The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lian, R. H.
Right arrow Articles by Takei, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lian, R. H.
Right arrow Articles by Takei, F.
The Journal of Immunology, 1998, 161: 2301-2306.
Copyright © 1998 by The American Association of Immunologists

Role of Conserved Glycosylation Site Unique to Murine Class I MHC in Recognition by Ly-49 NK Cell Receptor1

Rebecca H. Lian*, J. Douglas Freeman*, Dixie L. Mager*,{dagger} and Fumio Takei2,*,{ddagger}

* Terry Fox Laboratory, British Columbia Cancer Agency, {dagger} Department of Medical Genetics, and {ddagger} Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver, British Columbia, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The recognition of class I MHC molecules on target cells by the Ly-49 family of receptors regulates NK cytotoxicity. Previous studies have suggested that carbohydrates are involved in the recognition of class I MHC by Ly-49, although their precise role remains unclear. Here, we examined the role of asparagine-linked carbohydrates of the murine class I MHC in the binding to Ly-49A and Ly-49C. We have generated H-2Dd mutants that lack the highly conserved glycosylation sites at amino acid residues 86 in the {alpha}1 domain and 176 in the {alpha}2 domain, respectively. These mutant Dd cDNAs were transfected into leukemic cell lines, and the binding of the transfected cells to COS cells expressing Ly-49A or Ly-49C, as well as their susceptibility to lysis by Ly-49A+ NK cells, was examined. Only the mutation of the {alpha}2 domain glycosylation site significantly reduced the binding of Dd to Ly-49A and Ly-49C. Cells expressing Dd with the mutation at this site were partially resistant to killing by Ly-49A+ NK cells. These results suggest that, while carbohydrates linked to residue 176 seem to function as a part of the ligand structure for the Ly-49 family of NK receptors, there are additional structural features involved in this recognition. This glycosylation site is highly conserved among murine class I MHC but is not found among those of other species, suggesting that its role is unique to the murine immune system. It further suggests that murine class I MHC and Ly-49 gene families may have evolved in concert.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In many systems, expression of class I MHC molecules on target cells inversely correlates with their susceptibility to NK cell lysis (1, 2, 3, 4). The "missing self" hypothesis states that NK cells distinguish between normal and aberrant cells by recognizing and killing targets that lack self class I MHC (1, 5). Recent findings of MHC-specific inhibitory receptors on NK cells have provided the molecular basis for this hypothesis. In mice, the Ly-49 family of type II transmembrane proteins containing C-type lectin domains has been identified to be NK receptors for class I MHC. Of the nine Ly-49 molecules (Ly-49A-I) thus far identified, Ly-49A and Ly-49C are the best characterized. Ly-49A has been shown by Ab inhibition studies to bind specifically to the H-2Dd and H-2k haplotypes, resulting in the inability of Ly-49A+ NK cells to kill targets of these haplotypes in vitro and in vivo (6, 7, 8). The interaction between Ly-49A and class I MHC has also been demonstrated by the adhesion of Ly-49A+ lymphoma cells to purified and immobilized Dd and Dk (9). Similarly, Ly-49C binds certain class I MHC molecules, including H-2Dd, Kd, and Kb (10, 11), and functions as an inhibitory receptor for NK cells (12). Binding studies using various blocking mAb have suggested that Ly-49 binds to the {alpha}1/{alpha}2 domains of class I MHC (13).

Ly-49 contains a putative carbohydrate recognition domain (14, 15, 16), and previous studies have shown that Ly-49A and -C bind sulfated polysaccharides (17, 18). Furthermore, treatment of cells expressing class I MHC with tunicamycin to inhibit glycosylation (17) or with fucosidase (18) inhibited binding of class I MHC to Ly-49A or -C. These results suggested an involvement of carbohydrates in the recognition of class I MHC. However, the precise role of carbohydrates on class I MHC in its interaction with the Ly-49 family of NK inhibitory receptors has not yet been determined. The murine class I MHC molecules have two conserved asparagine N-linked glycosylation sites, amino acid residues at positions 86 in the {alpha}1 domain and 176 in the {alpha}2 domain. In this study, we report that the glycosylation at residue 176, but not residue 86, is required for the binding of class I MHC to Ly-49A and Ly-49C. We also report that other structural features are likely to be involved in this interaction. Interestingly, unlike residue 86, which is invariably conserved among all class I MHC molecules thus far sequenced (19, 20, 21, 22), the glycosylation site at residue 176 is conserved only among murine class I MHC and not those of other species. These findings suggest that the Ly-49 family of murine NK inhibitory receptors appear to have evolved simultaneously with murine class I MHC molecules.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abs and flow cytometry

The 5E6 (anti-Ly-49C and -I) and YE1/48 (anti-Ly-49A) mAbs have been described (23, 24). The 34-5-8S, 34-2-12S, and 34-4-20S hybridomas (anti-Dd) were obtained from the American Type Culture Collection (ATCC, Manassas, VA). Flow cytometric analysis was done as described (11). Briefly, 5 x 105 cells were incubated for 30 min on ice with the appropriate hybridoma supernatants, followed by two rinses with HBSS (containing 2% FCS) and an incubation with an FITC-conjugated secondary Ab. After a final rinse with HBSS/FBS, cells were stained with propidium iodide for detection of nonviable cells. Flow cytometric analysis was subsequently performed on the FACScan (Becton Dickinson, Mountain View, CA).

Site-directed mutagenesis

The cDNA encoding Dd was isolated by RT-PCR from the murine B lymphoma line A20. The Dd mut1 in which serine 88 is replaced by glycine residue was generated by a two-step PCR using Pfu I polymerase (Strategene, La Jolla, CA). The upstream PCR to generate a DNA fragment encoding the N-terminal portion of Dd that contained the mutation at residue 88 was conducted using oligonucleotide primers 5'-CTGGATCCCAGATGGGGGCGAT-3' and 5'-CCCTGGTTGTAGTAGCGCAGCG-3' (phosphorylated). The downstream PCR to generate a DNA fragment encoding the C-terminal portion of Dd was performed using primers 5'-CGCGGGCGGCTCTCACACACTC-3' (phosphorylated) and 5'-TTGAATTCATGTGTTAGTCTTGGTGGATGAAGG-3'. The two PCR fragments were blunt-end ligated and used as a template for the second round of PCR that used the primers 5'-CTGGATCCCAGATGGGGGCGAT-3' and 5'- TTGAATTCATGTGTTAGTCTTGGTGGATGAAGG3'. The Dd mut2 in which threonine in residue 178 is replaced by glycine was also generated in the same manner. The upstream PCR to generate the mutated DNA fragment was done using primers 5'-CTGGATCCCAGATGGGGGCGAT-3' and 5'-CCCAGCATTCCCGTTCTTCAGGTATC-3' (phosphorylated), and the downstream PCR was done using primers 5'-CTGCTGCGCACAGATCCCCC-3' (phosphorylated) and 5'-TTGAATTCATGTGTTAGTCTTGGTGGATGAAGG-3'. The second round of PCR was done using the same primers as those for the first mutation. The DNA fragments from the second round PCR were digested with BamHI and EcoRI, subcloned into pBluescript, and sequenced.

Transfections

The cell lines COS-1, RBL-1, GM979, and C1498 were obtained from ATCC and cultured in DMEM supplemented with 5% FCS. Ly-49A and -C cDNAs that had been cloned into the pAX142 expression vector were transfected into COS cells using Lipofectamine (Canadian Life Technologies, Burlington, ON) according to the manufacturer’s protocols. Transfection of RBL-1, GM979, and C1498 cells were performed by electroporation at 0.45 kV and 125 µFD, and stable transfectants resistant to G418 (Canadian Life Technologies) were subsequently selected for high expression by limiting dilution, panning, or cell sorting.

Immunoprecipitation

GM979 transfectants were surface biotinylated and lysed with lysis buffer (1% Triton X-100 lysis buffer containing 1% BSA, 150 mM NaCl, and 0.1% NaN3 in 10 mM Tris-HCl, pH 7.5) as described (25). The clarified lysates were incubated overnight at 4°C with anti-Dd (34-5-8S)-coupled beads (50 µl of a 1:1 slurry). The beads were then washed four times with lysis buffer (without BSA and NaN3), and bound proteins were eluted with 100 µl 2x SDS sample buffer containing 50 mM DTT and boiling for 5 min. The eluted proteins were subsequently analyzed by SDS-PAGE and transferred onto nitrocellulose for Western blotting. Following incubation with peroxidase-conjugated streptavidin, proteins were detected using the ECL (Amersham, Arlington Heights, IL) chemiluminescence method.

N-glycosidase F treatment

Following immunoprecipitation as above, Dd bound to anti-Dd-mAb-coupled beads were washed and resuspended with PBS, treated with two units of N-glycosidase F (Boehringer Mannheim Canada, Laval, QC) for 6 h or 18 h at 37°C, and finally eluted with 100 µl 2x SDS sample buffer.

Binding assays

Twenty-four hours after transfection, COS cells were trypsinized and replated on 6-cm dishes (Falcon, Oxnard, CA). Forty-eighty hours later, Dd transfectants were added to COS cells. For the adhesion of RBL-1 transfectants, dishes containing COS cells were pretreated with heat-inactivated BSA (0.1% in PBS) for 1 h at 37°C to reduce nonspecific binding. Adhesion assays were performed for 2 h at 37°C or 15 min at room temperature for GM979 and RBL-1 cells, respectively. The plates were subsequently rinsed six times with prewarmed media and photographed on a Nikon Diaphot microscope. For quantitative assays, GM979 cells were radiolabeled with 51Cr (Mandel Scientific, Guelph, ON), and equivalent amounts of radioactivity were subsequently added to COS cells. After the unbound cells were removed by rinsing with prewarmed media, the remaining bound cells were lysed with 10% Triton X-100 and counted for radioactivity.

NK cell isolation

Spleens from C57BL/6 mice were homogenized and passed through a nylon wool column (Polysciences, Warrington, PA). Flow-through cells were then further enriched for NK cells using the immunomagnetic separation method, StemSep (StemCell Technologies, Vancouver, BC). The NK cells were subsequently cultured for 3 days in 1000 U/ml of murine IL-2 before purification of the Ly-49A+ subpopulation using the MACS separation method (Miltenyi Biotec, Auburn, CA). After 6 additional days of culture in the presence of IL-2, the Ly-49A+ NK cells were used in standard 51Cr release cytotoxicity assays.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of N-linked glycosylation-deficient H-2 Dd

To determine the role of the conserved N-linked carbohydrates of class I MHC in the recognition of class I MHC by Ly-49, two glycosylation-deficient mutants of Dd were generated. The Dd mut1 lacks the glycosylation site at residue 86 due to a replacement of serine by glycine at residue 88. In the Dd mut2, residue 176 is deficient in glycosylation due to a substitution of threonine at residue 178 by glycine. The wild-type and mutant Dd cDNA clones were subsequently transfected into the murine erythroleukemic cell line GM979, the rat basophilic leukemia line RBL-1, and the murine lymphoma cell line C1498, and transfectants expressing Dd were established. Flow cytometric analysis of the transfected cells using the conformation-dependent anti-Dd mAb 34-5-8 showed that wild-type Dd and both mutant Dd were expressed at comparable levels (Fig. 1GoA). No differential binding of other mAb that recognize Dd, including 34-4-21, 34-2-12, and 34-4-20, to wild-type and mutant Dd was observed (data not shown), indicating that the mutations did not significantly disrupt the conformation of Dd. To verify that the expressed mutant Dd proteins were indeed deficient at one glycosylation site, Dd was immunoprecipitated from the transfected cells using the 34-5-8 mAb and analyzed by SDS-PAGE. The mutant Dd had lower apparent molecular masses than that of the wild-type (Fig. 1GoB), presumably because lack of glycosylation at the mutated sites would reduce the overall mass. Treatment of immunoprecipitated wild-type Dd with N-glycosidase F for 6 h to cleave off N-linked carbohydrates yielded three bands in SDS-PAGE, corresponding to undigested, partially digested, and fully digested Dd (Fig. 1GoB, upper panel). The apparent size of the two mutant Dd corresponded to the partially digested wild-type molecule, and treatment with N-glycosidase F reduced the sizes of mutant Dd to that of the fully digested wild-type Dd. Furthermore, prolonged treatment with the enzyme subsequently resulted in complete deglycosylation of all the Dd molecules to its lowest molecular mass (Fig. 1GoB, lower panel). These results confirmed that the glycosylation of Dd was indeed disrupted by the mutations as expected.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 1. Analysis of wild-type and mutant Dd on transfected RBL-1 and GM979 cells. (A) Dd-transfected cells were stained with the 34-5-8 (anti-Dd) mAb plus FITC-conjugated anti-mouse Ig secondary Ab and analyzed by flow cytometry. (a) untransfected GM979, (b) GM979 transfected with wild-type Dd, (c) GM979 transfected with Dd mut1, (d) GM979 transfected with Dd mut2, (e) untransfected RBL-1, (f) RBL-1 transfected with wild-type Dd, (g) RBL-1 transfected with Dd mut1 (h) RBL-1 transfected with Dd mut2. (B) Dd-transfected GM979 cells were cell-surface biotinylated, immunoprecipitated with the anti-Dd mAb, 34-5-8, and enzymatically treated with N-glycosidase F for 6 h (upper panel) or 18 h (lower panel) before SDS-PAGE and Western blot analysis. The biotinylated proteins were subsequently detected by probing with streptavidin conjugated to horseradish peroxidase.

 
Binding of mutant Dd to Ly-49A and Ly-49C

Binding of mutant Dd to Ly-49 was determined by adhesion of Dd-transfected cells to Ly-49-transfected COS cells. Flow cytometric analysis showed high levels of Ly-49A and Ly-49C expression on the transfected COS cells (Fig. 2GoA). GM979 transfected with wild-type Dd readily bound to Ly-49A-transfected COS cells (Fig. 2GoB). Similarly, GM979 transfected with Dd mut1 also bound to Ly-49A-transfected COS cells, and no significant effect of this mutation was observed in the binding assay. In contrast, Dd mut2-transfected GM979 failed to bind to Ly-49A-transfected COS cells. This was not due to the expression level of this mutant Dd, because flow cytometric analysis (Fig. 1GoA) showed the level of this mutant Dd to be slightly higher than that of Dd mut1. None of the GM979 lines bound to control COS cells transfected with vector alone, whereas untransfected GM979 cells did not bind to Ly-49A-transfected COS cells, indicating that the binding in this assay is mediated by Dd and Ly-49A. Quantitative analysis using 51Cr-labeled transfected GM979 cells in the presence and absence of YE1/32 (anti-Ly-49A mAb) also confirmed the binding of wild-type Dd and Dd mut1 to Ly-49A (Fig. 2GoC). The binding of Dd mut2 was significantly lower even in the absence of the blocking Ab.



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 2. Adhesion of mutant Dd to Ly-49A and Ly-49C. (A) 72 h following transfection, COS cells were analyzed for Ly-49A and Ly-49C expression using the mAbs YE1/48 and 5E6, respectively. The solid histograms represent COS cells transfected with Ly-49 cDNAs, and open histograms are cells transfected with the vector alone (pAX142). (B) Dd-transfected GM979 cells were incubated with Ly-49A-transfected COS cells for 2 h. Unbound cells were removed by gently swirling the media and removing it. The wash procedures were repeated six times. The remaining bound cells were photographed. (C) GM979 cells were labeled with 51Cr and incubated with COS cells in the presence or absence of YE1/32 anti-Ly-49A mAb. After removal of unbound cells by rinsing, bound cells were lysed with 10% Triton X-100, and cell lysates were then counted for radioactivity.

 
To examine the binding of mutant Dd to Ly-49C, the rat leukemia line RBL-1 was used, since endogenous class I MHC (H-2s) on untransfected GM979 cells bound to Ly-49C-transfected COS cells. RBL-1 expressing wild-type Dd and Dd mut1 bound avidly to both Ly-49A+ and Ly-49C+ COS cells whereas Dd mut2 showed no significant binding above background (Fig. 3Go). In all cases, the binding assays were scored in a blind fashion, and the results were consistent in three independent experiments. Therefore, glycosylation at residue 176 but not residue 86, of Dd is important for the binding to Ly-49C as well as Ly-49A in this assay system.



View larger version (97K):
[in this window]
[in a new window]
 
FIGURE 3. Adhesion of mutant Dd to Ly-49A and Ly-49C. RBL-1 cells transfected with mutant Dd were tested similarly as in Figure 2GoB for their binding to COS cells expressing Ly-49A or Ly-49C.

 
Cytotoxicity of mutant Dd by Ly-49A+ NK cells

The binding of Dd on target cells to Ly-49A on NK cells has been shown to inhibit cytotoxicity of Ly-49A+ NK cells (7). Therefore, we tested whether the very low level of binding of Dd mut2 to Ly-49A results in defective inhibition in NK cytotoxicity. For this study, we were unable to use RBL-1 or GM979 cells, because the former labeled poorly with chromium and the latter cells were NK-resistant. Therefore, we transfected wild-type and mutant Dd into the murine leukemic cell line C1498, which is highly sensitive to NK cytotoxicity. The expression levels of Dd on the transfectants were comparable (Fig. 4GoA). In cytotoxicity assays, untransfected C1498 cells were readily lysed by Ly-49A+ NK cells. C1498-expressing wild-type Dd or Dd mut1 were resistant to Ly-49A+ NK cells, whereas Dd mut2-transfected C1498 cells were only partially resistant to Ly-49A+ NK cells (Fig. 4GoB). In four independent experiments, the cytotoxic killing of Dd mut2-transfected C1498 was consistently higher than that of wild-type Dd or Dd mut1 transfectants, while no statistically significant difference was seen between wild-type Dd and Dd mut1. The cytotoxicities were restored to the level of control untransfected C1498 cells in the presence of mAb to Ly-49A (YE1/48) or F(ab')2 fragment of anti-Dd (34-5-8), demonstrating that the resistance of these cells to NK killing is due to the specific recognition of Dd by Ly-49A. These results indicate that the recognition of Dd mut2 by Ly-49A is less efficient than that of wild-type Dd or Dd mut1.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 4. Inhibition of NK cytotoxicity by mutant Dd. A, Flow cytometric analysis of Dd expression on untransfected C1498 cells (a), bulk populations of C1498 transfected with wild-type Dd (b), Dd mut1 (c) and Dd mut2 (d). The staining and analysis were done as in Figure 1Go. B, Cytotoxicity assay. C1498 cells were labeled with 51Cr and incubated with Ly-49A+ LAK cells isolated from B6 mice and grown in the presence of IL-2 as described in Materials and Methods. The results were typical of four independent experiments, each done in triplicate. The left hand side panel shows cytotoxicities in the absence of any mAb, the center panel shows those in the presence of anti-Ly49A mAb (YE1/48), and the right hand side panel shows those in the presence of anti-Dd mAb (34–5-8 F(ab')2 fragments).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results presented in this report have demonstrated that the conserved glycosylation site at residue 176 of Dd is involved in the interaction with the murine NK receptors Ly-49A and -C. In cell adhesion assays using Dd-transfected leukemic cells and Ly-49-transfected COS cells, the mutant Dd (Dd mut2) lacking this glycosylation site did not significantly bind to Ly-49A or -C, whereas wild-type Dd and the mutant Dd (Dd mut1) lacking the other conserved glycosylation site at residue 86 readily mediated cell adhesion. In cytotoxicity assays, Dd mut2 only partially inhibited cytotoxicity of Ly-49A+ NK cells. The level of this inhibition was significantly lower than that of wild-type Dd or Dd mut1, which almost completely inhibited cytotoxicity of Ly-49A+ NK cells. The difference seen in the two assays is probably due to low affinity interaction between Dd and Ly-49A or -C. It is likely that binding of Dd-transfected cells to Ly-49-transfected COS cells requires a large number of Ly-49 molecules binding to Dd, allowing high enough avidity interaction to maintain cell-cell binding during the washing procedure. In contrast, inhibition of NK cytotoxicity may require much less receptor (Ly-49A)-ligand (Dd) interaction. Thus, while the affinity of Dd mut2 for Ly-49A seems too low to mediate cell-cell adhesion, it is sufficient to partially inhibit cytotoxicity of Ly-49A+ NK cells. It should be noted that the expression levels of Dd and the two mutant Dd on the transfected cells in these studies were comparable, and the mutations did not seem to affect the conformation of Dd as determined by the binding of conformation-dependent mAbs. Therefore, these results suggest that carbohydrates linked to residue 176, but not residue 86, modulate the affinity of Dd for Ly-49.

The view that asparagine 176-linked carbohydrates on Dd plays a role in the interaction with Ly-49 is consistent with previous findings. Ly-49A and -C have been shown to bind certain polysaccharides (16, 17, 18). Furthermore, binding of class I MHC to Ly-49C is also inhibited by treatment of class I MHC-positive cells with tunicamycin (17) or fucosidase (18). These results indicate that carbohydrates on class I MHC are involved in the recognition by Ly-49. On the other hand, it is unlikely that the binding of class I MHC to Ly-49 is mediated solely by carbohydrates. It has been shown that recognition of class I MHC by Ly-49 depends on the conformation of the former since Ly-49A is unable to recognize class I MHC lacking bound peptides (13). Therefore, Ly-49 most probably recognizes a combination of carbohydrates and the peptide backbone structure of class I MHC. This is consistent with our previous finding that the binding of Ly-49 to class I MHC involves not only the carbohydrate recognition domain of Ly-49 but also a portion of the stalk region immediately adjacent to the carbohydrate recognition domain (14, 16). The involvement of carbohydrates of class I MHC in the binding to Ly-49 implies that NK cytotoxicity may be regulated not only by the expression level of class I MHC on target cells but also by the pattern of glycosylation of class I MHC.

While this manuscript was under review, Matsumoto et al. reported similar studies with different results (26). In their studies, mutations at the conserved glycosylation sites of Dd had no detectable effects on inhibition of NK cytotoxicity or binding of Dd-transfected C1498 cells to Ly-49A-transfected Chinese hamster ovary cells. The reasons for the discrepancies are unknown at this time, but they may be due to differences in cells used, mutations (substitutions of asparagines with glutamines in their studies vs substitution of serine or threonine with glycine in this study), or expression levels of Dd on target cells. Our studies have shown that mutation of the glycosylation site at residue 176 reduces the binding of Dd to Ly-49, but the binding is sufficient to induce partial inhibition of cytotoxicity of Ly-49A+ NK cells. It is conceivable that, if the expression level of this mutant Dd on target cells is high enough, it can protect the targets from cytotoxicity.

It is of interest that glycosylation at residue 176, but not residue 86, of class I MHC is involved in the binding to Ly-49. Residues 86 and 176 are located at the end of the {alpha}1 and {alpha}2 domains, respectively, and are outside of the peptide binding groove. The residue 86 glycosylation site is invariably conserved among all class I MHC thus far sequenced (19, 21). In contrast, the residue 176 glycosylation site is conserved only among murine class I MHC (Fig. 5Go). A survey of various class I MHC sequences in the data base showed that this glycosylation site in the {alpha}2 domain is conserved among all classical murine class I MHC including Kd, Kb, Kk, Kf, Dd, Db, Dk, and Df but is not found in any others examined. In addition to the class I MHC sequences listed in Figure 5Go, those of human (10 HLA-A, 30 HLA-B, 7 HLA-C), six rat, 13 chimpanzee, 5 orangutan, 14 gorilla, 3 baboon, 3 gibbon, 11 rhesus monkey, 6 cat, 3 rabbit, 3 cow, 5 horse, 2 cheetah, 2 squirrel, 2 frog, and 4 fish were examined. The glycosylation site at residue 176 was not found among any of the nonmurine class I MHC. This indicates that this glycosylation site in the {alpha}2 domain likely arose after the divergence of mice from other species and has became fixed in all murine class I MHC genes.



View larger version (64K):
[in this window]
[in a new window]
 
FIGURE 5. Amino acid sequences of class I MHC of various species. Only the sequences in the regions of conserved N-linked glycosylation sites are shown. Residues 86 and 176 of the mature class I MHC proteins are marked by asterisks. The potential glycosylation sites are in bold. The sequences were randomly selected from the GENBANK data base. Two of the rat class I MHC shown are RT1.Ab (Ab) and RT1.Ac (Ac).

 
Carbohydrates on residue 86 are thought to be important for the binding of class I MHC to the chaperone calnexin during the assembly of class I MHC {alpha}-chain with ß2 microglobulin and peptides (19, 27, 28). On the other hand, the functional role of carbohydrates on residue 176 of murine class I MHC has not yet been described. Since it is conserved among murine class I MHC and not found among others, its function should be uniquely attributed to mice. The results in this study show that carbohydrates on residue 176 function as a part of the ligand structure for the murine NK receptor Ly-49. Therefore, it is possible that murine class I MHC conserved this glycosylation site during evolution to maintain the function to serve as a ligand for the Ly-49 family. The complex and highly polymorphic Ly-49 family likely evolved in response to the rapid evolution of murine class I MHC. The lack of this N-linked glycosylation in class I MHC of other species suggests that the murine Ly-49 family diverged from other NK receptors with respect to how they recognize class I MHC on target cells. Although Ly-49 has also been found in rats (29, 30), direct interaction between rat Ly-49 and rat class I MHC has not been demonstrated. The absence of glycosylation sites in the {alpha}2 domain of rat class I MHC suggests that binding specificities of rat Ly-49 may be quite different from murine Ly-49. Moreover, efforts to isolate homologous human Ly-49 genes using mouse probes have not been successful. While a human Ly-49 gene family may exist, our results support the hypothesis that it may be significantly diverged from mouse Ly-49, reflecting the rapid evolution of genes involved in immune functions.


    Acknowledgments
 
We thank Dr. V. Kumar for the 5E6 hybridoma.


    Footnotes
 
1 This work was supported by a grant from the National Cancer Institute of Canada with core support provided by the British Columbia Cancer Agency. Back

2 Address correspondence and reprint requests to Dr. Fumio Takei, Terry Fox Laboratory, British Columbia Cancer Research Centre, 601 West 10th Avenue, Vancouver, BC V5Z 1L3, Canada. E-mail address: Back

Received for publication March 9, 1998. Accepted for publication May 4, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ljunggren, H. G., K. Kärre. 1990. In search of the "missing self": MHC molecules and NK cell recognition. Immunol. Today 11:237.[Medline]
  2. Kärre, K., H. G. Ljunggren, G. Piontek, R. Kiessling. 1986. Selective rejection of H-2-deficient lymphoma variants suggests alternative immune defense strategy. Nature 319:675.[Medline]
  3. Öhlen, C., G. Kling, P. Höglund, M. Hansson, G. Scangos, C. Bieberich, G. Jay, K. Kärre. 1989. Prevention of allogeneic bone marrow graft rejection by H-2 transgene. Science 246:666.[Abstract/Free Full Text]
  4. Storkus, W. J., D. N. Howell, R. D. Salter, J. R. Dawson, P. Cresswell. 1987. NK susceptibility varies inversely with target cell class I HLA antigen expression. J. Immunol. 138:1657.[Medline]
  5. Höglund, P., J. Sundbäck, M. Y. Olsson-Alheim, M. Johansson, M. Salcedo, H. C. Öhlén, C. L. Sentman Ljunggren, K. Kärre. 1997. Host MHC class I gene control of NK-cell specificity in the mouse. Immunol. Rev. 155:11.[Medline]
  6. Daniels, B. F., F. M. Karlhofer, W. E. Seaman, W. M. Yokoyama. 1994. A natural killer cell receptor specific for a major histocompatibility complex class I molecule. J. Exp. Med. 180:687.[Abstract/Free Full Text]
  7. Karlhofer, F. M., R. K. Ribaudo, W. M. Yokoyama. 1992. MHC class I alloantigen specificity of Ly-49+ IL-2 activated natural killer cells. Nature 358:66.[Medline]
  8. Raulet, D. H., W. Held, I. Correa, J. R. Dorfman, M.-F. Wu, L. Corral. 1997. Specificity, tolerance and developmental regulation of natural killer cells defined by expression of class I-specific Ly-49 receptors. Immunol. Rev. 155:41.[Medline]
  9. Kane, K.. 1994. Ly-49 mediates EL4 lymphoma adhesion to isolated class I major histocompatibility complex molecules. J. Exp. Med. 179:1011.[Abstract/Free Full Text]
  10. Brennan, J., D. Mager, W. Jefferies, F. Takei. 1994. Expression of different members of the Ly-49 gene family defines distinct natural killer subsets and cell adhesion properties. J. Exp. Med. 180:2287.[Abstract/Free Full Text]
  11. Brennan, J., S. Lemieux, J. D. Freeman, D. L. Mager, F. Takei. 1996. Heterogeneity among Ly-49C natural killer (NK) cells: characterization of highly related receptors with differing functions and expression patterns. J. Exp. Med. 184:2085.[Abstract/Free Full Text]
  12. Yu, Y. Y. L., T. George, J. R. Dorfman, J. Roland, V. Kumar, M. Bennett. 1996. The role of Ly-49A and 5E6 (Ly-49C) molecules in hybrid resistance mediated by murine natural killer cells against normal T cell blasts. Immunity 4:67.[Medline]
  13. Orihuela, M., D. H. Margulies, W. M. Yokoyama. 1996. The natural killer cell receptor Ly-49A recognizes a peptide-induced conformational determinant on its major histocompatibility complex class I ligand. Proc. Natl. Acad. Sci. USA 93:11792.[Abstract/Free Full Text]
  14. Brennan, J., G. Mahon, D. L. Mager, W. A. Jefferies, F. Takei. 1996. Recognition of class I major histocompatibility complex molecules by Ly-49: specificities and domain interactions. J. Exp. Med. 183:1553.[Abstract/Free Full Text]
  15. Wong, S., J. D. Freeman, C. Kelleher, D. Mager, F. Takei. 1991. Ly-49 multigene family: new members of a superfamily of type II membrane proteins with lectin-like domains. J. Immunol. 147:1417.[Abstract]
  16. Takei, F., J. Brennan, D. L. Mager. 1997. The Ly-49 family: genes, proteins, and recognition of class MHC. Immunol. Rev. 155:67.[Medline]
  17. Daniels, B. F., M. C. Nakamura, S. D. Rosen, W. M. Yokoyama, W. E. Seaman. 1994. Ly-49A, a receptor for H-2 Dd, has a functional carbohydrate recognition domain. Immunity 1:785.[Medline]
  18. Brennan, J., F. Takei, S. Wong, D. L. Mager. 1995. Carbohydrate recognition by a natural killer cell receptor, Ly-49C. J. Biol. Chem. 270:9691.[Abstract/Free Full Text]
  19. Parham, P.. 1996. Functions for MHC class I carbohydrates inside and outside the cell. Trends Biochem. Sci. 21:427.[Medline]
  20. Parham, P., B. N. Alpert, H. T. Orr, J. L. Strominger. 1977. Carbohydrate moiety of HLA antigens: antigenic properties and amino acid sequences around the site of glycosylation. J. Biol. Chem. 252:7555.[Free Full Text]
  21. Barber, L. D., T. P. Patel, L. Percival, J. E. Gumperz, L. L. Lanier, J. H. Phillips, J. C. Bigge, M. R. Wormwald, R. B. Parekh, P. Parham. 1996. Unusual uniformity of the N-linked oligosaccharides of HLA-A, -B, and -C glycoproteins. J. Immunol. 156:3275.[Abstract]
  22. Pease, L. R., R. M. Horton, J. K. Pullen, Z. L. Cai. 1991. Structure and diversity of class I antigen presenting molecules in the mouse. Crit. Rev. Immunol. 11:1.[Medline]
  23. Takei, F.. 1983. Two surface antigens expressed on proliferating mouse T lymphocytes defined by rat monoclonal antibodies. J. Immunol. 130:2794.[Abstract]
  24. Sentman, C. L., J. Hackett, V. Kumar, M. Bennett. 1989. Identification of a subset of murine natural killer cells that mediates rejection of Hh-1d but not Hh-1b bone marrow grafts. J. Exp. Med. 170:191.[Abstract/Free Full Text]
  25. Food, M. R., S. Rothenberger, R. Gabathuler, I. D. Haidl, G. Reid, W. A. Jefferies. 1994. Transport and expression in human melanomas of a transferrin-like glycosylphosphatidylinositol-anchored protein. J. Biol. Chem. 269:3034.[Abstract/Free Full Text]
  26. Matsumoto, N., R. K. Ribaudo, J. Abastado, D. H. Margulies, W. M. Yokoyama. 1998. The lectin-like NK cell receptor Ly-49A recognizes a carbohydrate-independent epitope on its MHC class I ligand. Immunity 8:245.[Medline]
  27. Zhang, Q., M. Tector, R. D. Salter. 1995. Calnexin recognizes carbohydrate and protein determinants of class I major histocompatibility complex molecules. J. Biol. Chem. 270:3944.[Abstract/Free Full Text]
  28. Suh, W. K., E. K. Mitchell, Y. Yang, P. A. Peterson, G. L. Waneck, D. B. Williams. 1996. MHC class I molecules from ternary complexes with calnexin and TAP and undergo peptide-regulated interaction with TAP via their extracellular domains. J. Exp. Med. 184:337.[Abstract/Free Full Text]
  29. Kraus, E., D. Lambracht, K. Wonigeit, T. Hünig. 1996. Negative regulation of rat natural killer cell activity by major histocompatibility complex class I recognition. Eur. J. Immunol. 26:2582.[Medline]
  30. Dissen, E., J. C. Ryan, W. E. Seaman, S. Fossum. 1996. An autosomal dominant locus, Nka, mapping to the Ly-49 region of a rat natural killer (NK) gene complex, controls NK cell lysis of allogeneic lymphocytes. J. Exp. Med. 183:2197.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. Martayan, L. Sibilio, A. Setini, E. L. Monaco, E. Tremante, D. Fruci, M. Colonna, and P. Giacomini
N-Linked Glycosylation Selectively Regulates the Generic Folding of HLA-Cw1
J. Biol. Chem., June 13, 2008; 283(24): 16469 - 16476.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. A. Benoit and R. Tan
Xenogeneic beta2-Microglobulin Substitution Alters NK Cell Function
J. Immunol., August 1, 2007; 179(3): 1466 - 1474.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Maeda, C. Carpenito, R. C. Russell, J. Dasanjh, L. L. Veinotte, H. Ohta, T. Yamamura, R. Tan, and F. Takei
Murine CD160, Ig-Like Receptor on NK Cells and NKT Cells, Recognizes Classical and Nonclassical MHC Class I and Regulates NK Cell Activation
J. Immunol., October 1, 2005; 175(7): 4426 - 4432.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Maeda, A. Shadeo, A. M. MacFadyen, and F. Takei
CD1d-Independent NKT Cells in {beta}2-Microglobulin-Deficient Mice Have Hybrid Phenotype and Function of NK and T Cells
J. Immunol., May 15, 2004; 172(10): 6115 - 6122.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. S. J. Marshall, J. A. Willment, H.-H. Lin, D. L. Williams, S. Gordon, and G. D. Brown
Identification and Characterization of a Novel Human Myeloid Inhibitory C-type Lectin-like Receptor (MICL) That Is Predominantly Expressed on Granulocytes and Monocytes
J. Biol. Chem., April 9, 2004; 279(15): 14792 - 14802.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. H. Mason, J. Willette-Brown, S. K. Anderson, W. G. Alvord, R. L. Klabansky, H. A. Young, and J. R. Ortaldo
Receptor Glycosylation Regulates Ly-49 Binding to MHC Class I
J. Immunol., October 15, 2003; 171(8): 4235 - 4242.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. H. Lian, M. Maeda, S. Lohwasser, M. Delcommenne, T. Nakano, R. E. Vance, D. H. Raulet, and F. Takei
Orderly and Nonstochastic Acquisition of CD94/NKG2 Receptors by Developing NK Cells Derived from Embryonic Stem Cells In Vitro
J. Immunol., May 15, 2002; 168(10): 4980 - 4987.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Sundback, A. Achour, J. Michaelsson, H. Lindstrom, and K. Karre
NK Cell Inhibitory Receptor Ly-49C Residues Involved in MHC Class I Binding
J. Immunol., January 15, 2002; 168(2): 793 - 800.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. A. Willment, S. Gordon, and G. D. Brown
Characterization of the Human beta -Glucan Receptor and Its Alternatively Spliced Isoforms
J. Biol. Chem., November 16, 2001; 276(47): 43818 - 43823.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
N. Matsumoto, M. Mitsuki, K. Tajima, W. M. Yokoyama, and K. Yamamoto
The Functional Binding Site for the C-type Lectin-like Natural Killer Cell Receptor Ly49A Spans Three Domains of Its Major Histocompatibility Complex Class I Ligand
J. Exp. Med., January 8, 2001; 193(2): 147 - 158.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. A. Tripp, D. Moore, L. Jones, W. Sullender, J. Winter, and L. J. Anderson
Respiratory Syncytial Virus G and/or SH Protein Alters Th1 Cytokines, Natural Killer Cells, and Neutrophils Responding to Pulmonary Infection in BALB/c Mice
J. Virol., September 1, 1999; 73(9): 7099 - 7107.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lian, R. H.
Right arrow Articles by Takei, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lian, R. H.
Right arrow Articles by Takei, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS