| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Celltech Therapeutics Ltd., Slough, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-chain from the TCR complex. Using an
engineered human single chain Fv derived from P67, an mAb with
specificity for human CD33, and a spacer comprising an Ab hinge region
with either Fc
or part of the CD28 extracellular region, fusion
molecules were constructed to test the ability of single chain designs
to mediate both primary signaling and costimulation from one
extracellular binding event. Constructs with the CD28 signaling domain
proximal and the -chain distal to the membrane were found to express
more efficiently in Jurkat than constructs with the opposite
orientation and were capable of mediating up to 20 times more IL-2
production on stimulation with solid phase Ag when compared with
transfectants expressing chimeric receptors with -chain
intracellular signaling domains only. IL-2 production was specific to
Ag challenge and was completely inhibited by incubation with free Ab of
the same specificity as the extracellular binding site of the
construct, but not by an isotype-matched control Ab. The CD28
intracellular domain of these fusion proteins was shown to be capable
of binding the p85 subunit of phosphatidylinositol 3'-kinase. These
constructs represent the first of a new generation of single gene
multidomain chimeric receptors capable of mediating both primary and
costimulatory signaling specifically from a single extracellular
recognition event. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
However, there is now substantial evidence that naive T cells require
more than one stimulus for efficient activation. Although engagement of
the TCR by peptide in the context of MHC is essential for the initial
steps of the activation pathway, occupancy of the TCR alone in the
absence of other, costimulatory signals does not lead to proliferation
of the majority of primary T cells but, rather, induces a state of
unresponsiveness or anergy (16, 17). As tumor cells in general fail to
express molecules that provide costimulation, the T cell response to
Ags presented on MHC by tumor cells is further compromised (18, 19). In
accordance with the two-signal hypothesis of T cell activation,
chimeric receptors with an scFv extracellular region and a TCR
-chain intracellular sequence do not activate naive T cells in
transgenic mice (20), in contrast to the ability of similar constructs
to activate cells in culture in the presence of high levels of IL-2
(9). Thus, the potential clinical use of current chimeric receptors may
be restricted to transduction of ex vivo-derived T cells stimulated
with high levels of cytokines for autologous adoptive immunotherapy.
A number of molecules with costimulatory signaling capacity in T cells have been identified, including CD2 (21), CD4 and CD8 (22), CD5 (23), and CD28 (24, 25). CD28 in particular has been shown to play a key role in the activation of naive T cells through interaction with members of the B7 family of molecules (B7-1, CD80, and B7-2, CD86) on APCs (26). The short intracellular domain of CD28 serves to initiate a signal transduction cascade, which is distinct from the primary signal delivered by the TCR. On binding of the extracellular domain of CD28 to B7, the intracellular domain of CD28 becomes phosphorylated at the tyrosine residue in a motif that conforms to the consensus amino acid sequence YMXM. This is a member of a subgroup of so-called intracellular tyrosine-based activation motifs that serve to recruit the receptor-specific signaling proteins containing phosphotyrosine-binding SH2 domains. Three molecules to date have been shown to bind phosphorylated CD28: the regulatory subunit (p85) of phosphatidylinositol 3'-kinase, the tyrosine kinase ITK (inducible T cell kinase), and the adaptor molecule grb-2 (27). The mechanism by which ligand binding leads to phosphorylation and recruitment of molecules capable of mediating intracellular signaling is not completely understood, but at least in some circumstances receptor oligomerization may be sufficient to initiate signal transduction. Cross-linking of a chimeric receptor comprising a CD8 extracellular domain and a CD28 intracellular domain led to activation of phosphatidylinositol 3'-kinase and enhanced IL-2 production in Jurkat cells (28).
A chimeric receptor (29) similar to those described above, with an
extracellular scFv binding domain, but with a CD28 intracellular domain
in place of the TCR -chain, has been shown to deliver costimulatory
signals similar to those elicited by cross-linking of unmodified CD28
when combined with stimulation via the TCR/CD3 complex. In the same
report double transfectants expressing scFv-CD28 and scFv- chimeric
receptors, with specificities for different haptens, were shown to
produce maximal levels of IL-2 in response to specific Ags.
In this paper we investigate the concept of providing primary and
costimulatory signaling from a single gene product. We describe single
chain chimeric receptors with scFv Ab extracellular domains (30) and
intracellular sequences comprising the signaling region of CD28 in
series with the signaling region of the -chain from the TCR complex.
Extracellular binding specificity for the constructs is provided by the
engineered human single chain Fv derived from P67 (31), an mAb with
specificity for human CD33, which is currently in clinical trials as a
drug conjugate for treatment of acute myeloid leukemia. Spacers are
used to distance the extracellular binding domain from the membrane
(32) and comprise the hinge region from human IgG1 with either the CH2
and CH3 domains from IgG1 (referred to as G1) (33) or part of the
extracellular region of CD28 (referred to as h.28). The primary
signaling and costimulatory regions are, respectively, either proximal
or distal to the membrane, and the transmembrane sequence is taken from
the region proximal to the membrane in either case. Constructs are
stably expressed in the human CD4+ve T cell line Jurkat,
and the ability of the transfectants to produce IL-2 on challenge with
either solid phase CD33 or HL60 cells expressing CD33 is compared.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
MOPC21 isotype-matched control Ab was obtained from Sigma (St. Louis, MO). Murine P67 Ab (34) was purified from hybridoma supernatant on a protein A-Sepharose column (Pharmacia, Piscataway, NJ). Soluble CD33 was purified by affinity chromatography on a P67 affinity column from supernatant from an NS0 stable cell line generated by transfection with a human CD33 gene genetically manipulated to allow secretion (gift from M. Rolfe).
Cell lines
The human cell lines HL60 (premyelocytic) and Jurkat E6.1 (T lymphoblastoma) were obtained from American Type Culture Collection (Rockville, MD) and cultured in DMEM supplemented with 10% FCS, 4 mM glutamine, and 1% penicillin/streptomycin (Life Technologies, Grand Island, NY).
Transfection
Stably transfected Jurkat cell lines were generated by electroporation. DNA was prepared by p500 columns according to the manufacturer’s instructions (Qiagen, Chatsworth, CA), and 30 µg was linearized with SalI before adding it to 1 x 107 PBS-washed Jurkat E6.1. Electroporation conditions were two pulses of 1000 V and 3 µF (Bio-Rad Gene Pulser, Hercules, CA). Cells were left to recover for 24 h in nonselective media. Following selection in 2 mg/ml antibiotic G418 (geneticin, Sigma), transfectants were maintained in the same concentration of G418 for a maximum period of 1 mo.
Construction of chimeric receptor genes
Each component of the chimeric receptor constructs was either
PCR cloned or PCR assembled by standard techniques and subcloned in a
cassette format into pBluescript SK+ (Stratagene, La Jolla,
CA; see Fig. 1
, A–E).
|
Hinge-CD28 cassette. Human CD28 extracellular, transmembrane, and intracellular components were PCR cloned from human leukocyte cDNA (Clontech, Palo Alto, CA) with oligos S0146 (introducing a 5' SpeI site) and P3241 (introducing a 3' EcoRI site). S0146 also constitutes residues 234 to 243 of human IgG1 hinge.
G1 spacer cassette. Human IgG1 hinge, CH2, and CH3 were PCR cloned from IgG1 cDNA clone (gift from A. Popplewell) with oligos S0060 (introducing a 5' SpeI site) and S0061 (introducing residues L, D, P, and K constituting a 3' BamHI site). PCR product was restricted with SpeI and BamHI and subcloned into pBluescript SK+.
h.28 spacer cassette. Human IgG1 hinge and part of human CD28 extracellular component were PCR cloned from the hinge-CD28 cassette with oligos T4057 and T4058. T4057 introduces a 5' SpeI site and T4058 introduces residues L, D, P, and K constituting a 3' BamHI site. PCR product was restricted with SpeI and BamHI and subcloned into pBluescript SK+.
TCR cassette. Human transmembrane and intracellular
components were PCR cloned from human leukocyte cDNA (Clontech) with
oligos R6488 (introducing a 5' BamHI site) and R6489
(introducing a 3' EcoRI site). PCR product was restricted
with BamHI and EcoRI and subcloned into
pBluescript SK+.
Human CD28 cassette. Human CD28 transmembrane and intracellular components were PCR cloned from human leukocyte cDNA (Clontech) with oligos P3240 (introducing a 5' BamHI site) and P3241 (introducing a 3' EcoRI site). PCR product was restricted with BamHI and EcoRI and subcloned into pBluescript SK+.
-CD28 fusion cassette. The 3' end of , starting at a
naturally occurring StyI site, and the intracellular
component of human CD28 were PCR assembled such that the stop codon
was removed, and an in-frame fusion protein would be translated. PCR
assembly was conducted with overlapping oligos: P3301, P3302, P3303,
P3304, P3305, and P3306. PCR product was restricted with
StyI and EcoRI and subcloned into pBluescript
SK+ containing the TCR cassette, replacing the 3' end
of zeta.
CD28- fusion cassette. Human CD28 transmembrane and
intracellular components were PCR cloned from the hinge-CD28 cassette
with oligos T7145 and T4060. T7145 introduces residues L, D, P, and K
constituting a 3' BamHI site. T4060 comprises a 3' overhang
compatible with the 5' end of human intracellular component.
The human intracellular component was PCR cloned from the
TCR cassette with oligos T4387 and S4700. T4387 comprises a 5'
overhang compatible with the 3' end of human CD28 intracellular
component. S4700 introduces a 3' EcoRI site. CD28
transmembrane and intracellular components were then PCR spliced to
intracellular component with oligos T7145 andS4700. PCR product was
restricted with BamHI and EcoRI and subcloned
into pBluescript SK+.
All of the above cassettes were completely sequenced (Applied Biosystems, Taq DyeDeoxy Terminator Cycle Sequencing, part 901497, Foster City, CA) in pBluescript SK+ before cloning into the expression vectors.
All oligos were either synthesized in-house or supplied by Oswell (Edinburgh, Scotland). All oligos are listed in the 5' to 3' orientation: R6490, ATATAGCGGCCGCAAGCTTCCACCATGTCTGTCCCCACCCAAGTCCTC; R6491, TGACCCTCCGCCACCTGACCCTCCGCCACCTGACCCTCCGCCACCTGACCCTCCGCCACCTGACCCTCCGCCACCTTTTACTTCTACTTTAGTACC; R6492, GGTGGCGGAGGGTCAGGTGGCGGAGGGTCAGGTGGCGGAGGGTCAGGTGGCGGAGGGTCAGAGGTGCAGCTGGTGCAGTCT; R6493, TATATACTAGTAGAAGACACTGTCACCAGTGT; S0146, CGACTAGTGACAAAACTCACACATGCCCACCGTGCCCAAAAGGGAAACACCTTTGTCCAAGTCCC; P3241, TATGAATTCTCAGGAGCGATAGGCTGCGAA; S0060, CGACTAGTGACAAAACTCACACATGCCCACCG; S0061, TTGGGATCCAGTTTACCCGGAGACAGGGAGAGGCT; T4057, CTACTAGTGACAAAACTCACAC;T4058, TTGGGATCCAGGGGCTTAGAAGGTCCGGAAATAG; R6488, ATATAGGATCCCAAACTCTGCTACCTGCTG; R6489, TATATGAATTCTTAGCGAGGGGGCAGGGCCTGCAT; P3240, TATGGATCCAAGCCCTTTTGGGTGCTGGTGGTG; P3301, GCCACCAAGGACACCTACGACGC; P3302, CCCCCTCGCAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCC; P3303, CAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCTGAGAATTCATA; P3304, TATGAATTCTCAGGAGCGATAG;P3305,GCATAGGGCTGGTAATGCTTCGGGTGGGCCCGGGGCGGCGGGGAGTCATGTTCATGTAGT; P3306, CTCTTACTCCTGCGAGGGGGCAGGGCCTGCATGTGAAGGGCGTCGTAGGTGTCCTTGGTGGC; T7145, CTGGATCCCAAATTTTGGGTGCTGGTGGTGGTTG; T4060, GCTCCTGCTGAACTTCACTCTGGAGCGATAGGCTGCGAAGTCG;T4387, GCGACTTCGCAGCCTATCGCTCCAGAGTGAAGTTCAGCAGGAGCG; and S4700, TATGAATTCTTAGCGAGGGGGCAGGGCCTGCATG.
The cassettes described above were assembled using standard molecular
biology techniques to construct chimeric receptors with the specificity
of the engineered human Ab hP67, directed against human CD33. The
following chimeric receptors were constructed (see Fig. 1
, A–E).
A) P67/G1/ chimeric receptor consists of a single chain Fv linked to
an extracellular spacer comprising human IgG 1 hinge, CH2 and CH3,
linked to the transmembrane and intracellular regions of human TCR .
The single chain Fv consists of the leader sequence and variable
component of the light chain of the engineered human Ab linked via a
(Gly4Ser)5 linker to the variable component of
the heavy chain of the engineered human Ab. The extracellular spacer
consists of residues 234 to 243 of human IgG1 hinge, 244 to 360 of CH2,
and 361 to 478 of CH3 (35). This is linked to residues 6 to 142 of
human TCR comprising extracellular (part), transmembrane, and
intracellular regions (36, 37).
B) P67/G1/-CD28 fusion chimeric receptor consists of a single chain
Fv linked to an extracellular spacer comprising human IgG 1 hinge, CH2
and CH3, linked to the transmembrane and intracellular regions of human
fused to the intracellular region of human CD28. The single chain
Fv and extracellular spacer and human TCR are the same as in A
above. The TCR is linked to residues 162 to 202 comprising the
intracellular component of human CD28 (38).
C) P67/G1/CD28- fusion chimeric receptor consists of a single chain
Fv linked to an extracellular spacer comprising human IgG 1 hinge, CH2
and CH3, linked to the transmembrane and intracellular regions of human
CD28 fused to the intracellular region of human . The single chain
Fv and extracellular spacer are the same as in A and B above. The
extracellular spacer is linked via residues L, D, P, and K to residues
135 to 202 comprising the transmembrane and intracellular components of
human CD28. This is linked to residues 31 to 142 of human TCR , the
intracellular region (36, 37).
D) P67/h.28/-CD28 fusion chimeric receptor consists of a single
chain Fv linked to an extracellular spacer consisting of human IgG1
hinge, part of the extracellular region of human CD28, and four amino
acid residues, linked to the transmembrane and intracellular regions of
human TCR fused to the intracellular region of human CD28. The
single chain Fv and intracellular regions are the same as in B above.
The extracellular spacer consists of residues 234 to 243 of human IgG1
hinge and residues 118 to 134 of human CD28, and this is linked via
residues L, D, P, and K to the intracellular regions.
E) P67/h.28/CD28- fusion chimeric receptor consists of a single
chain Fv linked to an extracellular spacer consisting of human IgG1
hinge, part of the extracellular region of human CD28, and four amino
acid residues, linked to the transmembrane and intracellular regions of
human CD28 fused to the intracellular region of human . The single
chain Fv and intracellular regions are the same as in C above. The
extracellular spacer is the same as in D above, and this is linked via
residues L, D, P, and K to the intracellular regions.
Full-length chimeric receptor genes were subcloned from pBluescript vectors on a HindIII to EcoRI fragment into the expression vector EE6HCMVNeo, a derivative of pEE6 (39) containing the human CMV intermediate early promoter and the bacterial gene for neomycin (antibiotic G418) resistance. All expression vectors were analyzed by restriction enzyme mapping.
Flow cytometry
Approximately 5 x 105 cells were washed once with PBS plus 5% FCS then incubated with 1 µg/ml FITC-conjugated soluble CD33 at 4°C for 30 min. Cells were washed again in PBS/5% FCS, and expression levels of chimeric receptors were analyzed in a FACScan cytometer (Becton Dickinson, Mountain View, CA). Estimation of the number of CD33 molecules bound per cell was performed using a quantum fluorescence kit for MESF (molecules of equivalent soluble fluorochrome) units of FITC (Sigma QMF10).
Stimulation and IL-2 production assays
Jurkat control or chimeric receptor effector cells (1 x 105) were stimulated by incubation on 96-well plates (Nunc Immunol, Naperville, IL) precoated with soluble CD33 titrated from 5 µg/ml in 0.1 M NaHCO3 (pH 9.6), OKT-3 at 5 µg/ml in PBS (pH 7.2), OKT-3, and anti-CD28 (Caltag, South San Francisco, CA) at 2.5 µg/ml each in PBS (pH 7.2) or by coincubation in 96-well U-bottom plates (Falcon, Oxnard, CA) with HL60 target cells at an E:T cell ratio of 1:1 or 1:5. The specificity of effector and target interaction was demonstrated by preincubation of HL60 target cells with 100 µg/ml of either mouse P67 Ab or an isotype-matched control mouse Ab (MOPC21) 30 min before addition of effector cells.
After 20- to 24-h incubation in a humidified 37°C incubator, supernatants from cell cultures were harvested and assayed for human IL-2 (Quantikine kit, R&D Systems, Minneapolis, MN).
Immunoprecipitation and Western blotting
The ability of Fc to bind protein A was used for
immunoprecipitation. Jurkat control cells and G1 spacer chimeric
receptor transfectants were lysed at 6 x 107 cells/ml
in a buffer consisting of 1% Nonidet P-40, 150 mM NaCl, 50 mM HEPES,
10 mM NaF, 1 mM EDTA, and 1 mM EGTA, pH 7, supplemented with the
following protease inhibitors: 2 mM NaVO4, 1 mg/ml Pefabloc
(Boehringer Mannheim, Indianapolis, IN), 10 µg/ml pepstatin,
10 µg/ml leupeptin, and 20 µg/ml aprotinin (Boehringer Mannheim).
After 10 min on ice, lysates were spun at 15,000 rpm for 10 min at
4°C. Lysate supernatants were immunoprecipitated for 1 h at
4°C with protein A-agarose beads (Upstate Biotechnology, Lake Placid,
NY) equilibrated in lysis buffer. Beads were washed in lysis buffer,
and immunoprecipitates were separated by 4 to 20% SDS-PAGE under
nonreducing conditions. Gel loading of lysates was adjusted according
to relative levels of receptor expression determined by FACS analysis.
Ten micrograms of A431 cell lysate, supplied as a positive control with
primary Ab (Upstate Biotechnology), was also loaded. Separated proteins
were transferred to a polyvinylidene difluoride membrane (NOVEX, San
Diego, CA) and blocked overnight in PBS containing 2% nonfat powered
milk and 0.1% Tween. The membrane was incubated with primary Ab,
rabbit polyclonal anti-p85 Ab (Upstate Biotechnology), then washed
extensively in PBS/0.1% Tween; bound Ab was detected with a second
horseradish peroxidase-conjugated donkey Ab to rabbit IgG (Jackson
Immunoresearch, West Grove, PA). After further washing, signal
was detected by a nonisotopic enhanced chemiluminescence assay (ECL
assay, Amersham International, Aylesbury, U.K.).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell surface expression of functional chimeric receptors was
determined by FACS analysis after incubation with fluorescent soluble
CD33. Figure 2 shows histograms of FL1
signal plotted against frequency for transfectants expressing the five
constructs described. Expression of P67/h.28/CD28- was similar to
that of P67/G1/, with a median 2000 molecules of CD33 bound/cell.
The presence of the CD28 extracellular spacer resulted in greater
expression of the CD28- signaling sequence than did the G1 spacer.
Constructs with the -chain proximal and the CD28 intracellular
domain distal to the membrane gave poor expression in Jurkat
transfectants, with <500 molecules of CD33 bound/cell.
|
Figure 3A shows the
concentration of IL-2 found in the supernatant of cultures of Jurkat
transfectants that had been incubated for 20 h with solid phase
CD33 Ag. Untransfected Jurkat cells and cells transfected with the
expression vector control produced no detectable IL-2 in response to
the CD33. Cells expressing P67/G1/ produced 70 pg/ml, while
constructs with the costimulatory and primary signaling domains
combined on the same protein chain were able to mediate IL-2 production
of up to 1600 pg/ml. Again, the h.28 spacer was seen to be advantageous
compared with the G1 spacer in fusion proteins with the same
intracellular signaling domains. No IL-2 was detected in cultures of
transfectants expressing chimeric receptors with the intracellular
orientation -CD28 with this form of stimulation.
|
B the production of IL-2 from transfectants
stimulated with cellular Ag is illustrated. Jurkat cells were incubated
with HL60 cells expressing CD33 at E:T cell ratios of 1:1 and 1:5.
Untransfected Jurkat cells and cells transfected with the expression
vector control produced no detectable IL-2 on incubation with
Ag-positive target cells. Cells expressing P67/G1/ produced 90 pg/ml
at an E:T cell ratio of 1:1, but this increased to >200 pg/ml as the
number of stimulators increased relative to the number of effectors.
The construct that produced the most IL-2 on solid phase Ag,
P67/h.28/CD28-, was the most efficient at mediating IL-2 production
from cellular Ag. No increase in IL-2 production was evident from
transfectants expressing this construct when the E:T cell ratio was
decreased from 1:1 to 1:5. Again the h.28 spacer was more efficient
than the G1 spacer at mediating IL-2 production. In contrast to results
with solid phase CD33, constructs with the intracellular orientation
-CD28 were able to mediate IL-2 production of some 100 to 200 pg/ml
on challenge with HL60 cells, with this level increasing when the E:T
cell ratio was decreased from 1:1 to 1:5.
Figure 3C shows the effect of titrating solid phase CD33 on
IL-2 production from P67/G1/ and P67G1/CD28-. IL-2 levels were
maximal for both constructs at CD33 coating concentrations of 5 and 2.5
µg/ml and decreased in each case as the coating concentration was
reduced to 1.25 µg/ml and 0.63 µg/ml. Stimulation with solid phase
anti-CD3 and a solid phase mixture of anti-CD3 and
anti-CD28 was compared with stimulation with immobilized CD33. The
amount of IL-2 mediated by P67/G1/CD28- stimulated with solid phase
CD33 was more than twofold greater than the level seen when a solid
phase mixture of anti-CD3 and anti-CD28 was used. This is in
contrast to the threefold underperformance of P67/G1/ on CD33
relative to stimulation with anti-CD3 and anti-CD28.
IL-2 production could be specifically and completely inhibited in all
transfectants by incubation of HL60 stimulator cells with free P67 Ab
(Fig. 4). No inhibition of IL-2
production was observed when MOPC-21, an isotype-matched control Ab,
was included in place of P67 in cultures of transfectants and HL60
cells.
|
In Figure 5 the presence of the p85
subunit of phosphatidylinositol 3'-kinase is revealed
immunoprecipitated with both the G1-spaced chimeric receptors featuring
the CD28 intracellular signaling domain, but not associated with the
G1-spaced chimeric receptor featuring only the -chain
intracellularly.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
chimeric
receptors, and here we present data from a set of molecules featuring
an extracellular scFv Ab binding domain with intracellular CD28 and
-chain signaling domains in series on a single chain. Each chimeric receptor was analyzed as a bulk transfection to provide a representative population of many individual transfectants. These cells were selected in the maximum possible level of G418 and maintained in culture for short periods to ensure a consistent expression level. This bulk transfection minimizes influence from individual positional integration effects to allow clear demonstration of differences in performance between constructs. We believe that such transfectants more closely resemble effector populations generated by in vivo targeted gene delivery.
Although the expression of construct P67/h.28/CD28- was similar to
the level seen with P67/G1/, inclusion of the CD28 intracellular
signaling domain in the design led to a 20-fold increase in the
secretion of IL-2 from Jurkat transfectants challenged with solid phase
CD33 Ag. This increase compares favorably with the 5- to 7-fold
improvement reported for the addition of cross-linked anti-CD28 Ab
to transfectants expressing chimeric receptors with signaling only
(29). When the IL-2 production from transfectants expressing constructs
P67/G1/ and P67/G1/CD28-, which share the same spacer, was
compared, there was a 10-fold increase attributable to the inclusion of
the CD28 intracellular signaling domain, less than the 20-fold reported
above. However the expression of P67/G1/CD28- was some 50% that of
the P67/G1/ construct, suggesting a roughly similar contribution
from the costimulatory domain in both cases.
The amount of IL-2 produced by P67/G1/CD28- when stimulated by
immobilized CD33 coated at 5 and 2.5 µg/ml was over twofold higher
than the level seen after stimulation with a solid phase mixture of
anti-CD3 and anti-CD28 coated at 2.5 µg/ml each. As the
concentration of coated Ab was saturating and could be considered to
provide conditions conducive to activation through both primary and
secondary signaling, the performance of the chimeric receptor is
particularly significant. In the same experiment, P67/G1/, which
lacks a CD28 intracellular domain, was shown to be at a disadvantage
not only in relation to P67/G1/CD28-, but also when compared with
stimulation with anti-CD3 mixed with anti-CD28. The threefold
underperformance of P67/G1/ on CD33 relative to anti-CD3 with
anti-CD28 together with the greater than twofold outperformance of
P67/G1/CD28- on CD33 relative to anti-CD3 with anti-CD28
provide another clear demonstration of the beneficial effect on IL-2
production of including the CD28 domain in series with the primary
signaling region in chimeric receptor design.
When HL60 cells were used to provide stimulation for the transfectants,
the maximal secretion of IL-2 was fourfold lower than the 1600 pg/ml
seen with solid phase CD33 stimulation. This may be due to the lower
density of CD33 Ag presented on the target cell surface compared with
the saturating coating on plastic solid phases, and it is interesting
that IL-2 production from p67/h.28/CD28- could not be increased from
HL60 cells as the E:T cell ratio was decreased, suggesting that the
density rather than the total amount of Ag used in stimulation is
important. The ability of the constructs to redistribute on the surface
of Jurkat may be important here (42) and has implications for the
design of the transmembrane domain of the constructs and the choice of
Ag targeted.
However, the increase in IL-2 production attributable to the inclusion
of the CD28 signaling domain was at best only 4-fold over the level
seen with the -chain chimeric receptor when stimulation was provided
by HL60 cells compared with the maximal 20-fold improvement seen above.
It would seem possible that other adhesion molecules on HL60 cells are
capable of providing limited costimulation to the Jurkat transfectants,
partially masking the CD28-mediated secondary signaling (43). The
3-fold improvement in IL-2 production from P67/G1/ stimulated with
HL60 cells over solid phase CD33 would seem to support this view. The
performances of the P67/spacer/-CD28 transfectants on solid phase
CD33 and HL60 cells are interesting in this regard, as they exhibit
barely detectable expression, produce no detectable IL-2 on solid phase
CD33, yet secrete significant levels of IL-2 on stimulation with HL60
cells, implicating reliance on alternative secondary stimulation. This
also suggests that this orientation of primary and secondary signaling
domains is particularly efficient at mediating signaling, at least from
Ag expressed on cell surfaces. The poor expression of constructs with
the intracellular sequence -CD28 may be due to partial masking of
key residues within that are responsible for providing transport of
assembled TCR chains from the Golgi to the cell surface (44).
The increase in IL-2 secretion seen when the CD28 intracellular
domain was included in the design of the chimeric receptors appears not
to be due simply to spatial reorganization of the signaling domain
intracellularly, but is due instead to genuine initiation of the
costimulatory pathway as judged by immunoprecipitation of the p85
subunit of phosphatidylinositol 3'-kinase. Western blots suggest that
the p85 subunit is constitutively associated with the chimeric
receptors expressed in Jurkat, although it remains possible that the
immunoprecipitation with protein A provides sufficient
stimulus for phosphorylation of the YMNM motif leading to recruitment
of the SH2-containing signaling molecules. The chimeric receptors
described have the ability to form stable dimers through the IgG hinge,
which was designed in the spacer region; they may also associate with
endogenous TCR complex in Jurkat, so constitutive phosphorylation and
association of signaling molecules might be expected. There appeared to
be no gross difference in the efficiency of recruitment of p85 between
the relative orientations of CD28 and .
Although Jurkat cells have proved useful for initial studies with the
chimeric receptors described, we are currently evaluating these
molecules in primary human CD4 and CD8 T cells, where the contribution
from the costimulatory domain might be expected to be more profound.
Previously described - or -chain chimeric receptors, which
provide primary signaling only, require high levels of exogenous IL-2
to demonstrate efficacy in animal models (9, 10, 12). The chimeric
receptors described here, which incorporate both primary and
costimulatory signaling domains in tandem and mediate greatly enhanced
cytokine production, may overcome the requirement for administration of
potentially toxic doses of exogenous cytokine in vivo.
Combining the two signaling domains on the same polypeptide chain offers advantages over expressing two distinct chimeric receptors, one with a primary signaling domain and a second with a costimulatory signaling domain. The two-receptor approach would probably require different spacer regions to prevent heterodimer formation and would be more difficult to deliver using a recombinant retroviral system. Consistent relative expression of each signaling domain would also be harder to achieve with the two-gene approach.
The chimeric receptors described in this paper represent the first of a new generation of single gene products that address the goal of MHC- and exogenous cytokine-independent activation of naive T cells and are specifically designed for in vivo gene therapy.
|
Footnotes |
|---|
2 Present address: Oxford Biomedica Ltd., The Medawar Center, Robinson Ave., Oxford Science Park, Oxford OX4 4GA, United Kingdom.
Received for publication February 6, 1998. Accepted for publication May 19, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
or subunits of the immunoglobulin and T-cell receptors. Proc. Natl. Acad. Sci. USA 90:720. chain. J. Exp. Med. 178:361.-chimera. Int. J. Cancer 68:232.[Medline]
gene-redirected human T lymphocytes produce cytokines, specifically lyse tumor cells, and recycle lytic capacity. J. Immunol. 157:836.[Abstract]
chain alone are insufficient to prime resting T lymphocytes. J. Exp. Med. 181:1653.-chain domain of chimeric T cell receptor components is required for efficient ligand binding and signaling activity. Gene Ther. 2:539.[Medline]
chain: distinction from the molecular CD3 complex. Proc. Natl. Acad. Sci. USA 85:9709. subunits as defined by cDNA cloning and sequence analysis. Eur. J. Immunol. 20:1741.[Medline]
This article has been cited by other articles:
|
|
 |
|
  H. Wang, H. Wei, R. Zhang, S. Hou, B. Li, W. Qian, D. Zhang, G. Kou, J. Dai, and Y. Guo Genetically Targeted T Cells Eradicate Established Breast Cancer in Syngeneic Mice Clin. Cancer Res., February 1, 2009; 15(3): 943 - 950. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. C.R. Emtage, A. S.Y. Lo, E. M. Gomes, D. L. Liu, R. M. Gonzalo-Daganzo, and R. P. Junghans Second-Generation Anti-Carcinoembryonic Antigen Designer T Cells Resist Activation-Induced Cell Death, Proliferate on Tumor Contact, Secrete Cytokines, and Exhibit Superior Antitumor Activity In vivo: A Preclinical Evaluation Clin. Cancer Res., December 15, 2008; 14(24): 8112 - 8122. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. J. Pegram, J. T. Jackson, M. J. Smyth, M. H. Kershaw, and P. K. Darcy Adoptive Transfer of Gene-Modified Primary NK Cells Can Specifically Inhibit Tumor Progression In Vivo J. Immunol., September 1, 2008; 181(5): 3449 - 3455. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Savoldo, C. M. Rooney, A. Di Stasi, H. Abken, A. Hombach, A. E. Foster, L. Zhang, H. E. Heslop, M. K. Brenner, and G. Dotti Epstein Barr virus specific cytotoxic T lymphocytes expressing the anti-CD30{zeta} artificial chimeric T-cell receptor for immunotherapy of Hodgkin disease Blood, October 1, 2007; 110(7): 2620 - 2630. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Brentjens, E. Santos, Y. Nikhamin, R. Yeh, M. Matsushita, K. La Perle, A. Quintas-Cardama, S. M. Larson, and M. Sadelain Genetically Targeted T Cells Eradicate Systemic Acute Lymphoblastic Leukemia Xenografts Clin. Cancer Res., September 15, 2007; 13(18): 5426 - 5435. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Biagi, V. Marin, G. M. P. Giordano Attianese, E. Dander, G. D'Amico, and A. Biondi Chimeric T-cell receptors: new challenges for targeted immunotherapy in hematologic malignancies Haematologica, March 1, 2007; 92(3): 381 - 388. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-R. Jiang, D. E. Gilham, K. Mulryan, N. Kirillova, R. E. Hawkins, and P. L. Stern Combination of Vaccination and Chimeric Receptor Expressing T Cells Provides Improved Active Therapy of Tumors J. Immunol., October 1, 2006; 177(7): 4288 - 4298. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Moeller, N. M. Haynes, M. H. Kershaw, J. T. Jackson, M. W. L. Teng, S. E. Street, L. Cerutti, S. M. Jane, J. A. Trapani, M. J. Smyth, et al. Adoptive transfer of gene-engineered CD4+ helper T cells induces potent primary and secondary tumor rejection Blood, November 1, 2005; 106(9): 2995 - 3003. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Willemsen, C. Ronteltap, P. Chames, R. Debets, and R. L. H. Bolhuis T Cell Retargeting with MHC Class I-Restricted Antibodies: The CD28 Costimulatory Domain Enhances Antigen-Specific Cytotoxicity and Cytokine Production J. Immunol., June 15, 2005; 174(12): 7853 - 7858. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. N. Cooper, Z. Al-Kadhimi, L. M. Serrano, T. Pfeiffer, S. Olivares, A. Castro, W.-C. Chang, S. Gonzalez, D. Smith, S. J. Forman, et al. Enhanced antilymphoma efficacy of CD19-redirected influenza MP1-specific CTLs by cotransfer of T cells modified to present influenza MP1 Blood, February 15, 2005; 105(4): 1622 - 1631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. H. Kershaw, J. T. Jackson, N. M. Haynes, M. W. L. Teng, M. Moeller, Y. Hayakawa, S. E. Street, R. Cameron, J. E. Tanner, J. A. Trapani, et al. Gene-Engineered T Cells as a Superior Adjuvant Therapy for Metastatic Cancer J. Immunol., August 1, 2004; 173(3): 2143 - 2150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. M. Finney, A. N. Akbar, and A. D. G. Lawson Activation of Resting Human Primary T Cells with Chimeric Receptors: Costimulation from CD28, Inducible Costimulator, CD134, and CD137 in Series with Signals from the TCR{zeta} Chain J. Immunol., January 1, 2004; 172(1): 104 - 113. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Nguyen, I. Moisini, and T. L. Geiger Identification of a murine CD28 dileucine motif that suppresses single-chain chimeric T-cell receptor expression and function Blood, December 15, 2003; 102(13): 4320 - 4325. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Pinthus, T. Waks, K. Kaufman-Francis, D. G. Schindler, A. Harmelin, H. Kanety, J. Ramon, and Z. Eshhar Immuno-Gene Therapy of Established Prostate Tumors Using Chimeric Receptor-redirected Human Lymphocytes Cancer Res., May 15, 2003; 63(10): 2470 - 2476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. M. Haynes, J. A. Trapani, M. W. L. Teng, J. T. Jackson, L. Cerruti, S. M. Jane, M. H. Kershaw, M. J. Smyth, and P. K. Darcy Rejection of Syngeneic Colon Carcinoma by CTLs Expressing Single-Chain Antibody Receptors Codelivering CD28 Costimulation J. Immunol., November 15, 2002; 169(10): 5780 - 5786. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. M. Haynes, J. A. Trapani, M. W. L. Teng, J. T. Jackson, L. Cerruti, S. M. Jane, M. H. Kershaw, M. J. Smyth, and P. K. Darcy Single-chain antigen recognition receptors that costimulate potent rejection of established experimental tumors Blood, October 16, 2002; 100(9): 3155 - 3163. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. J. Niederman, Z. Ghogawala, B. S. Carter, H. S. Tompkins, M. M. Russell, and R. C. Mulligan Antitumor activity of cytotoxic T lymphocytes engineered to target vascular endothelial growth factor receptors PNAS, May 14, 2002; 99(10): 7009 - 7014. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Geiger, P. Nguyen, D. Leitenberg, and R. A. Flavell Integrated src kinase and costimulatory activity enhances signal transduction through single-chain chimeric receptors in T lymphocytes Blood, October 15, 2001; 98(8): 2364 - 2371. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Brenner, C. Rossig, U. Sili, J. W. Young, and E. Goulmy Transfusion Medicine: New Clinical Applications of Cellular Immunotherapy Hematology, January 1, 2000; 2000(1): 356 - 375. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
