| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
B, Activation Protein-1, and Apoptosis1
Cytokine Research Laboratory, Department of Molecular Oncology, University of Texas M. D. Anderson Cancer Center, Houston, TX 77030
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and
activation protein-1 (AP-1) and apoptosis. Pretreatment of cells with
IL-13 blocked TNF-induced NF-B activation, nuclear translocation of
p65 subunit, and degradation of IB
. IL-13 also inhibited
NF-B activation by LPS, okadaic acid, H2O2,
and ceramide. TNF-induced NF-B-dependent gene transcription was also
blocked by IL-13. TNF-induced activation of another nuclear
transcription factor, AP-1, was suppressed by IL-13. The activation of
N-terminal c-Jun kinase and mitogen-activated protein kinase kinase,
implicated in the regulation of AP-1 and NF-B, was also
down-regulated by IL-13. TNF-mediated cytotoxicity and activation of
caspase-3 were abolished by IL-13. The inhibitory effects of IL-13 on
TNF were sensitive to H-7, neomycin, and wortmannin, suggesting that
the pathway consisting of protein kinase C, phosphatidylinositol
3-kinase, and phospholipase C must be involved in IL-13 signaling.
Thus, overall, these results demonstrate that IL-13 is a potent
inhibitor of TNF-mediated activation of NF-B, AP-1, and apoptosis,
which may contribute to its previously described immunosuppressive and
anti-inflammatory effects. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
R
(6). The anti-inflammatory effects of IL-13 are indicated by its
ability in monocytes to suppress LPS-induced production of the
proinflammatory cytokines IL-1, TNF, IL-6, IL-8, IL-10, IL-12,
macrophage inflammatory protein-1, IFN-, granulocyte and monocyte
colony-stimulating factor, and granulocyte CSF (1, 6). In addition,
IL-13 inhibits protein kinase C
(PKC)3-triggered respiratory
bursts (7) and suppresses nitric oxide release from macrophages (8). In
vivo, IL-13 protects animals from LPS-induced lethal endotoxemia (9)
and from IgG immune complex-induced lung injury (10).
IL-13 exhibits several properties similar to those of IL-4. All
cellular responses assigned to IL-13 appear to be also mediated by
IL-4, but the reverse is not the case. For instance, human T cells and
mouse T cells and B cells respond to IL-4 but not to IL-13 (11). The
overlapping biologic activities of the two cytokines are most likely
due to a common -chain of the IL-4R to which both IL-4 and IL-13
bind (12, 13). The reason why some biologic activities do not overlap
may be the requirements for c-chain for IL-4, but not IL-13,
signaling in B lymphocytes and monocytes (14). The IL-13R consists of
IL-4R and a newly identified IL-13-specific binding subunit related
to IL-5R -chain (11, 15). Regardless of the receptor composition,
the engagement of the receptor by the ligand activates protein tyrosine
kinases TYK2 and JAK1, and STAT-6 by both receptors (13). Unlike IL-4,
IL-13 does not activate JAK3, which may also contribute to difference
in activities between the two cytokines. The roles of phospholipase C
(PLC) and phosphotidylinositol 3-kinase (PI-3K) have also been
demonstrated in IL-13 signaling (7, 16).
How IL-13 carries out its anti-inflammatory effects is not known,
but the nuclear transcription factor NF-B is known to play an
important role in immune regulation and inflammation (17). This factor
is present in its inactive state in the cytoplasm. It consists of p50,
p65, and IB subunits, but when activated it translocates to the
nucleus, binds the DNA, and activates genes. The activation involves
the phosphorylation, ubiquitination, and degradation of IB,
leading to the nuclear migration of p50-p65 heterodimer. A wide variety
of inflammatory stimuli activate NF-B, including TNF, IL-1, LPS,
ceramide, phorbol ester, and H2O2. Most of
these stimuli also activate the nuclear transcription factor,
activation protein (AP-1). AP-1 consists of a homodimer and
heterodimers of members of the Jun family (c-Jun, JunB, and JunD) and
heterodimers of the Jun and Fos families (c-Fos, FosB, Fra1, and Fra2)
and is regulated in part by c-Jun N-terminal kinase
(JNK)/stress-activated protein kinase (18). Most of the stimuli that
activate NF-B and AP-1 also induce apoptosis.
Although IL-13 blocks the production of inflammatory cytokines,
as indicated above, whether it also affects their activity is not
clear. Several of the LPS-induced genes whose expression is blocked by
IL-13 contain NF-B binding sites, which would indicate that NF-B
activation may be blocked. In this report we investigated the effect of
IL-13 on TNF-induced activation of NF-B, AP-1, and apoptosis. The
results demonstrate that IL-13 suppressed TNF-mediated activation of
NF-B and AP-1, which correlated with inhibition of JNK and
mitogen-activated protein kinase kinase (MAPKK or MEK). TNF-mediated
cytotoxicity and activation of caspase-3 were also blocked by IL-13.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Purified Escherichia coli-derived recombinant human IL-13 (sp. act., 4.86 x 106/mg protein) was supplied as a gift by Dr. Rene de Waal Malefyt of DNAX (Palo Alto, CA). IL-13 was diluted to 100 µg/ml, aliquoted, and stored at -20°C until use. Glycine, H-7, and wortmannin were obtained from Sigma (St. Louis, MO). Penicillin, streptomycin, neomycin, RPMI 1640 medium, and FCS were obtained from Life Technologies (Grand Island, NY). Bacteria-derived recombinant human TNF, purified to homogeneity with a sp. act. of 5 x 107 U/mg, was provided by Genentech (South San Francisco, CA).
Abs against IB p50, p65, c-Jun kinase, cyclin D1, c-Rel,
double-stranded oligonucleotides for NF-B and AP-1, and
single-stranded oligonucleotide for NF-B were obtained from Santa
Cruz Biotechnology (Santa Cruz, CA). Phosphospecific
anti-p44/42 MAPK (Thr202/Tyr204) Ab raised
in rabbits was obtained from New England Biolabs (Beverley, MA).
Anti-poly(ADP)-ribose polymerase (PARP) Ab was obtained from
PharMingen (San Diego, CA). The plasmids (wild-type and mutant)
-243RMICAT with rat MDR1b promoter possessing either
wild-type or mutated NF-B binding site linked to chloramphenicol
acetyltransferase (CAT) reporter gene were supplied by Dr. M. Tien Kuo,
University of Texas M. D. Anderson Cancer Center (Houston, TX).
The characterization of these plasmids has been described previously in
detail (19).
Cell lines
The cell lines employed in this study included U937 (human histiocytic lymphoma), Jurkat (human T cell line), HeLa (human epithelial), and H4 (human glioma). All these cell lines were obtained from the American Type Culture Collection (Mannasas, VA). Murine B cell lymphoma B9 was obtained from Dr. Lucien A. Aarden (Red Cross Blood Transfusion Service, Amsterdam, The Netherlands). All these cells were cultured in RPMI 1640 medium containing 10% FBS, penicillin (100 U/ml), and streptomycin (100 µg/ml). B9 cells were cultured in the presence of IL-6 (provided by Dr. Toshio Hirano, Osaka University, Osaka, Japan). All these cells were mycoplasma free as tested by the Gen-Probe mycoplasma rapid detection kit (Fisher Scientific, Pittsburgh, PA).
Assay for NF-B and AP-1
NF-B was assayed by the method of Chaturvedi et al. (20).
Briefly, nuclear extracts from 2 x 106 cells were
prepared according to the method of Schreiber et al. (21).
Electrophoretic mobility shift assays (EMSAs) were performed by
incubating 4 µg of nuclear extract with 16 fmol of 32P
end-labeled 45-mer double-stranded NF-B oligonucleotide from the HIV
long terminal repeat,
5'-TTGTTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGG-3'
(underlined regions are consensus NF-B binding sites), for 15 min at
37°C. The incubation mixture included 2 to 3 µg of poly(dI-dC) in a
binding buffer. The DNA-protein complex formed was separated from free
oligonucleotide on 6.6% native PAGE, and then the gel was dried. A
double-stranded mutated oligonucleotide,
5'TTGTTACAACTCACTTTCCGCTGCTCACTTTCCAGG
GAGGCGTGG3', was used to examine the specificity of binding of
NF-B to the DNA. The specificity of binding was also examined by
competition with the unlabeled oligonucleotide.
For AP-1, nuclear extracts were prepared as described above. EMSA was performed by incubating nuclear extracts (6 µg protein) with 28 fmol using 32P end-labeled double-stranded oligonucleotide of AP-1, 5'-CGCTTGATGACTCAGCCGGAA-3' (3'-GCGAACTACTGAGTCGGCCTT5'; underlined regions are consensus AP-1 binding sites), and resolved on 6% native polyacrylamide gel. The specificity of binding was determined using an excess of unlabeled oligonucleotide.
Visualization and quantitation of radioactive bands were conducted with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) using ImageQuant software.
Western blot analysis
After the NF-B activation reaction described above,
postnuclear extracts were resolved on 8.5% SDS-polyacrylamide gels for
IB. To determine the p50 and p65 levels, nuclear and postnuclear
(cytoplasmic) extracts were resolved on 8.5% SDS-PAGE. The proteins
were electrotransferred to nitrocellulose filters, probed with a rabbit
polyclonal Ab against IB and p65, and detected by
chemiluminescence (ECL, Amersham, Arlington Heights, IL) (20).
IL-6 bioassay
B9 hybridoma cells were grown in RPMI 1640 medium supplemented with 10% FBS, penicillin (100 IU/ml), and streptomycin (100 µg/ml). The IL-6 bioassay was performed as described previously (22, 23). Briefly, 5000 B9 cells in 100 µl of culture medium were seeded in 96-well flat-bottom microtiter plates in the presence of known amounts of recombinant human IL-6 or 100 µl of culture supernatant (different dilution) from U937 cells treated with TNF, IL-13, or their combination. Cell proliferation was measured by thymidine incorporation after 48 h (50 µl of [3H]thymidine diluted in HBSS containing 0.5 µCi/well). After addition of thymidine, cells were harvested after 12 h and washed, and thymidine incorporation was measured in a beta counter (Packard, Downers Grove, IL).
MAPK assay
MAPK was assayed by the modified method of Cowley (24). Briefly, U937 cells were stimulated with different concentrations of TNF. After incubation for 30 min at 37°C, cells were washed with Dulbecco’s PBS and then extracted with lysis buffer containing 20 mM HEPES (pH 7.4), 2 mM EDTA, 250 mM NaCl, 0.1% Nonidet P-40, 2 µg/ml leupeptin, 2 µg/ml aprotinin, 1 mM PMSF, 0.5 µg/ml benzamidine, 1 mM DTT, and 1 mM sodium orthovanadate. The protein concentration in the supernatant was determined and then resolved at 50 µg of protein/lane on 10% SDS-PAGE. After the electrophoresis, the proteins were electrotransferred onto nitrocellulose filters and probed with the phospho-specific anti-p44/42 MAPK (Thr202/Tyr204) Ab (New England Biolabs) raised in a rabbit (1/3000 dilution). Then, the membrane was incubated with peroxidase-conjugated anti-rabbit IgG (1/3000 dilution), and bands were detected by chemiluminescence (ECL, Amersham).
Immunoblot analysis of PARP degradation
TNF-induced apoptosis was examined by proteolytic cleavage of PARP (25). Briefly, cells (2 x 106/ml) were treated with cycloheximide (10 µg/ml) and TNF (1 nM) for 2 h at 37°C. After treatment, cell extracts were prepared by incubating the cells for 30 min on ice in 0.05 ml of buffer containing 20 mM HEPES (pH 7.4), 2 mM EDTA, 250 mM NaCl, 0.1% Nonidet P-40, 2 µg/ml leupeptin, 2 µg/ml aprotinin, 1 mM PMSF, 0.5 µg/ml benzamidine, and 1 mM DTT. The lysate was centrifuged, and the supernatant was collected. Cell extract protein (50 µg) was resolved in 7.5% SDS-PAGE, electrotransferred onto a nitrocellulose membrane, blotted with mouse anti-PARP Ab, and then detected by chemiluminescence (ECL, Amersham). Apoptosis was represented by the cleavage of 116-kDa PARP into a 85-kDa peptide product.
MTT assay
Cell viability and activity were detected by the MTT dye assay, in which the dye is converted into formasan granules in the presence of reactive oxygen. After overnight incubation at 37°C, the granules were lysed with SDS and dimethylformamide, and the absorbance of formasan granules was detected at 590 nm using a 96-well multiscanner autoreader (Dynatech MR 5000, Dynal, Chantilly, VA).
c-Jun kinase assay
The c-Jun kinase assay was performed using a modified method as
described previously (25). Briefly, after treatment of cells (3 x
106/ml) with TNF for 10 min, cell extracts were prepared by
lysing cells in buffer containing 20 mM HEPES (pH 7.4), 2 mM EDTA, 250
mM NaCl, 1% Nonidet P-40, 2 µg/ml leupeptin, 2 µg/ml aprotinin, 1
mM PMSF, 0.5 µg/ml benzamidine, and 1 mM DTT. Cell extracts (150–250
µg/sample) were subjected to immunoprecipitation with 0.3 µg of
anti-JNK Ab for 60 min at 4°C. The immune complex was collected
by incubation with protein A/G-Sepharose beads for 45 min at 4°C. The
beads were extensively washed with lysis buffer (four times, 400 µl
each time) and kinase buffer (twice, 400 µl each time; 20 mM HEPES
(pH 7.4), 1 mM DTT, and 25 mM NaCl). Kinase assays were performed for
15 min at 30°C with
glutathione-S-transferase-Jun1–79 in 20 mM
HEPES (pH 7.4), 10 mM MgCl2, 1 mM DTT, and 10 µCi
[-32P]ATP. Reactions were stopped by the addition of
15 µl 2x SDS sample buffer, boiled for 5 min, and subjected to
SDS-PAGE (9%).
Glutathione-S-transferase-Jun1–79 was
visualized by staining with Coomassie blue, and the dried gel was
analyzed with a PhosphorImager (Molecular Dynamics).
Transient transfection and CAT assay
U937 cells were transiently transfected with -243RMICAT
(wild-type) and -243RMICAT-m (mutant) gene for 6 h using the
calcium phosphate method, according to the instructions supplied by the
manufacturer (Life Technologies). After transfection, the cells were
incubated for 24 h at 37°C and then treated with IL-13 (10
ng/ml) 24 h before stimulation with 100 and 1000 pM TNF for 1
h. Thereafter, the cells were washed with PBS and examined for CAT
activity as previously described (26).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B
activation, p65 translocation, IB degradation, NF-B-dependent
gene expression, production of IL-6, and activation of AP-1, JNK, MEK,
cytotoxicity, and caspase-3. We used U937 cell for these studies
because various TNF responses in this cell line have been well
characterized in our laboratory. The time of incubation and the
concentration of IL-13 used in our studies had no effect on the
viability of these cells as assessed by trypan blue dye uptake.
Treatment of U-937 cells for 24 h with IL-13 also had no
significant effect on the TNF receptors as determined by ligand binding
(27). Specific TNF binding to untreated and IL-13-treated cells was
5598 ± 172 and 5181 ± 328 cpm, respectively. As TNF binds
to cells through p60 and p80 receptors, we also examined the effect of
IL-13 on each type of TNF receptor by using receptor-specific Abs (27).
The specific binding to p60 and p80 receptors on untreated cells was
3924 ± 198 and 1650 ± 106 cpm, respectively; in
IL-13-treated cells the specific binding to p60 and p80 receptors was
4053 ± 310 and 1813 ± 211 cpm, respectively. These results
thus indicate that there is no significant change in either total or
p60 or p80 receptor subunits after treatment of U-937 cells with IL-13.
IL-13 inhibits TNF-dependent NF-B activation
U937 cells were preincubated at 37°C for 24 h with
different concentrations of IL-13 and then treated with TNF (100 pM)
for 30 min at 37°C. The cells were examined for NF-B activation by
EMSA. The results in Figure 1
A
indicate that 5 to 10 ng/ml IL-13 inhibited most of the TNF-induced
response. IL-13 by itself did not activate NF-B even up to 100
ng/ml. We next tested the minimum duration of IL-13 preexposure
required to inhibit TNF-induced NF-B activation. Cells were
incubated with IL-13 for 0 to 24 h before a 30-min exposure to
TNF. Inhibition could first be seen at 6 h, but maximum inhibition
required 24-h pretreatment (Fig. 1B).
|
B within 5 min, and this
induction is higher in its intensity than that obtained with cells
using 1/100th the concentration of TNF for longer times (27). To
determine the effect of IL-13 on NF-B activation at even higher
concentrations, both untreated and IL-13-pretreated cells were
incubated with various concentrations of TNF (0–10,000 pM) for 30 min,
and then the NF-B was assayed by EMSA (Fig. 1
C). Although
activation of NF-B by 10,000 pM TNF was strong, IL-13 inhibited it
almost as efficiently as it did at 0.1 nM. These results show that
IL-13 is a very potent inhibitor of NF-B activation. To determine
the effect of IL-13 on the kinetics of TNF-induced NF-B activation,
both untreated and IL-13-pretreated cells were incubated with TNF (100
pM) and then exposed to TNF for 0 to 60 min. In untreated cells, the
activation of NF-B by TNF was first detected at 5 min and reached
maximum at 30 min. In IL-13-pretreated cells, no significant activation
of NF-B was detected up to 30 min (Fig. 1D).
To show that the retarded band visualized by EMSA in TNF-treated cells
was indeed NF-B, we incubated nuclear extracts from TNF-activated
cells with Ab to either p50 (NF-BI) or p65 (Rel A) subunits and then
conducted EMSA. Abs to either subunit of NF-B shifted the band to a
higher m.w. (Fig. 1E), thus suggesting that the
TNF-activated complex consisted of p50 and p65 subunits. Neither
preimmune serum nor irrelevant Abs (anti-c-Rel and anti-cyclin
DI) had any effect on the mobility of NF-B. In addition, excess cold
NF-B oligonucleotide (100-fold) completely eliminated the band,
indicating it was specifically NF-B (Fig. 1E). An
oligonucleotide with mutated NF-B binding site failed to bind the
p50-p65 heterodimer (Fig. 1E).
IL-13 inhibits TNF-dependent degradation of IB and
p65 nuclear translocation
The translocation of NF-B to the nucleus is preceded by
phosphorylation and proteolytic degradation of IB (17). To
determine whether the inhibitory action of IL-13 was due to an effect
on IB degradation, the cytoplasmic levels of IB proteins
was examined by Western blot analysis. In control cells, partial
IB degradation could be noted within 5 min of TNF administration,
complete degradation occurred by 10 min, and full resynthesis of
IB was seen by 30 min. In IL-13-pretreated cells, however, no
degradation of IB was noted at any time during the 60-min period.
Thus, IL-13 completely blocked the TNF-mediated degradation of IB
(Fig. 2A).
|
B activation requires nuclear translocation of the p65
subunit of NF-B, we measured the level of p65 in the cytoplasm and
nucleus. As expected, upon TNF treatment, the level of p65 declined in
the cytoplasm and concurrently increased in the nucleus (Fig. 2B). Treatment of the cells with IL-13 abolished the
TNF-dependent change in the nuclear and cytoplasmic p65 levels. These
results show that IL-13 inhibits the TNF-induced translocation of p65
to the nucleus, which is consistent with IL-13-induced inhibition of
TNF-dependent degradation of IB.
IL-13 blocks PMA-, LPS-, H2O2-, okadaic
acid-, and ceramide-mediated activation of NF-B
Besides TNF, NF-B is also activated by wide variety of other
agents, including, PMA, H2O2, LPS, okadaic
acid, and ceramide. As the mechanisms by which these agents activate
NF-B may differ (17), we investigated the effect of IL-13 on
activation of the transcription factor by these various agents. The
results shown in Figure 3A
indicate that IL-13 completely blocked the activation of NF-B
induced by all these agents. These results suggest that IL-13 may act
at a step where all these agents converge in the signal transduction
pathway leading to NF-B activation.
|
B activation by IL-13 is cell type specific
All the effects of IL-13 described above were examined with human
myeloid U937 cells. Whether IL-13 also affects T cells or epithelial
cells was also investigated. First, we investigated the specific
binding of TNF to U-937 (myeloid), Jurkat (T cells), HeLa (epithelial),
and H4 (glioma) cell lines by the method previously described (27);
these values were 5598 ± 172, 4251 ± 287, 3748 ± 31,
and 2317 ± 148, respectively. Then we examined the ability of
IL-13 to block TNF-induced NF-B activation in T (Jurkat),
epithelial (HeLa), and glioma (H4) cells. The results of these
experiments (Fig. 3B) indicate that IL-13 inhibited
TNF-induced NF-B activation in epithelial cells, but not in T cells
or in H4 glioma cells. The lack of effect of IL-13 on T cells is
consistent with the published reports (11).
IL-13 blocks NF-B-dependent gene expression
The results presented above indicate that pretreatment of cells
with IL-13 blocks NF-B activation as determined by DNA binding. To
determine whether IL-13 also affects NF-B-dependent gene
transcription, cells were transfected with a plasmid containing the rat
MDR1b promoter with NF-B binding sites linked to a CAT reporter
gene. We used a transient expression assay to determine the effect of
IL-13 on TNF-induced CAT gene transcription. As expected, almost 5- and
10-fold increases in CAT activity were obtained upon stimulation with
100 and 1000 pM TNF, respectively (Fig. 4A). However, TNF-induced CAT
activity was completely abolished when the cells were pretreated with
IL-13 for 24 h before TNF treatment. Transfection with an MDR gene
containing a mutated NF-B binding site abrogated the induction of
CAT activity by TNF. These results demonstrate that IL-13 also
represses MDR gene expression induced by NF-B activator, TNF.
|
B activation (23). Therefore, we also examined the effect of
IL-13 on TNF-induced IL-6 production from U-937 cells. The production
of IL-6 from these cells was assayed by the proliferation of B9 cells.
These cells undergo proliferation when cultured in presence of IL-6.
The results showed that IL-13 inhibited TNF-stimulated IL-6 production
in a dose-dependent manner, with a maximum effect at 10 ng/ml (Fig. 4B). IL-13 inhibits TNF-induced AP-1 activation
Besides NF-B, TNF is a potent activator of another
transcription factor, AP-1 (28). The mechanism of AP-1 activation,
however, is known to be different from that of NF-B (29). Thus, we
also investigated the effect of IL-13 on TNF-induced AP-1 activation.
Treatment of control cells with 1 nM TNF for 2 h induced a
sevenfold increase in AP-1 binding. Pretreatment of cells with IL-13,
however, inhibited the TNF-induced AP-1 activation in a dose-dependent
manner, completely abolishing it at 10 ng/ml (Fig. 5A). AP-1 activation by TNF
concentrations even higher than 1 nM was also suppressed by IL-13 (Fig. 5B). Competition with the unlabeled AP-1 probe abolished DNA
binding, indicating specificity. Thus, IL-13 also inhibits TNF-induced
AP-1 activation, suggesting that IL-13 acts at a step common to AP-1
and NF-B activation.
|
A kinase that regulates AP-1 activation, JNK, is activated by TNF
(30). Activation of JNK precedes AP-1 activation. Therefore, we
examined the effect of IL-13 on the activation of JNK. The exposure of
U-937 cells to 1 nM TNF for 10 min caused a 17-fold increase in the
activation of JNK (Fig. 6A).
Pretreatment of cells with different concentrations of IL-13 for
24 h, however, abolished the TNF-induced JNK. At 10 ng/ml IL-13,
no activation of JNK by TNF was detected (Fig. 6A). We also
investigated the time required for exposure to IL-13 to suppress
TNF-mediated JNK activation. Cells were exposed to 10 ng/ml IL-13 for
0, 3, 6, 12, and 24 h, and then activated with 1 nM TNF for 10 min
and assayed for JNK. The 24-h pretreatment with IL-13 proved to be a
prerequisite for inhibition of TNF-mediated JNK activation (Fig. 6B). Thus, it is possible that suppression of AP-1
activation by IL-13 is due to inhibition of JNK.
|
Some of the recent reports indicate that NF-B activation by TNF
requires activation of MAPK kinase kinase (31), which is known to
phosphorylate MEK. Other reports show that inactivation of MAPK kinase
kinase has no effect on TNF-induced NF-B activation (18, 32). We
investigated whether IL-13 inhibits TNF-induced NF-B activation in
our system by blocking MEK activation. U-937 cells were pretreated with
0 to 10 ng/ml IL-13 for 24 h, and then stimulated with TNF (100
pM) for 30 min and assayed for MEK. The results in Figure 6C
show that TNF increased the activity of MEK and that this activity was
abolished by pretreatment of cells with increasing concentrations of
IL-13. These results thus suggest that the effect of IL-13 on NF-B
activation may be mediated through the MAPK pathway.
IL-13 blocks TNF-induced cytotoxicity and caspase-3 activation
Activations of NF-B, AP-1, and JNK are early cellular responses
to TNF. Induction of cytotoxicity to tumor cells is a late response.
Whether IL-13 modulates TNF-mediated cytotoxicity was also
investigated. U-937 cells were treated with 1 nM TNF for 24 h and
then examined for cytotoxicity by MTT assay. Under these conditions
approximately 90% cell killing was induced by TNF (Fig. 7A). When cells were
pretreated with IL-13, however, TNF-induced cytotoxicity was suppressed
in a dose-dependent manner, reaching almost 100% protection at 8 ng/ml
(Fig. 7A). These results suggest that the cytotoxic effects
of TNF are also antagonized by IL-13. How TNF induces cytotoxicity is
not fully understood, but activation of a protease, caspase-3, has been
shown to be involved, and it precedes cytotoxicity (33). We examined
the effect of IL-13 on TNF-mediated activation of caspase-3. U-937
cells were pretreated with IL-13 (10 ng/ml) for 24 h, then
stimulated with TNF (1 nM) for 2 h in the presence of
cycloheximide (10 µg/ml) and assayed for caspase-3 by its ability to
cleave PARP protein. A 2-h treatment with TNF induced complete cleavage
of PARP (Fig. 7B). However, when cells were pretreated with
IL-13, no TNF-mediated PARP cleavage was observed, suggesting that
IL-13 also inhibits caspase-3. Thus, IL-13 blocks TNF-induced
cytotoxicity via inhibition of caspase-3.
|
How IL-13 inhibits the wide variety of TNF effects was further
investigated. Recently, it was shown by using metabolic inhibitors that
PKC, PLC, and PI3K play essential roles in IL-13 signaling (7, 16). For
these studies, neomycin, H-7, and wortmannin were used to block PLC,
PKC, and PI3K, respectively. Pretreatment of cells with different
concentrations of neomycin (Fig. 8A), H-7 (Fig. 8B),
or wortmannin (Fig. 8C) for 1 h before treatment with
IL-13 (10 ng/ml) abolished the inhibitory effect of IL-13 on
TNF-induced NF-B activation. The effects of all the inhibitors was
specific because at the concentrations of these inhibitors used they
had no effect by themselves and did not affect TNF-induced NF-B
activation (Fig. 8). Besides NF-B, we also examined the effect of
the metabolic inhibitors on the suppression by IL-13 of TNF-mediated
cytotoxicity. The results in Figure 8D show that both
neomycin and H-7 blocked the effect of IL-13 on TNF-mediated
cytotoxicity, thus suggesting that IL-13 suppresses all the effects of
TNF by a similar mechanism.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and AP-1
activation. Besides TNF, NF-B activation by a wide variety of other
agents was also abolished by IL-13. Suppression of AP-1 activation
correlated with inhibition of JNK and MEK by IL-13. TNF-induced
apoptosis was also blocked by IL-13. Suppression by IL-13 appeared to
involve PKC, PLC, and PI-3 kinase.
NF-B activation regulates a large number of genes involved in
inflammation, including cytokines (e.g., TNF, IL-1, IL-8, IL-6,
granulocyte CSF, and granulocyte-macrophage CSF), cell adhesion
proteins (e.g., ICAM-1, endothelial leukocyte adhesion
molecule-1, and vascular cell adhesion molecule-1), MHC genes,
and enzymes (e.g., nitric oxide synthase cyclo-oxygenase, and magnesium
superoxide dismutase) (17). It is possible that the immunosuppressive
effects of IL-13 are due to inhibition of expression of some of these
genes through inhibition of NF-B activation. Suppression of
LPS-induced TNF, IL-1, IL-8, and NOS by IL-13 has been demonstrated (6, 7). These reports are in agreement with our results, which show that
IL-13 blocks LPS-mediated NF-B activation. The inhibition of
immunodeficiency virus type I production by IL-13 (34, 35) may also be
due to its effects on NF-B as reported here.
How IL-13 blocks NF-B activation is not clear and will not be
until we have full understanding of the pathway leading to NF-B
activation. Recently, the TNF-induced pathway was found to involve
binding of the cytoplasmic domain of TNF receptor to the TNF
receptor-associated death domain; the latter then recruits TNF
receptor-associated factor-2, which then binds to
NF-B-inducing kinase, which, in turn, binds to I-
and I-ß to cause the phosphorylation and degradation of
IB, finally leading to NF-B activation (32, 36). This pathway
does not account for the roles of reactive oxygen species and various
other phosphatases and kinases that have been implicated in
TNF-mediated NF-B activation (29, 36, 37). In addition, recent
results indicate that TNF-induced NF-B activation is normal in
animals in which the TNF receptor-associated factor-2 gene has
been deleted, suggesting that there are alternate mechanisms (38, 39).
Moreover, the pathway by which TNF activates NF-B differs from that
activated by other agents (17). IL-13, however, blocked the NF-B
activation induced by all the agents, including TNF, LPS, ceramide,
okadaic acid, H2O2, and PMA, indicating that a
common step in the pathway for all these agents is blocked by IL-13. As
ROI are needed for NF-B activation by a wide variety of agents, it
is possible that the effects of IL-13 are due to suppression of ROI
generation. Indeed, IL-13 has been shown to block PMA-induced ROI
production in human monocytes (7). In some systems, IL-13 can
up-regulate the expression of proteins such as Bcl-xL and Mcl-1, which
can quench ROS (40). This may also play an important role in the action
of IL-13.
IL-13 blocked TNF-induced AP-1 activation. How IL-13 suppresses AP-1
activation is not clear. It is unlikely that IL-13 works as an
antioxidant, because antioxidants, even though they suppress NF-B
activation, activate AP-1 (29). AP-1 activation has been shown to be
regulated by JNK through phosphorylation of c-Jun (30). Since we found
that IL-13 also blocked JNK activation by TNF, it is possible that AP-1
suppresses IL-13 through JNK.
IL-13 also inhibited TNF-induced cytotoxicity. The pathway leading to
cytotoxicity/apoptosis by TNF is known to involve the interaction of
the cytoplasmic domain of the p60 receptor with the TNF
receptor-associated death domain, which then binds to FADD,
which, in turn, binds to Fas-associated death domain-like
IL-1-converting enzyme/caspase-8, leading finally to the
sequential activation of caspase-1 and caspase-3 and PARP cleavage
(33). We found that TNF-induced caspase-3 activation was inhibited by
IL-13. Although there are reports that JNK activation is needed for
apoptosis induction by certain stimuli (41), whether JNK activation is
needed for TNF-induced apoptosis is not known. Nevertheless, it is
possible IL-13 exerts its effects on TNF-induced apoptosis through
inhibition of JNK. Although some reports suggest that NF-B
activation protects the cells from TNF-induced apoptosis (18, 42),
others demonstrate either a lack of a role for NF-B activation in
TNF-induced apoptosis (43) or its involvement in inducing apoptosis
(44). Our results are in agreement with the latter. The inhibitory
effects of IL-13 on TNF-induced apoptosis could also be due to its
ability to induce anti-apoptotic proteins such as Bcl-xL (40).
Recent reports indicate that IL-13 may exhibit its effects
through activation of PLC and PI-3K, inasmuch as neomycin (PLC
inhibitor) and wortmannin (PI-3K) blocked the effects of IL-13 on human
monocytes (7, 16). These results are in agreement with ours, in which
neomycin and wortmannin blocked all the suppressive effects of IL-13 on
TNF. We also showed that the IL-13-induced inhibition was neutralized
by H-7, a potent inhibitor of PKC; to our knowledge this is the first
report implicating PKC in IL-13 signaling. In human monocytes, IL-13
inhibited the PKC-triggered respiratory burst through mobilization of
calcium and elevation of intracellular cAMP (7). IL-4, a cytokine that
shares several cellular responses with IL-13, however, is known to
mediates its effects in part through PKC. For instance, inhibition of
nitric oxide synthesis (dependent on NF-B activation) by IL-4
involves inhibiting the activation of PKC
(45).
Our results indicate that IL-13 inhibits TNF-induced NF-B
activation in myeloid and epithelial cells but not in T cells or glioma
cells. The lack of effect of IL-13 on human Jurkat cells could be due
to the lack of IL-13R, which is consistent with previous report on
human T cells (11). Although human glioma cells are known to
overexpress IL-13R (46), it is possible that the lack of effect of
IL-13 on TNF-induced NF-B activation in the H4 cell line is due to
the absence of IL-13R. Similar and dissimilar effects of IL-4 and IL-13
are due to common and distinct receptor subunits (11, 12, 13, 14, 15). Previous
studies have shown that IL-4 also blocks TNF-induced NF-B activation
in monocytes but not in fibroblasts (47) or in endothelial cells (48).
IL-1-induced NF-B activation, however, was potentiated by IL-4 (49).
Our observations indicate that, like IL-13, IL-4 suppresses TNF-induced
NF-B activation in monocytes, but the mechanism of suppression by
the two cytokines may differ (S. K. Manna and B. B. Aggarwal,
unpublished observations).
Previously it has been shown that IL-4 potentiates the cytotoxic effects of TNF (50), in contrast to the action of IL-13, which inhibits these effects. In addition, we show here that TNF-induced AP-1 and JNK activation are suppressed by IL-13. Whether IL-4 modulates these activities activated by TNF has not been demonstrated. Overall our results provide the molecular basis for immunosuppressive effects of IL-13 and demonstrate that besides blocking production of inflammatory cytokines, IL-13 also down-regulates their signaling.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Bharat B. Aggarwal, Cytokine Research Laboratory, Department of Molecular Oncology, University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., P.O. Box 143, Houston, TX 77030. E-mail address:
3 Abbreviations used in this paper: PKC, protein kinase C; PLC, phospholipase C; PI-3K, phosphatidylinositol-3-kinase; IB, inhibitory subunit of NF-B; AP-1, activation protein-1; JNK, c-Jun N-terminal kinase; MEK, mitogen-activated protein kinase kinase; MAPK, mitogen-activated protein kinase; PARP, poly(adenosine diphosphate)ribose polymerase; CAT, chloramphenicol acetyltransferase; EMSA, electrophoretic mobility shift assay; H-7, 1-(5-isoquinolinyl sulfonyl)-2-methyl piperazine; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide.
Received for publication February 26, 1998. Accepted for publication May 6, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
or IL-10. J. Immunol. 151:1.[Abstract]
, IFN-, and IL-12 production. J. Immunol. 158:2898.[Abstract]
chain of the IL-2 receptor. J. Biol. Chem. 272:20251.B as a frequent target for immunosuppressive and anti-inflammatory molecules. Adv. Immunol. 65:111.[Medline]
B activation prevents cell death. Cell 87:565.[Medline]
B-mediated induction of mdr1b expression by insulin in rat hepatoma cells. J. Biol. Chem. 272:15174.B activation. J. Biol. Chem. 272:30129. and tumor necrosis factor- in monocytic cells involves cooperation between interferon regulatory factor-1, NFB, and Sp1 transcription factors. J. Biol. Chem. 270:27920.B activation and c-Jun kinase activation: comparison with the endogenous receptor. J. Immunol. 160:3152.. Nature 337:661.[Medline]
B and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor. EMBO J. 12:2005.[Medline]
B kinase complex by MEKK1, a kinase of the JNK pathway. Cell 88:213.[Medline]
B and c-jun N-terminal kinase (JNK/SAPK) pathways at TNF receptor-associated factor 2. Proc. Natl. Acad. Sci. USA 94:9792.B activation: the I B kinase revealed?. Cell 82:299.
B. J. Biol. Chem. 270:10631.B activation and regulates lymphocyte proliferation and survival. Immunity 7:703.[Medline]
B activation, and increased sensitivity to TNF-induced cell death in TRAF2-deficient mice. Immunity 7:715.[Medline]
B. Science 274:784.B alpha overexpression in human breast carcinoma MCF7 cells inhibits nuclear factor-B activation but not tumor necrosis factor--induced apoptosis. J. Biol. Chem. 272:96.B induced upon apoptosis. J. Cell. Biol. 134:13.B activity in monocytes and fibroblasts. J. Immunol. 151:5603.[Abstract]
-stimulated E-selectin gene transcription is mediated by STAT6 antagonism of NF-B. J. Biol. Chem. 272:10212.B activation. Hematopathol. Mol. Hematol. 10:171.[Medline]
This article has been cited by other articles:
|
|
 |
|
  K. Silbermann, G. Schneider, and R. Grassmann Stimulation of interleukin-13 expression by human T-cell leukemia virus type 1 oncoprotein Tax via a dually active promoter element responsive to NF-{kappa}B and NFAT J. Gen. Virol., November 1, 2008; 89(11): 2788 - 2798. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Wu, R. J. Martin, S. LaFasto, B. J. Efaw, J. G. Rino, R. J. Harbeck, and H. W. Chu Toll-like Receptor 2 Down-regulation in Established Mouse Allergic Lungs Contributes to Decreased Mycoplasma Clearance Am. J. Respir. Crit. Care Med., April 1, 2008; 177(7): 720 - 729. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. de Kozak, B. Omri, J. R. Smith, M.-C. Naud, B. Thillaye-Goldenberg, and P. Crisanti Protein Kinase C{zeta} (PKC{zeta}) Regulates Ocular Inflammation and Apoptosis in Endotoxin-Induced Uveitis (EIU): Signaling Molecules Involved in EIU Resolution by PKC{zeta} Inhibitor and Interleukin-13 Am. J. Pathol., April 1, 2007; 170(4): 1241 - 1257. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Waldele, G. Schneider, T. Ruckes, and R. Grassmann Interleukin-13 Overexpression by Tax Transactivation: a Potential Autocrine Stimulus in Human T-Cell Leukemia Virus-Infected Lymphocytes J. Virol., June 15, 2004; 78(12): 6081 - 6090. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. K. Samanta, H. J. Huang, R. C. Bast Jr., and W. S.-L. Liao Overexpression of MEKK3 Confers Resistance to Apoptosis through Activation of NF{kappa}B J. Biol. Chem., February 27, 2004; 279(9): 7576 - 7583. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Berrebi, S. Bruscoli, N. Cohen, A. Foussat, G. Migliorati, L. Bouchet-Delbos, M.-C. Maillot, A. Portier, J. Couderc, P. Galanaud, et al. Synthesis of glucocorticoid-induced leucine zipper (GILZ) by macrophages: an anti-inflammatory and immunosuppressive mechanism shared by glucocorticoids and IL-10 Blood, January 15, 2003; 101(2): 729 - 738. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ichiyama, M. Nishikawa, T. Yoshitomi, S. Hasegawa, T. Matsubara, T. Hayashi, and S. Furukawa Clarithromycin Inhibits NF-{kappa}B Activation in Human Peripheral Blood Mononuclear Cells and Pulmonary Epithelial Cells Antimicrob. Agents Chemother., January 1, 2001; 45(1): 44 - 47. [Abstract] [Full Text]
|
|
|
|
 |
|
 J. M. Woods, K. J. Katschke Jr., M. Tokuhira, H. Kurata, K.-I. Arai, P. L. Campbell, and A. E. Koch Reduction of Inflammatory Cytokines and Prostaglandin E2 by IL-13 Gene Therapy in Rheumatoid Arthritis Synovium J. Immunol., September 1, 2000; 165(5): 2755 - 2763. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bergmann, P. J. Barnes, and R. Newton Molecular Regulation of Granulocyte Macrophage Colony-Stimulating Factor in Human Lung Epithelial Cells by Interleukin (IL)-1beta , IL-4, and IL-13 Involves Both Transcriptional and Post-Transcriptional Mechanisms Am. J. Respir. Cell Mol. Biol., May 1, 2000; 22(5): 582 - 589. [Abstract] [Full Text]
|
|
|
|
 |
|
 L. M. Staudt The Molecular and Cellular Origins of Hodgkin's Disease J. Exp. Med., January 17, 2000; 191(2): 207 - 212. [Full Text] [PDF]
|
|
|
|
|
|
H. Yoshidome, A. Kato, M. Miyazaki, M. J. Edwards, and A. B. Lentsch IL-13 Activates STAT6 and Inhibits Liver Injury Induced by Ischemia/Reperfusion Am. J. Pathol., October 1, 1999; 155(4): 1059 - 1064. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Wright, G. Kolios, J. Westwick, and S. G. Ward Cytokine-induced Apoptosis in Epithelial HT-29 Cells Is Independent of Nitric Oxide Formation. EVIDENCE FOR AN INTERLEUKIN-13-DRIVEN PHOSPHATIDYLINOSITOL 3-KINASE-DEPENDENT SURVIVAL MECHANISM J. Biol. Chem., June 11, 1999; 274(24): 17193 - 17201. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. K. Manna and B. B. Aggarwal Interleukin-4 Down-regulates Both Forms of Tumor Necrosis Factor Receptor and Receptor-mediated Apoptosis, NF-kappa B, AP-1, and c-Jun N-Terminal Kinase. COMPARISON WITH INTERLEUKIN-13 J. Biol. Chem., December 11, 1998; 273(50): 33333 - 33341. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
