The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Berrier, A.
Right arrow Articles by Calame, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Berrier, A.
Right arrow Articles by Calame, K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*12-O-TETRADECANOYLPHORBOL-13-ACETATE
The Journal of Immunology, 1998, 161: 2267-2275.
Copyright © 1998 by The American Association of Immunologists

Transcription of a Minimal Promoter from the NF-IL6 Gene Is Regulated by CREB/ATF and SP1 Proteins in U937 Promonocytic Cells1

Allison Berrier2, Gerald Siu and Kathryn Calame3

Department of Microbiology, College of Physicians and Surgeons, Columbia University, New York, NY 10032


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NF-IL6 is an important transcriptional regulator of genes induced in activated monocytes/macrophages, and NF-IL6 is the only CCAAT/enhancer-binding protein (C/EBP) family member whose steady-state mRNA levels increase upon activation of monocytes (1). We show that increased transcription of the NF-IL6 gene is responsible, at least in part, for induction of NF-IL6 mRNA following activation of U937 promonocytic cells. We have identified a 104-bp minimal promoter region of the NF-IL6 gene that is sufficient for basal and activation-dependent induction of transcription in U937 cells. This region contains binding sites for the cAMP response element-binding protein/activation transcription factor (CREB/ATF) and Sp1 families of transcription factors. Each site is functionally important and contributes independently to transcription of the NF-IL6 gene in U937 cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The NF-IL6 gene was first identified as a transcription factor in monocytes that bound an IL-1 response element in the IL-6 promoter (2). NF-IL6 is a member of the CCAAT/enhancer-binding protein (C/EBP)4 family of basic-leucine zipper transcription factors that bind as dimers to a consensus C/EBP site (TTNNGNAAN). NF-IL6 is strongly induced upon activation of monocytes, and it is the only known C/EBP protein induced following monocyte activation (1). In monocyte/macrophages, NF-IL6 is critical for activation-dependent expression of numerous cellular and viral genes. Many cellular genes expressed in activated macrophages, including IL-1ß, IL-6, IL-8, macrophage (M)-CSF, TNF-{alpha}, granulocyte (G)-CSF, and nitric oxide synthase, contain functionally important C/EBP sites in their transcriptional regulatory regions (2, 3, 4, 5, 6). NF-IL6 is also required for the induction of latent HIV-1 provirus and for replication of HIV-1 in monocytes/macrophages (1, 7).

The biologic importance of NF-IL6 in macrophages has been confirmed by gene targeting experiments in mice. NF-IL6-/- mice have impaired macrophage function, including a poor response to bacterial or viral pathogens and severely defective tumor cytotoxicity (8). Cytokine production by macrophages derived from NF-IL6-/- mice is abnormal, confirming the importance of NF-IL6 for regulated transcription of cytokine genes. In addition, splenomegaly due to B cell and monocyte/macrophage hyperplasia is frequently observed in older NF-IL6-/- mice in conjunction with elevations in the serum levels of IL-6 and macrophage (M)-CSF, suggesting that some biologic functions of NF-IL6 in vivo are not completely understood (9, 10).

Although NF-IL6 mRNA is expressed in many tissues, its expression is usually tightly regulated by cellular activation or differentiation. Steady-state NF-IL6 mRNA levels are strongly induced following activation of monocytes/macrophages by a variety of effectors including mitogens and cytokines such as LPS, PMA, IL-1, and IL-6 (2). NF-IL6 is induced upon activation of splenic B cells by the polyclonal B cell mitogen LPS (11). In adipocytes, NF-IL6 mRNA levels decrease during terminal differentiation (12). The molecular basis for the regulated expression of NF-IL6 in these cell lineages is not well understood.

The importance of NF-IL6 in monocytes/macrophages for activation-dependent regulation of cellular genes and of HIV-1 provirus prompted us to investigate the regulation of NF-IL6 mRNA expression in monocytes/macrophages. As a model, we have utilized the U937 promonocytic cell line that can be activated to undergo differentiation by treatment with LPS and/or PMA (13). Our studies demonstrate that in U937 cells steady-state levels of NF-IL6 mRNA increase following cellular activation with LPS and PMA due to increased transcription initiation of the NF-IL6 gene. Analysis of the NF-IL6 promoter showed that a 104-bp region was sufficient to confer strong basal and PMA-responsive promoter activity in U937 cells. Within this region, binding sites for CREB/ATF and Sp1 families of transcription factors were identified and shown to be functionally important for promoter activity. Finally, endogenous CREB/ATF proteins were shown to be important for maximal NF-IL6 promoter activity in U937 cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissue culture

The promonocytic U937 cell line was purchased from American Type Culture Collection (ATCC, Manassas, VA) and cultured in RPMI 1640 supplemented with 10% FCS and gentamicin. LPS (Salmonella typhimurium type w; Difco, Detroit, MI) was resuspended at 10 mg/ml in H2O and used at a final concentration of 10 µg/ml. Phorbol-12-myristate 13-acetate purchased from Sigma Chemicals (catalog number P-8139; St. Louis, MO) was resuspended at 1 mg/ml in DMSO and used at a final concentration of 10 ng/ml. For the stimulations, U937 cells were plated at a density of 1 x 106 cell/ml before the addition of LPS or PMA.

Luciferase assays

The murine NF-IL6 genomic clone was a generous gift of V. Poli (Istituto Ricerche di Biologia Moleculaire, Pomezia, Italy). The 16-kbp genomic DNA Sau3A fragment was cloned into the BamHI site of {lambda} EMBL3. An NcoI fragment containing 2 kbp 5' of the transcription initiation site and 125 bp 3' of the initiation site was end-filled and blunt-end cloned into the SmaI site of p19luc. A plasmid containing 1 kbp 5' of the initiation site was generated by digestion of the 2-kbp luc construct with HindIII and AvrII, and subsequently end filled and religated. The HindIII site is a unique restriction enzyme site located on the 5' end of the p19luc cloning polylinker, whereas the AvrII site is located approximately 1 kbp upstream of the start site of NF-IL6 transcription. The 125-bp NF-IL6 promoter construct was prepared by digestion of the 2-kbp luc construct with HindIII and SmaI, with subsequent end fill and religation. The 125-bp NF-IL6 promoter plasmid served as the PCR template for generation of the -97 to +72, -74 to +72, -44 to +72. The primers used for PCR amplification of the minimal promoter constructs were -97 AAGGAAGCTTCGGGTGGCGGGG -74 AAGGAAGCTTGCCCCAGCGTGACG -44 AAGGAAGCTTGCCGCCTTATAAAC +72 GGAAAAGCTTCCCAGGCCAGCA. The construct used for transfection efficiency control contains the renilla luciferase gene driven by the thymidine kinase promoter (Promega, Madison, WI). The site I mutant -97 to +72 NF-IL6 promoter plasmid containing 13 nucleotide sequence changes in a 15-bp nucleotide region extending from -53 to -67 was cloned upstream of the firefly luciferase reporter gene through mutagenic PCR using the SmaI construct as the PCR template. The sequence of the mutagenic PCR primer is as follows: 5' AGGCGGCGCCTGGCACGCCGAGCTCCACCCCTGGGGCCCCTCCCG 3'.

Nuclear run-on assay

For the nuclear run-on assay, U937 cells were cultured in the presence of LPS/PMA or media alone for 12 h. Cells (5 x 106) were set aside for FACS analysis, and the intensity of CD54 (ICAM-1) staining was used to monitor cellular activation. The nascent RNA transcripts within nuclei prepared from the remainder of the cells were elongated in vitro in the presence of the radiolabeled nucleotide [32P]CTP. The labeled RNA transcripts were isolated as described previously (14). A total of approximately 1 x 107 cpm of nuclear run-on RNA were hybridized with a filter onto which target DNA had been slotted. The controls used in this study included murine c-myc and glyceraldehyde phosphate dehydrogenase (GAPDH). The washed filter was air dried and then exposed to a phosphorimager screen for quantitation of the signals using Molecular Dynamics (Sunnyvale, CA) software.

Transient transfections

For the transient transfection assays, 6 x 106 U937 cells in 0.3 ml of RPMI 1640 and 10% FCS were transfected by electroporation with a Bio-Rad gene pulsar set at 240 V, 960 µF. Twenty micrograms of the NF-IL6 promoter firefly luciferase reporter construct were cotransfected with 5 µg of a plasmid containing the renilla luciferase gene driven by the thymidine kinase promoter as a transfection efficiency control. The CREB-2 cotransfection experiments did not include a transfection efficiency control because TK promoter activity is responsive to CREB/ATF family members (15). For the CREB cotransfection experiments, the luciferase activities were corrected for the total amount of protein in the transfectant cellular extracts.

Electroporated cells were equally divided into two 6-ml cultures containing complete RPMI with or without PMA. Twelve to sixteen hours following electroporation, the transfected cells were harvested and the levels of luciferase activity were measured as described previously (16). In the renilla luciferase cotransfection experiments, 20{lambda} of the transfectant extract prepared from non-PMA-treated cultures were assayed for renilla luciferase activity according to the manufacturer’s instructions (Promega Dual Luciferase Assay Kit).

Transcript stability studies

U937 cells were cultured without or with LPS and PMA for 12 h. At the end of the stimulation period, cultures of control and activated U937 cells were treated with 5 µg/ml Actinomycin D for variable lengths of time; then total cellular RNA was prepared (17). Total cellular mRNA levels were assessed by Northern blot. For the Northern analysis, 40 µg of total cellular RNA were loaded per lane in the 1% agarose formaldehyde gel according to the protocol described previously (18). DNA probes for Northern analysis were labeled by the random hexamer priming method (19). The NF-IL6 hybridization probe was a PstI-EcoRI fragment derived from the pBlue 610 plasmid containing the human NF-IL6 cDNA (kindly provided by S. Akira, Hyogo College of Medicine, Hyogo, Japan). The Northern was hybridized with the NF-IL6 specific probe, stripped (Amersham protocol, Arlington Heights, IL) and then rehybridized with a probe containing sequences of the 2.0-kbp human ß-actin cDNA to control for equal loading of RNA per lane. The ß-actin sequences were derived from the pGhu-ß-actin construct containing a human ß-actin cDNA in the pGEM3 vector (kindly provided by R. Della-Favera, Columbia University, New York, NY). The Northern blot signals were quantitated using a phosphorimager (Molecular Dynamics). The RNA signal observed at the 10-min time point was normalized to 100%, and the percentage of signal remaining with time was calculated.

DNase I protection assay

A NotI-NcoI fragment from the NF-IL6 gene corresponding to -284 to +125 bp relative to the start site of transcription was 5' end labeled on the coding or noncoding strand and subjected to DNase I footprinting as described previously (20). Each reaction contained approximately 50,000 cpm of 5' end-labeled DNA that was subjected to limited DNase I digestion in the presence or absence of nuclear factors. The crude nuclear extracts used for the DNase I reaction were prepared from control and LPS/PMA-activated U937 cells as described elsewhere (20). The nuclear extracts were purified by ammonium sulfate fractionation as previously described (21). Approximately one third of the purified DNase I reaction products were resolved on an 8% polyacrylamide/8 M urea sequencing gel.

EMSAs

Nuclear extracts from control and 20 h PMA-activated U937 cells were prepared as previously described (22). Site I EMSAs were performed as described previously (20). The binding reactions included 1.5 to 6.0 µg crude nuclear extract, 0.5 µg sheared herring sperm DNA, 10 mM HEPES.KOH pH7.9, 50 mM NaCl, 5 mM Tris. HCl pH7.5, 15 mM EDTA pH8.0, 1 mM DTT, 10% glycerol, 1 mM ZnSO4, and 4 x 104 cpm of probe. Binding reactions were incubated at room temperature for 15 min and then loaded directly onto a 4.5% polyacrylamide gel and electrophoresed at 100 V in 1x Tris glycine electrophoresis buffer (190 mM glycine, 25 mM Tris.HCl pH8.5, 1 mM EDTA). The binding reaction complexes resolved from free probe on the nondenaturing polyacrylamide gel were dried onto Whatman paper and then exposed to x-ray film overnight. For the competitions, cold oligonucleotides were incubated with extract for 15 min at room temperature before addition of the probe. In the supershift experiments, Abs were added to the binding reaction and incubated for 40 min at room temperature before addition of probe. The CREB/ATF1 mAb was purchased from Santa Cruz Biotechnologies (catalog number sc-270; Santa Cruz, CA). The IgG1 Gag Abs were a kind gift from D. Wong (Columbia University). Site II EMSAs were performed using the binding conditions elsewhere described (see 28 . The binding reaction complexes were resolved from the free probe as described for site I EMSA. For site II supershift experiments, the Sp1 and Sp3 Abs were added to the cold binding reaction for 15 min before the addition of probe.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activation of U937 promonocytes with PMA and LPS induces NF-IL6 transcription

Steady-state levels of NF-IL6 mRNA are induced 10- to 15-fold following activation of promonocytes with cytokines or phorbol esters (Ref. 4 and data not shown); however, the molecular basis for this induction is not known. Therefore, we wished to determine whether increased mRNA stability or increased transcription was responsible for the activation-dependent increase in steady-state NF-IL6 mRNA. To determine whether cellular activation alters the stability of NF-IL6 mRNA, the half-life of NF-IL6 mRNA was measured in untreated and activated U937 cells following treatment with actinomycin D. Figure 1GoA shows results that are representative of two independent experiments. Although activation caused a 14-fold increase in absolute levels of NF-IL6 mRNA, the pattern of mRNA degradation was similar in untreated and activated U937 cells, and NF-IL6 mRNA stability decreased modestly following activation. Therefore, increased stability of NF-IL6 mRNA cannot account for the increase in steady-state levels observed in activated U937 cells.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 1. Mitogen activation of U937 cells increases the transcription of the NF-IL6 gene. A, Comparison of the stability of the NF-IL6 mRNA in untreated and LPS/PMA-activated U937 cells. Upper panel, Northern blot analysis of total cellular RNA from untreated and LPS/PMA U937 cells at various times following addition of actinomycin D. The blot was hybridized with an NF-IL6-specific probe, stripped, and then rehybridized with a human ß-actin probe to control for RNA loading. Lower panel, The NF-IL6 transcripts were quantitated with a phosphoImager (molecular dynamics software) and normalized to ß-Actin. B, Comparison of the relative rates of transcription initiation in untreated (filter 1) and 12-h LPS/PMA-activated (filter 2) U937 cells. Left panel shows hybridization of labeled RNA to specific cDNAs. Right panel shows a graphic representation of the quantitated results. This experiment was performed three times and relative rate of transcription initiation on the NF-IL6 gene increased an average of 3.2 ± 1.6-fold.

 
Nuclear run-on experiments were performed to measure the relative rate of transcription initiation of the NF-IL6 gene in U937 cells before and 12 h after cellular activation with PMA+LPS. Figure 1GoB shows a representative nuclear run-on experiment where the rate of NF-IL6 transcription initiation was induced approximately threefold. As a control, the relative rate of c-myc transcription was examined and, as reported previously, it decreased following activation of the U937 cells (23). In three nuclear run-on experiments, an average increase of 3.2 ± 1.6-fold in the relative rate of NF-IL6 transcription initiation was observed. We conclude that the induction of NF-IL6 mRNA observed following activation of U937 promonocytes by PMA+LPS can be attributed, at least in part, to increased transcription of the gene.

Two promoter-proximal regions regulate NF-IL6 gene transcription in U937 promonocytes

Having shown that the relative rate of NF-IL6 gene transcription initiation is increased in response to cellular activation, we wished to identify the DNA sequences required for this effect. The transcription initiation site of the NF-IL6 gene was mapped previously (24). First we tested whether a portion of the NF-IL6 gene containing the start site of transcription conferred activation-inducible transcription on a luciferase reporter. Transient transfections were conducted in U937 cells using a luciferase reporter where transcription was dependent upon a fragment of the NF-IL6 gene containing 2 kbp 5' and 125 bp 3' of the transcription initiation site. Following transfection, the cells were divided and treated with various combinations of activators. As shown in Figure 2GoA, this DNA fragment contains promoter and transcriptional regulatory sequences sufficient to confer both basal and activation-responsive transcription on the reporter. The data in Figure 2GoA confirm the results in Figure 1Go, showing that transcription from the NF-IL6 promoter increases in response to cellular activation by PMA+LPS. Treatment of U937 cells with PMA alone or PMA+LPS had a similar effect, inducing transcription five- to sixfold; however, treatment with LPS alone induced transcription minimally (1.6-fold). Therefore, in subsequent transfections, PMA alone was used for U937 cell activation, and our studies provide insight into PMA-dependent regulation of NF-IL6.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 2. NF-IL6 promoter activity following transfection into U937 cells. A, Activity of a luciferase reporter dependent upon a fragment of the NF-IL6 gene (-2 kbp to +125 bp) in untreated and activated U937 cells. Following electroporation, cells were cultured in complete media with or without LPS, PMA, or the combination of LPS and PMA, as indicated below the bar graph. The data are presented relative to the activity in untreated cells. B, Defining the minimal NF-IL6 promoter. Activity of different portions of the promoter, represented schematically on the left, was determined in untreated (open bars) and PMA-treated (closed bars) cells. The activity of the -97- to +72-bp NF-IL6 construct in control U937 cells (approximately 1–5 x 103 light units) was set to 1.0. These data represent a minimum of three independent transfections.

 
To define a minimal promoter region and identify regulatory elements required for NF-IL6 promoter activity, a series of truncated promoters was generated and transfected into U937 cells. Deleting sequences 5' of -97 bp had no significant effect on either basal or activated NF-IL6 promoter activity, suggesting that the region from -2 kb to -97 bp is not required for promoter activity (Fig. 2GoB). In addition, 3' truncation to +7 bp did not alter promoter activity. Therefore, sequences between +7 and +125 bp are not required for promoter activity. However, 5' truncation to -44 bp resulted in a significant reduction in NF-IL6 promoter activity. Thus, the region from -97 to +7 bp is sufficient to confer basal and PMA-activated promoter activity and can be considered the minimal NF-IL6 promoter in this assay system. Furthermore, the region between -97 to -44 bp was shown to be required for promoter activity in monocytic cells.

To identify protein-binding sites within this functionally defined regulatory region of the NF-IL6 gene, DNase I footprinting reactions were performed with U937 cell nuclear extracts. The DNase I protection pattern conferred by the presence of nuclear factors in the -44 to -97-bp region on both the coding and noncoding strands of the NF-IL6 gene is shown in Figure 3GoA. Two regions of protection bracketed by hypersensitive sites were observed on the coding strand: -34 to -41 bp, which encompasses the TATA box, and -48 to -69 bp, which we will refer to subsequently as site I. On the noncoding strand, a region corresponding to site I on the coding strand, between -55 to -70 bp, was protected. In addition, another region of protection between -76 to -82 bp was observed only on the noncoding strand, and this region is designated site II. Nuclear extracts prepared from untreated and activated U937 cells gave similar patterns of protection on the coding and noncoding strands (lanes 2 vs 3, and data not shown).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 3. DNase I protection analysis of the NF-IL6 gene. A, The NF-IL6 gene coding strand was 5' labeled at -284 relative to the start site of transcription. The NF-IL6 gene noncoding strand probe was 5' labeled at +125 relative to the start site of transcription. The NF-IL6 coding strand (lanes 1–4) and noncoding strand (lanes 5–7) probes were incubated with 0 (lanes 1, 4, 5 and 7) or 80 µg of nuclear extract protein prepared from untreated (lanes 2 and 6) and LPS/PMA-activated (lane 3) U937 cells before the limited DNase I reaction. Positions of the DNA strand protected from DNase I digestion, designated with a box, were identified by alignment with parallel lanes of a dideoxynucleotide sequencing ladder of pUC19. Arrows designate sites of hypersensitivity to DNase I when nuclear proteins were present. The image of the noncoding strand gel was inverted to allow a direct comparison of the same regions on both strands. B, Sequence of the NF-IL6 gene transcriptional regulatory region with nucleotide positions protected in the DNase I reaction shown with a line. Vertical arrows designate positions of hypersensitivity detected in the DNase I protection assay. C, Sequence of the murine NF-IL6 gene minimal promoter region required for inducible promoter activity in U937 cells. Alignment with the rat and human minimal NF-IL6 promoter region is shown. The positions of the NF-IL6 gene designated as sites I and II that contain the DNase I protected regions are framed with a box. The TATA Box, CRE or AP-1 like site, and Sp1 consensus regions are underlined. The horizontal arrow designates the start site of transcription. The dash refers to the absence of a corresponding nucleotide; a gap indicates the insertion of a nucleotide.

 
The footprinting results are depicted schematically in Figure 3GoB. Comparison of the sequences of sites I and II with known transcription factor binding sites revealed that site I contains sequences similar to a CRE or AP-1 site (25, 26). Site II contains a consensus binding site for the Sp1 family of transcription factors (Fig. 3GoC) (27). Although the region 5' of site II is very GC-rich and contains additional 5' Sp1 consensus binding sites (Fig. 3GoC), we did not observe protection of these 5' sequences in our DNase I experiments. The DNA sequence of the mouse, rat, and human NF-IL6 promoter region is shown in Figure 3GoC. The regions of the NF-IL6 gene designated as sites I and II are indicated with a box in Figure 3GoC. Interestingly, the DNase I protected regions occur within sequences of the NF-IL6 gene, which are highly conserved among the three species.

The contribution of sites I and II to basal NF-IL6 promoter activity in U937 cells was tested by a transient transfection assay. A promoter lacking both site I and site II (-44 to +72 bp) was approximately 20-fold less active than the -97- to +72-bp promoter containing sites I and II (Fig. 4Go), establishing the importance of the -97 to -44-bp region for NF-IL6 promoter activity. A promoter lacking site II but retaining site I (-74 to +72 bp) displays modest but statistically significant reduction in activity compared with the -97 to +72-bp promoter in untreated cells. Similarly, a promoter containing wild-type site II and a site-directed mutation that alters bases -53 to -67 in site I (mutI -97 to +72 bp) also displays a modest but statistically significant reduction in activity, compared with the promoter containing both sites I and II. Thus, both sites I and II are important for basal NF-IL6 promoter activity in U937 cells.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 4. Site I and site II are required for activity of the NF-IL6 promoter. U937 cells were transiently transfected with reporters dependent on portions of the NF-IL6 promoter. The length and content of the sequences upstream of the NF-IL6 promoter in the panel of constructs are shown schematically at the left. The bars represent the relative activity in untreated (solid) and PMA-activated (open) U937 cells after normalization to a control. The activity of the -97- to +72-bp NF-IL6 promoter construct in untreated U937 cells was set to 1.0. The values shown represent the average of at least five independent transfections. The Student t test for variability was applied to results comparing basal activity of the -97 to +72-bp promoter to that of promoters containing -74 to +72 bp (no site II) and -97 to +72 with a mutation in site I. The reduction in activity of the latter two promoters, compared with the -97 to +72-bp promoter, was statistically significant (p = 0.01).

 
The contribution of sites I and II to activation-inducible NF-IL6 promoter activity in U937 cells was also determined. The promoter containing sites I and II is reproducibly induced 5.5-fold by activation of U937 cells. The activity of a promoter containing only site I (-74 to +72 bp) is induced 4.2-fold following activation. The activity of a promoter containing site II alone (mutI -97 to +72 bp) is induced 3.5-fold in response to activation. Thus both sites I and II are necessary for full activity in response to activation, but they do not function synergistically. In summary, these data show that sites I and II function as positive regulatory elements for the NF-IL6 promoter in U937 cells and that they are independently required for basal and activation-induced transcription.

CREB/ATF and Sp1 proteins bind to sites I and II in the NF-IL6 promoter

EMSAs were performed to identify proteins from U937 nuclei that bind to sites I and II of the NF-IL6 promoter. Table IGo contains the DNA sequences of the oligonucleotides used in these experiments. In the EMSA shown in Figure 5GoA, a site I oligonucleotide probe was incubated with PMA-activated U937 cell nuclear proteins. One prominent complex was observed that was competed by the addition of a 20-fold molar excess of unlabeled site I oligonucleotide (Fig. 5GoA, lanes 9–11) but not by an 80-fold molar excess of a mutant site I oligonucleotide (lanes 12–14). An unlabeled consensus CRE site oligonucleotide (lanes 6–8) competed efficiently for binding to the site I probe at a fivefold molar excess. In contrast, a consensus AP-1 site oligonucleotide did not compete for binding to the site I probe at an 80-fold molar excess (lanes 3–5). These data suggest that nuclear factors that recognize a CRE site bind to site I. We compared the binding of U937 nuclear proteins, before and after activation, to oligonucleotide probes containing consensus binding sites for AP-1 and CRE with site I complexes. The mobility and the presence of a site I complex before and after activation of U937 cells were similar to the CRE consensus probe binding activity, while the AP-1 consensus probe showed a retarded complex with a slower mobility. This result also suggests that CREB/ATF family proteins bind to site I both before and after activation.


View this table:
[in this window]
[in a new window]
 
Table I. The sequence of oligonucleotides used in the EMSAs

 


View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 5. Identification of proteins in U937 nuclear extracts that bind sites I and II. A, Oligonucleotides containing sequences derived from site I (-44 to -73 bp) of the wild-type NF-IL6 gene were incubated with nuclear extracts from PMA-activated U937 cells. Binding to the site I probe was competed with 5x (lanes 3, 6, 9 and 12), 20x (lanes 4, 7, 10 and 13), 80x (lanes 5, 8, 11 and 14) molar excess of unlabeled AP-1 (lanes 3–5), CRE (lanes 6–8), site I (lanes 9–11), and mutant site I (lanes 12–14) oligonucleotides described in Table IGo. B, EMSA performed with a consensus AP-1 site (lanes 1 and 2), CRE site (lanes 3 and 4), and wt site I (lanes 5 and 6) probes incubated with 6 µg crude nuclear extracts prepared from untreated (lanes 1, 3 and 5) and PMA-activated (lanes 2, 4 and 6) U937 cells. C, EMSA supershift performed with site I probe (lanes 1–5, 8–10) or a consensus CRE probe (lanes 6–7) incubated without (lane 1) or with crude nuclear extracts prepared from untreated (lanes 2, 3 and 8–10) and PMA-activated (lanes 4–7) U937 cells. {alpha}CREB/ATF (lanes 1, 3, 5 and 7) or isotype-matched control {alpha}Gag (lanes 2, 4 and 6) mAbs were added to the binding reactions. The specificity of the site I complexes were confirmed by competitions with wt (lane 9) and mutant site I (lane 10) oligonucleotides. Controls containing probe and {alpha}Gag showed no bands (data not shown) D, EMSA performed with 1 ng end-labeled wt site I (lanes 3, 4) and mutant site I (lanes 1, 2) probes incubated without (lanes 1, 3) or with 6 µg PMA-activated U937 cell crude nuclear extract (lanes 2, 4). E, Oligonucleotides containing sequences derived from site II (-74 to -96 bp) of the NF-IL6 gene were end labeled and incubated without (lane 1) or with (lanes 2–12) 6 µg U937 cell crude nuclear extract. Binding to the site II probe was competed with 50x (lanes 3, 6 and 9), 200x (lanes 4, 7 and 10) and 800x (lanes 5, 8 and 11) molar excess of oligonucleotides corresponding to NF-IL6 site II (lanes 3–5), the Sp1 site from the p21 promoter (lanes 6–8), and a mutant Sp1 site from the p21 promoter (lanes 9–11). F, EMSA supershift performed with end-labeled site II probe incubated with crude nuclear extracts prepared from untreated (lanes 1–3) and PMA-activated (lanes 4–6) U937 cells. To the binding reaction, polyclonal antiserum to either Sp1(lanes 2 and 5), Sp3 (lanes 3 and 6), or control preimmune serum (lanes 1 and 4) was added. Control reactions containing probe and preimmune antiserum showed no bands (data not shown).

 
To test directly for binding of ATF/CREB proteins to site I, a mAb that recognizes members of the CREB/ATF family was used in a "supershift" experiment. The ability of the CREB/ATF mAb to supershift a consensus CRE site complex was examined in the EMSA binding reactions shown in Figure 5GoC (lanes 6 and 7). Nuclear factors that recognize the site I probe in untreated and activated U937 cells were supershifted by the CREB/ATF mAb (Fig. 5GoC, lanes 3 and 5) but not by an isotype-matched control mAb (lanes 2 and 4). The specific site I complex was efficiently supershifted by the CREB/ATF mAb, suggesting that most site I complexes contain CREB/ATF family members. The site I mutation, previously shown to reduce NF-IL6 promoter activity (Fig. 4Go), was used as a probe in an EMSA that revealed that the site I mutation ablates the binding of nuclear factors to that oligonucleotide (Fig. 5GoD, compare lanes 2 and 4). We conclude that, in U937 cells, members of the CREB/ATF family bind to site I of the NF-IL6 gene and are likely to mediate site I-dependent transcriptional activation.

Analysis of U937 cell nuclear factors that recognize the NF-IL6 gene site II region is shown in Figure 5GoE. In the EMSA, binding reactions performed with an excess of unlabeled competitor oligonucleotides corresponding to a consensus Sp1 binding site derived from the p21 promoter (lanes 6–8) or site II from the NF-IL6 gene (lanes 3–5) competed for the binding of U937 cell nuclear factors to the site II probe. An oligonucleotide containing a mutant Sp1 binding site did not compete for binding to the site II probe (Fig. 5GoE, lanes 9–11) (28). To examine directly the binding of Sp1 proteins to the site II probe, antisera that recognize Sp1 or Sp3 were added to the binding reactions. Antiserum that recognizes Sp1 supershifted a site II complex formed by nuclear factors from untreated and PMA-activated U937 cells (Fig. 5GoF, lanes 2 and 5) (29). In contrast, preimmune and antiserum that recognizes Sp3 did not affect the binding of U937 cell nuclear factor(s) to site II (lanes 1, 3, 4 and 6) (30). We conclude that Sp1 family proteins, including Sp1 but not Sp3, bind site II in the NF-IL6 gene and are likely to activate transcription of the NF-IL6 gene in U937 cells.

Endogenous CREB/ATF proteins are required for maximal NF-IL6 promoter activity in U937 cells

Our biochemical studies showed that CREB/ATF protein(s) in U937 nuclear extracts bind site I of the NF-IL6 gene, and transient transfections indicated that site I is functionally important for promoter activity. To test the role of CREB/ATF proteins for regulating NF-IL6 promoter activity in vivo, we performed a transient cotransfection assay using reporters dependent on the NF-IL6 promoter and an expression plasmid encoding a dominant negative form of CREB, CREB-2. CREB-2 exhibits CRE binding activity but does not activate transcription due to changes in amino acid residues of the kinase inducible domain (KID) domain (31). NF-IL6 promoter activity with a cotransfected CREB-2 expression plasmid was compared with promoter activity with a cotransfected expression plasmid lacking the CREB-2 cDNA (Fig. 6Go). Cotransfection of the CREB-2 cDNA significantly reduced the activity of NF-IL6 promoters containing an upstream CRE site (site I) in untreated U937 cells (Fig. 6Go, lanes 1 vs 3 and 5 vs 7) and in PMA-activated U937 cells (lanes 2 vs 4 and 6 vs 8). In contrast, the activity of a comparable NF-IL6 promoter containing a mutation in the CRE site, mI -97 to +72 bp, was only slightly reduced by the presence of cotransfected CREB-2 in untreated (lanes 9 vs 11) or PMA-activated (lanes 10 vs 12) U937 cells. We conclude that endogenous CRE-binding proteins are important for basal and PMA-inducible NF-IL6 promoter activity in U937 cells.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 6. A transdominant negative CREB/ATF family member, CREB-2, reduces NF-IL6 promoter activity. U937 cells were cotransfected with a panel of NF-IL6 promoter constructs driving reporter gene expression and control or CREB-2 expression plasmids, as indicated below the bar graph. Following electroporation, the cotransfected cells were equally split into two cultures without (open bars) or with (gray bars) PMA. The luciferase activity was normalized for the protein concentration of the cell extracts. The reporter activity shown for each construct is relative to the reporter activity in untreated U937 cells cotransfected with the control expression plasmid. The constructs used in this experiment include wt site I and II NF-IL6 promoter construct lanes 1–4, wt site I NF-IL6 promoter construct lanes 5–8, mutant site I and wt site II NF-IL6 promoter constructs lanes 9–12.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have shown that activation of U937 promonocytic cells leads to increased transcription of the NF-IL6 gene. Analysis of the NF-IL6 promoter has revealed that 97 bp 5' of the transcription initiation site is sufficient to confer both basal and activation-induced activity in this system. Within this region, we have identified functionally important binding sites for CREB/ATF and Sp1 family proteins.

The role of the CRE site at -62 bp in the NF-IL6 promoter

Our studies show that a conserved CRE site at -62 bp is functionally important for basal and PMA-inducible NF-IL6 promoter activity in U937 cells (Fig. 4Go) and that endogenous CREB/ATF proteins are necessary for maximal activity of the NF-IL6 promoter in U937 cells (Fig. 6Go). The supershift experiments (Fig. 5Go) confirm that proteins recognized by CREB antiserum (including ATF, CREB-1, and CRM-1) bind site I, although the antiserum does not distinguish among these proteins. The CREB/ATF family is comprised of at least 11 family members including ATF1–8, CREB-1, and CRE modulator (CREM); it contains both trans-activators and trans-dominant negative inhibitors of CRE site-dependent transcription (31, 32, 33, 34, 35). In the future it will be important to determine which CREB/ATF proteins regulate transcription of the NF-IL6 gene in monocytes/macrophages and how monocyte/macrophage activation may alter the abundance and/or activity of CREB/ATF proteins.

The contribution of CREB/ATF proteins to NF-IL6 promoter activity before cellular activation is consistent with our observation of proteins binding to site I before U937 cell activation (Fig. 5Go), the observation of others that CREB/ATF proteins can interact directly with the basal transcription machinery (36), and the fact that CREB/ATF proteins are known to regulate the transcription of other genes before cellular activation (37, 38). CREB/ATF proteins are also important for PMA-inducible transcription of the NF-IL6 gene in monocytes. It has been clearly demonstrated that signal-dependent kinases phosphorylate CREB and enhance CREB-mediated trans-activation. In monocytes we observed an increase in transcriptional activation without a change in the binding of nuclear factors to site I, which is consistent with the possibility that PMA may induce kinases that activate CREB/ATF proteins (39, 40, 41). The role of the CRE site in cellular activation responsive gene expression is consistent with prior observations that CRE sites are cytokine responsive elements in the myeloid cell line TF-1. Treatment of TF-1 cells with GM-CSF or IL-3 induces erg-1 promoter activity, which is dependent upon CRE and serum response element (SRE) sites (40, 41, 42). CRE sites have also been implicated in monocyte differentiation-specific transcription of macrophage inflammatory protein-1ß (MIP-1ß) (43), MuRANTES, and crg-2 (44). Thus, a functional role for the CRE site in transcriptional regulation of the NF-IL6 gene in activated U937 cells underscores the important role played by CRE-binding proteins in monocyte/macrophage activation-dependent gene expression.

The role of the -80-bp Sp1 site in the NF-IL6 promoter

We also demonstrated that a guanosine and cytosine-rich region recognized by the Sp1 family of proteins at -80 is important for basal and activation-induced NF-IL6 promoter activity in U937 cells. Factors known to bind Sp1 sites include Sp1-4, and the Egr family (45, 46, 47, 48). Our supershift experiments demonstrated that Sp1, but not Sp3, present in U937 cell nuclear extracts binds to the NF-IL6 gene site II sequence. It is also possible that other Sp1 family members, which cross-react with the Sp1 antiserum, bind site II. Consistent with our observations, guanosine and cytosine-rich sequences recognized by Sp1 have been identified as PMA-responsive elements in other genes such as the thromboxane receptor gene (49), proximal platelet-derived growth factor A-chain gene (50), and the HIV-1 long terminal repeat (LTR) (51). Although we do not know how Sp1 proteins confer PMA inducibility to the NF-IL6 promoter, our data add to growing evidence that Sp1 sites can be targets of signal transduction pathways.

The NF-IL6 promoter is controlled by different regulatory elements in macrophages and hepatocytes

During completion of this work, a study analyzing NF-IL6 gene expression during liver regeneration was reported (52). In the liver, expression of NF-IL6 is induced at times of physiologic stress such as the acute phase response and liver regeneration (53). There are significant differences in promoter elements required for NF-IL6 transcription in hepatocytic and monocytic cell lines. In hepatocytic lines, basal and protein kinase A (PKA)-inducible NF-IL6 promoter activity required the synergistic activity of two CRE sites, located at -62 and -110 bp relative to the start site of transcription. Although our DNase I footprinting experiments showed that the -110-bp CRE site was occupied by U937 cell nuclear proteins (data not shown), this region was not required for minimal promoter activity in U937 cells (Fig. 2Go). A 104-bp region of the NF-IL6 gene (-97 to +7 bp), containing a functionally important CRE site at -62 bp and a functionally important Sp1 site at -80 bp, was sufficient to confer full promoter activity in either untreated or activated U937 cells. Our results, together with those of Niehof et al. (52), emphasize the importance of CRE sites for regulation of the NF-IL6 promoter in both cell lineages and show that the -62-bp CRE site alone is not sufficient to provide full promoter activity in either cell lineage. In monocytes, the promoter proximal CRE site requires the Sp1 site, whereas in hepatocytes an upstream CRE site is required. Thus the NF-IL6 gene provides an example of a promoter that is regulated by different cis elements in different cell lineages.

Proteins binding to both CRE and Sp1 sites are ubiquitously present; however, tissue-specific differences in the relative abundance of individual family members, posttranslational modifications or coactivators are likely to exist. It may be that monocytes have increased abundance or activity of proteins that can activate through the Sp1 site relative to hepatocytes. This would be consistent with the finding that the Sp1 site in the macrophage-specific CD11b promoter is occupied in a macrophage-specific way (54). Similarly, hepatocytes may have a cellular activity that functions through the -110-bp CRE site that is less active or abundant in monocytes. Either model could explain why the promoter proximal CRE site requires the Sp1 site in monocytes while the upstream CRE site is required in hepatocytes. As a consequence of being regulated by different cis elements, we speculate that the NF-IL6 promoter is subjected to regulation by different signaling pathways in hepatocytes and monocytes.


    Acknowledgments
 
We thank the members of the Calame laboratory for helpful discussions and suggestions during this work and Dr. A. Henderson for critically reading the manuscript. We thank R. Allen for technical help with the DNase I experiments, Dr. R. Prywes for assistance with the EMSAs, Dr. X.-F. Wang for supplying oligonucleotides and antiserum used in our work, and Y. Lin for help with the figures. We also thank Dr. V. Poli for the murine NF-IL6 genomic clone, Dr. Denong Wong for supplying the Gag antiserum, Dr. R. Dalla-Favera for the human ß-actin construct, and Dr. J.Leiden for the CREB-2 plasmid.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants GM29361 and AI40342 to K.C. and Grant AI34925 to G.S. Back

2 Current address: Department of Physiology and Cell Biology, Albany Medical College, Albany, NY 12208. Back

3 Address correspondence and reprint requests to Dr. Kathryn Calame, Department of Microbiology, Columbia University College of Physicians and Surgeons, 701 West 168th Street, New York, NY 10032. Back

4 Abbreviations used in this paper: C/EBP, CCAAT/enhancer-binding protein; M-CSF, macrophage CSF; CREB/ATF, cAMP response element-binding protein/activation transcription factor; CRE, cAMP response element; AP-1, activator protein-1; wt, wild type; EMSA, electrophoretic mobility shift assay. Back

Received for publication October 16, 1997. Accepted for publication April 23, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Henderson, A., R. Connor, K. Calame. 1996. C/EBP activators are required for HIV-1 replication and proviral induction monocytic cell lines. Immunity 5:91.[Medline]
  2. Akira, S., H. Isshiki, T. Sugita, T. Osamu, S. Kinoshita, Y. Nishio, T. Nakajima, T. Hirano, T. Kishimoto. 1990. A nuclear factor for IL-6 expression (NF-IL6) is a member of the C/EBP family. EMBO J. 9:1897.[Medline]
  3. Matsusaka, T., K. Fujikawa, Y. Nishio, N. Mukaida, K. Matsushima, T. Kishimoto, S. Akira. 1993. Transcription factors NF-IL6 and NF-{kappa}B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc. Natl. Acad. Sci. USA 90:10193.[Abstract/Free Full Text]
  4. Natsuka, S., S. Akira, Y. Nishio, S. Hashimoto, T. Sugita, H. Isshiki, T. Kishimoto. 1992. Macrophage differentiation-specific expression of NF-IL6, a transcription factor for Interleukin-6. Blood 79:460.[Abstract/Free Full Text]
  5. Dunn, S. M., L. S. Coles, R. K. Lang, S. Gerondakis, M. A. Vadas, M. F. Shannon. 1994. Requirement for nuclear factor (NF)-{kappa}B p65 and NF-interleukin-6 binding elements in the tumor necrosis factor response region of the granulocyte colony-stimulating factor promoter. Blood 83:2469.[Abstract/Free Full Text]
  6. Pope, R. M., A. Leutz, S. A. Ness. 1994. C/EBP ß regulation of the tumor necrosis factor {alpha} gene. J. Clin. Invest. 94:1449.
  7. Henderson, A., K. Calame. 1997. C/EBP sites are required for HIV-1 replication in monocyte/macrophages but not T-cells. Proc. Natl. Acad. Sci. USA 84:8714.
  8. Tanaka, T., S. Akira, K. Yoshida, M. Umemoto, Y. Yoneda, N. Shirafuji, H. Fujiwara, S. Suematsu, N. Yoshida, T. Kishimoto. 1995. Targeted disruption of the NF-IL6 gene discloses its essential role in bacteria killing and tumor cytotoxicity by macrophages. Cell 80:353.[Medline]
  9. Screpanti, I., L. Romani, P. Musiani, A. Modesti, E. Fattori, D. Lazzaro, C. Sellito, S. Scarpa, D. Bellavia, G. Lattanzio.. 1995. Lymphoproliferative disorder and imbalanced T helper response in C/EBPß-deficient mice. EMBO J. 14:1932.[Medline]
  10. Screpanti, I., P. Musiani, D. Bellavia, M. Cappelletti, F. B. Aiello, M. Maroder, L. Frati, A. Modesti, A. Gulino, V. Poli. 1996. Inactivation of the IL-6 gene prevents development of multicentric Castleman’s disease in C/EBP ß-deficient mice. J. Exp. Med. 184:1561.[Abstract/Free Full Text]
  11. Cooper, C., A. Berrier, C. Roman, K. Calame. 1994. Limited expression of C/EBP family proteins during B-lymphocyte development: negative regulator Ig/EBP predominates early and activator NF-IL6 is induced later. J. Immunol. 153:5049.[Abstract]
  12. Manchado, C., P. Yubero, O. Vinas, R. Iglesias, F. Villarroya, T. Mampel, M. Giralt. 1994. CCAAT/enhancer-binding proteins {alpha} and ß in brown adipose tissue: evidence for a tissue-specific pattern of expression during development. Biochem. J. 302:695.
  13. Nilsson, K., K. Forsbeck, M. Gidlund, C. Sundstrom, T. Totterman, J. Sallstrom, P. Venge. 1981. Surface characteristics of the U-937 human histiocytic lymphoma cell line: specific changes during inducible morphologic and functional differentiation in vitro. Hamatol. Bluttransfus. 26:215.[Medline]
  14. Krumm, A., T. Meulia, M. Brunvand, M. Groudine. 1992. The block to transcriptional elongation within the human c-myc gene is determined in the promoter-proximal region. Genes Dev. 6:2201.[Abstract/Free Full Text]
  15. Quinn, P. G.. 1993. Distinct activation domains within cAMP response element-binding protein (CREB) mediate basal and cAMP-stimulated transcription. J. Biol. Chem. 268:16999.[Abstract/Free Full Text]
  16. Brasier, A. R., J. E. Tate, J. F. Habener. 1989. Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. Biotechniques 7:1116.[Medline]
  17. Chirgwin, M. J., A. E. Przbyla, R. J. MacDonald, W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294.[Medline]
  18. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Plainview, NY.
  19. Feinberg, A. P., B. Vogelstein. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6.[Medline]
  20. Duncan, D. D., A. Stupakoff, S. M. Hedrick, K. B. Marcu, G. Siu. 1995. A myc-associated zinc finger protein binding site is one of four important functional regions in the CD4 promoter. Mol. Cell. Biol. 15:3179.[Abstract]
  21. Parker, C. S., J. Topol. 1984. A drosophila RNA polymerase II transcription factor contains a promoter-region-specific DNA-binding activity. Cell 36:357.[Medline]
  22. Muller, M. M., E. Schreiber, W. Schaffner, P. Matthias. 1989. Rapid test for in vivo stability and DNA binding of mutated octamer binding proteins with "mini-extracts" prepared from transfected cells. Nucleic Acids Res. 17:6420.[Free Full Text]
  23. Einat, M., D. Resnitzky, A. Kimchi. 1985. Close link between reduction of c-myc expression by interferon and G0/G1 arrest. Nature 313:597.[Medline]
  24. Chang, C.-J., T.-T. Chen, H.-Y. Lei, D.-S. Chen, S.-C. Lee. 1990. Molecular cloning of a transcription factor, AGP-EBP, that belongs to members of the C/EBP family. Mol. Cell. Biol. 10:6642.[Abstract/Free Full Text]
  25. Lee, W., P. Mitchell, R. Tjian. 1987. Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements. Cell 49:741.[Medline]
  26. Lin, Y. S., M. R. Green. 1988. Interaction of a common transcription factor, ATF, with regulatory elements in both E1a and cyclic AMP-inducible promoters. Proc. Natl. Acad. Sci. USA 85:3396.[Abstract/Free Full Text]
  27. Dynan, W. S., R. Tjian. 1983. The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell 35:79.[Medline]
  28. Datto, M. B., Y. Yu, X.-F. Wang. 1995. Functional analysis of the transforming growth factor J. Biol. Chem. 270:28623.
  29. Udvadia, A. J., K. T. Rogers, P. D. R. Higgins, Y. Murata, K. Martin, P. A. Humphrey, J. M. Horowitz. 1993. Sp-1 binds promoter elements regulated by the RB protein and Sp-1-mediated transcription is stimulated by RB coexpression. Proc. Natl. Acad. Sci. USA 90:3265.[Abstract/Free Full Text]
  30. Udvadia, A., D. J. Templeton, J. M. Horowitz. 1995. Functional interactions between the retinoblastoma (Rb) protein and Sp-family members: superactivation by Rb requires amino acids necessary for growth. Proc. Natl. Acad. Sci. USA 92:3953.[Abstract/Free Full Text]
  31. Karpinski, B. A., G. D. Morle, J. Huggenvik, M. D. Uhler, J. M. Leiden. 1992. Molecular cloning of human CREB-2: an ATF/CREB transcription factor that can negatively regulate transcription from the cAMP response element. Proc. Natl. Acad. Sci. USA 89:4820.[Abstract/Free Full Text]
  32. Ziff, E. B.. 1990. Transcription factors: a new family gathers at the cAMP response site. Trends Genet. 6:69.[Medline]
  33. Hai, T., F. Liu, W. J. Coukos, M. R. Green. 1989. Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes Dev, 3:2083.[Abstract/Free Full Text]
  34. Hoeffler, J. P., T. E. Meyer, Y. Yun, J. L. Jameson, J. F. Habener. 1988. Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science 242:1430.[Abstract/Free Full Text]
  35. Foulkes, N. S., E. Borrelli, P. Sassone-Corsi. 1991. CREM gene: use of alternative DNA-binding domains generates multiple antagonists of cAMP-induced transcription. Cell 64:739.[Medline]
  36. Xing, L., V. K. Gopal, P. G. Quinn. 1995. cAMP response element binding protein (CREB) interacts with transcription factor IIB and IID. J. Biol. Chem. 270:17488.[Abstract/Free Full Text]
  37. Xing, L., P. G. Quinn. 1993. Involvement of 3'5'-cAMP regulatory element binding protein (CREB) in both basal and hormone mediated expression of the phosphoenolpyruvate carboxykinase (PEPCK) gene. Mol. Endocrinol. 7:1484.[Abstract/Free Full Text]
  38. Kim, K. S., M. K. Lee, J. Carroll, T. H. Joh. 1993. Both the basal and inducible transcription of the tyrosine hydroxylase gene are dependent upon a cAMP response element. J. Biol. Chem. 268:15689.[Abstract/Free Full Text]
  39. Chrivia, J. C., R. P. S. Kwok, N. Lamb, M. Hagiwara, M. R. Montminy, R. H. Goodman. 1993. Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365:855.[Medline]
  40. Sakamoto, K. M., J. K. Fraser, H. J. Lee, E. Lehman, J. C. Gasson. 1994. Granulocyte-macrophage colony-stimulating factor and interleukin-3 signaling pathways converge on the CREB-binding site in the human egr-1 promoter. Mol. Cell. Biol. 14:5975.[Abstract/Free Full Text]
  41. Lee, H. J., R. C. Mignacca, K. M. Sakamoto. 1995. Transcriptional activation of egr-1 by granulocyte-macrophage colony-stimulating factor but not interleukin 3 requires phosphorylation of cAMP response element-binding protein (CREB) on serine 133. J. Biol. Chem. 270:15979.[Abstract/Free Full Text]
  42. Mignacca, R. C., H. J. Lee, E. M. Kwon, K. M. Sakamoto. 1996. Mechanism of transcriptional activation of the immediate early gene Egr-1 in response to PIXY321. Blood 88:848.[Abstract/Free Full Text]
  43. Proffitt, J., G. Crabtree, M. Grove, P. Daubersies, B. Bailleul, E. Wright, M. Plumb. 1995. An ATF/CREB-binding site is essential for cell-specific and inducible transcription of the murine MIP-1 ß cytokine gene. Gene 152:173.[Medline]
  44. Shin, H. S., B. E. Drysdale, M. L. Shin, P. W. Noble, S. N. Fisher, W. A. Paznekas. 1994. Definition of a lipopolysaccharide-responsive element in the 5'-flanking regions of MuRantes and crg-2. Mol. Cell. Biol. 14:2914.[Abstract/Free Full Text]
  45. Hagen, G., S. Muller, M. Beato, G. Suske. 1992. Cloning by recognition site screening of two novel GT box binding proteins: a family of Sp1 related genes. Nucleic Acids Res. 20:5519.[Abstract/Free Full Text]
  46. Kharbanda, S., T. Nakamura, R. Stone, R. Hass, S. Bernstein, R. Datta, V. P. Sukhatme, D. Kufe. 1991. Expression of the early growth response 1 and 2 zinc finger genes during induction of monocytic differentiation. J. Clin. Invest. 88:571.
  47. Sukhatme, V. P., X. M. Cao, L. C. Chang, C. H. Tsai-Morris, D. Stamenkovich, P. C. Ferreira, D. R. Cohen, S. A. Edwards, T. B. Shows, T. Curran, M. M. Le Beau, E. D. Adamson. 1988. A zinc finger-encoding gene coregulated with c-fos during growth and differentiation, and after cellular depolarization. Cell 53:37.[Medline]
  48. Kingsley, C., A. Winoto. 1992. Cloning of GT box-binding proteins: a novel Sp1 multigene family regulating T-cell receptor gene expression. Mol. Cell. Biol. 12:4251.[Abstract/Free Full Text]
  49. D’Angelo, D.D., B. G. Oliver, M. G. Davis, T. S. McCluskey, II. G. Dorn. 1996. Novel role for Sp1 in phorbol ester enhancement of human platelet thromboxane receptor gene expression. J. Biol. Chem. 271:19696.[Abstract/Free Full Text]
  50. Khachigian, L. M., A. J. Williams, T. Collins. 1995. Interplay of Sp1 and Egr-1 in the proximal platelet-derived growth factor A-chain promoter in cultured vascular endothelial cells. J. Biol. Chem. 270:27679.[Abstract/Free Full Text]
  51. Perkins, N. D., N. L. Edwards, C. S. Duckett, A. B. Agranoff, R. M. Schmid, G. J. Nabel. 1993. A cooperative interaction between NF-{kappa}B and Sp1 is required for HIV-1 enhancer activation. EMBO J. 12:3551.[Medline]
  52. Niehof, M., M. P. Manns, C. Trautwein. 1997. CREB controls LAP/C/EBP transcription. Mol. Cell. Biol. 17:3600.[Abstract]
  53. Akira, S., T. Kishimoto. 1992. IL-6 and NF-IL6 in acute-phase response and viral infection. Immunol. Rev. 127:25.[Medline]
  54. Chen, H. M., H. L. Pahl, R. J. Scheibe, D. E. Zhang, D. G. Tenen. 1993. The Sp1 transcription factor binds the CD11b promoter specifically in myeloid cells in vivo and is essential for myeloid-specific promoter activity. J. Biol. Chem. 268:8230.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
BloodHome page
B. Csoka, Z. H. Nemeth, L. Virag, P. Gergely, S. J. Leibovich, P. Pacher, C.-X. Sun, M. R. Blackburn, E. S. Vizi, E. A. Deitch, et al.
A2A adenosine receptors and C/EBP{beta} are crucially required for IL-10 production by macrophages exposed to Escherichia coli
Blood, October 1, 2007; 110(7): 2685 - 2695.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
N. Tanaka, Y. Hoshino, J. Gold, S. Hoshino, F. Martiniuk, T. Kurata, R. Pine, D. Levy, W. N. Rom, and M. Weiden
Interleukin-10 Induces Inhibitory C/EBP{beta} through STAT-3 and Represses HIV-1 Transcription in Macrophages
Am. J. Respir. Cell Mol. Biol., October 1, 2005; 33(4): 406 - 411.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. N. Bradley, L. Zhou, and S. T. Smale
C/EBP{beta} Regulation in Lipopolysaccharide-Stimulated Macrophages
Mol. Cell. Biol., July 15, 2003; 23(14): 4841 - 4858.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Brenner, S. Prosch, K. Schenke-Layland, U. Riese, U. Gausmann, and C. Platzer
cAMP-induced Interleukin-10 Promoter Activation Depends on CCAAT/Enhancer-binding Protein Expression and Monocytic Differentiation
J. Biol. Chem., February 14, 2003; 278(8): 5597 - 5604.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. R. Hughes, T. S. Tengku-Muhammad, S. A. Irvine, and D. P. Ramji
A Novel Role of Sp1 and Sp3 in the Interferon-gamma -mediated Suppression of Macrophage Lipoprotein Lipase Gene Transcription
J. Biol. Chem., March 22, 2002; 277(13): 11097 - 11106.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Gupta, M. Jiang, A. Anthony, and A. B. Pernis
Lineage-specific Modulation of Interleukin 4 Signaling by Interferon Regulatory Factor 4
J. Exp. Med., December 20, 1999; 190(12): 1837 - 1848.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Silverman, S. Eimerl, and J. Orly
CCAAT Enhancer-binding Protein beta  and GATA-4 Binding Regions within the Promoter of the Steroidogenic Acute Regulatory Protein (StAR) Gene Are Required for Transcription in Rat Ovarian Cells
J. Biol. Chem., June 18, 1999; 274(25): 17987 - 17996.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Niehof, K. Streetz, T. Rakemann, S. C. Bischoff, M. P. Manns, F. Horn, and C. Trautwein
Interleukin-6-induced Tethering of STAT3 to the LAP/C/EBPbeta Promoter Suggests a New Mechanism of Transcriptional Regulation by STAT3
J. Biol. Chem., March 16, 2001; 276(12): 9016 - 9027.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Caivano, B. Gorgoni, P. Cohen, and V. Poli
The Induction of Cyclooxygenase-2 mRNA in Macrophages Is Biphasic and Requires both CCAAT Enhancer-binding protein beta (C/EBPbeta ) and C/EBPdelta Transcription Factors
J. Biol. Chem., December 21, 2001; 276(52): 48693 - 48701.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Berrier, A.
Right arrow Articles by Calame, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Berrier, A.
Right arrow Articles by Calame, K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*12-O-TETRADECANOYLPHORBOL-13-ACETATE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS