|
|
||||||||
, Signal Transduction1



*
Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215; and
Maxwell Finland Laboratory for Infectious Diseases, Boston University School of Medicine, Boston Medical Center, Boston, MA 02118
| Abstract |
|---|
|
|
|---|
B (NF-
B) following LPS
exposure. TNF-
-treated mutant cells continued to express Tac and
translocate NF-
B. An analysis of LPS-induced NF-
B activity in
heterokaryons derived from polyethylene glycol-fused cell lines
indicated that recessive mutations in genes encoding components of the
LPS signaling pathway accounted for the signaling defects. To date, two
complementation groups have been identified from 11 cell lines
analyzed. These data demonstrate that the TNF-
signaling pathway
diverges from the LPS pathway early in the signal-transduction cascade
despite similarities in LPS- and TNF-
-induced responses.
Identification of the genes affected in these mutant reporter cells
should identify heretofore-elusive components of the LPS signaling
cascade. | Introduction |
|---|
|
|
|---|
CD14 is a glycosylphosphatidylinositol (GPI4)-anchored protein (3) expressed by monocytes, macrophages, and activated neutrophils that binds to LPS and initiates cellular activation (4). A central role for CD14 in LPS-mediated responses has been proposed based upon the following observations: 1) specific anti-CD14 mAb inhibit the ability of LPS to stimulate phagocytes (4, 5, 6, 7); 2) a soluble fragment of CD14 (sCD14) is present in blood (8) and facilitates the activation of cells that do not express membrane CD14 (9, 10, 11); 3) transfection of CD14 into Chinese hamster ovary (CHO)-K1 fibroblasts or HT1080 fibrosarcoma cells transformed these cells from an LPS-nonresponsive to an LPS-responsive phenotype. The physiologic relevance of these observations was underscored recently using a CD14-deficient knockout mouse that was 10,000-fold less sensitive to LPS when compared with hemizygous littermates (12).
Macrophages express multiple receptors for LPS in addition to CD14. For example, the macrophage scavenger receptor binds and internalizes the toxic lipid A moiety of LPS. In contrast to CD14, the scavenger receptor does not appear to participate in macrophage activation; rather, it seems to function in the clearance and detoxification of LPS (13). Macrophages also express the ß2 integrins, a family of obligate heterodimers that include LFA-1, CR3, and CR4 (CD11a/CD18, CD11b/CD18, and CD11c/CD18, respectively). These leukocyte-restricted adhesion molecules can bind LPS-coated erythrocytes and Gram-negative bacteria (14). Transfection of CHO-K1 cells with any of the ß2 integrins increased their sensitivity to LPS, implying a role for these receptors in macrophage-mediated responses to endotoxin (15, 16).
Although both CD14 and CD11/CD18 integrins bind LPS and are associated with signaling, evidence suggests that neither of these proteins functions in transducing a signal following LPS binding. CD14 is a GPI-anchored protein lacking a transmembrane and cytoplasmic domain. It is not directly apparent how this protein can function to transmit a signal across the cell membrane. Consistent with the hypothesis that CD14 does not directly function to induce a transmembrane signaling event is the observation that certain cells (e.g., endothelial cells) that do not express CD14 respond to LPS in the presence of sCD14 normally present in blood. To determine whether the cytoplasmic domains of CD11/CD18 were necessary for signaling, mutant constructs of CD11/CD18 devoid of their cytoplasmic tails were expressed in CHO cells. The mutant receptors were capable of enabling LPS responses when expressed in CHO cells, similar to transfected full-length CR3 constructs (16). Thus, like CD14, CD11/CD18 receptors do not require a cytoplasmic motif to enable an LPS signal. Finally, studies of the LPS antagonists deacylated LPS, lipid IVA (also known as lipid Ia, compound 408), and Rhodobacter sphaeroides lipid A have given additional credence to the idea that CD14 does not directly signal cells after binding to LPS. These LPS antagonists appear to inhibit LPS-induced signal transduction through interactions with a cellular element that is distinct from CD14 (17). One hypothesis that is consistent with these observations is that complexes of LPS and CD14 (or CR3) can interact with a putative transmembrane receptor that functions to transmit a signal across the plasma membrane and initiate an intracellular signaling cascade. The identification of this putative signaling component of the LPS receptor remains an important focus of endotoxin research today.
Progress in defining the LPS signal-transduction pathway has been
hampered, in part, by difficulties in working with a ligand that cannot
be purified to homogeneity. LPS also cannot be radiolabeled to a high
specific activity (discussed in 18 . The observation that
macrophages express several receptors that bind to LPS complicates the
use of myeloid cells in the study of LPS-induced signal transduction
using traditional biochemical methods. In addition to the problems of
studying LPS signaling by traditional biochemical approaches, the low
efficiency with which myeloid cells can be transfected with plasmid DNA
(<10-6) precludes the facile application of molecular
genetic approaches using monocyte-derived cell lines. One strategy to
circumvent these difficulties is to identify an easily transfectable
cell line that does not express other LPS receptors and responds to LPS
via CD14. Mutant LPS nonresponder cell lines could then be derived from
such cells and used to expression clone genes in the LPS
signal-transduction pathway. This approach has been used successfully
to define critical elements of important signaling pathways such as the
IFN-
(19, 20) and the TGF-ß (21) signal-transducing pathways.
The CHO-K1 fibroblast cell line displays excellent growth
characteristics and can be transfected with high efficiency.
Established methods for inducing and rescuing mutations in CHO cells
have led to the isolation of genes that encode important components of
metabolic and signal-transduction pathways (22, 23). Furthermore,
stable transfection of CHO cells with a CD14 expression plasmid
(CHO/CD14) conferred an LPS-responsive phenotype, as evidenced by the
inducible release of arachidonic acid (24), translocation of nuclear
factor (NF)-
B from the cytoplasm to the nucleus (25), and the
production of IL-6 (H. Heine, R. L. Delude, T. Espevik, and
D. T. Golenbock, manuscript in preparation). These characteristics
led us to engineer the LPS-responsive 3E10 reporter cell line, which
up-regulates surface expression of the human Tac Ag (
-chain of the
IL-2R; CD25) following exposure to endotoxin. We report in this work
the engineering and use of an LPS-responsive reporter cell line,
designated clone 3E10, that we have used to isolate LPS
signal-transduction mutants. These mutants fall into two distinct
complementation groups that fail to express Tac or translocate NF-
B
following exposure to endotoxin. However, these LPS signaling mutants
retain responsiveness to murine TNF-
when assessed for NF-
B
translocation and Tac reporter expression. These LPS signaling mutants
should be useful in identifying genes that encode necessary components
of the CD14-dependent LPS signaling pathway by employing established
expression-cloning techniques.
| Materials and Methods |
|---|
|
|
|---|
Unless otherwise indicated, reagents were obtained from Sigma
(St. Louis, MO). PBS and Hams F-12 were obtained from BioWhittaker
(Walkersville, MD). Heat-inactivated FBS (LPS <10 pg/ml) was obtained
from HyClone Laboratories (Logan, UT). Ciprofloxacin, a broad-spectrum
antibiotic with activity against standard lab contaminants as well as
mycoplasma, was a gift from Miles Pharmaceuticals (West Haven, CT).
Protein-free LPS was obtained from Dr. Nilofor Qureshi (William S.
Middleton Veterans Hospital, Madison, WI), and was extracted
from Salmonella minnesota R595 (ReLPS). Lipids were prepared
at 1 mg/ml in PBS and stored at -20°C. Before use, the suspensions
were thawed and sonicated in an 80-W sonicator bath (Lab Supply,
Hicksville, NY) for 2 min. The IFN-
-inducible reporter plasmid,
pUMS(GT)8-Tac, was obtained from Dr. M. Aguet (26).
Cell lines and culture
CHO cell lines were cultured in Hams F-12 containing 10% heat-inactivated FBS and 10 µg/ml of ciprofloxacin in a 5% saturated CO2 atmosphere at 37°C. Staining of cells for flow cytometry was performed as described (6).
Construction of the Tac reporter plasmid
The PCR was used to amplify a fragment of the human E-selectin
(ELAM) promoter from -241 to -54 bp relative to the transcription
start site. The 5' primer (TAATCGATAATCATGCATTTTTGTCATA) and the 3'
primer (CAGAAGCTTATAGGAGGATATTGTCCACAT) were engineered with a
ClaI and HindIII restriction site, respectively.
A 50-µl amplification reaction containing each primer at 1 µM, 10
µg of human genomic DNA, and 1 U of Taq DNA polymerase
(Promega, Madison, WI) was subjected to 30 amplification cycles at
95°C for 1 min, 55°C for 1 min, and 70°C for 1 min. The 205-bp
amplification product was digested with ClaI and
HindIII, and the fragment was cloned in place of the
IFN-
-inducible element contained within the unique ClaI
and HindIII sites in pUMS(GT)8-Tac. The
resulting plasmid, pUMS(ELAM)-Tac (Fig. 1
A), was subjected to
dideoxynucleotide sequence analysis to confirm the integrity of the
inserted promoter element.
|
We have reported previously that CHO-K1 cells transfected with
CD14 responded to LPS by releasing arachidonic acid (24), translocating
NF-
B (25), and releasing IL-6 (H. Heine, R. L. Delude, T.
Espevik, and D. T. Golenbock, manuscript in preparation). We
reasoned that the translocation of NF-
B could be used to drive the
expression of a transfected reporter gene under the transcriptional
control of an NF-
B-inducible promoter. We obtained a plasmid,
pUMS(GT)8-Tac, which contained an upstream viral
transcription termination region (UMS), eight repeats of an
IFN-
-binding element (GT), and the minimal promoter of the rabbit
ß-globin gene upstream of the Tac cDNA (26). We removed the
artificial IFN-
-responsive element from pUMS(GT)8-Tac
and replaced it with a segment of the human endothelial leukocyte
adhesion molecule (ELAM) promoter including sequences between -241 and
-54 bp relative to the transcription start site, as described above
(Fig. 1
). The resulting vector, pUMS(ELAM)-Tac, contains a
cis regulatory element for NF-
B and a CAAT box that binds
the CAAT enhancer-binding protein, NF-IL6 (27).
CHO-K1 cells were cotransfected with 5 µg each of pCEP4 (Invitrogen,
San Diego, CA) containing the human CD14 cDNA (pCEP4/CD14) and
pUMS(ELAM)-Tac, as described (28), except that Hams F-12 complete
medium was used in place of
-MEM. Stable transfectants were selected
in Hams F-12 complete medium containing hygromycin B at a
concentration of 400 U/ml (LC Laboratories, Woburn, MA). Stable
transfectants were transferred to two separate 10-cm dishes and allowed
to grow to near confluence in the presence of selective drug. The cells
in one dish were left untreated, while the cells in the other dish were
stimulated with 100 ng of LPS/ml for 16 h. These cells were
harvested and stained with a FITC-conjugated anti-Tac mAb or an
isotype-matched mAb specific for the human Tac Ag, to define
autofluorescence. LPS-stimulated and anti-CD25-stained cells were
subjected to one round of positive selection using a Becton Dickinson
FACScanPlus in enrichment mode to select cells with high
inducible levels of Tac Ag expression. The sorting gate was set to
enrich for LPS-stimulated cells that expressed the highest 5% of
fluorescence (measured as mean channel fluorescence). An additional
gate was defined, using forward scatter and side scatter as the
parameters, to avoid the selection of cells whose enhanced
immunofluorescence resulted from their larger size (i.e., cells with a
large amount of scatter were excluded). The collected cells were plated
in two wells of a six-well dish, allowed to achieve near confluence,
and subjected to a second round of positive enrichment after LPS
stimulation, as described above. To minimize basal expression of Tac,
enriched cells were harvested without LPS stimulation and stained with
FITC-conjugated anti-Tac mAb. These unstimulated cells were
subjected to one round of negative enrichment by FACS by collecting
cells whose immunofluorescence was in the lowest 5% with respect to
Tac Ag expression. Finally, the cells were expanded and positively
sorted after 18 h of LPS stimulation. After allowing these cells
to expand in culture, this enriched population was cloned by limiting
dilution in 96-well tissue culture dishes at a cell density of 0.3 to
0.5 cells/well. Individual clones were expanded and tested for LPS
responsiveness. One CD14-expressing LPS-responsive cell line was chosen
to represent wild-type CHO/CD14 and subcloned. In this way, a clonal
cell line that expressed low basal levels of surface Tac, and that
up-regulated Tac expression following exposure to low concentrations of
LPS, was identified. We designated this clone as 3E10.
Mutagenesis and selection
3E10 reporter cells were seeded at a density of 1 x 106 cells per T25 tissue culture flask and allowed to grow overnight. The following day, the growth medium was replaced with 8 ml of Hams F-12 complete medium containing methanesulfonic acid ethyl ester (300 µg/ml), a concentration of mutagen that we (and others (22)) have determined to increase the mutational frequency of ouabain resistance from 1:106 to 1:104 in CHO fibroblasts. Following a 20-h incubation at 37°C, the medium was aspirated and the cells were washed once with 8 ml of Hams F-12 complete medium. The cells were allowed to recover for 2 days and then passed 1:10 into a T25 flask. After the cells grew to confluence, they were harvested and stored in liquid nitrogen until later use.
The mutagenized cells were thawed rapidly and plated into a 10-cm-diameter dish containing Hams F-12 complete medium with hygromycin B and allowed to grow to approximately 80% confluence. Cells were treated with 100 ng/ml of LPS for 18 h. The cells were labeled with anti-Tac mAb, and hyporesponsive cells were selected by FACS. Three rounds of negative sorting (i.e., only the lowest 5% of cells based on mean FL1 fluorescence) were performed to enrich for cells that failed to up-regulate Tac Ag expression in response to LPS. The resulting population was plated using limiting dilution in a 96-well tissue culture dish to obtain clonal mutant cell lines for analysis. The phenotypes of the mutant cell lines described in this work have remained stable over a period of 9 mo of continuous growth in cell culture.
NF-
B translocation analysis
Nuclear extracts were prepared from 1 x 106
nuclei using slightly hypotonic conditions in a solution containing
0.1% Nonidet P-40, exactly as described (25). A
32P-labeled DNA fragment containing the mouse Ig NF-
B
binding site was mixed with 2 µg/lane of nuclear extracts and
fractionated on a native 4% polyacrylamide gel. The gels were dried
and used to expose x-ray film at -80°C. All gel-shift experiments
shown in this report are representative of experiments performed on two
or more occasions.
Northern blot analysis
For Northern blot analysis, cells were plated the day before the experiment at 3 x 106 cells per 10-cm-diameter tissue culture-treated Petri dish. The following day, the cells were stimulated for the indicated times, and RNA was extracted from the cells using TriReagent, exactly as directed by the manufacturer (Medical Research Center, Cincinnati, OH). Total RNA (10 µg) was size fractionated and blotted to nylon membranes, exactly as described (29). A random primed DNA probe was generated using the Tac cDNA as template (30). All experiments were performed on two or more occasions.
LPS-binding assay
LPS-binding assays with boron dipyrromethane (BODIPY)-labeled LPS were performed as described, except that the assay was adapted for whole cell binding. Complexes of BODIPY-LPS (100 ng/ml; gift of Rolf Thieringer, Merck, Rahway, NJ) and sCD14 (2 µg/ml; gift of Henry Lichenstein, Amgen, Thousand Oaks, CA) were preformed at 37°C for 6 h. BODIPY-LPS/sCD14 complexes were then added to cells in the presence or absence of human rLPS-binding protein (200 ng/ml; gift of Henry Lichenstein, Amgen) for 20 min at 37°C. Cells were washed with PBS and analyzed for fluorescence by FACS.
Cell fusions
Each mutant cell line was fused to the ouabain-resistant, but hygromycin-sensitive, CHO-K1a cell line, as described (31). The 7.11 mutant cell line was also fused individually to the 3E10, 7.11, 7.19, 8.18, and 8.20 mutant cell lines, and the 8.20 cell line was fused to 3E10, 7.7, 7.9, 7.13, 7.14, 7.15, 7.23, 7.24, and 8.20 cell lines to perform complementation analysis. Briefly, each clone was remutagenized (300 µg of EMS/ml) at a cell density of 106 cells per 25-cm2 flask, and selected in 0.5 mM ouabain in complete medium. In addition, clonal cell lines were transfected as described above with the neomycin resistance plasmid pcDNA3 (Invitrogen), and selected in 1 µg/ml of G418. The fusion partners (2.5 x 105 cells each) were seeded into wells of a 24-well tissue culture dish and grown overnight. The next day, the medium was replaced with 1 ml of 50% polyethylene glycol (w/v; m.w. 3350) in Hams F-12 complete medium. The plates were incubated at room temperature for 1 min, and the polyethylene glycol solution was aspirated. Following five washes with PBS, the cells were allowed to recover overnight in Hams F-12 complete medium. The following day, the medium was replaced with Hams F-12 complete medium containing 0.5 mM ouabain plus hygromycin B (400 U/ml), or ouabain plus G418 (depending on the antibiotic-resistance profile of each fusion partner) to select for heterokaryons. FACS analysis of heterokaryons was performed on two or more separate occasions, and gel-shift analysis was performed on three separate occasions.
| Results |
|---|
|
|
|---|
FACS analysis was performed to study the LPS-induced expression of
Tac Ag in the 3E10 reporter cell line. The cells were seeded at a
density of 0.5 x 106 cells/well in a six-well tissue
culture-treated dish and allowed to grow overnight. The following day,
LPS was added to some wells at a final concentration of 100 ng/ml and
the cells were incubated an additional 18 h. Cells were harvested
and stained with FITC-conjugated anti-human CD14 mAb or an
isotype-matched FITC-conjugated anti-human CD20 control mAb. Cell
fluorescence was determined using flow cytometry. Resting 3E10 reporter
cells expressed low levels of surface Tac Ag (Fig. 2
). Stimulation with LPS up-regulated Tac
expression, as measured by mean channel fluorescence by approximately
10-fold compared with nonstimulated control cells. This increase in Tac
Ag expression was maximal within 18 h of stimulation and decreased
to 50% of that level within 48 h of stimulation (data not shown).
Thus, we engineered a fibroblast cell line that reports following
stimulation with LPS by up-regulating the expression of cell
membrane-associated Tac Ag approximately 10-fold when compared with
nonstimulated control cells.
|
Northern blot analysis was performed on these cells to confirm
that the increase in Tac expression was the result of increased steady
state levels of Tac mRNA in cells exposed to LPS. 3E10 reporter cells
were seeded at a density of 3 x 106 cells per
10-cm-diameter tissue culture-treated Petri dish and allowed to grow
overnight. The following day, the cells were treated with LPS (100
ng/ml) for increasing amounts of time, and total cellular RNA was
prepared. Total RNA was size fractionated in an agarose gel containing
formaldehyde, then blotted to a nylon membrane and probed using a
Tac-specific DNA probe. Resting 3E10 cells expressed very low basal
levels of Tac mRNA (inset, Fig. 2
, lane 1). Reporter cells
treated with LPS for 30 min expressed increased levels of steady state
Tac mRNA, and these levels continued to increase until 2 h
following LPS exposure (inset, Fig. 2
, lane 5). Within
4 h of stimulation, the steady state levels of Tac mRNA had
decreased significantly. These results were consistent with the
rapid increase and postinduction decrease in NF-
B DNA-binding
activity in CHO/CD14 cells (25). Total RNA isolated from resting
CD14-transfected CHO-K1 (CHO/CD14) cells were included in the Northern
blot analysis as a negative control and were devoid of bands
hybridizing to the Tac cDNA probe (inset, Fig. 2
, lane 7). A
control blot was probed for ß-actin mRNA expression, and the steady
state levels of ß-actin remained constant throughout the
experiment (data not shown). Thus, the increase in Tac Ag
expression observed in the 3E10 reporter cell line was due, at least in
part, to increased steady state levels of the Tac Ag mRNA.
Isolation of 3E10 reporter cell mutants that fail to express Tac in response to LPS
CHO cells appear to be functionally hemizygous (22) for most genetic loci, thus facilitating the identification of mutant cell lines from reasonably small starting numbers of cells after a single round of mutagenesis. Exposure of wild-type CHO-K1 cells to methanesulfonate ethyl ester (300 µg/ml) results in a mutation frequency of approximately 1:10-4 based on the rate at which cells become resistant to ouabain (22). We used these conditions to mutagenize eight dishes of 3E10 reporter cells, as described in Materials and Methods; two of these mutagenized pools (pools 7 and 8) were used to generate LPS response mutants independently, to minimize the enrichment of sibling cells. We exposed mutagenized 3E10 reporter cells to LPS and subjected them to three successive rounds of negative enrichment using a FACS. The sort gate was set to enrich for cells that expressed extremely low to undetectable levels of Tac Ag on their surface (cells with the lowest 5% of mean channel fluorescence). Cells were simultaneously gated for forward and side scatter within the 5th through 95th percentile, to avoid choosing cells that had less surface immunofluorescence because they were smaller than the wild-type cell line. Following the final round of negative enrichment, the cells were cloned by limiting dilution into 96-well dishes. Individual clones were stimulated with LPS and labeled with phycoerythrin-conjugated anti-CD14 and FITC-conjugated anti-Tac mAb. Flow-cytometric analysis revealed that all of the clones expressed CD14 (data not shown). A total of 25 clones of 30 clones screened from pool 7 did not up-regulate Tac Ag in response to LPS. Similarly, 5 of 6 clones from pool 8 had no response to LPS.
We randomly selected a total of 11 clonal cell lines (clones 7.7, 7.9,
7.11, 7.13, 7.14, 7.15, 7.19, 7.23, 7.24, 8.18, and 8.20), representing
both independently mutagenized pools of 3E10 reporter cells, for
additional analysis. All of these mutant cell lines failed to
up-regulate Tac expression following exposure to LPS. Four of the lines
are shown in Figure 3
. Furthermore,
stimulation of the mutants with murine TNF-
up-regulated Tac
reporter expression normally compared with the parental 3E10 reporter
line (Fig. 3
). These results indicated that the integrity of the Tac
reporter gene remained intact. Therefore, these mutants appear to
result from lesions in genes that encode important components of the
LPS signaling pathway.
|
B following
exposure to TNF-
, but not LPS
Treatment of CHO/CD14 cells with LPS results in the rapid
mobilization of NF-
B from the cytoplasm to the nucleus (25). The
increase in nuclear NF-
B is evident within 5 min following exposure
to LPS and is maximal within 30 min of stimulation. Thus, activation of
NF-
B represents an early event in the signaling cascade initiated by
LPS. We used the electrophoretic mobility shift assay (EMSA) to
determine whether the reporter mutants could translocate NF-
B in
response to LPS. We previously reported that CHO-K1 fibroblasts
translocated NF-
B to the nuclear compartment following exposure to
murine TNF-
(32). Therefore, the mutant cell lines were also
stimulated with murine TNF-
. The 3E10 reporter cell line
translocated NF-
B to the nucleus following exposure to either LPS
(100 ng/ml) or TNF-
(10 ng/ml; Fig. 4
). However, each of the 3E10 mutant cell
lines failed to mobilize NF-
B in response to LPS. It should be noted
that mutants 8.18 and 8.20 show a subtle, almost undetectable increase
in nuclear levels of NF-
B following exposure to LPS. The
response is minimal, and may be due to the production of a partially
functional mutant protein in the LPS signal-transduction pathway, or
may be due to variability in background. In contrast to the response to
exogenous LPS, all of the mutant lines respond normally to murine
TNF-
, as evidenced by translocation of NF-
B to the nucleus. These
data infer that the genetic lesions in these mutant cell lines are not
the result of generalized effects on NF-
B activation. The
observation that the mutant cell lines respond normally to TNF-
strengthens our previous conclusion that the affected genes in the LPS
nonresponsive mutant cell lines are specific for the LPS
signal-transduction pathway.
|
LPS-binding protein (LBP) is a plasma protein that has been shown
to accelerate the binding of LPS monomers from LPS aggregates to CD14,
thus enhancing the sensitivity of cells to LPS. One possible
explanation for the inability of the mutant cell lines to respond to
LPS was that they were unable to interact with LPS and LPS/LBP
complexes. Therefore, we analyzed one mutant, 8.20, for its ability to
bind LPS in a fluorescent assay, using BODIPY-labeled LPS. As
BODIPY-labeled LPS monomers exit from their aggregated state and bind
to CD14, an increased fluorescent signal can be observed. As shown in
Figure 5
, both the parental 3E10 line and
the mutant 8.20 were capable of binding LPS equally in an LBP-dependent
manner.
|
Fusion of mutant and wild-type cells can be used to determine
whether the genetic lesions arise through dominant negative mutations
or recessive loss-of-function mutations. The generation of such hybrid
cells can be used also to determine whether the CD14 present in the
mutant cell lines is biologically active, or has been mutated to a
nonfunctional receptor, as the only cell line capable of providing CD14
to the resultant heterokaryons is the LPS-response mutant. A
hygromycin-sensitive, ouabain-resistant cell line was chosen for hybrid
analysis. This line, CHO-K1a, does not express CD14; furthermore,
wild-type (nontransfected) CHO cells do not respond to LPS (24, 25).
CHO-K1a cells do not contain the pUMS(ELAM)-Tac expression vector. This
cell line was fused to each of the individual mutant 3E10 reporter cell
lines, and stable fusions were selected by growth in medium containing
ouabain and hygromycin B. As a control, we fused a reporter cell line
that had undergone mutagenesis and negative selection by FACS, yet
retained an LPS-responsive phenotype (clone 7.5). Stimulation of the
mutant/CHO-K1a fusion lines resulted in an increase in the surface
expression of the Tac Ag following LPS exposure (Fig. 6
). This increase in Tac expression was
identical when compared with the increase in Tac expression observed
with the control 7.5 cell line. Therefore, the mutations that were
isolated using the 3E10 reporter act in a recessive fashion.
|
B following exposure to LPS was
assessed using EMSA. While CHO-K1a cells and the mutant cell lines
failed to translocate NF-
B in response to LPS, fusion of the two
cell lines produced heterokaryons that translocated NF-
B from the
cytoplasm to the nucleus after exposure to endotoxin (Fig. 7
|
To determine whether each of the mutant lines was defective in a unique gene, complementation analysis was performed. Eleven of the thirty LPS signaling mutant cell lines and the parental 3E10 reporter cell line were tested. This analysis revealed that these mutants constitute at least two distinct complementation groups. The larger majority of the mutant cell lines fell into a single complementation group, which we called group A; mutants 7.7 and 7.15 constituted the B complementation group.
The results of experiments using select members of each complementation
group are presented in Figures 8
and
9. We selected the entire group of B
mutants and selected clones 7.11 and 8.20 as representatives of the A
mutants. To perform these experiments, clonal 3E10, 7.11, 7.15, and
8.20 cell lines were transfected with pcDNA3, which conferred
resistance to G418. In addition, the 7.7 and 8.20 cell lines were
remutagenized with methanesulfonic acid ethyl ester (300 µg/ml), and
ouabain-resistant lines were selected in medium containing 0.5 mM of
ouabain.
|
B, and the results of this
analysis are presented in Figure 9
|
| Discussion |
|---|
|
|
|---|
.
The identification of proteins involved in LPS-induced signal
transduction immediately downstream from CD14 is a central question in
our understanding of the signaling cascade. Any hypothesis suggesting
that LPS and TNF-
share signaling components is not supported by the
data presented in this study. Mutant 3E10 reporter cell lines that
failed to respond to LPS responded normally to mouse TNF-
(Fig. 3
),
a finding that suggests that at least some of the most proximal
portions of the TNF-
and LPS signaling cascades are unique to each
pathway.
While CD14 clearly initiates the process of LPS-induced cellular activation, a mechanistic description of the molecular events that occur subsequent to LPS binding to CD14 remains elusive. CD14 is a GPI-linked protein with no known signaling motifs. Thus, it does not seem likely that CD14 actually effects a transmembrane signaling event. Strong evidence supports a model in which complexes of CD14 and LPS signal cells through interactions with a distinct signal-transducing molecule(s). This derives from studies performed with lipid A analogues, which antagonize the effects of LPS when tested with human cells. Kitchens et al. (17, 33) observed a discrepancy between the concentration of the LPS antagonist lipid IVA needed to inhibit binding of LPS to CD14 (µM-mM range) and the concentration of lipid IVA needed to antagonize LPS-induced signaling (nM-µM range). Thus, LPS inhibitors suppressed signaling at concentrations that were too low to prevent LPS binding to CD14. Previous observations had indicated that several of the LPS analogues that acted as LPS antagonists in human cells had LPS-mimetic activity in cells from mice (34). Human and rodent cell lines that expressed human- or mouse-derived CD14 were engineered. The species-specific effect did not correlate with the species of CD14 expressed in cells, but was dependent on the genetic background of the transfected cell line (32). We hypothesized that CD14-bound LPS causes a signal-transduction event by interacting with a second signaling receptor, which also functions to discriminate between structural differences present in the lipid A moieties of the various LPS antagonists. This putative signal transducer was proposed as the target of LPS antagonists.
The role of sCD14 in the activation of endothelial cells initially suggested that a CD14/LPS complex might form a ternary complex with an as yet unidentified signal-transducing molecule with transmembrane and cytoplasmic signaling domains (10, 11, 35). Sophisticated biochemical approaches to identify such a molecule have not been productive, although the failure of such studies does not eliminate the possibility that such a transmembrane signal transducer exists. Wright and colleagues have recently presented evidence suggesting that CD14 is a lipid transfer protein, and that cell signaling depends upon the movement of CD14 into cells. These authors have observed a lesion in LPS import in cells obtained from C3H/HeJ LPS nonresponder mice. While C3H/HeJ mice express CD14, and bind LPS normally, they fail to internalize LPS presented to cells as sCD14/LPS complexes (36). Thus, Wright has suggested that the first step in CD14-mediated signaling is the movement of LPS into the lipid bilayer of cells. Detmers et al. (37) have suggested that a trypsin-sensitive surface protein aids in the movement of LPS from CD14 into the cell and subsequent LPS-induced signaling. Trypsin treatment of cells had no effect on CD14 expression, but abolished both LPS internalization and LPS-induced activation of adhesion molecules. However, a question that has not been directly addressed using this approach is whether LPS internalization is actually necessary for LPS signaling or if LPS signaling is necessary for rapid internalization of the ligand. The inability of C3H/HeJ cells to respond to LPS may be the cause of reduced LPS uptake. It is likely that the identification and cloning of any surface molecule involved in LPS uptake and signaling will shed great light upon the question of LPS uptake and its relationship to signal transduction. Progress in the understanding of CD14-mediated signaling should be greatly facilitated following the identification of the next signaling molecule downstream of CD14 in the LPS signaling cascade.
The identification and analysis of cell mutants have proven to be an
alternative and effective means to binding studies for identifying
components of biochemical and signal-transduction pathways. Mutants in
a defined pathway have been used to identify genes that can revert the
mutant phenotype. Excellent examples of the successful application of
this strategy include the characterization of the TGF-ß receptor in
mutants derived from mink lung epithelium (21), the identification of
JAK/STAT pathway components required for IFN-
-induced signaling in
HT1080 fibrosarcoma cells (19, 20), and the expression cloning of
peroxisomal assembly factor-2 gene in mutant peroxisome-deficient CHO
cells (23).
The use of mutational analysis to study the LPS signaling pathway has
been attempted by several investigators, but was apparently thwarted by
the low transfection frequencies of the cell lines from which the
mutants were derived. Mains and Sibley (38) derived NF-
B signaling
mutants in the 70Z/3 pro-B cell line that failed to respond to LPS, but
were responsive to IFN-
. Although the approach was straightforward,
later attempts to clone the signaling lesions in these mutant cell
lines were not feasible because of a transfection frequency of
approximately 1:106. The initial description of a 55-kDa
protein necessary for LPS responses, which later proved (via nongenetic
approaches) to be CD14, was made by Hara-Kuge and colleagues, who
identified mutant J774.1 cells that neither growth arrested in response
to LPS nor bound 125I-labeled LPS (39). Like Mains and
Sibley, these investigators failed to rescue the lesion in the mutant
cell line by expression cloning probably because of the low
transfection efficiency of monocyte/macrophage-derived cell lines.
Thus, while the mutant analysis of LPS nonresponder B
lymphocyte- and macrophage-derived lines is interesting and
informative, they are also excellent examples of the problems inherent
in performing genetic studies with such cell lines. In contrast, the
genetic analysis of CHO-derived mutant cell lines should be
significantly easier because the transfection efficiency of CHO cells
is approximately 10-2.
It is our hope that the analysis of these mutants, as well as additional mutant lines that we have not yet characterized, will soon constitute a number of complementation groups defining genes that encode necessary components of the LPS signal-transduction cascade. The identification of mutant lines from additional pools of mutagenized stock will also be necessary, because of the tendency to identify siblings using this technique. Ultimately, the goal is to clone genes necessary for LPS responses, including additional signaling components of the LPS receptor. The identification of such genes should facilitate the rationale design of drugs to reduce the morbidity and mortality associated with endotoxin-caused disease.
| Footnotes |
|---|
2 Current address: Beth Israel Deaconess Medical Center, Department of Surgery, 330 Brookline Avenue, Boston, MA 02215. E-mail address: ![]()
3 Address correspondence and reprint requests to Dr. Douglas Golenbock, Maxwell Finland Laboratory for Infectious Diseases, 774 Albany Street, Boston, MA 02118. E-mail address: ![]()
4 Abbreviations used in this paper: GPI, glycosylphosphatidylinositol; BODIPY, boron dipyrromethane; CHO, Chinese hamster ovary; EMSA, electrophoretic mobility shift assay; LBP, lipopolysaccharide-binding protein; NF-
B, nuclear factor-
B; sCD14, soluble fragment of CD14. ![]()
Received for publication January 9, 1998. Accepted for publication May 8, 1998.
| References |
|---|
|
|
|---|
signal transduction pathway. Nature 366:166.[Medline]
interferon to obtain mutations in the signaling pathway. Mol. Cell. Biol. 9:4605.
B induced by LPS does not require tyrosine kinase activity. J. Biol. Chem. 269:22252.
receptor in human cells. Cell 76:803.[Medline]
This article has been cited by other articles:
![]() |
F. Debierre-Grockiego, M. A. Campos, N. Azzouz, J. Schmidt, U. Bieker, M. G. Resende, D. S. Mansur, R. Weingart, R. R. Schmidt, D. T. Golenbock, et al. Activation of TLR2 and TLR4 by Glycosylphosphatidylinositols Derived from Toxoplasma gondii J. Immunol., July 15, 2007; 179(2): 1129 - 1137. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Viriyakosol, P. S. Tobias, and T. N. Kirkland Mutational Analysis of Membrane and Soluble Forms of Human MD-2 J. Biol. Chem., April 28, 2006; 281(17): 11955 - 11964. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Thomas, A. Sapone, A. Fasano, and S. N. Vogel Gliadin Stimulation of Murine Macrophage Inflammatory Gene Expression and Intestinal Permeability Are MyD88-Dependent: Role of the Innate Immune Response in Celiac Disease J. Immunol., February 15, 2006; 176(4): 2512 - 2521. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Coats, T.-T. T. Pham, B. W. Bainbridge, R. A. Reife, and R. P. Darveau MD-2 Mediates the Ability of Tetra-Acylated and Penta-Acylated Lipopolysaccharides to Antagonize Escherichia coli Lipopolysaccharide at the TLR4 Signaling Complex J. Immunol., October 1, 2005; 175(7): 4490 - 4498. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yang, D. Coriolan, V. Murthy, K. Schultz, D. T. Golenbock, and D. Beasley Proinflammatory phenotype of vascular smooth muscle cells: role of efficient Toll-like receptor 4 signaling Am J Physiol Heart Circ Physiol, September 1, 2005; 289(3): H1069 - H1076. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Mansur, E. G. Kroon, M. L. Nogueira, R. M.E. Arantes, S. C.O. Rodrigues, S. Akira, R. T. Gazzinelli, and M. A. Campos Lethal Encephalitis in Myeloid Differentiation Factor 88-Deficient Mice Infected with Herpes Simplex Virus 1 Am. J. Pathol., May 1, 2005; 166(5): 1419 - 1426. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Zamboni, M. A. Campos, A. C. T. Torrecilhas, K. Kiss, J. E. Samuel, D. T. Golenbock, F. N. Lauw, C. R. Roy, I. C. Almeida, and R. T. Gazzinelli Stimulation of Toll-like Receptor 2 by Coxiella burnetii Is Required for Macrophage Production of Pro-inflammatory Cytokines and Resistance to Infection J. Biol. Chem., December 24, 2004; 279(52): 54405 - 54415. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wu, S. Adam, L. Hamann, H. Heine, A. J. Ulmer, U. Buwitt-Beckmann, and C. Stamme Accumulation of Inhibitory {kappa}B-{alpha} as a Mechanism Contributing to the Anti-Inflammatory Effects of Surfactant Protein-A Am. J. Respir. Cell Mol. Biol., December 1, 2004; 31(6): 587 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-C. Oliveira, J. R. Peixoto, L. B. de Arruda, M. A. Campos, R. T. Gazzinelli, D. T. Golenbock, S. Akira, J. O. Previato, L. Mendonca-Previato, A. Nobrega, et al. Expression of Functional TLR4 Confers Proinflammatory Responsiveness to Trypanosoma cruzi Glycoinositolphospholipids and Higher Resistance to Infection with T. cruzi J. Immunol., November 1, 2004; 173(9): 5688 - 5696. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nilsen, U. Nonstad, N. Khan, C. F. Knetter, S. Akira, A. Sundan, T. Espevik, and E. Lien Lipopolysaccharide and Double-stranded RNA Up-regulate Toll-like Receptor 2 Independently of Myeloid Differentiation Factor 88 J. Biol. Chem., September 17, 2004; 279(38): 39727 - 39735. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Triantafilou, S. Morath, A. Mackie, T. Hartung, and K. Triantafilou Lateral diffusion of Toll-like receptors reveals that they are transiently confined within lipid rafts on the plasma membrane J. Cell Sci., September 1, 2004; 117(17): 4007 - 4014. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Darrah, M. C. G. Monaco, S. Jain, M. K. Hondalus, D. T. Golenbock, and D. M. Mosser Innate Immune Responses to Rhodococcus equi J. Immunol., August 1, 2004; 173(3): 1914 - 1924. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hasebe, A. Yoshimura, T. Into, H. Kataoka, S. Tanaka, S. Arakawa, H. Ishikura, D. T. Golenbock, T. Sugaya, N. Tsuchida, et al. Biological Activities of Bacteroides forsythus Lipoproteins and Their Possible Pathological Roles in Periodontal Disease Infect. Immun., March 1, 2004; 72(3): 1318 - 1325. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Campos, G. M. S. Rosinha, I. C. Almeida, X. S. Salgueiro, B. W. Jarvis, G. A. Splitter, N. Qureshi, O. Bruna-Romero, R. T. Gazzinelli, and S. C. Oliveira Role of Toll-Like Receptor 4 in Induction of Cell-Mediated Immunity and Resistance to Brucella abortus Infection in Mice Infect. Immun., January 1, 2004; 72(1): 176 - 186. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Coats, R. A. Reife, B. W. Bainbridge, T.-T. T. Pham, and R. P. Darveau Porphyromonas gingivalis Lipopolysaccharide Antagonizes Escherichia coli Lipopolysaccharide at Toll-Like Receptor 4 in Human Endothelial Cells Infect. Immun., December 1, 2003; 71(12): 6799 - 6807. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Triantafilou and K. Triantafilou Receptor cluster formation during activation by bacterial products Innate Immunity, October 1, 2003; 9(5): 331 - 335. [Abstract] [PDF] |
||||
![]() |
L.-Y. Huang, J. Aliberti, C. A. Leifer, D. M. Segal, A. Sher, D. T. Golenbock, and B. Golding Heat-Killed Brucella abortus Induces TNF and IL-12p40 by Distinct MyD88-Dependent Pathways: TNF, Unlike IL-12p40 Secretion, Is Toll-Like Receptor 2 Dependent J. Immunol., August 1, 2003; 171(3): 1441 - 1446. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Compton, E. A. Kurt-Jones, K. W. Boehme, J. Belko, E. Latz, D. T. Golenbock, and R. W. Finberg Human Cytomegalovirus Activates Inflammatory Cytokine Responses via CD14 and Toll-Like Receptor 2 J. Virol., April 15, 2003; 77(8): 4588 - 4596. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Malley, P. Henneke, S. C. Morse, M. J. Cieslewicz, M. Lipsitch, C. M. Thompson, E. Kurt-Jones, J. C. Paton, M. R. Wessels, and D. T. Golenbock Recognition of pneumolysin by Toll-like receptor 4 confers resistance to pneumococcal infection PNAS, February 18, 2003; 100(4): 1966 - 1971. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Becker, M. J. Fenton, and J. M. Soukup Involvement of Microbial Components and Toll-like Receptors 2 And 4 in Cytokine Responses to Air Pollution Particles Am. J. Respir. Cell Mol. Biol., November 1, 2002; 27(5): 611 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Henneke, O. Takeuchi, R. Malley, E. Lien, R. R. Ingalls, M. W. Freeman, T. Mayadas, V. Nizet, S. Akira, D. L. Kasper, et al. Cellular Activation, Phagocytosis, and Bactericidal Activity Against Group B Streptococcus Involve Parallel Myeloid Differentiation Factor 88-Dependent and Independent Signaling Pathways J. Immunol., October 1, 2002; 169(7): 3970 - 3977. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Triantafilou, K. Miyake, D. T. Golenbock, and K. Triantafilou Mediators of innate immune recognition of bacteria concentrate in lipid rafts and facilitate lipopolysaccharide-induced cell activation J. Cell Sci., June 15, 2002; 115(12): 2603 - 2611. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Guillot, V. Balloy, F. X. McCormack, D. T. Golenbock, M. Chignard, and M. Si-Tahar Cutting Edge: The Immunostimulatory Activity of the Lung Surfactant Protein-A Involves Toll-Like Receptor 4 J. Immunol., June 15, 2002; 168(12): 5989 - 5992. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Massari, P. Henneke, Y. Ho, E. Latz, D. T. Golenbock, and L. M. Wetzler Cutting Edge: Immune Stimulation by Neisserial Porins Is Toll-Like Receptor 2 and MyD88 Dependent J. Immunol., February 15, 2002; 168(4): 1533 - 1537. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yoshimura, T. Kaneko, Y. Kato, D. T. Golenbock, and Y. Hara Lipopolysaccharides from Periodontopathic Bacteria Porphyromonas gingivalis and Capnocytophaga ochracea Are Antagonists for Human Toll-Like Receptor 4 Infect. Immun., January 1, 2002; 70(1): 218 - 225. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Henneke, O. Takeuchi, J. A. van Strijp, H.-K. Guttormsen, J. A. Smith, A. B. Schromm, T. A. Espevik, S. Akira, V. Nizet, D. L. Kasper, et al. Novel Engagement of CD14 and Multiple Toll-Like Receptors by Group B Streptococci J. Immunol., December 15, 2001; 167(12): 7069 - 7076. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Medvedev, P. Henneke, A. Schromm, E. Lien, R. Ingalls, M. J. Fenton, D. T. Golenbock, and S. N. Vogel Induction of Tolerance to Lipopolysaccharide and Mycobacterial Components in Chinese Hamster Ovary/CD14 Cells Is Not Affected by Overexpression of Toll-Like Receptors 2 or 4 J. Immunol., August 15, 2001; 167(4): 2257 - 2267. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Schromm, E. Lien, P. Henneke, J. C. Chow, A. Yoshimura, H. Heine, E. Latz, B. G. Monks, D. A. Schwartz, K. Miyake, et al. Molecular Genetic Analysis of an Endotoxin Nonresponder Mutant Cell Line: A Point Mutation in a Conserved Region of MD-2 Abolishes Endotoxin-induced Signaling J. Exp. Med., July 2, 2001; 194(1): 79 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rabehi, T. Irinopoulou, B. Cholley, N. Haeffner-Cavaillon, and M.-P. Carreno Gram-Positive and Gram-Negative Bacteria Do Not Trigger Monocytic Cytokine Production through Similar Intracellular Pathways Infect. Immun., July 1, 2001; 69(7): 4590 - 4599. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. S. Campos, I. C. Almeida, O. Takeuchi, S. Akira, E. P. Valente, D. O. Procopio, L. R. Travassos, J. A. Smith, D. T. Golenbock, and R. T. Gazzinelli Activation of Toll-Like Receptor-2 by Glycosylphosphatidylinositol Anchors from a Protozoan Parasite J. Immunol., July 1, 2001; 167(1): 416 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Jones, T. K. Means, K. A. Heldwein, M. A. Keen, P. J. Hill, J. T. Belisle, and M. J. Fenton Different Toll-like receptor agonists induce distinct macrophage responses J. Leukoc. Biol., June 1, 2001; 69(6): 1036 - 1044. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Ingalls, E. Lien, and D. T. Golenbock Membrane-Associated Proteins of a Lipopolysaccharide-Deficient Mutant of Neisseria meningitidis Activate the Inflammatory Response through Toll-Like Receptor 2 Infect. Immun., April 1, 2001; 69(4): 2230 - 2236. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shoham, C. Huang, J.-M. Chen, D. T. Golenbock, and S. M. Levitz Toll-Like Receptor 4 Mediates Intracellular Signaling Without TNF-{{alpha}} Release in Response to Cryptococcus neoformans Polysaccharide Capsule J. Immunol., April 1, 2001; 166(7): 4620 - 4626. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Means, B. W. Jones, A. B. Schromm, B. A. Shurtleff, J. A. Smith, J. Keane, D. T. Golenbock, S. N. Vogel, and M. J. Fenton Differential Effects of a Toll-Like Receptor Antagonist on Mycobacterium tuberculosis-Induced Macrophage Responses J. Immunol., March 15, 2001; 166(6): 4074 - 4082. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yoshimura, H. Takada, T. Kaneko, I. Kato, D. Golenbock, and Y. Hara Structural requirements of muramylpeptides for induction of Toll-like receptor 2-mediated NF-{kappa}B activation in CHO cells Innate Immunity, October 1, 2000; 6(5): 407 - 410. [Abstract] [PDF] |
||||
![]() |
R. R. Ingalls, E. Lien, and D. T. Golenbock Differential roles of TLR2 and TLR4 in the host response to Gram-negative bacteria: lessons from a lipopolysaccharide-deficient mutant of Neisseria meningitidis Innate Immunity, October 1, 2000; 6(5): 411 - 415. [Abstract] [PDF] |
||||
![]() |
N. W. J. Schroder, B. Opitz, N. Lamping, K. S. Michelsen, U. Zahringer, U. B. Gobel, and R. R. Schumann Involvement of Lipopolysaccharide Binding Protein, CD14, and Toll-Like Receptors in the Initiation of Innate Immune Responses by Treponema Glycolipids J. Immunol., September 1, 2000; 165(5): 2683 - 2693. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kol, A. H. Lichtman, R. W. Finberg, P. Libby, and E. A. Kurt-Jones Cutting Edge: Heat Shock Protein (HSP) 60 Activates the Innate Immune Response: CD14 Is an Essential Receptor for HSP60 Activation of Mononuclear Cells J. Immunol., January 1, 2000; 164(1): 13 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Means, E. Lien, A. Yoshimura, S. Wang, D. T. Golenbock, and M. J. Fenton The CD14 Ligands Lipoarabinomannan and Lipopolysaccharide Differ in Their Requirement for Toll-Like Receptors J. Immunol., December 15, 1999; 163(12): 6748 - 6755. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lien, T. J. Sellati, A. Yoshimura, T. H. Flo, G. Rawadi, R. W. Finberg, J. D. Carroll, T. Espevik, R. R. Ingalls, J. D. Radolf, et al. Toll-like Receptor 2 Functions as a Pattern Recognition Receptor for Diverse Bacterial Products J. Biol. Chem., November 19, 1999; 274(47): 33419 - 33425. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Means, S. Wang, E. Lien, A. Yoshimura, D. T. Golenbock, and M. J. Fenton Human Toll-Like Receptors Mediate Cellular Activation by Mycobacterium tuberculosis J. Immunol., October 1, 1999; 163(7): 3920 - 3927. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Sellati, D. A. Bouis, M. J. Caimano, J. A. Feulner, C. Ayers, E. Lien, and J. D. Radolf Activation of Human Monocytic Cells by Borrelia burgdorferi and Treponema pallidum Is Facilitated by CD14 and Correlates with Surface Exposure of Spirochetal Lipoproteins J. Immunol., August 15, 1999; 163(4): 2049 - 2056. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Heine, R. L. Delude, B. G. Monks, T. Espevik, and D. T. Golenbock Bacterial Lipopolysaccharide Induces Expression of the Stress Response Genes hop and H411 J. Biol. Chem., July 23, 1999; 274(30): 21049 - 21055. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yoshimura, E. Lien, R. R. Ingalls, E. Tuomanen, R. Dziarski, and D. Golenbock Cutting Edge: Recognition of Gram-Positive Bacterial Cell Wall Components by the Innate Immune System Occurs Via Toll-Like Receptor 2 J. Immunol., July 1, 1999; 163(1): 1 - 5. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Heine, C. J. Kirschning, E. Lien, B. G. Monks, M. Rothe, and D. T. Golenbock Cutting Edge: Cells That Carry A Null Allele for Toll-Like Receptor 2 Are Capable of Responding to Endotoxin J. Immunol., June 15, 1999; 162(12): 6971 - 6975. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lien, J. C. Chow, L. D. Hawkins, P. D. McGuinness, K. Miyake, T. Espevik, F. Gusovsky, and D. T. Golenbock A Novel Synthetic Acyclic Lipid A-like Agonist Activates Cells via the Lipopolysaccharide/Toll-like Receptor 4 Signaling Pathway J. Biol. Chem., January 12, 2001; 276(3): 1873 - 1880. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Viriyakosol, P. S. Tobias, R. L. Kitchens, and T. N. Kirkland MD-2 Binds to Bacterial Lipopolysaccharide J. Biol. Chem., October 5, 2001; 276(41): 38044 - 38051. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |