gately, U. Gubler. 1996. A functional interleukin 12 receptor complex is composed of two ß-type cytokine receptor subunits. Proc. Natl. Acad. Sci. USA 93:14002.[Abstract/Free Full Text]
  37. Szabo, S. J., A. S. Dighe, U. Gubler, K. M. Murphy. 1997. Regulation of the interleukin (IL)-12R ß2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185:817.[Abstract/Free Full Text]
  38. Jacobson, N. G., S. J. Szabo, R. M. Weber-Nordt, Z. Zhong, R. D. Schreiber, J. E. J. Darnell, K. M. Murphy. 1995. Interleukin 12 signaling in T helper type 1 (Th1) cells involves phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J. Exp. Med. 181:1755.[Abstract/Free Full Text]
  39. Szabo, S. J., N. G. Jacobson, A. S. Dighe, U. Gubler, K. M. Murphy. 1995. Developmental commitment to the Th2 lineage by extinction of IL-12 signaling. Immunity 2:665.[Medline]
  40. Thierfelder, W. E., J. M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, R. T. Carson, M. Y. Sangster, D. A. A. Vignali, P. C. Doherty, G. C. Grosveld., J. N. Ihle. 1996. Requirement of Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382:171.[Medline]
  41. Kaplan, N. H., Y. L. Sun, T. Hoey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in STAT4-deficient mice. Nature 382:174.[Medline]
  42. Matsumoto, S., K. Tsuji-Takayama, Y. Aizawa, K. Koide, M. Takeuchi, T. Ohta, M. Kurimoto. 1997. Interleukin-18 activates NF-{kappa}B in murine T helper type 1 cells. Biochem. Biophys. Res. Commun. 234:454.[Medline]
  43. Hu-Li, J., H. Huang, J. Ryan, W. E. Paul. 1997. In differentiated CD4+ T cells, interleukin 4 production is cytokine-autonomous, whereas interferon {gamma} production is cytokine-dependent. Proc. Natl. Acad. Sci. USA 94:3189.[Abstract/Free Full Text]
  44. Manetti, R., F. Gerosa, M. G. Giudizi, R. Biagiotti, P. Parronchi, M. P. Piccinni, S. Sampognaro, E. Maggi, S. Romagnani, G. Trinchieri.. 1994. Interleukin 12 induces stable priming for interferon gamma (IFN-{gamma}) production during differentiation of human T helper (Th) cells and transient IFN-{gamma} production in established Th2 cell clones. J. Exp. Med. 179:1273.[Abstract/Free Full Text]
  45. Yssel, H., S. Fasler, J. E. De Vries, R. de Waal Malefyt. 1994. IL-12 transiently induces IFN-{gamma} transcription and protein synthesis in human CD4+ allergen-specific Th2 T cell clones. Int. Immunol. 6:1091.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Mol Cell BiolHome page
Y. Y. Wan and R. A. Flavell
How Diverse--CD4 Effector T Cells and their Functions
J Mol Cell Biol, October 1, 2009; 1(1): 20 - 36.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. Sanchez, R. J. Palomino-Morales, N. Ortego-Centeno, J. Jimenez-Alonso, M. A. Gonzalez-Gay, M. A. Lopez-Nevot, J. Sanchez-Roman, E. de Ramon, M. F. Gonzalez-Escribano, B. A. Pons-Estel, et al.
Identification of a new putative functional IL18 gene variant through an association study in systemic lupus erythematosus
Hum. Mol. Genet., October 1, 2009; 18(19): 3739 - 3748.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Argiriadi, T. Xiang, C. Wu, T. Ghayur, and D. W. Borhani
Unusual Water-mediated Antigenic Recognition of the Proinflammatory Cytokine Interleukin-18
J. Biol. Chem., September 4, 2009; 284(36): 24478 - 24489.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N.-L. L. Pham, V. P. Badovinac, and J. T. Harty
A Default Pathway of Memory CD8 T Cell Differentiation after Dendritic Cell Immunization Is Deflected by Encounter with Inflammatory Cytokines during Antigen-Driven Proliferation
J. Immunol., August 15, 2009; 183(4): 2337 - 2348.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Guo, G. Wei, J. Zhu, W. Liao, W. J. Leonard, K. Zhao, and W. Paul
IL-1 family members and STAT activators induce cytokine production by Th2, Th17, and Th1 cells
PNAS, August 11, 2009; 106(32): 13463 - 13468.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. P. Longhi, C. Trumpfheller, J. Idoyaga, M. Caskey, I. Matos, C. Kluger, A. M. Salazar, M. Colonna, and R. M. Steinman
Dendritic cells require a systemic type I interferon response to mature and induce CD4+ Th1 immunity with poly IC as adjuvant
J. Exp. Med., July 6, 2009; 206(7): 1589 - 1602.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. S. Haring and J. T. Harty
Interleukin-18-Related Genes Are Induced during the Contraction Phase but Do Not Play Major Roles in Regulating the Dynamics or Function of the T-Cell Response to Listeria monocytogenes Infection
Infect. Immun., May 1, 2009; 77(5): 1894 - 1903.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
J. Yamada, J. Hamuro, A. Fukushima, T. Ohteki, K. Terai, Y. Iwakura, H. Yagita, and S. Kinoshita
MHC-Matched Corneal Allograft Rejection in an IFN-{gamma}/IL-17-Independent Manner in C57BL/6 Mice
Invest. Ophthalmol. Vis. Sci., May 1, 2009; 50(5): 2139 - 2146.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
H. Wu, M. L. Craft, P. Wang, K. R. Wyburn, G. Chen, J. Ma, B. Hambly, and S. J. Chadban
IL-18 Contributes to Renal Damage after Ischemia-Reperfusion
J. Am. Soc. Nephrol., December 1, 2008; 19(12): 2331 - 2341.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
H. P. Carroll, V. Paunovic, and M. Gadina
Signalling, inflammation and arthritis: Crossed signals: the role of interleukin-15 and -18 in autoimmunity
Rheumatology, September 1, 2008; 47(9): 1269 - 1277.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
Y. Kondo, T. Yoshimoto, K. Yasuda, S. Futatsugi-Yumikura, M. Morimoto, N. Hayashi, T. Hoshino, J. Fujimoto, and K. Nakanishi
Administration of IL-33 induces airway hyperresponsiveness and goblet cell hyperplasia in the lungs in the absence of adaptive immune system
Int. Immunol., June 1, 2008; 20(6): 791 - 800.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. J. Robertson, J. M. Kirkwood, T. F. Logan, K. M. Koch, S. Kathman, L. C. Kirby, W. N. Bell, L. M. Thurmond, J. Weisenbach, and M. M. Dar
A Dose-Escalation Study of Recombinant Human Interleukin-18 Using Two Different Schedules of Administration in Patients with Cancer
Clin. Cancer Res., June 1, 2008; 14(11): 3462 - 3469.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K.-J. Hong, J. R. Wickstrum, H.-W. Yeh, and M. J. Parmely
Toll-Like Receptor 2 Controls the Gamma Interferon Response to Francisella tularensis by Mouse Liver Lymphocytes
Infect. Immun., November 1, 2007; 75(11): 5338 - 5345.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Yoshimoto, T. Yoshimoto, K. Yasuda, J. Mizuguchi, and K. Nakanishi
IL-27 Suppresses Th2 Cell Development and Th2 Cytokines Production from Polarized Th2 Cells: A Novel Therapeutic Way for Th2-Mediated Allergic Inflammation
J. Immunol., October 1, 2007; 179(7): 4415 - 4423.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Hayashi, T. Yoshimoto, K. Izuhara, K. Matsui, T. Tanaka, and K. Nakanishi
T helper 1 cells stimulated with ovalbumin and IL-18 induce airway hyperresponsiveness and lung fibrosis by IFN-{gamma} and IL-13 production
PNAS, September 11, 2007; 104(37): 14765 - 14770.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
N. Foster, K. Andreadou, L. Jamieson, P.M. Preshaw, and J.J. Taylor
VIP Inhibits P. gingivalis LPS-induced IL-18 and IL-18BPa in Monocytes
Journal of Dental Research, September 1, 2007; 86(9): 883 - 887.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. R. de Arquer, R. Pena, C. Cabrera, G. Coma, R. Ruiz-Hernandez, R. Guerola, B. Clotet, L. Ruiz, J. A. Este, M. L. Calle, et al.
Skewed expression and up-regulation of the IL-12 and IL-18 receptors in resting and activated CD4 T cells from HIV-1-infected patients
J. Leukoc. Biol., July 1, 2007; 82(1): 72 - 78.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Imanishi, H. Hara, S. Suzuki, N. Suzuki, S. Akira, and T. Saito
Cutting Edge: TLR2 Directly Triggers Th1 Effector Functions
J. Immunol., June 1, 2007; 178(11): 6715 - 6719.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Srinivasan, R.-M. Salazar-Gonzalez, M. Jarcho, M. M. Sandau, L. Lefrancois, and S. J. McSorley
Innate Immune Activation of CD4 T Cells in Salmonella-Infected Mice Is Dependent on IL-18
J. Immunol., May 15, 2007; 178(10): 6342 - 6349.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
W. Wannamaker, R. Davies, M. Namchuk, J. Pollard, P. Ford, G. Ku, C. Decker, P. Charifson, P. Weber, U. A. Germann, et al.
(S)-1-((S)-2-{[1-(4-Amino-3-chloro-phenyl)-methanoyl]-amino}-3,3-dimethyl-butanoyl)-pyrrolidine-2-carboxylic acid ((2R,3S)-2-ethoxy-5-oxo-tetrahydro-furan-3-yl)-amide (VX-765), an Orally Available Selective Interleukin (IL)-Converting Enzyme/Caspase-1 Inhibitor, Exhibits Potent Anti-Inflammatory Activities by Inhibiting the Release of IL-1beta and IL-18
J. Pharmacol. Exp. Ther., May 1, 2007; 321(2): 509 - 516.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Nakae, Y. Iwakura, H. Suto, and S. J. Galli
Phenotypic differences between Th1 and Th17 cells and negative regulation of Th1 cell differentiation by IL-17
J. Leukoc. Biol., May 1, 2007; 81(5): 1258 - 1268.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. S. Way, C. Havenar-Daughton, G. A. Kolumam, N. N. Orgun, and K. Murali-Krishna
IL-12 and Type-I IFN Synergize for IFN-{gamma} Production by CD4 T Cells, Whereas Neither Are Required for IFN-{gamma} Production by CD8 T Cells after Listeria monocytogenes Infection
J. Immunol., April 1, 2007; 178(7): 4498 - 4505.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. Tellides and J. S. Pober
Interferon-{gamma} Axis in Graft Arteriosclerosis
Circ. Res., March 16, 2007; 100(5): 622 - 632.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. R. Wickstrum, K.-J. Hong, S. Bokhari, N. Reed, N. McWilliams, R. T. Horvat, and M. J. Parmely
Coactivating Signals for the Hepatic Lymphocyte Gamma Interferon Response to Francisella tularensis
Infect. Immun., March 1, 2007; 75(3): 1335 - 1342.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. C. Lewis and C. A. Dinarello
Responses of IL-18- and IL-18 receptor-deficient pancreatic islets with convergence of positive and negative signals for the IL-18 receptor
PNAS, November 7, 2006; 103(45): 16852 - 16857.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
U. I. Chaudhry, T. P. Kingham, G. Plitas, S. C. Katz, J. R. Raab, and R. P. DeMatteo
Combined Stimulation with Interleukin-18 and CpG Induces Murine Natural Killer Dendritic Cells to Produce IFN-{gamma} and Inhibit Tumor Growth
Cancer Res., November 1, 2006; 66(21): 10497 - 10504.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. J. Robertson, J. W. Mier, T. Logan, M. Atkins, H. Koon, K. M. Koch, S. Kathman, L. N. Pandite, C. Oei, L. C. Kirby, et al.
Clinical and biological effects of recombinant human interleukin-18 administered by intravenous infusion to patients with advanced cancer.
Clin. Cancer Res., July 15, 2006; 12(14): 4265 - 4273.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. R. Maxwell, R. Yadav, R. J. Rossi, C. E. Ruby, A. D. Weinberg, H. L. Aguila, and A. T. Vella
IL-18 Bridges Innate and Adaptive Immunity through IFN-{gamma} and the CD134 Pathway
J. Immunol., July 1, 2006; 177(1): 234 - 245.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
Y. Ishikawa, T. Yoshimoto, and K. Nakanishi
Contribution of IL-18-induced innate T cell activation to airway inflammation with mucus hypersecretion and airway hyperresponsiveness
Int. Immunol., June 1, 2006; 18(6): 847 - 855.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. R. Coward, A. Marei, A. Yang, M. M. Vasa-Nicotera, and S. C. Chow
Statin-Induced Proinflammatory Response in Mitogen-Activated Peripheral Blood Mononuclear Cells through the Activation of Caspase-1 and IL-18 Secretion in Monocytes
J. Immunol., May 1, 2006; 176(9): 5284 - 5292.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
M. C. Park, S. W. Lee, Y. B. Park, and S. K. Lee
Serum cytokine profiles and their correlations with disease activity in Takayasu's arteritis
Rheumatology, May 1, 2006; 45(5): 545 - 548.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. Skarsvik, J. Puranen, J. Honkanen, M. Roivainen, J. Ilonen, H. Holmberg, J. Ludvigsson, and O. Vaarala
Decreased in vitro type 1 immune response against coxsackie virus b4 in children with type 1 diabetes.
Diabetes, April 1, 2006; 55(4): 996 - 1003.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
C. A Dinarello
Interleukin 1 and interleukin 18 as mediators of inflammation and the aging process
Am. J. Clinical Nutrition, February 1, 2006; 83(2): 447S - 455S.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
C. Tortorella, I. Stella, G. Piazzolla, V. Cappiello, O. Simone, A. Pisconti, and S. Antonaci
Impaired Interleukin-12-Dependent T-Cell Functions During Aging: Role of Signal Transducer and Activator of Transcription 4 (STAT4) and Suppressor of Cytokine Signaling 3 (SOCS3).
J. Gerontol. A Biol. Sci. Med. Sci., February 1, 2006; 61(2): 125 - 135.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K.-i. Yamanaka, R. Clark, R. Dowgiert, D. Hurwitz, M. Shibata, B. E. Rich, K. Hirahara, D. A. Jones, S. Eapen, H. Mizutani, et al.
Expression of Interleukin-18 and Caspase-1 in Cutaneous T-Cell Lymphoma
Clin. Cancer Res., January 15, 2006; 12(2): 376 - 382.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. P. Harris, S. Goodrich, K. Mohrs, M. Mohrs, and F. E. Lund
Cutting Edge: The Development of IL-4-Producing B Cells (B Effector 2 Cells) Is Controlled by IL-4, IL-4 Receptor {alpha}, and Th2 Cells
J. Immunol., December 1, 2005; 175(11): 7103 - 7107.
[Abstract] [Full Text] [PDF]


Home page
Postgrad. Med. J.Home page
S G Baidya and Q-T Zeng
Helper T cells and atherosclerosis: the cytokine web
Postgrad. Med. J., December 1, 2005; 81(962): 746 - 752.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Y. Sasaki, T. Yoshimoto, H. Maruyama, T. Tegoshi, N. Ohta, N. Arizono, and K. Nakanishi
IL-18 with IL-2 protects against Strongyloides venezuelensis infection by activating mucosal mast cell-dependent type 2 innate immunity
J. Exp. Med., September 6, 2005; 202(5): 607 - 616.
[Abstract] [Full Text] [PDF]


Home page
Vet PatholHome page
S. Tanaka, M. Sato, T. Onitsuka, H. Kamata, and Y. Yokomizo
Inflammatory Cytokine Gene Expression in Different Types of Granulomatous Lesions during Asymptomatic Stages of Bovine Paratuberculosis
Vet. Pathol., September 1, 2005; 42(5): 579 - 588.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
L. Fernandez-Lago, A. Orduna, and N. Vizcaino
Reduced interleukin-18 secretion in Brucella abortus 2308-infected murine peritoneal macrophages and in spleen cells obtained from B. abortus 2308-infected mice
J. Med. Microbiol., June 1, 2005; 54(6): 527 - 531.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. D. Finkelman, M. Yang, C. Perkins, K. Schleifer, A. Sproles, J. Santeliz, J. A. Bernstein, M. E. Rothenberg, S. C. Morris, and M. Wills-Karp
Suppressive Effect of IL-4 on IL-13-Induced Genes in Mouse Lung
J. Immunol., April 15, 2005; 174(8): 4630 - 4638.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. A. Papadakis, D. Zhu, J. L. Prehn, C. Landers, A. Avanesyan, G. Lafkas, and S. R. Targan
Dominant Role for TL1A/DR3 Pathway in IL-12 plus IL-18-Induced IFN-{gamma} Production by Peripheral Blood and Mucosal CCR9+ T Lymphocytes
J. Immunol., April 15, 2005; 174(8): 4985 - 4990.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
R. J.L. Stuyt, M. G. Netea, I. Verschueren, C. A. Dinarello, B. J. Kullberg, and J. W.M. van der Meer
Interleukin-18 does not modulate the acute-phase response
Innate Immunity, April 1, 2005; 11(2): 85 - 88.
[Abstract] [PDF]


Home page
BloodHome page
F. Pages, J. Galon, G. Karaschuk, D. Dudziak, M. Camus, V. Lazar, S. Camilleri-Broet, C. Lagorce-Pages, S. Lebel-Binay, G. Laux, et al.
Epstein-Barr virus nuclear antigen 2 induces interleukin-18 receptor expression in B cells
Blood, February 15, 2005; 105(4): 1632 - 1639.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
U. Schleicher, A. Hesse, and C. Bogdan
Minute numbers of contaminant CD8+ T cells or CD11b+CD11c+ NK cells are the source of IFN-{gamma} in IL-12/IL-18-stimulated mouse macrophage populations
Blood, February 1, 2005; 105(3): 1319 - 1328.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Sun, M. Walsh, A. V. Villarino, L. Cervi, C. A. Hunter, Y. Choi, and E. J. Pearce
TLR Ligands Can Activate Dendritic Cells to Provide a MyD88-Dependent Negative Signal for Th2 Cell Development
J. Immunol., January 15, 2005; 174(2): 742 - 751.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Kusaba, P. Ghosh, R. Derin, M. Buchholz, C. Sasaki, K. Madara, and D. L. Longo
Interleukin-12-induced Interferon-{gamma} Production by Human Peripheral Blood T Cells Is Regulated by Mammalian Target of Rapamycin (mTOR)
J. Biol. Chem., January 14, 2005; 280(2): 1037 - 1043.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Mavropoulos, G. Sully, A. P. Cope, and A. R. Clark
Stabilization of IFN-{gamma} mRNA by MAPK p38 in IL-12- and IL-18-stimulated human NK cells
Blood, January 1, 2005; 105(1): 282 - 288.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-P. Raue, J. D. Brien, E. Hammarlund, and M. K. Slifka
Activation of Virus-Specific CD8+ T Cells by Lipopolysaccharide-Induced IL-12 and IL-18
J. Immunol., December 1, 2004; 173(11): 6873 - 6881.
[Abstract] [Full Text] [PDF]


Home page
Am J Trop Med HygHome page
A. HAILU, T. VAN DER POLL, N. BERHE, and P. A. KAGER
ELEVATED PLASMA LEVELS OF INTERFERON (IFN)-{gamma}, IFN-{gamma} INDUCING CYTOKINES, AND IFN-{gamma} INDUCIBLE CXC CHEMOKINES IN VISCERAL LEISHMANIASIS
Am J Trop Med Hyg, November 1, 2004; 71(5): 561 - 567.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
S-M Dai, K Nishioka, and K Yudoh
Interleukin (IL) 18 stimulates osteoclast formation through synovial T cells in rheumatoid arthritis: comparison with IL1{beta} and tumour necrosis factor {alpha}
Ann Rheum Dis, November 1, 2004; 63(11): 1379 - 1386.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Kinoshita, T. Yamagata, Y. Nozaki, M. Sugiyama, S. Ikoma, M. Funauchi, and A. Kanamaru
Blockade of IL-18 Receptor Signaling Delays the Onset of Autoimmune Disease in MRL-Faslpr Mice
J. Immunol., October 15, 2004; 173(8): 5312 - 5318.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Friebe, A. Siegling, S. Friederichs, H.-D. Volk, and O. Weber
Immunomodulatory Effects of Inactivated Parapoxvirus Ovis (Orf Virus) on Human Peripheral Immune Cells: Induction of Cytokine Secretion in Monocytes and Th1-Like Cells
J. Virol., September 1, 2004; 78(17): 9400 - 9411.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. A. Akhiani, K. Schon, and N. Lycke
Vaccine-Induced Immunity against Helicobacter pylori Infection Is Impaired in IL-18-Deficient Mice
J. Immunol., September 1, 2004; 173(5): 3348 - 3356.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-K. Lee, S.-H. Kim, E. C. Lewis, T. Azam, L. L. Reznikov, and C. A. Dinarello
Differences in signaling pathways by IL-1{beta} and IL-18
PNAS, June 8, 2004; 101(23): 8815 - 8820.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. Matsumura, H. Hayashi, T. Takii, C. F. Thorn, A. S. Whitehead, J.-i. Inoue, and K. Onozaki
TGF-{beta} down-regulates IL-1{alpha}-induced TLR2 expression in murine hepatocytes
J. Leukoc. Biol., June 1, 2004; 75(6): 1056 - 1061.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. A. Papadakis, J. L. Prehn, C. Landers, Q. Han, X. Luo, S. C. Cha, P. Wei, and S. R. Targan
TL1A Synergizes with IL-12 and IL-18 to Enhance IFN-{gamma} Production in Human T Cells and NK Cells
J. Immunol., June 1, 2004; 172(11): 7002 - 7007.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
J. A. DeVoti, B. M. Steinberg, D. W. Rosenthal, L. Hatam, A. Vambutas, A. L. Abramson, M. J. Shikowitz, and V. R. Bonagura
Failure of Gamma Interferon but Not Interleukin-10 Expression in Response to Human Papillomavirus Type 11 E6 Protein in Respiratory Papillomatosis
Clin. Vaccine Immunol., May 1, 2004; 11(3): 538 - 547.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
D. J. Esteban, A. A. Nuara, and R. M. L. Buller
Interleukin-18 and glycosaminoglycan binding by a protein encoded by Variola virus
J. Gen. Virol., May 1, 2004; 85(5): 1291 - 1299.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. E. Towne, K. E. Garka, B. R. Renshaw, G. D. Virca, and J. E. Sims
Interleukin (IL)-1F6, IL-1F8, and IL-1F9 Signal through IL-1Rrp2 and IL-1RAcP to Activate the Pathway Leading to NF-{kappa}B and MAPKs
J. Biol. Chem., April 2, 2004; 279(14): 13677 - 13688.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Chitnis, A. D. Salama, M. J. Grusby, M. H. Sayegh, and S. J. Khoury
Defining Th1 and Th2 Immune Responses in a Reciprocal Cytokine Environment In Vivo
J. Immunol., April 1, 2004; 172(7): 4260 - 4265.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
S Finotto, J Siebler, M Hausding, M Schipp, S Wirtz, S Klein, M Protschka, A Doganci, H A Lehr, C Trautwein, et al.
Severe hepatic injury in interleukin 18 (IL-18) transgenic mice: a key role for IL-18 in regulating hepatocyte apoptosis in vivo
Gut, March 1, 2004; 53(3): 392 - 400.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. Sugimoto, Y. Ishikawa, T. Yoshimoto, N. Hayashi, J. Fujimoto, and K. Nakanishi
Interleukin 18 Acts on Memory T Helper Cells Type 1 to Induce Airway Inflammation and Hyperresponsiveness in a Naive Host Mouse
J. Exp. Med., February 17, 2004; 199(4): 535 - 545.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Schroder, P. J. Hertzog, T. Ravasi, and D. A. Hume
Interferon-{gamma}: an overview of signals, mechanisms and functions
J. Leukoc. Biol., February 1, 2004; 75(2): 163 - 189.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Kaser, S. Kaser, N. C. Kaneider, B. Enrich, C. J. Wiedermann, and H. Tilg
Interleukin-18 attracts plasmacytoid dendritic cells (DC2s) and promotes Th1 induction by DC2s through IL-18 receptor expression
Blood, January 15, 2004; 103(2): 648 - 655.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Gutzmer, K. Langer, S. Mommert, M. Wittmann, A. Kapp, and T. Werfel
Human Dendritic Cells Express the IL-18R and Are Chemoattracted to IL-18
J. Immunol., December 15, 2003; 171(12): 6363 - 6371.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Durali, M.-G. de Goer de Herve, J. Giron-Michel, B. Azzarone, J.-F. Delfraissy, and Y. Taoufik
In human B cells, IL-12 triggers a cascade of molecular events similar to Th1 commitment
Blood, December 1, 2003; 102(12): 4084 - 4089.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. Fantuzzi, N. K. Banda, C. Guthridge, A. Vondracek, S.-H. Kim, B. Siegmund, T. Azam, J. A. Sennello, C. A. Dinarello, and W. P. Arend
Generation and characterization of mice transgenic for human IL-18-binding protein isoform a
J. Leukoc. Biol., November 1, 2003; 74(5): 889 - 896.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. W. Gobel, K. Schneider, B. Schaerer, I. Mejri, F. Puehler, S. Weigend, P. Staeheli, and B. Kaspers
IL-18 Stimulates the Proliferation and IFN-{gamma} Release of CD4+ T Cells in the Chicken: Conservation of a Th1-Like System in a Nonmammalian Species
J. Immunol., August 15, 2003; 171(4): 1809 - 1815.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. M. Gherardi, J. C. Ramirez, and M. Esteban
IL-12 and IL-18 act in synergy to clear vaccinia virus infection: involvement of innate and adaptive components of the immune system
J. Gen. Virol., August 1, 2003; 84(8): 1961 - 1972.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Plitz, P. Saint-Mezard, M. Satho, S. Herren, C. Waltzinger, M. de Carvalho Bittencourt, M. H. Kosco-Vilbois, and Y. Chvatchko
IL-18 Binding Protein Protects Against Contact Hypersensitivity
J. Immunol., August 1, 2003; 171(3): 1164 - 1171.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E.-M. Boneberg and T. Hartung
Febrile Temperatures Attenuate IL-1{beta} Release by Inhibiting Proteolytic Processing of the Proform and Influence Th1/Th2 Balance by Favoring Th2 Cytokines
J. Immunol., July 15, 2003; 171(2): 664 - 668.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. H. Bream, R. E. Curiel, C.-R. Yu, C. E. Egwuagu, M. J. Grusby, T. M. Aune, and H. A. Young
IL-4 synergistically enhances both IL-2- and IL-12-induced IFN-{gamma} expression in murine NK cells
Blood, July 1, 2003; 102(1): 207 - 214.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Wu, P. Sakorafas, R. Miller, D. McCarthy, S. Scesney, R. Dixon, and T. Ghayur
IL-18 Receptor {beta}-Induced Changes in the Presentation of IL-18 Binding Sites Affect Ligand Binding and Signal Transduction
J. Immunol., June 1, 2003; 170(11): 5571 - 5577.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Fairweather, S. Yusung, S. Frisancho, M. Barrett, S. Gatewood, R. Steele, and N. R. Rose
IL-12 Receptor {beta}1 and Toll-Like Receptor 4 Increase IL-1{beta}- and IL-18-Associated Myocarditis and Coxsackievirus Replication
J. Immunol., May 1, 2003; 170(9): 4731 - 4737.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Ito, A. Matejuk, C. Hopke, H. Drought, J. Dwyer, A. Zamora, S. Subramanian, A. A. Vandenbark, and H. Offner
Transfer of Severe Experimental Autoimmune Encephalomyelitis by IL-12- and IL-18-Potentiated T Cells Is Estrogen Sensitive
J. Immunol., May 1, 2003; 170(9): 4802 - 4809.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. Yoshimoto, B. Min, T. Sugimoto, N. Hayashi, Y. Ishikawa, Y. Sasaki, H. Hata, K. Takeda, K. Okumura, L. Van Kaer, et al.
Nonredundant Roles for CD1d-restricted Natural Killer T Cells and Conventional CD4+ T Cells in the Induction of Immunoglobulin E Antibodies in Response to Interleukin 18 Treatment of Mice
J. Exp. Med., April 21, 2003; 197(8): 997 - 1005.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Kikawada, D. M. Lenda, and V. R. Kelley
IL-12 Deficiency in MRL-Faslpr Mice Delays Nephritis and Intrarenal IFN-{gamma} Expression, and Diminishes Systemic Pathology
J. Immunol., April 1, 2003; 170(7): 3915 - 3925.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
M. de Fost, R. A. Hartskeerl, M. R. Groenendijk, and T. van der Poll
Interleukin 12 in Part Regulates Gamma Interferon Release in Human Whole Blood Stimulated with Leptospira interrogans
Clin. Vaccine Immunol., March 1, 2003; 10(2): 332 - 335.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Kambayashi, E. Assarsson, A. E. Lukacher, H.-G. Ljunggren, and P. E. Jensen
Memory CD8+ T Cells Provide an Early Source of IFN-{gamma}
J. Immunol., March 1, 2003; 170(5): 2399 - 2408.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. A. Gracie, S. E. Robertson, and I. B. McInnes
Interleukin-18
J. Leukoc. Biol., February 1, 2003; 73(2): 213 - 224.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H. K. Takahashi, T. Morichika, H. Iwagaki, T. Yoshino, R. Tamura, S. Saito, S. Mori, T. Akagi, N. Tanaka, and M. Nishibori
Effect of {beta}2-Adrenergic Receptor Stimulation on Interleukin-18-Induced Intercellular Adhesion Molecule-1 Expression and Cytokine Production
J. Pharmacol. Exp. Ther., February 1, 2003; 304(2): 634 - 642.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. H. Qureshi, A. G. Harmsen, and B. A. Garvy
IL-10 Modulates Host Responses and Lung Damage Induced by Pneumocystis carinii Infection
J. Immunol., January 15, 2003; 170(2): 1002 - 1009.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. M. Harandi, K. Eriksson, and J. Holmgren
A Protective Role of Locally Administered Immunostimulatory CpG Oligodeoxynucleotide in a Mouse Model of Genital Herpes Infection
J. Virol., December 20, 2002; 77(2): 953 - 962.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
J. A. Symons, E. Adams, D. C. Tscharke, P. C. Reading, H. Waldmann, and G. L. Smith
The vaccinia virus C12L protein inhibits mouse IL-18 and promotes virus virulence in the murine intranasal model
J. Gen. Virol., November 1, 2002; 83(11): 2833 - 2844.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Kimura, K. Kakimi, S. Wieland, L. G. Guidotti, and F. V. Chisari
Interleukin-18 Inhibits Hepatitis B Virus Replication in the Livers of Transgenic Mice
J. Virol., October 2, 2002; 76(21): 10702 - 10707.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. Dreher, M. Kok, C. Obregon, S. G. Kiama, P. Gehr, and L. P. Nicod
Salmonella virulence factor SipB induces activation and release of IL-18 in human dendritic cells
J. Leukoc. Biol., October 1, 2002; 72(4): 743 - 751.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Morinobu, M. Gadina, W. Strober, R. Visconti, A. Fornace, C. Montagna, G. M. Feldman, R. Nishikomori, and J. J. O'Shea
STAT4 serine phosphorylation is critical for IL-12-induced IFN-gamma production but not for cell proliferation
PNAS, September 17, 2002; 99(19): 12281 - 12286.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Konishi, H. Tsutsui, T. Murakami, S. Yumikura-Futatsugi, K.-i. Yamanaka, M. Tanaka, Y. Iwakura, N. Suzuki, K. Takeda, S. Akira, et al.
IL-18 contributes to the spontaneous development of atopic dermatitis-like inflammatory skin lesion independently of IgE/stat6 under specific pathogen-free conditions
PNAS, August 20, 2002; 99(17): 11340 - 11345.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Ariel, D. Novick, M. Rubinstein, C. A. Dinarello, O. Lider, and R. Hershkoviz
IL-12 and IL-18 induce MAP kinase-dependent adhesion of T cells to extracellular matrix components
J. Leukoc. Biol., July 1, 2002; 72(1): 192 - 198.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. B. Smeltz, J. Chen, R. Ehrhardt, and E. M. Shevach
Role of IFN-{gamma} in Th1 Differentiation: IFN-{gamma} Regulates IL-18R{alpha} Expression by Preventing the Negative Effects of IL-4 and by Inducing/Maintaining IL-12 Receptor {beta}2 Expression
J. Immunol., June 15, 2002; 168(12): 6165 - 6172.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
D. Arnold, C. Wasem, P. Juillard, P. Graber, I. Cima, C. Frutschi, S. Herren, S. Jakob, S. Alouani, C. Mueller, et al.
IL-18-independent cytotoxic T lymphocyte activation and IFN-{gamma} production during experimental acute graft-versus-host disease
Int. Immunol., May 1, 2002; 14(5): 503 - 511.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshimoto, T.
Right arrow Articles by Nakanishi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshimoto, T.
Right arrow Articles by Nakanishi, K.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS