The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Delude, R. L.
Right arrow Articles by Golenbock, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Delude, R. L.
Right arrow Articles by Golenbock, D. T.
The Journal of Immunology, 1998, 161: 3001-3009.
Copyright © 1998 by The American Association of Immunologists

Construction of a Lipopolysaccharide Reporter Cell Line and Its Use in Identifying Mutants Defective in Endotoxin, But Not TNF-{alpha}, Signal Transduction1

Russell L. Delude2,*, Atsutoshi Yoshimura{dagger}, Robin R. Ingalls{dagger} and Douglas T. Golenbock3,{dagger}

* Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215; and {dagger} Maxwell Finland Laboratory for Infectious Diseases, Boston University School of Medicine, Boston Medical Center, Boston, MA 02118


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Gram-negative bacterial LPS is a potent activator of inflammatory responses. The binding of LPS to CD14 initiates signal transduction; however, the molecular processes immediately following this event remain unclear. We engineered an LPS-inducible fibroblast reporter cell line to facilitate the use of molecular genetic techniques to study the LPS signaling pathway. A plasmid containing the human Tac Ag cDNA under transcriptional control of the human E selectin promoter was cotransfected into Chinese hamster ovary (CHO)-K1 cells together with a CD14 expression plasmid. A cell line was obtained, 3E10, which up-regulated expression of Tac following stimulation with LPS. Pools of mutagenized cells were exposed to LPS and then labeled with anti-Tac mAb. Cells that failed to up-regulate Tac expression were enriched by flow cytometry. Thirty clonal mutant cell lines were identified that continued to express CD14 and bind LPS, but failed to express Tac or translocate nuclear factor-{kappa}B (NF-{kappa}B) following LPS exposure. TNF-{alpha}-treated mutant cells continued to express Tac and translocate NF-{kappa}B. An analysis of LPS-induced NF-{kappa}B activity in heterokaryons derived from polyethylene glycol-fused cell lines indicated that recessive mutations in genes encoding components of the LPS signaling pathway accounted for the signaling defects. To date, two complementation groups have been identified from 11 cell lines analyzed. These data demonstrate that the TNF-{alpha} signaling pathway diverges from the LPS pathway early in the signal-transduction cascade despite similarities in LPS- and TNF-{alpha}-induced responses. Identification of the genes affected in these mutant reporter cells should identify heretofore-elusive components of the LPS signaling cascade.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lipopolysaccharide is the major component of the outer leaflet of the Gram-negative bacterial outer membrane. During the course of an infection, LPS can be beneficial to the host by enhancing the immune response (1). However, the release of large amounts of LPS can be harmful to the host by stimulating the excessive production of inflammatory mediators resulting in septic shock (2). An increased understanding of the role of LPS in cellular activation could lead to the design of effective therapies to exploit the beneficial effects of LPS and modulate the harmful effects of excessive exposure to endotoxin.

CD14 is a glycosylphosphatidylinositol (GPI4)-anchored protein (3) expressed by monocytes, macrophages, and activated neutrophils that binds to LPS and initiates cellular activation (4). A central role for CD14 in LPS-mediated responses has been proposed based upon the following observations: 1) specific anti-CD14 mAb inhibit the ability of LPS to stimulate phagocytes (4, 5, 6, 7); 2) a soluble fragment of CD14 (sCD14) is present in blood (8) and facilitates the activation of cells that do not express membrane CD14 (9, 10, 11); 3) transfection of CD14 into Chinese hamster ovary (CHO)-K1 fibroblasts or HT1080 fibrosarcoma cells transformed these cells from an LPS-nonresponsive to an LPS-responsive phenotype. The physiologic relevance of these observations was underscored recently using a CD14-deficient knockout mouse that was 10,000-fold less sensitive to LPS when compared with hemizygous littermates (12).

Macrophages express multiple receptors for LPS in addition to CD14. For example, the macrophage scavenger receptor binds and internalizes the toxic lipid A moiety of LPS. In contrast to CD14, the scavenger receptor does not appear to participate in macrophage activation; rather, it seems to function in the clearance and detoxification of LPS (13). Macrophages also express the ß2 integrins, a family of obligate heterodimers that include LFA-1, CR3, and CR4 (CD11a/CD18, CD11b/CD18, and CD11c/CD18, respectively). These leukocyte-restricted adhesion molecules can bind LPS-coated erythrocytes and Gram-negative bacteria (14). Transfection of CHO-K1 cells with any of the ß2 integrins increased their sensitivity to LPS, implying a role for these receptors in macrophage-mediated responses to endotoxin (15, 16).

Although both CD14 and CD11/CD18 integrins bind LPS and are associated with signaling, evidence suggests that neither of these proteins functions in transducing a signal following LPS binding. CD14 is a GPI-anchored protein lacking a transmembrane and cytoplasmic domain. It is not directly apparent how this protein can function to transmit a signal across the cell membrane. Consistent with the hypothesis that CD14 does not directly function to induce a transmembrane signaling event is the observation that certain cells (e.g., endothelial cells) that do not express CD14 respond to LPS in the presence of sCD14 normally present in blood. To determine whether the cytoplasmic domains of CD11/CD18 were necessary for signaling, mutant constructs of CD11/CD18 devoid of their cytoplasmic tails were expressed in CHO cells. The mutant receptors were capable of enabling LPS responses when expressed in CHO cells, similar to transfected full-length CR3 constructs (16). Thus, like CD14, CD11/CD18 receptors do not require a cytoplasmic motif to enable an LPS signal. Finally, studies of the LPS antagonists deacylated LPS, lipid IVA (also known as lipid Ia, compound 408), and Rhodobacter sphaeroides lipid A have given additional credence to the idea that CD14 does not directly signal cells after binding to LPS. These LPS antagonists appear to inhibit LPS-induced signal transduction through interactions with a cellular element that is distinct from CD14 (17). One hypothesis that is consistent with these observations is that complexes of LPS and CD14 (or CR3) can interact with a putative transmembrane receptor that functions to transmit a signal across the plasma membrane and initiate an intracellular signaling cascade. The identification of this putative signaling component of the LPS receptor remains an important focus of endotoxin research today.

Progress in defining the LPS signal-transduction pathway has been hampered, in part, by difficulties in working with a ligand that cannot be purified to homogeneity. LPS also cannot be radiolabeled to a high specific activity (discussed in 18 . The observation that macrophages express several receptors that bind to LPS complicates the use of myeloid cells in the study of LPS-induced signal transduction using traditional biochemical methods. In addition to the problems of studying LPS signaling by traditional biochemical approaches, the low efficiency with which myeloid cells can be transfected with plasmid DNA (<10-6) precludes the facile application of molecular genetic approaches using monocyte-derived cell lines. One strategy to circumvent these difficulties is to identify an easily transfectable cell line that does not express other LPS receptors and responds to LPS via CD14. Mutant LPS nonresponder cell lines could then be derived from such cells and used to expression clone genes in the LPS signal-transduction pathway. This approach has been used successfully to define critical elements of important signaling pathways such as the IFN-{gamma} (19, 20) and the TGF-ß (21) signal-transducing pathways.

The CHO-K1 fibroblast cell line displays excellent growth characteristics and can be transfected with high efficiency. Established methods for inducing and rescuing mutations in CHO cells have led to the isolation of genes that encode important components of metabolic and signal-transduction pathways (22, 23). Furthermore, stable transfection of CHO cells with a CD14 expression plasmid (CHO/CD14) conferred an LPS-responsive phenotype, as evidenced by the inducible release of arachidonic acid (24), translocation of nuclear factor (NF)-{kappa}B from the cytoplasm to the nucleus (25), and the production of IL-6 (H. Heine, R. L. Delude, T. Espevik, and D. T. Golenbock, manuscript in preparation). These characteristics led us to engineer the LPS-responsive 3E10 reporter cell line, which up-regulates surface expression of the human Tac Ag ({alpha}-chain of the IL-2R; CD25) following exposure to endotoxin. We report in this work the engineering and use of an LPS-responsive reporter cell line, designated clone 3E10, that we have used to isolate LPS signal-transduction mutants. These mutants fall into two distinct complementation groups that fail to express Tac or translocate NF-{kappa}B following exposure to endotoxin. However, these LPS signaling mutants retain responsiveness to murine TNF-{alpha} when assessed for NF-{kappa}B translocation and Tac reporter expression. These LPS signaling mutants should be useful in identifying genes that encode necessary components of the CD14-dependent LPS signaling pathway by employing established expression-cloning techniques.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

Unless otherwise indicated, reagents were obtained from Sigma (St. Louis, MO). PBS and Ham’s F-12 were obtained from BioWhittaker (Walkersville, MD). Heat-inactivated FBS (LPS <10 pg/ml) was obtained from HyClone Laboratories (Logan, UT). Ciprofloxacin, a broad-spectrum antibiotic with activity against standard lab contaminants as well as mycoplasma, was a gift from Miles Pharmaceuticals (West Haven, CT). Protein-free LPS was obtained from Dr. Nilofor Qureshi (William S. Middleton Veterans Hospital, Madison, WI), and was extracted from Salmonella minnesota R595 (ReLPS). Lipids were prepared at 1 mg/ml in PBS and stored at -20°C. Before use, the suspensions were thawed and sonicated in an 80-W sonicator bath (Lab Supply, Hicksville, NY) for 2 min. The IFN-{gamma}-inducible reporter plasmid, pUMS(GT)8-Tac, was obtained from Dr. M. Aguet (26).

Cell lines and culture

CHO cell lines were cultured in Ham’s F-12 containing 10% heat-inactivated FBS and 10 µg/ml of ciprofloxacin in a 5% saturated CO2 atmosphere at 37°C. Staining of cells for flow cytometry was performed as described (6).

Construction of the Tac reporter plasmid

The PCR was used to amplify a fragment of the human E-selectin (ELAM) promoter from -241 to -54 bp relative to the transcription start site. The 5' primer (TAATCGATAATCATGCATTTTTGTCATA) and the 3' primer (CAGAAGCTTATAGGAGGATATTGTCCACAT) were engineered with a ClaI and HindIII restriction site, respectively. A 50-µl amplification reaction containing each primer at 1 µM, 10 µg of human genomic DNA, and 1 U of Taq DNA polymerase (Promega, Madison, WI) was subjected to 30 amplification cycles at 95°C for 1 min, 55°C for 1 min, and 70°C for 1 min. The 205-bp amplification product was digested with ClaI and HindIII, and the fragment was cloned in place of the IFN-{gamma}-inducible element contained within the unique ClaI and HindIII sites in pUMS(GT)8-Tac. The resulting plasmid, pUMS(ELAM)-Tac (Fig. 1GoA), was subjected to dideoxynucleotide sequence analysis to confirm the integrity of the inserted promoter element.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 1. Construction of an LPS-inducible Tac reporter plasmid. A, Plasmid map of pUMS(ELAM)-Tac, which contains the Tac Ag cDNA region downstream of a fragment of the human ELAM gene promoter driving transcription from the rabbit ß-globin gene minimal promoter. B, A schematic diagram showing the location of the NF-{kappa}B and CAAT (NF-IL6) binding sites located within the promoter of the human ELAM gene and the PCR generated fragment that was used to generate pUMS(ELAM)-Tac.

 
Construction of the LPS-responsive 3E10 reporter cell line

We have reported previously that CHO-K1 cells transfected with CD14 responded to LPS by releasing arachidonic acid (24), translocating NF-{kappa}B (25), and releasing IL-6 (H. Heine, R. L. Delude, T. Espevik, and D. T. Golenbock, manuscript in preparation). We reasoned that the translocation of NF-{kappa}B could be used to drive the expression of a transfected reporter gene under the transcriptional control of an NF-{kappa}B-inducible promoter. We obtained a plasmid, pUMS(GT)8-Tac, which contained an upstream viral transcription termination region (UMS), eight repeats of an IFN-{gamma}-binding element (GT), and the minimal promoter of the rabbit ß-globin gene upstream of the Tac cDNA (26). We removed the artificial IFN-{gamma}-responsive element from pUMS(GT)8-Tac and replaced it with a segment of the human endothelial leukocyte adhesion molecule (ELAM) promoter including sequences between -241 and -54 bp relative to the transcription start site, as described above (Fig. 1Go). The resulting vector, pUMS(ELAM)-Tac, contains a cis regulatory element for NF-{kappa}B and a CAAT box that binds the CAAT enhancer-binding protein, NF-IL6 (27).

CHO-K1 cells were cotransfected with 5 µg each of pCEP4 (Invitrogen, San Diego, CA) containing the human CD14 cDNA (pCEP4/CD14) and pUMS(ELAM)-Tac, as described (28), except that Ham’s F-12 complete medium was used in place of {alpha}-MEM. Stable transfectants were selected in Ham’s F-12 complete medium containing hygromycin B at a concentration of 400 U/ml (LC Laboratories, Woburn, MA). Stable transfectants were transferred to two separate 10-cm dishes and allowed to grow to near confluence in the presence of selective drug. The cells in one dish were left untreated, while the cells in the other dish were stimulated with 100 ng of LPS/ml for 16 h. These cells were harvested and stained with a FITC-conjugated anti-Tac mAb or an isotype-matched mAb specific for the human Tac Ag, to define autofluorescence. LPS-stimulated and anti-CD25-stained cells were subjected to one round of positive selection using a Becton Dickinson FACScanPlus in enrichment mode to select cells with high inducible levels of Tac Ag expression. The sorting gate was set to enrich for LPS-stimulated cells that expressed the highest 5% of fluorescence (measured as mean channel fluorescence). An additional gate was defined, using forward scatter and side scatter as the parameters, to avoid the selection of cells whose enhanced immunofluorescence resulted from their larger size (i.e., cells with a large amount of scatter were excluded). The collected cells were plated in two wells of a six-well dish, allowed to achieve near confluence, and subjected to a second round of positive enrichment after LPS stimulation, as described above. To minimize basal expression of Tac, enriched cells were harvested without LPS stimulation and stained with FITC-conjugated anti-Tac mAb. These unstimulated cells were subjected to one round of negative enrichment by FACS by collecting cells whose immunofluorescence was in the lowest 5% with respect to Tac Ag expression. Finally, the cells were expanded and positively sorted after 18 h of LPS stimulation. After allowing these cells to expand in culture, this enriched population was cloned by limiting dilution in 96-well tissue culture dishes at a cell density of 0.3 to 0.5 cells/well. Individual clones were expanded and tested for LPS responsiveness. One CD14-expressing LPS-responsive cell line was chosen to represent wild-type CHO/CD14 and subcloned. In this way, a clonal cell line that expressed low basal levels of surface Tac, and that up-regulated Tac expression following exposure to low concentrations of LPS, was identified. We designated this clone as 3E10.

Mutagenesis and selection

3E10 reporter cells were seeded at a density of 1 x 106 cells per T25 tissue culture flask and allowed to grow overnight. The following day, the growth medium was replaced with 8 ml of Ham’s F-12 complete medium containing methanesulfonic acid ethyl ester (300 µg/ml), a concentration of mutagen that we (and others (22)) have determined to increase the mutational frequency of ouabain resistance from 1:106 to 1:104 in CHO fibroblasts. Following a 20-h incubation at 37°C, the medium was aspirated and the cells were washed once with 8 ml of Ham’s F-12 complete medium. The cells were allowed to recover for 2 days and then passed 1:10 into a T25 flask. After the cells grew to confluence, they were harvested and stored in liquid nitrogen until later use.

The mutagenized cells were thawed rapidly and plated into a 10-cm-diameter dish containing Ham’s F-12 complete medium with hygromycin B and allowed to grow to approximately 80% confluence. Cells were treated with 100 ng/ml of LPS for 18 h. The cells were labeled with anti-Tac mAb, and hyporesponsive cells were selected by FACS. Three rounds of negative sorting (i.e., only the lowest 5% of cells based on mean FL1 fluorescence) were performed to enrich for cells that failed to up-regulate Tac Ag expression in response to LPS. The resulting population was plated using limiting dilution in a 96-well tissue culture dish to obtain clonal mutant cell lines for analysis. The phenotypes of the mutant cell lines described in this work have remained stable over a period of 9 mo of continuous growth in cell culture.

NF-{kappa}B translocation analysis

Nuclear extracts were prepared from 1 x 106 nuclei using slightly hypotonic conditions in a solution containing 0.1% Nonidet P-40, exactly as described (25). A 32P-labeled DNA fragment containing the mouse Ig NF-{kappa}B binding site was mixed with 2 µg/lane of nuclear extracts and fractionated on a native 4% polyacrylamide gel. The gels were dried and used to expose x-ray film at -80°C. All gel-shift experiments shown in this report are representative of experiments performed on two or more occasions.

Northern blot analysis

For Northern blot analysis, cells were plated the day before the experiment at 3 x 106 cells per 10-cm-diameter tissue culture-treated Petri dish. The following day, the cells were stimulated for the indicated times, and RNA was extracted from the cells using TriReagent, exactly as directed by the manufacturer (Medical Research Center, Cincinnati, OH). Total RNA (10 µg) was size fractionated and blotted to nylon membranes, exactly as described (29). A random primed DNA probe was generated using the Tac cDNA as template (30). All experiments were performed on two or more occasions.

LPS-binding assay

LPS-binding assays with boron dipyrromethane (BODIPY)-labeled LPS were performed as described, except that the assay was adapted for whole cell binding. Complexes of BODIPY-LPS (100 ng/ml; gift of Rolf Thieringer, Merck, Rahway, NJ) and sCD14 (2 µg/ml; gift of Henry Lichenstein, Amgen, Thousand Oaks, CA) were preformed at 37°C for 6 h. BODIPY-LPS/sCD14 complexes were then added to cells in the presence or absence of human rLPS-binding protein (200 ng/ml; gift of Henry Lichenstein, Amgen) for 20 min at 37°C. Cells were washed with PBS and analyzed for fluorescence by FACS.

Cell fusions

Each mutant cell line was fused to the ouabain-resistant, but hygromycin-sensitive, CHO-K1a cell line, as described (31). The 7.11 mutant cell line was also fused individually to the 3E10, 7.11, 7.19, 8.18, and 8.20 mutant cell lines, and the 8.20 cell line was fused to 3E10, 7.7, 7.9, 7.13, 7.14, 7.15, 7.23, 7.24, and 8.20 cell lines to perform complementation analysis. Briefly, each clone was remutagenized (300 µg of EMS/ml) at a cell density of 106 cells per 25-cm2 flask, and selected in 0.5 mM ouabain in complete medium. In addition, clonal cell lines were transfected as described above with the neomycin resistance plasmid pcDNA3 (Invitrogen), and selected in 1 µg/ml of G418. The fusion partners (2.5 x 105 cells each) were seeded into wells of a 24-well tissue culture dish and grown overnight. The next day, the medium was replaced with 1 ml of 50% polyethylene glycol (w/v; m.w. 3350) in Ham’s F-12 complete medium. The plates were incubated at room temperature for 1 min, and the polyethylene glycol solution was aspirated. Following five washes with PBS, the cells were allowed to recover overnight in Ham’s F-12 complete medium. The following day, the medium was replaced with Ham’s F-12 complete medium containing 0.5 mM ouabain plus hygromycin B (400 U/ml), or ouabain plus G418 (depending on the antibiotic-resistance profile of each fusion partner) to select for heterokaryons. FACS analysis of heterokaryons was performed on two or more separate occasions, and gel-shift analysis was performed on three separate occasions.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
FACS analysis of the 3E10 reporter cell line

FACS analysis was performed to study the LPS-induced expression of Tac Ag in the 3E10 reporter cell line. The cells were seeded at a density of 0.5 x 106 cells/well in a six-well tissue culture-treated dish and allowed to grow overnight. The following day, LPS was added to some wells at a final concentration of 100 ng/ml and the cells were incubated an additional 18 h. Cells were harvested and stained with FITC-conjugated anti-human CD14 mAb or an isotype-matched FITC-conjugated anti-human CD20 control mAb. Cell fluorescence was determined using flow cytometry. Resting 3E10 reporter cells expressed low levels of surface Tac Ag (Fig. 2Go). Stimulation with LPS up-regulated Tac expression, as measured by mean channel fluorescence by approximately 10-fold compared with nonstimulated control cells. This increase in Tac Ag expression was maximal within 18 h of stimulation and decreased to 50% of that level within 48 h of stimulation (data not shown). Thus, we engineered a fibroblast cell line that reports following stimulation with LPS by up-regulating the expression of cell membrane-associated Tac Ag approximately 10-fold when compared with nonstimulated control cells.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 2. Analysis of Tac protein and mRNA expression in the 3E10 reporter cell line. The 3E10 reporter cell line was either left untreated (PBS) or stimulated with 100 ng/ml of LPS (LPS) for 18 h. The cells were harvested and stained with FITC-conjugated anti-Tac mAb, and surface expression levels of the reporter protein were detected using a flow cytometer. LPS-stimulated cells stained with the isotype-matched FITC-conjugated mAb (ISO) were included to show autofluorescence. The inset shows a Northern blot time-course analysis of the 3E10 reporter cell line stimulated with LPS (100 ng/ml) for the times indicated. The lane labeled "-" contains total RNA prepared from CHO/CD14 cells as a negative control. Steady state levels of Tac mRNA were revealed using a 32P-labeled full-length Tac cDNA as probe.

 
Northern blot analysis of the 3E10 reporter cell line

Northern blot analysis was performed on these cells to confirm that the increase in Tac expression was the result of increased steady state levels of Tac mRNA in cells exposed to LPS. 3E10 reporter cells were seeded at a density of 3 x 106 cells per 10-cm-diameter tissue culture-treated Petri dish and allowed to grow overnight. The following day, the cells were treated with LPS (100 ng/ml) for increasing amounts of time, and total cellular RNA was prepared. Total RNA was size fractionated in an agarose gel containing formaldehyde, then blotted to a nylon membrane and probed using a Tac-specific DNA probe. Resting 3E10 cells expressed very low basal levels of Tac mRNA (inset, Fig. 2Go, lane 1). Reporter cells treated with LPS for 30 min expressed increased levels of steady state Tac mRNA, and these levels continued to increase until 2 h following LPS exposure (inset, Fig. 2Go, lane 5). Within 4 h of stimulation, the steady state levels of Tac mRNA had decreased significantly. These results were consistent with the rapid increase and postinduction decrease in NF-{kappa}B DNA-binding activity in CHO/CD14 cells (25). Total RNA isolated from resting CD14-transfected CHO-K1 (CHO/CD14) cells were included in the Northern blot analysis as a negative control and were devoid of bands hybridizing to the Tac cDNA probe (inset, Fig. 2Go, lane 7). A control blot was probed for ß-actin mRNA expression, and the steady state levels of ß-actin remained constant throughout the experiment (data not shown). Thus, the increase in Tac Ag expression observed in the 3E10 reporter cell line was due, at least in part, to increased steady state levels of the Tac Ag mRNA.

Isolation of 3E10 reporter cell mutants that fail to express Tac in response to LPS

CHO cells appear to be functionally hemizygous (22) for most genetic loci, thus facilitating the identification of mutant cell lines from reasonably small starting numbers of cells after a single round of mutagenesis. Exposure of wild-type CHO-K1 cells to methanesulfonate ethyl ester (300 µg/ml) results in a mutation frequency of approximately 1:10-4 based on the rate at which cells become resistant to ouabain (22). We used these conditions to mutagenize eight dishes of 3E10 reporter cells, as described in Materials and Methods; two of these mutagenized pools (pools 7 and 8) were used to generate LPS response mutants independently, to minimize the enrichment of sibling cells. We exposed mutagenized 3E10 reporter cells to LPS and subjected them to three successive rounds of negative enrichment using a FACS. The sort gate was set to enrich for cells that expressed extremely low to undetectable levels of Tac Ag on their surface (cells with the lowest 5% of mean channel fluorescence). Cells were simultaneously gated for forward and side scatter within the 5th through 95th percentile, to avoid choosing cells that had less surface immunofluorescence because they were smaller than the wild-type cell line. Following the final round of negative enrichment, the cells were cloned by limiting dilution into 96-well dishes. Individual clones were stimulated with LPS and labeled with phycoerythrin-conjugated anti-CD14 and FITC-conjugated anti-Tac mAb. Flow-cytometric analysis revealed that all of the clones expressed CD14 (data not shown). A total of 25 clones of 30 clones screened from pool 7 did not up-regulate Tac Ag in response to LPS. Similarly, 5 of 6 clones from pool 8 had no response to LPS.

We randomly selected a total of 11 clonal cell lines (clones 7.7, 7.9, 7.11, 7.13, 7.14, 7.15, 7.19, 7.23, 7.24, 8.18, and 8.20), representing both independently mutagenized pools of 3E10 reporter cells, for additional analysis. All of these mutant cell lines failed to up-regulate Tac expression following exposure to LPS. Four of the lines are shown in Figure 3Go. Furthermore, stimulation of the mutants with murine TNF-{alpha} up-regulated Tac reporter expression normally compared with the parental 3E10 reporter line (Fig. 3Go). These results indicated that the integrity of the Tac reporter gene remained intact. Therefore, these mutants appear to result from lesions in genes that encode important components of the LPS signaling pathway.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 3. FACS analysis of the LPS signaling mutants exposed to either LPS or TNF-{alpha}. The parental 3E10 reporter line or the LPS signaling mutants were plated in triplicate wells of a six-well tissue culture-treated dish in Ham’s F-12 complete medium at a density of 1 x 106 cells/well and grown overnight. The next day, one well was exposed to PBS (PBS), one well was stimulated with LPS at 100 ng/ml (LPS), and the remaining well was exposed to murine TNF-{alpha} at 10 ng/ml (TNF). The plates were incubated for an additional 18 h, then the cells were harvested with 1 mM EDTA in PBS and stained with FITC-conjugated anti-Tac mAb. The y-axis represents cell number, and the x-axis represents the relative cell fluorescence representing Ag expression levels.

 
3E10 reporter mutant cell lines translocate NF-{kappa}B following exposure to TNF-{alpha}, but not LPS

Treatment of CHO/CD14 cells with LPS results in the rapid mobilization of NF-{kappa}B from the cytoplasm to the nucleus (25). The increase in nuclear NF-{kappa}B is evident within 5 min following exposure to LPS and is maximal within 30 min of stimulation. Thus, activation of NF-{kappa}B represents an early event in the signaling cascade initiated by LPS. We used the electrophoretic mobility shift assay (EMSA) to determine whether the reporter mutants could translocate NF-{kappa}B in response to LPS. We previously reported that CHO-K1 fibroblasts translocated NF-{kappa}B to the nuclear compartment following exposure to murine TNF-{alpha} (32). Therefore, the mutant cell lines were also stimulated with murine TNF-{alpha}. The 3E10 reporter cell line translocated NF-{kappa}B to the nucleus following exposure to either LPS (100 ng/ml) or TNF-{alpha} (10 ng/ml; Fig. 4Go). However, each of the 3E10 mutant cell lines failed to mobilize NF-{kappa}B in response to LPS. It should be noted that mutants 8.18 and 8.20 show a subtle, almost undetectable increase in nuclear levels of NF-{kappa}B following exposure to LPS. The response is minimal, and may be due to the production of a partially functional mutant protein in the LPS signal-transduction pathway, or may be due to variability in background. In contrast to the response to exogenous LPS, all of the mutant lines respond normally to murine TNF-{alpha}, as evidenced by translocation of NF-{kappa}B to the nucleus. These data infer that the genetic lesions in these mutant cell lines are not the result of generalized effects on NF-{kappa}B activation. The observation that the mutant cell lines respond normally to TNF-{alpha} strengthens our previous conclusion that the affected genes in the LPS nonresponsive mutant cell lines are specific for the LPS signal-transduction pathway.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 4. Analysis of NF-{kappa}B translocation in the LPS signaling mutants exposed to either LPS or TNF-{alpha}. The parental 3E10 reporter line or four randomly chosen LPS signaling mutants were plated at 5 x 105 cells/well in tissue culture dishes, as described in Figure 3Go. The next day, one well was exposed to PBS (P), one well was stimulated with LPS at 100 ng/ml (L), and the remaining well was exposed to murine TNF-{alpha} at 10 ng/ml (T). After 45 min of stimulation, nuclear levels of NF-{kappa}B were assessed by EMSA. NE, no extract.

 
LPS signaling mutant 8.20 binds LPS in an LBP-dependent manner

LPS-binding protein (LBP) is a plasma protein that has been shown to accelerate the binding of LPS monomers from LPS aggregates to CD14, thus enhancing the sensitivity of cells to LPS. One possible explanation for the inability of the mutant cell lines to respond to LPS was that they were unable to interact with LPS and LPS/LBP complexes. Therefore, we analyzed one mutant, 8.20, for its ability to bind LPS in a fluorescent assay, using BODIPY-labeled LPS. As BODIPY-labeled LPS monomers exit from their aggregated state and bind to CD14, an increased fluorescent signal can be observed. As shown in Figure 5Go, both the parental 3E10 line and the mutant 8.20 were capable of binding LPS equally in an LBP-dependent manner.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 5. Analysis of LPS binding to signaling mutant. The parental 3E10 reporter line or the LPS signaling mutant 8.20 was incubated with BODIPY-LPS/sCD14 complexes in the presence or absence of LBP, and assayed for bound LPS by FACS. Mock-transfected neomycin-resistant CHO-K1 (CHO/Neo) cells do not express CD14, and were included as a control.

 
Fusing mutant 3E10 reporter cells to CHO cells restores the LPS-responsive phenotype

Fusion of mutant and wild-type cells can be used to determine whether the genetic lesions arise through dominant negative mutations or recessive loss-of-function mutations. The generation of such hybrid cells can be used also to determine whether the CD14 present in the mutant cell lines is biologically active, or has been mutated to a nonfunctional receptor, as the only cell line capable of providing CD14 to the resultant heterokaryons is the LPS-response mutant. A hygromycin-sensitive, ouabain-resistant cell line was chosen for hybrid analysis. This line, CHO-K1a, does not express CD14; furthermore, wild-type (nontransfected) CHO cells do not respond to LPS (24, 25). CHO-K1a cells do not contain the pUMS(ELAM)-Tac expression vector. This cell line was fused to each of the individual mutant 3E10 reporter cell lines, and stable fusions were selected by growth in medium containing ouabain and hygromycin B. As a control, we fused a reporter cell line that had undergone mutagenesis and negative selection by FACS, yet retained an LPS-responsive phenotype (clone 7.5). Stimulation of the mutant/CHO-K1a fusion lines resulted in an increase in the surface expression of the Tac Ag following LPS exposure (Fig. 6Go). This increase in Tac expression was identical when compared with the increase in Tac expression observed with the control 7.5 cell line. Therefore, the mutations that were isolated using the 3E10 reporter act in a recessive fashion.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 6. FACS analysis of the LPS signaling mutants fused to the CHO-K1a cell line. The parental 3E10 reporter line or the LPS signaling mutants fused to the CHO-K1a cell line were plated in duplicate wells of a six-well tissue culture-treated dish at 5 x 105 cells/well in Ham’s F-12 complete medium and grown overnight. The next day, 10 µl of PBS was added to one well (PBS), and the remaining well was exposed to an equal volume of LPS, to achieve a final concentration of 100 ng/ml (LPS). The plates were incubated for an additional 18 h at 37°C, and the cells were harvested and stained with anti-Tac mAb. The dotted line (... ) shows the fluorescence of LPS-stimulated cells stained with an isotype-matched FITC-conjugated mAb. The y-axis represents cell number, and the x-axis represents the relative cell fluorescence representing Ag expression levels. The fused mutant cell lines were given a designation of F#, in which the F represents cell fusion and the # represents the name of the parental mutant line; e.g., F7.11 was produced by fusing the 7.11 mutant to the CHO-K1a cell line. Note that clone 7.5 is a control cell line derived from a population of cells that had undergone mutagenesis and negative selection by FACS and yet retained an LPS-responsive phenotype.

 
The ability to translocate NF-{kappa}B following exposure to LPS was assessed using EMSA. While CHO-K1a cells and the mutant cell lines failed to translocate NF-{kappa}B in response to LPS, fusion of the two cell lines produced heterokaryons that translocated NF-{kappa}B from the cytoplasm to the nucleus after exposure to endotoxin (Fig. 7Go). This provides further evidence to support our conclusion that the mutations in the LPS reporter cell were most likely due to loss-of-function (i.e., recessive) mutations. The observation that the genetic lesions can be complemented using the wild-type copy of the mutated gene suggests that an expression-cloning strategy is feasible for the rescue of mutants and concomitant identification of the mutated genes.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 7. Analysis of NF-{kappa}B translocation in the LPS signaling mutants fused to CHO-K1a cells. The parental 3E10 reporter line or the LPS signaling mutants fused to the CHO-K1a cell line were plated at 5 x 105 cells/well. The next day, one well was treated with PBS alone (P) and the remaining well was exposed to LPS at 100 ng/ml (L). The plates were incubated for an additional 45 min., and then the cells were harvested. Nuclear extracts were prepared, and nuclear levels of NF-{kappa}B were determined using the EMSA. NE, no extract.

 
Complementation analysis of the Tac reporter mutants reveals that they represent a two-complementation group

To determine whether each of the mutant lines was defective in a unique gene, complementation analysis was performed. Eleven of the thirty LPS signaling mutant cell lines and the parental 3E10 reporter cell line were tested. This analysis revealed that these mutants constitute at least two distinct complementation groups. The larger majority of the mutant cell lines fell into a single complementation group, which we called group A; mutants 7.7 and 7.15 constituted the B complementation group.

The results of experiments using select members of each complementation group are presented in Figures 8Go and 9. We selected the entire group of B mutants and selected clones 7.11 and 8.20 as representatives of the A mutants. To perform these experiments, clonal 3E10, 7.11, 7.15, and 8.20 cell lines were transfected with pcDNA3, which conferred resistance to G418. In addition, the 7.7 and 8.20 cell lines were remutagenized with methanesulfonic acid ethyl ester (300 µg/ml), and ouabain-resistant lines were selected in medium containing 0.5 mM of ouabain.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 8. Complementation analysis of the mutant cell lines using FACS analysis. Either ouabain- or neomycin-resistant derivatives (see text) of the parental 3E10 reporter line or each of the LPS signaling mutants were fused to each other and then plated in duplicate wells of a six-well tissue culture-treated dish at 5 x 105 cells/well. The next day, 10 µl of PBS was added to one well (PBS) and the remaining well was exposed to an equal volume of LPS (LPS; final concentration of 100 ng/ml). The plates were incubated for an additional 18 h, harvested, and then stained with anti-Tac mAb (CD25) for flow-cytometric analysis.

 
Figure 8Go shows the results of FACS analysis performed on the various fusion partners, which were selected in G418 and ouabain after polyethylene glycol fusion. As expected, fusion of the parental cell line 3E10 to either mutant 8.20 or 7.7 cell lines produced heterokaryons that responded to LPS and up-regulated Tac Ag expression. Fusion of mutants 8.20 to 7.11 or mutants 7.15 to 7.7 failed to complement the mutations, demonstrating that these cell lines shared genetic lesions. In contrast, the fusion of mutant 8.20 to either mutant 7.7 or 7.15 did restore the LPS-responsive phenotype, demonstrating that 8.20 is lesioned in a gene that is normally expressed in 7.7 and 7.15. The fusion partners were also analyzed for LPS-induced nuclear localization of NF-{kappa}B, and the results of this analysis are presented in Figure 9Go. These results were qualitatively identical to those demonstrated by flow cytometry in the previous figure.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 9. Complementation analysis of the mutant cell lines using EMSA. Either ouabain- or neomycin-resistant derivatives (see text) of the parental 3E10 reporter line or each of the LPS signaling mutants were fused to each other and plated at 5 x 105 cells/well. The next day, one well was treated with PBS alone (P) and the remaining well was exposed to LPS at 100 ng/ml (L). The cells were incubated for an additional 18 h and harvested. Nuclear extracts were prepared and analyzed for the presence of NF-{kappa}B by EMSA. NE, no extract.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In summary, a useful fibroblast cell line was engineered for use in studying the LPS signaling pathway. Furthermore, this LPS reporter cell line was used to identify several LPS signal-transduction mutant cell lines that constitute at least two distinct complementation groups. These signaling mutations are specific for the LPS signaling pathway, because the mutant cell lines remain responsive to murine TNF-{alpha}.

The identification of proteins involved in LPS-induced signal transduction immediately downstream from CD14 is a central question in our understanding of the signaling cascade. Any hypothesis suggesting that LPS and TNF-{alpha} share signaling components is not supported by the data presented in this study. Mutant 3E10 reporter cell lines that failed to respond to LPS responded normally to mouse TNF-{alpha} (Fig. 3Go), a finding that suggests that at least some of the most proximal portions of the TNF-{alpha} and LPS signaling cascades are unique to each pathway.

While CD14 clearly initiates the process of LPS-induced cellular activation, a mechanistic description of the molecular events that occur subsequent to LPS binding to CD14 remains elusive. CD14 is a GPI-linked protein with no known signaling motifs. Thus, it does not seem likely that CD14 actually effects a transmembrane signaling event. Strong evidence supports a model in which complexes of CD14 and LPS signal cells through interactions with a distinct signal-transducing molecule(s). This derives from studies performed with lipid A analogues, which antagonize the effects of LPS when tested with human cells. Kitchens et al. (17, 33) observed a discrepancy between the concentration of the LPS antagonist lipid IVA needed to inhibit binding of LPS to CD14 (µM-mM range) and the concentration of lipid IVA needed to antagonize LPS-induced signaling (nM-µM range). Thus, LPS inhibitors suppressed signaling at concentrations that were too low to prevent LPS binding to CD14. Previous observations had indicated that several of the LPS analogues that acted as LPS antagonists in human cells had LPS-mimetic activity in cells from mice (34). Human and rodent cell lines that expressed human- or mouse-derived CD14 were engineered. The species-specific effect did not correlate with the species of CD14 expressed in cells, but was dependent on the genetic background of the transfected cell line (32). We hypothesized that CD14-bound LPS causes a signal-transduction event by interacting with a second signaling receptor, which also functions to discriminate between structural differences present in the lipid A moieties of the various LPS antagonists. This putative signal transducer was proposed as the target of LPS antagonists.

The role of sCD14 in the activation of endothelial cells initially suggested that a CD14/LPS complex might form a ternary complex with an as yet unidentified signal-transducing molecule with transmembrane and cytoplasmic signaling domains (10, 11, 35). Sophisticated biochemical approaches to identify such a molecule have not been productive, although the failure of such studies does not eliminate the possibility that such a transmembrane signal transducer exists. Wright and colleagues have recently presented evidence suggesting that CD14 is a lipid transfer protein, and that cell signaling depends upon the movement of CD14 into cells. These authors have observed a lesion in LPS import in cells obtained from C3H/HeJ LPS nonresponder mice. While C3H/HeJ mice express CD14, and bind LPS normally, they fail to internalize LPS presented to cells as sCD14/LPS complexes (36). Thus, Wright has suggested that the first step in CD14-mediated signaling is the movement of LPS into the lipid bilayer of cells. Detmers et al. (37) have suggested that a trypsin-sensitive surface protein aids in the movement of LPS from CD14 into the cell and subsequent LPS-induced signaling. Trypsin treatment of cells had no effect on CD14 expression, but abolished both LPS internalization and LPS-induced activation of adhesion molecules. However, a question that has not been directly addressed using this approach is whether LPS internalization is actually necessary for LPS signaling or if LPS signaling is necessary for rapid internalization of the ligand. The inability of C3H/HeJ cells to respond to LPS may be the cause of reduced LPS uptake. It is likely that the identification and cloning of any surface molecule involved in LPS uptake and signaling will shed great light upon the question of LPS uptake and its relationship to signal transduction. Progress in the understanding of CD14-mediated signaling should be greatly facilitated following the identification of the next signaling molecule downstream of CD14 in the LPS signaling cascade.

The identification and analysis of cell mutants have proven to be an alternative and effective means to binding studies for identifying components of biochemical and signal-transduction pathways. Mutants in a defined pathway have been used to identify genes that can revert the mutant phenotype. Excellent examples of the successful application of this strategy include the characterization of the TGF-ß receptor in mutants derived from mink lung epithelium (21), the identification of JAK/STAT pathway components required for IFN-{gamma}-induced signaling in HT1080 fibrosarcoma cells (19, 20), and the expression cloning of peroxisomal assembly factor-2 gene in mutant peroxisome-deficient CHO cells (23).

The use of mutational analysis to study the LPS signaling pathway has been attempted by several investigators, but was apparently thwarted by the low transfection frequencies of the cell lines from which the mutants were derived. Mains and Sibley (38) derived NF-{kappa}B signaling mutants in the 70Z/3 pro-B cell line that failed to respond to LPS, but were responsive to IFN-{gamma}. Although the approach was straightforward, later attempts to clone the signaling lesions in these mutant cell lines were not feasible because of a transfection frequency of approximately 1:106. The initial description of a 55-kDa protein necessary for LPS responses, which later proved (via nongenetic approaches) to be CD14, was made by Hara-Kuge and colleagues, who identified mutant J774.1 cells that neither growth arrested in response to LPS nor bound 125I-labeled LPS (39). Like Mains and Sibley, these investigators failed to rescue the lesion in the mutant cell line by expression cloning probably because of the low transfection efficiency of monocyte/macrophage-derived cell lines. Thus, while the mutant analysis of LPS nonresponder B lymphocyte- and macrophage-derived lines is interesting and informative, they are also excellent examples of the problems inherent in performing genetic studies with such cell lines. In contrast, the genetic analysis of CHO-derived mutant cell lines should be significantly easier because the transfection efficiency of CHO cells is approximately 10-2.

It is our hope that the analysis of these mutants, as well as additional mutant lines that we have not yet characterized, will soon constitute a number of complementation groups defining genes that encode necessary components of the LPS signal-transduction cascade. The identification of mutant lines from additional pools of mutagenized stock will also be necessary, because of the tendency to identify siblings using this technique. Ultimately, the goal is to clone genes necessary for LPS responses, including additional signaling components of the LPS receptor. The identification of such genes should facilitate the rationale design of drugs to reduce the morbidity and mortality associated with endotoxin-caused disease.


    Footnotes
 
1 This was supported by National Institutes of Health Grant R01-GM54060 (to D.T.G.). R.L.D. was supported by a fellowship grant from the Eisai Research Institute (Andover, MA). Back

2 Current address: Beth Israel Deaconess Medical Center, Department of Surgery, 330 Brookline Avenue, Boston, MA 02215. E-mail address: Back

3 Address correspondence and reprint requests to Dr. Douglas Golenbock, Maxwell Finland Laboratory for Infectious Diseases, 774 Albany Street, Boston, MA 02118. E-mail address: Back

4 Abbreviations used in this paper: GPI, glycosylphosphatidylinositol; BODIPY, boron dipyrromethane; CHO, Chinese hamster ovary; EMSA, electrophoretic mobility shift assay; LBP, lipopolysaccharide-binding protein; NF-{kappa}B, nuclear factor-{kappa}B; sCD14, soluble fragment of CD14. Back

Received for publication January 9, 1998. Accepted for publication May 8, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rietschel, E. T., H. Brade. 1992. Bacterial endotoxins. Sci. Am. 267:26.
  2. Bone, R. C.. 1991. The pathogenesis of sepsis. Ann. Intern. Med. 115:457.
  3. Haziot, A., S. Chen, E. Ferrero, M. G. Low, R. Silber, S. M. Goyert. 1988. The monocyte differentiation antigen, CD14, is anchored to the cell membrane by a phosphatidylinositol linkage. J. Immunol. 141:547.[Abstract]
  4. Wright, S. D., R. A. Ramos, P. S. Tobias, R. J. Ulevitch, J. C. Mathison. 1990. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS-binding protein. Science 249:1431.[Abstract/Free Full Text]
  5. Wright, S. D., R. A. Ramos, A. H. Hermanowski-Vosatka, P. Rockwell, P. A. Detmers. 1991. Activation of the adhesive capacity of CR3 on neutrophils by endotoxin: dependence on lipopolysaccharide binding protein and CD14. J. Exp. Med. 173:1281.[Abstract/Free Full Text]
  6. Lynn, W. A., C. R. Raetz, N. Qureshi, D. T. Golenbock. 1991. Lipopolysaccharide-induced stimulation of CD11b/CD18 expression on neutrophils: evidence of specific receptor-based response and inhibition by lipid A-based antagonists. J. Immunol. 147:3072.[Abstract]
  7. Kirkland, T. N., F. Finley, D. Leturcq, A. Moriarty, J. D. Lee, R. J. Ulevitch, P. S. Tobias. 1993. Analysis of lipopolysaccharide binding by CD14. J. Biol. Chem. 268:24818.[Abstract/Free Full Text]
  8. Bazil, V., J. L. Strominger. 1991. Shedding as a mechanism of down-modulation of CD14 on stimulated human monocytes. J. Immunol. 147:1567.[Abstract]
  9. Pugin, J., M. C. Schurer, D. Leturcq, A. Moriarty, R. J. Ulevitch, P. S. Tobias. 1993. Lipopolysaccharide activation of human endothelial and epithelial cells is mediated by lipopolysaccharide-binding protein and soluble CD14. Proc. Natl. Acad. Sci. USA 90:2744.[Abstract/Free Full Text]
  10. Arditi, M., J. Zhou, R. Dorio, G. W. Rong, S. M. Goyert, K. S. Kim. 1993. Endotoxin-mediated endothelial cell injury and activation: role of soluble CD14. Infect. Immun. 61:3149.[Abstract/Free Full Text]
  11. Frey, E. A., D. S. Miller, T. G. Jahr, A. Sundan, V. Bazil, T. Espevik, B. B. Finlay, S. D. Wright. 1992. Soluble CD14 participates in the response of cells to lipopolysaccharide. J. Exp. Med. 176:1665.[Abstract/Free Full Text]
  12. Haziot, A., E. Ferrero, F. Kontgen, N. Hijiya, S. Yamamoto, J. Silver, C. L. Stewart, S. M. Goyert. 1996. Resistance to endotoxin shock and reduced dissemination of Gram-negative bacteria in CD14-deficient mice. Immunity 4:407.[Medline]
  13. Hampton, R. Y., D. T. Golenbock, M. Penman, M. Krieger, C. R. Raetz. 1991. Recognition and plasma clearance of endotoxin by scavenger receptors. Nature 352:342.[Medline]
  14. Wright, S. D., M. T. C. Jong. 1986. Adhesion-promoting receptors on human macrophages recognize Escherichia coli by binding to lipopolysaccharide. J. Exp. Med. 164:1876.[Abstract/Free Full Text]
  15. Ingalls, R. R., D. T. Golenbock. 1995. CD11c/CD18, a transmembrane signaling receptor for lipopolysaccharide. J. Exp. Med. 181:1473.[Abstract/Free Full Text]
  16. Ingalls, R. R., M. A. Arnaout, D. T. Golenbock. 1997. Outside-in signaling by lipopolysaccharide through a tailless integrin. J. Immunol. 159:433.[Abstract]
  17. Kitchens, R. L., R. S. Munford. 1995. Enzymatically deacylated lipopolysaccharide (LPS) can antagonize LPS at multiple sites in the LPS recognition pathway. J. Biol. Chem. 270:9904.[Abstract/Free Full Text]
  18. Hampton, R. Y., D. T. Golenbock, C. R. H. Raetz. 1988. Lipid A binding sites in membranes of macrophage tumor cells. J. Biol. Chem. 263:14802.[Abstract/Free Full Text]
  19. Watling, D., D. Guschin, M. Muller, O. Silvennoinen, B. A. Witthuhn, F. W. Quelle, N. C. Rogers, C. Schindler, G. R. Stark, J. N. Ihle, I. M. Kerr. 1993. Complementation by the protein tyrosine kinase JAK2 of a mutant cell line defective in the interferon-{gamma} signal transduction pathway. Nature 366:166.[Medline]
  20. Pellegrini, S., J. John, M. Shearer, I. M. Kerr, G. R. Stark. 1989. Use of a selectable marker regulated by {alpha} interferon to obtain mutations in the signaling pathway. Mol. Cell. Biol. 9:4605.[Abstract/Free Full Text]
  21. Carcamo, J., A. Zentella, J. Massague. 1995. Disruption of transforming growth factor ß signaling by a mutation that prevents transphosphorylation within the receptor complex. Mol. Cell. Biol. 15:1573.[Abstract]
  22. Zoeller, R. A., C. R. Raetz. 1992. Strategies for isolating somatic cell mutants defective in lipid biosynthesis. Methods Enzymol. 209:34.[Medline]
  23. Tsukamoto, T., S. Miura, Y. Fujiki. 1991. Restoration by a 35K membrane protein of peroxisome assembly in a peroxisome-deficient mammalian cell mutant. Nature 350:77.[Medline]
  24. Golenbock, D., Y. Liu, F. Millham, M. Freeman, R. Zoeller. 1993. Surface expression of human CD14 in Chinese hamster ovary fibroblasts imparts macrophage-like responsiveness to bacterial endotoxin. J. Biol. Chem. 268:22055.[Abstract/Free Full Text]
  25. Delude, R., M. Fenton, R. Savedra, P.-Y. Perera, S. Vogel, D. Golenbock. 1994. CD14-mediated translocation of NF-{kappa}B induced by LPS does not require tyrosine kinase activity. J. Biol. Chem. 269:22252.
  26. Hemmi, S., R. Bohni, G. Stark, F. Di Marco, M. Aguet. 1994. A novel member of the interferon receptor family complements functionality of the murine interferon {gamma} receptor in human cells. Cell 76:803.[Medline]
  27. Collins, T., A. Williams, G. I. Johnston, J. Kim, R. Eddy, T. Shows, Jr M. A. Gimbrone, M. P. Bevilacqua. 1991. Structure and chromosomal location of the gene for endothelial-leukocyte adhesion molecule 1. J. Biol. Chem. 266:2466.[Abstract/Free Full Text]
  28. Chen, C., H. Okayama. 1987. High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7:2745.[Abstract/Free Full Text]
  29. Lynn, W. A., Y. Liu, D. T. Golenbock. 1992. Neither CD14 nor serum LPS-binding proteins are absolutely necessary for the activation of mononuclear phagocytes by bacterial lipopolysaccharide. Infect. Immun. 61:4452.[Abstract/Free Full Text]
  30. Jr Savedra, R., R. L. Delude, R. R. Ingalls, M. J. Fenton, D. T. Golenbock. 1996. Mycobacterial lipoarabinomannan recognition requires a receptor that shares components of the endotoxin signaling system. J. Immunol. 157:2549.[Abstract]
  31. Nagan, N., A. K. Hajra, A. K. Das, H. W. Moser, A. Moser, P. Lazarow, P. E. Purdue, R. A. Zoeller. 1997. A fibroblast cell line defective in alkyl-dihydroxyacetone phosphate synthase: a novel defect in plasmalogen biosynthesis. Proc. Natl. Acad. Sci. USA 94:4475.[Abstract/Free Full Text]
  32. Delude, R., R. Savedra, H. Zhao, R. Thieringer, S. Yamamoto, M. Fenton, D. Golenbock. 1995. CD14 enhances cellular responses to endotoxin without imparting ligand-specific recognition. Proc. Natl. Acad. Sci, USA 92:9288.[Abstract/Free Full Text]
  33. Kitchens, R. L., R. J. Ulevitch, R. S. Munford. 1992. Lipopolysaccharide (LPS) partial structures inhibit responses to LPS in a human macrophage cell line without inhibiting LPS uptake by a CD14-mediated pathway. J. Exp. Med. 176:485.[Abstract/Free Full Text]
  34. Golenbock, D. T., R. Y. Hampton, N. Qureshi, K. Takayama, C. R. H. Raetz. 1991. Lipid A-like molecules that antagonize the effects of endotoxins on human monocytes. J. Biol. Chem. 266:19490.[Abstract/Free Full Text]
  35. Pugin, J., R. J. Ulevitch, P. S. Tobias. 1995. Activation of endothelial cells by endotoxin: direct versus indirect pathways and the role of CD14. Prog. Clin. Biol. Res. 392:369.[Medline]
  36. Thieblemont, N., S. D. Wright. 1997. Mice genetically hyporesponsive to lipopolysaccharide (LPS) exhibit a defect in endocytic uptake of LPS and ceramide. J. Exp. Med. 185:2095.[Abstract/Free Full Text]
  37. Vasselon, T., R. Pironkova, P. A. Detmers. 1997. Sensitive responses of leukocytes to lipopolysaccharide require a protein distinct from CD14 at the cell surface. J. Immunol. 159:4498.[Abstract]
  38. Mains, P. E., C. H. Sibley. 1983. LPS-nonresponsive variants of mouse B cell lymphoma, 70Z/3: isolation and characterization. Somatic Cell Genet. 9:699.[Medline]
  39. Hara-Kuge, S., F. Amano, M. Nishijima, Y. Akamatsu. 1990. Isolation of a lipopolysaccharide (LPS)-resistant mutant, with defective LPS binding, of cultured macrophage-like cells. J. Biol. Chem. 265:6606.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
K. Haruyama, A. Yoshimura, M. Naito, M. Kishimoto, M. Shoji, Y. Abiko, Y. Hara, and K. Nakayama
Identification of a Gingipain-Sensitive Surface Ligand of Porphyromonas gingivalis That Induces Toll-Like Receptor 2- and 4-Independent NF-{kappa}B Activation in CHO Cells
Infect. Immun., October 1, 2009; 77(10): 4414 - 4420.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Debierre-Grockiego, M. A. Campos, N. Azzouz, J. Schmidt, U. Bieker, M. G. Resende, D. S. Mansur, R. Weingart, R. R. Schmidt, D. T. Golenbock, et al.
Activation of TLR2 and TLR4 by Glycosylphosphatidylinositols Derived from Toxoplasma gondii
J. Immunol., July 15, 2007; 179(2): 1129 - 1137.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Viriyakosol, P. S. Tobias, and T. N. Kirkland
Mutational Analysis of Membrane and Soluble Forms of Human MD-2
J. Biol. Chem., April 28, 2006; 281(17): 11955 - 11964.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. E. Thomas, A. Sapone, A. Fasano, and S. N. Vogel
Gliadin Stimulation of Murine Macrophage Inflammatory Gene Expression and Intestinal Permeability Are MyD88-Dependent: Role of the Innate Immune Response in Celiac Disease
J. Immunol., February 15, 2006; 176(4): 2512 - 2521.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. R. Coats, T.-T. T. Pham, B. W. Bainbridge, R. A. Reife, and R. P. Darveau
MD-2 Mediates the Ability of Tetra-Acylated and Penta-Acylated Lipopolysaccharides to Antagonize Escherichia coli Lipopolysaccharide at the TLR4 Signaling Complex
J. Immunol., October 1, 2005; 175(7): 4490 - 4498.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
X. Yang, D. Coriolan, V. Murthy, K. Schultz, D. T. Golenbock, and D. Beasley
Proinflammatory phenotype of vascular smooth muscle cells: role of efficient Toll-like receptor 4 signaling
Am J Physiol Heart Circ Physiol, September 1, 2005; 289(3): H1069 - H1076.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. S. Mansur, E. G. Kroon, M. L. Nogueira, R. M.E. Arantes, S. C.O. Rodrigues, S. Akira, R. T. Gazzinelli, and M. A. Campos
Lethal Encephalitis in Myeloid Differentiation Factor 88-Deficient Mice Infected with Herpes Simplex Virus 1
Am. J. Pathol., May 1, 2005; 166(5): 1419 - 1426.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. S. Zamboni, M. A. Campos, A. C. T. Torrecilhas, K. Kiss, J. E. Samuel, D. T. Golenbock, F. N. Lauw, C. R. Roy, I. C. Almeida, and R. T. Gazzinelli
Stimulation of Toll-like Receptor 2 by Coxiella burnetii Is Required for Macrophage Production of Pro-inflammatory Cytokines and Resistance to Infection
J. Biol. Chem., December 24, 2004; 279(52): 54405 - 54415.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Y. Wu, S. Adam, L. Hamann, H. Heine, A. J. Ulmer, U. Buwitt-Beckmann, and C. Stamme
Accumulation of Inhibitory {kappa}B-{alpha} as a Mechanism Contributing to the Anti-Inflammatory Effects of Surfactant Protein-A
Am. J. Respir. Cell Mol. Biol., December 1, 2004; 31(6): 587 - 594.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A.-C. Oliveira, J. R. Peixoto, L. B. de Arruda, M. A. Campos, R. T. Gazzinelli, D. T. Golenbock, S. Akira, J. O. Previato, L. Mendonca-Previato, A. Nobrega, et al.
Expression of Functional TLR4 Confers Proinflammatory Responsiveness to Trypanosoma cruzi Glycoinositolphospholipids and Higher Resistance to Infection with T. cruzi
J. Immunol., November 1, 2004; 173(9): 5688 - 5696.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Nilsen, U. Nonstad, N. Khan, C. F. Knetter, S. Akira, A. Sundan, T. Espevik, and E. Lien
Lipopolysaccharide and Double-stranded RNA Up-regulate Toll-like Receptor 2 Independently of Myeloid Differentiation Factor 88
J. Biol. Chem., September 17, 2004; 279(38): 39727 - 39735.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Triantafilou, S. Morath, A. Mackie, T. Hartung, and K. Triantafilou
Lateral diffusion of Toll-like receptors reveals that they are transiently confined within lipid rafts on the plasma membrane
J. Cell Sci., September 1, 2004; 117(17): 4007 - 4014.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. A. Darrah, M. C. G. Monaco, S. Jain, M. K. Hondalus, D. T. Golenbock, and D. M. Mosser
Innate Immune Responses to Rhodococcus equi
J. Immunol., August 1, 2004; 173(3): 1914 - 1924.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Hasebe, A. Yoshimura, T. Into, H. Kataoka, S. Tanaka, S. Arakawa, H. Ishikura, D. T. Golenbock, T. Sugaya, N. Tsuchida, et al.
Biological Activities of Bacteroides forsythus Lipoproteins and Their Possible Pathological Roles in Periodontal Disease
Infect. Immun., March 1, 2004; 72(3): 1318 - 1325.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. A. Campos, G. M. S. Rosinha, I. C. Almeida, X. S. Salgueiro, B. W. Jarvis, G. A. Splitter, N. Qureshi, O. Bruna-Romero, R. T. Gazzinelli, and S. C. Oliveira
Role of Toll-Like Receptor 4 in Induction of Cell-Mediated Immunity and Resistance to Brucella abortus Infection in Mice
Infect. Immun., January 1, 2004; 72(1): 176 - 186.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. R. Coats, R. A. Reife, B. W. Bainbridge, T.-T. T. Pham, and R. P. Darveau
Porphyromonas gingivalis Lipopolysaccharide Antagonizes Escherichia coli Lipopolysaccharide at Toll-Like Receptor 4 in Human Endothelial Cells
Infect. Immun., December 1, 2003; 71(12): 6799 - 6807.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
M. Triantafilou and K. Triantafilou
Receptor cluster formation during activation by bacterial products
Innate Immunity, October 1, 2003; 9(5): 331 - 335.
[Abstract] [PDF]


Home page
J. Immunol.Home page
L.-Y. Huang, J. Aliberti, C. A. Leifer, D. M. Segal, A. Sher, D. T. Golenbock, and B. Golding
Heat-Killed Brucella abortus Induces TNF and IL-12p40 by Distinct MyD88-Dependent Pathways: TNF, Unlike IL-12p40 Secretion, Is Toll-Like Receptor 2 Dependent
J. Immunol., August 1, 2003; 171(3): 1441 - 1446.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Compton, E. A. Kurt-Jones, K. W. Boehme, J. Belko, E. Latz, D. T. Golenbock, and R. W. Finberg
Human Cytomegalovirus Activates Inflammatory Cytokine Responses via CD14 and Toll-Like Receptor 2
J. Virol., April 15, 2003; 77(8): 4588 - 4596.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Malley, P. Henneke, S. C. Morse, M. J. Cieslewicz, M. Lipsitch, C. M. Thompson, E. Kurt-Jones, J. C. Paton, M. R. Wessels, and D. T. Golenbock
Recognition of pneumolysin by Toll-like receptor 4 confers resistance to pneumococcal infection
PNAS, February 18, 2003; 100(4): 1966 - 1971.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. Becker, M. J. Fenton, and J. M. Soukup
Involvement of Microbial Components and Toll-like Receptors 2 And 4 in Cytokine Responses to Air Pollution Particles
Am. J. Respir. Cell Mol. Biol., November 1, 2002; 27(5): 611 - 618.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Henneke, O. Takeuchi, R. Malley, E. Lien, R. R. Ingalls, M. W. Freeman, T. Mayadas, V. Nizet, S. Akira, D. L. Kasper, et al.
Cellular Activation, Phagocytosis, and Bactericidal Activity Against Group B Streptococcus Involve Parallel Myeloid Differentiation Factor 88-Dependent and Independent Signaling Pathways
J. Immunol., October 1, 2002; 169(7): 3970 - 3977.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Triantafilou, K. Miyake, D. T. Golenbock, and K. Triantafilou
Mediators of innate immune recognition of bacteria concentrate in lipid rafts and facilitate lipopolysaccharide-induced cell activation
J. Cell Sci., June 15, 2002; 115(12): 2603 - 2611.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Guillot, V. Balloy, F. X. McCormack, D. T. Golenbock, M. Chignard, and M. Si-Tahar
Cutting Edge: The Immunostimulatory Activity of the Lung Surfactant Protein-A Involves Toll-Like Receptor 4
J. Immunol., June 15, 2002; 168(12): 5989 - 5992.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Massari, P. Henneke, Y. Ho, E. Latz, D. T. Golenbock, and L. M. Wetzler
Cutting Edge: Immune Stimulation by Neisserial Porins Is Toll-Like Receptor 2 and MyD88 Dependent
J. Immunol., February 15, 2002; 168(4): 1533 - 1537.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Yoshimura, T. Kaneko, Y. Kato, D. T. Golenbock, and Y. Hara
Lipopolysaccharides from Periodontopathic Bacteria Porphyromonas gingivalis and Capnocytophaga ochracea Are Antagonists for Human Toll-Like Receptor 4
Infect. Immun., January 1, 2002; 70(1): 218 - 225.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Henneke, O. Takeuchi, J. A. van Strijp, H.-K. Guttormsen, J. A. Smith, A. B. Schromm, T. A. Espevik, S. Akira, V. Nizet, D. L. Kasper, et al.
Novel Engagement of CD14 and Multiple Toll-Like Receptors by Group B Streptococci
J. Immunol., December 15, 2001; 167(12): 7069 - 7076.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. E. Medvedev, P. Henneke, A. Schromm, E. Lien, R. Ingalls, M. J. Fenton, D. T. Golenbock, and S. N. Vogel
Induction of Tolerance to Lipopolysaccharide and Mycobacterial Components in Chinese Hamster Ovary/CD14 Cells Is Not Affected by Overexpression of Toll-Like Receptors 2 or 4
J. Immunol., August 15, 2001; 167(4): 2257 - 2267.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. B. Schromm, E. Lien, P. Henneke, J. C. Chow, A. Yoshimura, H. Heine, E. Latz, B. G. Monks, D. A. Schwartz, K. Miyake, et al.
Molecular Genetic Analysis of an Endotoxin Nonresponder Mutant Cell Line: A Point Mutation in a Conserved Region of Md-2 Abolishes Endotoxin-Induced Signaling
J. Exp. Med., July 2, 2001; 194(1): 79 - 88.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
L. Rabehi, T. Irinopoulou, B. Cholley, N. Haeffner-Cavaillon, and M.-P. Carreno
Gram-Positive and Gram-Negative Bacteria Do Not Trigger Monocytic Cytokine Production through Similar Intracellular Pathways
Infect. Immun., July 1, 2001; 69(7): 4590 - 4599.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. S. Campos, I. C. Almeida, O. Takeuchi, S. Akira, E. P. Valente, D. O. Procopio, L. R. Travassos, J. A. Smith, D. T. Golenbock, and R. T. Gazzinelli
Activation of Toll-Like Receptor-2 by Glycosylphosphatidylinositol Anchors from a Protozoan Parasite
J. Immunol., July 1, 2001; 167(1): 416 - 423.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
B. W. Jones, T. K. Means, K. A. Heldwein, M. A. Keen, P. J. Hill, J. T. Belisle, and M. J. Fenton
Different Toll-like receptor agonists induce distinct macrophage responses
J. Leukoc. Biol., June 1, 2001; 69(6): 1036 - 1044.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
R. R. Ingalls, E. Lien, and D. T. Golenbock
Membrane-Associated Proteins of a Lipopolysaccharide-Deficient Mutant of Neisseria meningitidis Activate the Inflammatory Response through Toll-Like Receptor 2
Infect. Immun., April 1, 2001; 69(4): 2230 - 2236.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Shoham, C. Huang, J.-M. Chen, D. T. Golenbock, and S. M. Levitz
Toll-Like Receptor 4 Mediates Intracellular Signaling Without TNF-{{alpha}} Release in Response to Cryptococcus neoformans Polysaccharide Capsule
J. Immunol., April 1, 2001; 166(7): 4620 - 4626.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. K. Means, B. W. Jones, A. B. Schromm, B. A. Shurtleff, J. A. Smith, J. Keane, D. T. Golenbock, S. N. Vogel, and M. J. Fenton
Differential Effects of a Toll-Like Receptor Antagonist on Mycobacterium tuberculosis-Induced Macrophage Responses
J. Immunol., March 15, 2001; 166(6): 4074 - 4082.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
A. Yoshimura, H. Takada, T. Kaneko, I. Kato, D. Golenbock, and Y. Hara
Structural requirements of muramylpeptides for induction of Toll-like receptor 2-mediated NF-{kappa}B activation in CHO cells
Innate Immunity, October 1, 2000; 6(5): 407 - 410.
[Abstract] [PDF]


Home page
Innate ImmunityHome page
R. R. Ingalls, E. Lien, and D. T. Golenbock
Differential roles of TLR2 and TLR4 in the host response to Gram-negative bacteria: lessons from a lipopolysaccharide-deficient mutant of Neisseria meningitidis
Innate Immunity, October 1, 2000; 6(5): 411 - 415.
[Abstract] [PDF]


Home page
J. Immunol.Home page
N. W. J. Schroder, B. Opitz, N. Lamping, K. S. Michelsen, U. Zahringer, U. B. Gobel, and R. R. Schumann
Involvement of Lipopolysaccharide Binding Protein, CD14, and Toll-Like Receptors in the Initiation of Innate Immune Responses by Treponema Glycolipids
J. Immunol., September 1, 2000; 165(5): 2683 - 2693.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Kol, A. H. Lichtman, R. W. Finberg, P. Libby, and E. A. Kurt-Jones
Cutting Edge: Heat Shock Protein (HSP) 60 Activates the Innate Immune Response: CD14 Is an Essential Receptor for HSP60 Activation of Mononuclear Cells
J. Immunol., January 1, 2000; 164(1): 13 - 17.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. K. Means, E. Lien, A. Yoshimura, S. Wang, D. T. Golenbock, and M. J. Fenton
The CD14 Ligands Lipoarabinomannan and Lipopolysaccharide Differ in Their Requirement for Toll-Like Receptors
J. Immunol., December 15, 1999; 163(12): 6748 - 6755.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Lien, T. J. Sellati, A. Yoshimura, T. H. Flo, G. Rawadi, R. W. Finberg, J. D. Carroll, T. Espevik, R. R. Ingalls, J. D. Radolf, et al.
Toll-like Receptor 2 Functions as a Pattern Recognition Receptor for Diverse Bacterial Products
J. Biol. Chem., November 19, 1999; 274(47): 33419 - 33425.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. K. Means, S. Wang, E. Lien, A. Yoshimura, D. T. Golenbock, and M. J. Fenton
Human Toll-Like Receptors Mediate Cellular Activation by Mycobacterium tuberculosis
J. Immunol., October 1, 1999; 163(7): 3920 - 3927.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. J. Sellati, D. A. Bouis, M. J. Caimano, J. A. Feulner, C. Ayers, E. Lien, and J. D. Radolf
Activation of Human Monocytic Cells by Borrelia burgdorferi and Treponema pallidum Is Facilitated by CD14 and Correlates with Surface Exposure of Spirochetal Lipoproteins
J. Immunol., August 15, 1999; 163(4): 2049 - 2056.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Heine, R. L. Delude, B. G. Monks, T. Espevik, and D. T. Golenbock
Bacterial Lipopolysaccharide Induces Expression of the Stress Response Genes hop and H411
J. Biol. Chem., July 23, 1999; 274(30): 21049 - 21055.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Yoshimura, E. Lien, R. R. Ingalls, E. Tuomanen, R. Dziarski, and D. Golenbock
Cutting Edge: Recognition of Gram-Positive Bacterial Cell Wall Components by the Innate Immune System Occurs Via Toll-Like Receptor 2
J. Immunol., July 1, 1999; 163(1): 1 - 5.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Heine, C. J. Kirschning, E. Lien, B. G. Monks, M. Rothe, and D. T. Golenbock
Cutting Edge: Cells That Carry A Null Allele for Toll-Like Receptor 2 Are Capable of Responding to Endotoxin
J. Immunol., June 15, 1999; 162(12): 6971 - 6975.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Lien, J. C. Chow, L. D. Hawkins, P. D. McGuinness, K. Miyake, T. Espevik, F. Gusovsky, and D. T. Golenbock
A Novel Synthetic Acyclic Lipid A-like Agonist Activates Cells via the Lipopolysaccharide/Toll-like Receptor 4 Signaling Pathway
J. Biol. Chem., January 12, 2001; 276(3): 1873 - 1880.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Viriyakosol, P. S. Tobias, R. L. Kitchens, and T. N. Kirkland
MD-2 Binds to Bacterial Lipopolysaccharide
J. Biol. Chem., October 5, 2001; 276(41): 38044 - 38051.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Delude, R. L.
Right arrow Articles by Golenbock, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Delude, R. L.
Right arrow Articles by Golenbock, D. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS