|
|
||||||||
Department of Microbiology, College of Physicians and Surgeons, Columbia University, New York, NY 10032
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
, granulocyte (G)-CSF, and nitric oxide
synthase, contain functionally important C/EBP sites in their
transcriptional regulatory regions (2, 3, 4, 5, 6). NF-IL6 is also required for
the induction of latent HIV-1 provirus and for replication of HIV-1 in
monocytes/macrophages (1, 7). The biologic importance of NF-IL6 in macrophages has been confirmed by gene targeting experiments in mice. NF-IL6-/- mice have impaired macrophage function, including a poor response to bacterial or viral pathogens and severely defective tumor cytotoxicity (8). Cytokine production by macrophages derived from NF-IL6-/- mice is abnormal, confirming the importance of NF-IL6 for regulated transcription of cytokine genes. In addition, splenomegaly due to B cell and monocyte/macrophage hyperplasia is frequently observed in older NF-IL6-/- mice in conjunction with elevations in the serum levels of IL-6 and macrophage (M)-CSF, suggesting that some biologic functions of NF-IL6 in vivo are not completely understood (9, 10).
Although NF-IL6 mRNA is expressed in many tissues, its expression is usually tightly regulated by cellular activation or differentiation. Steady-state NF-IL6 mRNA levels are strongly induced following activation of monocytes/macrophages by a variety of effectors including mitogens and cytokines such as LPS, PMA, IL-1, and IL-6 (2). NF-IL6 is induced upon activation of splenic B cells by the polyclonal B cell mitogen LPS (11). In adipocytes, NF-IL6 mRNA levels decrease during terminal differentiation (12). The molecular basis for the regulated expression of NF-IL6 in these cell lineages is not well understood.
The importance of NF-IL6 in monocytes/macrophages for activation-dependent regulation of cellular genes and of HIV-1 provirus prompted us to investigate the regulation of NF-IL6 mRNA expression in monocytes/macrophages. As a model, we have utilized the U937 promonocytic cell line that can be activated to undergo differentiation by treatment with LPS and/or PMA (13). Our studies demonstrate that in U937 cells steady-state levels of NF-IL6 mRNA increase following cellular activation with LPS and PMA due to increased transcription initiation of the NF-IL6 gene. Analysis of the NF-IL6 promoter showed that a 104-bp region was sufficient to confer strong basal and PMA-responsive promoter activity in U937 cells. Within this region, binding sites for CREB/ATF and Sp1 families of transcription factors were identified and shown to be functionally important for promoter activity. Finally, endogenous CREB/ATF proteins were shown to be important for maximal NF-IL6 promoter activity in U937 cells.
| Materials and Methods |
|---|
|
|
|---|
The promonocytic U937 cell line was purchased from American Type Culture Collection (ATCC, Manassas, VA) and cultured in RPMI 1640 supplemented with 10% FCS and gentamicin. LPS (Salmonella typhimurium type w; Difco, Detroit, MI) was resuspended at 10 mg/ml in H2O and used at a final concentration of 10 µg/ml. Phorbol-12-myristate 13-acetate purchased from Sigma Chemicals (catalog number P-8139; St. Louis, MO) was resuspended at 1 mg/ml in DMSO and used at a final concentration of 10 ng/ml. For the stimulations, U937 cells were plated at a density of 1 x 106 cell/ml before the addition of LPS or PMA.
Luciferase assays
The murine NF-IL6 genomic clone was a generous gift of V. Poli
(Istituto Ricerche di Biologia Moleculaire, Pomezia, Italy). The
16-kbp genomic DNA Sau3A fragment was cloned into the BamHI
site of
EMBL3. An NcoI fragment containing 2
kbp 5' of the transcription initiation site and 125 bp 3' of the
initiation site was end-filled and blunt-end cloned into the
SmaI site of p19luc. A plasmid containing 1 kbp 5' of the
initiation site was generated by digestion of the 2-kbp luc construct
with HindIII and AvrII, and subsequently end
filled and religated. The HindIII site is a unique
restriction enzyme site located on the 5' end of the p19luc cloning
polylinker, whereas the AvrII site is located approximately
1 kbp upstream of the start site of NF-IL6 transcription. The 125-bp
NF-IL6 promoter construct was prepared by digestion of the 2-kbp luc
construct with HindIII and SmaI, with subsequent
end fill and religation. The 125-bp NF-IL6 promoter plasmid
served as the PCR template for generation of the -97 to +72,
-74 to +72, -44 to +72. The primers used for PCR
amplification of the minimal promoter constructs were -97
AAGGAAGCTTCGGGTGGCGGGG -74 AAGGAAGCTTGCCCCAGCGTGACG -44
AAGGAAGCTTGCCGCCTTATAAAC +72 GGAAAAGCTTCCCAGGCCAGCA. The construct
used for transfection efficiency control contains the renilla
luciferase gene driven by the thymidine kinase promoter (Promega,
Madison, WI). The site I mutant -97 to +72 NF-IL6 promoter
plasmid containing 13 nucleotide sequence changes in a 15-bp
nucleotide region extending from -53 to -67 was cloned upstream of
the firefly luciferase reporter gene through mutagenic PCR using the
SmaI construct as the PCR template. The sequence of the
mutagenic PCR primer is as follows: 5'
AGGCGGCGCCTGGCACGCCGAGCTCCACCCCTGGGGCCCCTCCCG 3'.
Nuclear run-on assay
For the nuclear run-on assay, U937 cells were cultured in the presence of LPS/PMA or media alone for 12 h. Cells (5 x 106) were set aside for FACS analysis, and the intensity of CD54 (ICAM-1) staining was used to monitor cellular activation. The nascent RNA transcripts within nuclei prepared from the remainder of the cells were elongated in vitro in the presence of the radiolabeled nucleotide [32P]CTP. The labeled RNA transcripts were isolated as described previously (14). A total of approximately 1 x 107 cpm of nuclear run-on RNA were hybridized with a filter onto which target DNA had been slotted. The controls used in this study included murine c-myc and glyceraldehyde phosphate dehydrogenase (GAPDH). The washed filter was air dried and then exposed to a phosphorimager screen for quantitation of the signals using Molecular Dynamics (Sunnyvale, CA) software.
Transient transfections
For the transient transfection assays, 6 x 106 U937 cells in 0.3 ml of RPMI 1640 and 10% FCS were transfected by electroporation with a Bio-Rad gene pulsar set at 240 V, 960 µF. Twenty micrograms of the NF-IL6 promoter firefly luciferase reporter construct were cotransfected with 5 µg of a plasmid containing the renilla luciferase gene driven by the thymidine kinase promoter as a transfection efficiency control. The CREB-2 cotransfection experiments did not include a transfection efficiency control because TK promoter activity is responsive to CREB/ATF family members (15). For the CREB cotransfection experiments, the luciferase activities were corrected for the total amount of protein in the transfectant cellular extracts.
Electroporated cells were equally divided into two 6-ml cultures
containing complete RPMI with or without PMA. Twelve to sixteen hours
following electroporation, the transfected cells were harvested and the
levels of luciferase activity were measured as described previously
(16). In the renilla luciferase cotransfection experiments, 20
of
the transfectant extract prepared from non-PMA-treated cultures were
assayed for renilla luciferase activity according to the
manufacturers instructions (Promega Dual Luciferase Assay Kit).
Transcript stability studies
U937 cells were cultured without or with LPS and PMA for 12 h. At the end of the stimulation period, cultures of control and activated U937 cells were treated with 5 µg/ml Actinomycin D for variable lengths of time; then total cellular RNA was prepared (17). Total cellular mRNA levels were assessed by Northern blot. For the Northern analysis, 40 µg of total cellular RNA were loaded per lane in the 1% agarose formaldehyde gel according to the protocol described previously (18). DNA probes for Northern analysis were labeled by the random hexamer priming method (19). The NF-IL6 hybridization probe was a PstI-EcoRI fragment derived from the pBlue 610 plasmid containing the human NF-IL6 cDNA (kindly provided by S. Akira, Hyogo College of Medicine, Hyogo, Japan). The Northern was hybridized with the NF-IL6 specific probe, stripped (Amersham protocol, Arlington Heights, IL) and then rehybridized with a probe containing sequences of the 2.0-kbp human ß-actin cDNA to control for equal loading of RNA per lane. The ß-actin sequences were derived from the pGhu-ß-actin construct containing a human ß-actin cDNA in the pGEM3 vector (kindly provided by R. Della-Favera, Columbia University, New York, NY). The Northern blot signals were quantitated using a phosphorimager (Molecular Dynamics). The RNA signal observed at the 10-min time point was normalized to 100%, and the percentage of signal remaining with time was calculated.
DNase I protection assay
A NotI-NcoI fragment from the NF-IL6 gene corresponding to -284 to +125 bp relative to the start site of transcription was 5' end labeled on the coding or noncoding strand and subjected to DNase I footprinting as described previously (20). Each reaction contained approximately 50,000 cpm of 5' end-labeled DNA that was subjected to limited DNase I digestion in the presence or absence of nuclear factors. The crude nuclear extracts used for the DNase I reaction were prepared from control and LPS/PMA-activated U937 cells as described elsewhere (20). The nuclear extracts were purified by ammonium sulfate fractionation as previously described (21). Approximately one third of the purified DNase I reaction products were resolved on an 8% polyacrylamide/8 M urea sequencing gel.
EMSAs
Nuclear extracts from control and 20 h PMA-activated U937 cells were prepared as previously described (22). Site I EMSAs were performed as described previously (20). The binding reactions included 1.5 to 6.0 µg crude nuclear extract, 0.5 µg sheared herring sperm DNA, 10 mM HEPES.KOH pH7.9, 50 mM NaCl, 5 mM Tris. HCl pH7.5, 15 mM EDTA pH8.0, 1 mM DTT, 10% glycerol, 1 mM ZnSO4, and 4 x 104 cpm of probe. Binding reactions were incubated at room temperature for 15 min and then loaded directly onto a 4.5% polyacrylamide gel and electrophoresed at 100 V in 1x Tris glycine electrophoresis buffer (190 mM glycine, 25 mM Tris.HCl pH8.5, 1 mM EDTA). The binding reaction complexes resolved from free probe on the nondenaturing polyacrylamide gel were dried onto Whatman paper and then exposed to x-ray film overnight. For the competitions, cold oligonucleotides were incubated with extract for 15 min at room temperature before addition of the probe. In the supershift experiments, Abs were added to the binding reaction and incubated for 40 min at room temperature before addition of probe. The CREB/ATF1 mAb was purchased from Santa Cruz Biotechnologies (catalog number sc-270; Santa Cruz, CA). The IgG1 Gag Abs were a kind gift from D. Wong (Columbia University). Site II EMSAs were performed using the binding conditions elsewhere described (see 28 . The binding reaction complexes were resolved from the free probe as described for site I EMSA. For site II supershift experiments, the Sp1 and Sp3 Abs were added to the cold binding reaction for 15 min before the addition of probe.
| Results |
|---|
|
|
|---|
Steady-state levels of NF-IL6 mRNA are induced 10- to 15-fold
following activation of promonocytes with cytokines or phorbol esters
(Ref. 4 and data not shown); however, the molecular basis for this
induction is not known. Therefore, we wished to determine whether
increased mRNA stability or increased transcription was responsible for
the activation-dependent increase in steady-state NF-IL6 mRNA. To
determine whether cellular activation alters the stability of NF-IL6
mRNA, the half-life of NF-IL6 mRNA was measured in untreated and
activated U937 cells following treatment with actinomycin D. Figure 1
A shows results that are
representative of two independent experiments. Although activation
caused a 14-fold increase in absolute levels of NF-IL6 mRNA, the
pattern of mRNA degradation was similar in untreated and activated U937
cells, and NF-IL6 mRNA stability decreased modestly following
activation. Therefore, increased stability of NF-IL6 mRNA cannot
account for the increase in steady-state levels observed in
activated U937 cells.
|
Two promoter-proximal regions regulate NF-IL6 gene transcription in U937 promonocytes
Having shown that the relative rate of NF-IL6
gene transcription initiation is increased in response to cellular
activation, we wished to identify the DNA sequences required for this
effect. The transcription initiation site of the NF-IL6 gene
was mapped previously (24). First we tested whether a portion of the
NF-IL6 gene containing the start site of transcription
conferred activation-inducible transcription on a luciferase reporter.
Transient transfections were conducted in U937 cells using a luciferase
reporter where transcription was dependent upon a fragment of the
NF-IL6 gene containing 2 kbp 5' and 125 bp 3' of the
transcription initiation site. Following transfection, the cells were
divided and treated with various combinations of activators. As shown
in Figure 2
A, this DNA
fragment contains promoter and transcriptional regulatory sequences
sufficient to confer both basal and activation-responsive transcription
on the reporter. The data in Figure 2
A confirm the results
in Figure 1
, showing that transcription from the NF-IL6
promoter increases in response to cellular activation by PMA+LPS.
Treatment of U937 cells with PMA alone or PMA+LPS had a similar effect,
inducing transcription five- to sixfold; however, treatment with LPS
alone induced transcription minimally (1.6-fold). Therefore, in
subsequent transfections, PMA alone was used for U937 cell activation,
and our studies provide insight into PMA-dependent regulation of
NF-IL6.
|
To identify protein-binding sites within this functionally defined
regulatory region of the NF-IL6 gene, DNase I footprinting
reactions were performed with U937 cell nuclear extracts. The DNase I
protection pattern conferred by the presence of nuclear factors in the
-44 to -97-bp region on both the coding and noncoding strands of the
NF-IL6 gene is shown in Figure 3
A. Two regions of protection
bracketed by hypersensitive sites were observed on the coding strand:
-34 to -41 bp, which encompasses the TATA box, and -48 to -69 bp,
which we will refer to subsequently as site I. On the noncoding strand,
a region corresponding to site I on the coding strand, between -55 to
-70 bp, was protected. In addition, another region of protection
between -76 to -82 bp was observed only on the noncoding strand, and
this region is designated site II. Nuclear extracts prepared from
untreated and activated U937 cells gave similar patterns of protection
on the coding and noncoding strands (lanes 2 vs
3, and data not shown).
|
The contribution of sites I and II to basal NF-IL6 promoter
activity in U937 cells was tested by a transient transfection assay. A
promoter lacking both site I and site II (-44 to +72 bp) was
approximately 20-fold less active than the -97- to +72-bp promoter
containing sites I and II (Fig. 4
),
establishing the importance of the -97 to -44-bp region for
NF-IL6 promoter activity. A promoter lacking site II but
retaining site I (-74 to +72 bp) displays modest but statistically
significant reduction in activity compared with the -97 to +72-bp
promoter in untreated cells. Similarly, a promoter containing wild-type
site II and a site-directed mutation that alters bases -53 to -67 in
site I (mutI -97 to +72 bp) also displays a modest but statistically
significant reduction in activity, compared with the promoter
containing both sites I and II. Thus, both sites I and II are important
for basal NF-IL6 promoter activity in U937 cells.
|
CREB/ATF and Sp1 proteins bind to sites I and II in the NF-IL6 promoter
EMSAs were performed to identify proteins from U937 nuclei
that bind to sites I and II of the NF-IL6 promoter.
Table I
contains the DNA sequences of the
oligonucleotides used in these experiments. In the EMSA shown in Figure 5
A, a site I oligonucleotide
probe was incubated with PMA-activated U937 cell nuclear proteins. One
prominent complex was observed that was competed by the addition of a
20-fold molar excess of unlabeled site I oligonucleotide (Fig. 5
A, lanes 911) but not by an 80-fold molar
excess of a mutant site I oligonucleotide (lanes
1214). An unlabeled consensus CRE site oligonucleotide
(lanes 68) competed efficiently for binding to the
site I probe at a fivefold molar excess. In contrast, a consensus AP-1
site oligonucleotide did not compete for binding to the site I probe at
an 80-fold molar excess (lanes 35). These data
suggest that nuclear factors that recognize a CRE site bind to site I.
We compared the binding of U937 nuclear proteins, before and after
activation, to oligonucleotide probes containing consensus binding
sites for AP-1 and CRE with site I complexes. The mobility and the
presence of a site I complex before and after activation of U937 cells
were similar to the CRE consensus probe binding activity, while the
AP-1 consensus probe showed a retarded complex with a slower mobility.
This result also suggests that CREB/ATF family proteins bind to site I
both before and after activation.
|
|
Analysis of U937 cell nuclear factors that recognize the
NF-IL6 gene site II region is shown in Figure 5
E.
In the EMSA, binding reactions performed with an excess of unlabeled
competitor oligonucleotides corresponding to a consensus Sp1 binding
site derived from the p21 promoter (lanes 68) or
site II from the NF-IL6 gene (lanes 35)
competed for the binding of U937 cell nuclear factors to the site II
probe. An oligonucleotide containing a mutant Sp1 binding site did not
compete for binding to the site II probe (Fig. 5
E,
lanes 911) (28). To examine directly the binding of Sp1
proteins to the site II probe, antisera that recognize Sp1 or Sp3 were
added to the binding reactions. Antiserum that recognizes Sp1
supershifted a site II complex formed by nuclear factors from untreated
and PMA-activated U937 cells (Fig. 5
F, lanes 2
and 5) (29). In contrast, preimmune and antiserum that
recognizes Sp3 did not affect the binding of U937 cell nuclear
factor(s) to site II (lanes 1, 3, 4 and 6)
(30). We conclude that Sp1 family proteins, including Sp1 but not Sp3,
bind site II in the NF-IL6 gene and are likely to activate
transcription of the NF-IL6 gene in U937 cells.
Endogenous CREB/ATF proteins are required for maximal NF-IL6 promoter activity in U937 cells
Our biochemical studies showed that CREB/ATF protein(s) in U937
nuclear extracts bind site I of the NF-IL6 gene, and
transient transfections indicated that site I is functionally important
for promoter activity. To test the role of CREB/ATF proteins for
regulating NF-IL6 promoter activity in vivo, we performed a
transient cotransfection assay using reporters dependent on the
NF-IL6 promoter and an expression plasmid encoding a
dominant negative form of CREB, CREB-2. CREB-2 exhibits CRE
binding activity but does not activate transcription due to changes in
amino acid residues of the kinase inducible domain (KID) domain
(31). NF-IL6 promoter activity with a cotransfected
CREB-2 expression plasmid was compared with promoter
activity with a cotransfected expression plasmid lacking the
CREB-2 cDNA (Fig. 6
).
Cotransfection of the CREB-2 cDNA significantly reduced the
activity of NF-IL6 promoters containing an upstream CRE site
(site I) in untreated U937 cells (Fig. 6
, lanes 1 vs
3 and 5 vs 7) and in PMA-activated
U937 cells (lanes 2 vs 4 and 6
vs 8). In contrast, the activity of a comparable
NF-IL6 promoter containing a mutation in the CRE site, mI
-97 to +72 bp, was only slightly reduced by the presence of
cotransfected CREB-2 in untreated (lanes 9
vs 11) or PMA-activated (lanes 10 vs
12) U937 cells. We conclude that endogenous CRE-binding
proteins are important for basal and PMA-inducible NF-IL6
promoter activity in U937 cells.
|
| Discussion |
|---|
|
|
|---|
The role of the CRE site at -62 bp in the NF-IL6 promoter
Our studies show that a conserved CRE site at -62 bp is
functionally important for basal and PMA-inducible NF-IL6
promoter activity in U937 cells (Fig. 4
) and that endogenous CREB/ATF
proteins are necessary for maximal activity of the NF-IL6
promoter in U937 cells (Fig. 6
). The supershift experiments (Fig. 5
)
confirm that proteins recognized by CREB antiserum (including ATF,
CREB-1, and CRM-1) bind site I, although the antiserum does not
distinguish among these proteins. The CREB/ATF family is comprised of
at least 11 family members including ATF18,
CREB-1, and CRE modulator (CREM); it contains both
trans-activators and trans-dominant negative
inhibitors of CRE site-dependent transcription (31, 32, 33, 34, 35). In the future
it will be important to determine which CREB/ATF proteins regulate
transcription of the NF-IL6 gene in monocytes/macrophages
and how monocyte/macrophage activation may alter the abundance and/or
activity of CREB/ATF proteins.
The contribution of CREB/ATF proteins to NF-IL6 promoter
activity before cellular activation is consistent with our observation
of proteins binding to site I before U937 cell activation (Fig. 5
), the observation of others that CREB/ATF proteins can interact
directly with the basal transcription machinery (36), and the fact that
CREB/ATF proteins are known to regulate the transcription of other
genes before cellular activation (37, 38). CREB/ATF proteins
are also important for PMA-inducible transcription of the
NF-IL6 gene in monocytes. It has been clearly demonstrated
that signal-dependent kinases phosphorylate CREB and enhance
CREB-mediated trans-activation. In monocytes we observed an
increase in transcriptional activation without a change in the binding
of nuclear factors to site I, which is consistent with the possibility
that PMA may induce kinases that activate CREB/ATF proteins (39, 40, 41).
The role of the CRE site in cellular activation responsive gene
expression is consistent with prior observations that CRE sites are
cytokine responsive elements in the myeloid cell line TF-1. Treatment
of TF-1 cells with GM-CSF or IL-3 induces erg-1 promoter
activity, which is dependent upon CRE and serum response element
(SRE) sites (40, 41, 42). CRE sites have also been implicated in monocyte
differentiation-specific transcription of macrophage inflammatory
protein-1ß (MIP-1ß) (43), MuRANTES, and
crg-2 (44). Thus, a functional role for the CRE site in
transcriptional regulation of the NF-IL6 gene in activated
U937 cells underscores the important role played by CRE-binding
proteins in monocyte/macrophage activation-dependent gene
expression.
The role of the -80-bp Sp1 site in the NF-IL6 promoter
We also demonstrated that a guanosine and cytosine-rich region recognized by the Sp1 family of proteins at -80 is important for basal and activation-induced NF-IL6 promoter activity in U937 cells. Factors known to bind Sp1 sites include Sp1-4, and the Egr family (45, 46, 47, 48). Our supershift experiments demonstrated that Sp1, but not Sp3, present in U937 cell nuclear extracts binds to the NF-IL6 gene site II sequence. It is also possible that other Sp1 family members, which cross-react with the Sp1 antiserum, bind site II. Consistent with our observations, guanosine and cytosine-rich sequences recognized by Sp1 have been identified as PMA-responsive elements in other genes such as the thromboxane receptor gene (49), proximal platelet-derived growth factor A-chain gene (50), and the HIV-1 long terminal repeat (LTR) (51). Although we do not know how Sp1 proteins confer PMA inducibility to the NF-IL6 promoter, our data add to growing evidence that Sp1 sites can be targets of signal transduction pathways.
The NF-IL6 promoter is controlled by different regulatory elements in macrophages and hepatocytes
During completion of this work, a study analyzing
NF-IL6 gene expression during liver regeneration was
reported (52). In the liver, expression of NF-IL6 is induced at times
of physiologic stress such as the acute phase response and liver
regeneration (53). There are significant differences in promoter
elements required for NF-IL6 transcription in hepatocytic
and monocytic cell lines. In hepatocytic lines, basal and protein
kinase A (PKA)-inducible NF-IL6 promoter activity
required the synergistic activity of two CRE sites, located at -62 and
-110 bp relative to the start site of transcription. Although our
DNase I footprinting experiments showed that the -110-bp CRE site was
occupied by U937 cell nuclear proteins (data not shown), this region
was not required for minimal promoter activity in U937 cells (Fig. 2
).
A 104-bp region of the NF-IL6 gene (-97 to +7 bp),
containing a functionally important CRE site at -62 bp and a
functionally important Sp1 site at -80 bp, was sufficient to confer
full promoter activity in either untreated or activated U937 cells. Our
results, together with those of Niehof et al. (52), emphasize the
importance of CRE sites for regulation of the NF-IL6
promoter in both cell lineages and show that the -62-bp CRE site alone
is not sufficient to provide full promoter activity in either cell
lineage. In monocytes, the promoter proximal CRE site requires the Sp1
site, whereas in hepatocytes an upstream CRE site is required. Thus
the NF-IL6 gene provides an example of a promoter that is
regulated by different cis elements in different cell
lineages.
Proteins binding to both CRE and Sp1 sites are ubiquitously present; however, tissue-specific differences in the relative abundance of individual family members, posttranslational modifications or coactivators are likely to exist. It may be that monocytes have increased abundance or activity of proteins that can activate through the Sp1 site relative to hepatocytes. This would be consistent with the finding that the Sp1 site in the macrophage-specific CD11b promoter is occupied in a macrophage-specific way (54). Similarly, hepatocytes may have a cellular activity that functions through the -110-bp CRE site that is less active or abundant in monocytes. Either model could explain why the promoter proximal CRE site requires the Sp1 site in monocytes while the upstream CRE site is required in hepatocytes. As a consequence of being regulated by different cis elements, we speculate that the NF-IL6 promoter is subjected to regulation by different signaling pathways in hepatocytes and monocytes.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Physiology and Cell Biology, Albany Medical College, Albany, NY 12208. ![]()
3 Address correspondence and reprint requests to Dr. Kathryn Calame, Department of Microbiology, Columbia University College of Physicians and Surgeons, 701 West 168th Street, New York, NY 10032. ![]()
4 Abbreviations used in this paper: C/EBP, CCAAT/enhancer-binding protein; M-CSF, macrophage CSF; CREB/ATF, cAMP response element-binding protein/activation transcription factor; CRE, cAMP response element; AP-1, activator protein-1; wt, wild type; EMSA, electrophoretic mobility shift assay. ![]()
Received for publication October 16, 1997. Accepted for publication April 23, 1998.
| References |
|---|
|
|
|---|
B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc. Natl. Acad. Sci. USA 90:10193.
B p65 and NF-interleukin-6 binding elements in the tumor necrosis factor response region of the granulocyte colony-stimulating factor promoter. Blood 83:2469.
gene. J. Clin. Invest. 94:1449.
and ß in brown adipose tissue: evidence for a tissue-specific pattern of expression during development. Biochem. J. 302:695.
B and Sp1 is required for HIV-1 enhancer activation. EMBO J. 12:3551.[Medline]
This article has been cited by other articles:
![]() |
B. Csoka, Z. H. Nemeth, L. Virag, P. Gergely, S. J. Leibovich, P. Pacher, C.-X. Sun, M. R. Blackburn, E. S. Vizi, E. A. Deitch, et al. A2A adenosine receptors and C/EBP{beta} are crucially required for IL-10 production by macrophages exposed to Escherichia coli Blood, October 1, 2007; 110(7): 2685 - 2695. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tanaka, Y. Hoshino, J. Gold, S. Hoshino, F. Martiniuk, T. Kurata, R. Pine, D. Levy, W. N. Rom, and M. Weiden Interleukin-10 Induces Inhibitory C/EBP{beta} through STAT-3 and Represses HIV-1 Transcription in Macrophages Am. J. Respir. Cell Mol. Biol., October 1, 2005; 33(4): 406 - 411. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Bradley, L. Zhou, and S. T. Smale C/EBP{beta} Regulation in Lipopolysaccharide-Stimulated Macrophages Mol. Cell. Biol., July 15, 2003; 23(14): 4841 - 4858. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Brenner, S. Prosch, K. Schenke-Layland, U. Riese, U. Gausmann, and C. Platzer cAMP-induced Interleukin-10 Promoter Activation Depends on CCAAT/Enhancer-binding Protein Expression and Monocytic Differentiation J. Biol. Chem., February 14, 2003; 278(8): 5597 - 5604. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Hughes, T. S. Tengku-Muhammad, S. A. Irvine, and D. P. Ramji A Novel Role of Sp1 and Sp3 in the Interferon-gamma -mediated Suppression of Macrophage Lipoprotein Lipase Gene Transcription J. Biol. Chem., March 22, 2002; 277(13): 11097 - 11106. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gupta, M. Jiang, A. Anthony, and A. B. Pernis Lineage-Specific Modulation of Interleukin 4 Signaling by Interferon Regulatory Factor 4 J. Exp. Med., December 20, 1999; 190(12): 1837 - 1848. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Silverman, S. Eimerl, and J. Orly CCAAT Enhancer-binding Protein beta and GATA-4 Binding Regions within the Promoter of the Steroidogenic Acute Regulatory Protein (StAR) Gene Are Required for Transcription in Rat Ovarian Cells J. Biol. Chem., June 18, 1999; 274(25): 17987 - 17996. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Niehof, K. Streetz, T. Rakemann, S. C. Bischoff, M. P. Manns, F. Horn, and C. Trautwein Interleukin-6-induced Tethering of STAT3 to the LAP/C/EBPbeta Promoter Suggests a New Mechanism of Transcriptional Regulation by STAT3 J. Biol. Chem., March 16, 2001; 276(12): 9016 - 9027. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Caivano, B. Gorgoni, P. Cohen, and V. Poli The Induction of Cyclooxygenase-2 mRNA in Macrophages Is Biphasic and Requires both CCAAT Enhancer-binding protein beta (C/EBPbeta ) and C/EBPdelta Transcription Factors J. Biol. Chem., December 21, 2001; 276(52): 48693 - 48701. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |