|
|
||||||||
at Double- and Single-Positive Stages of Thymic Development1


*
Research Institute, Hospital For Sick Children, and Department of Immunology, University of Toronto, Toronto, Ontario, Canada; and
Division of Immunology and Rheumatology, Department of Medicine, Stanford University School of Medicine, Stanford, CA 94305
| Abstract |
|---|
|
|
|---|
ß-TCR T lymphocytes go
through progressive stages of expression of coreceptors CD8 and CD4
from being negative for both (the double-negative stage), to
coexpressing both (the double-positive (DP) stage), to a mutually
exclusive sublineage-specific expression of one or the other (the
single-positive (SP) stage). To delineate the mechanisms underlying
regulation of CD8 during these developmental transitions, we have
examined expression of a series of mouse CD8
gene constructs in
developing T cells of conventional and CD8
"knock-out"
transgenic mice. Our results indicate that cis-active
transcriptional control sequences essential for stage- and
sublineage-specific expression lie within a 5' 40-kb segment of the CD8
locus,
12 kb upstream of the CD8
gene. Studies to characterize
and sublocalize these cis sequences showed that a 17-kb
5' subfragment is able to direct expression of the CD8
gene up to
the CD3intermediate DP stage but not in more mature DP or
SP cells. These results indicate that stage-specific expression of
CD8
in developing T cells is mediated by the differential activity
of multiple functionally distinct cis-active
transcriptional control mechanisms. It will be important to determine
the relationship of "switching" between these cis
mechanisms and selection. | Introduction |
|---|
|
|
|---|
ß-TCR expressed by the majority of peripheral T lymphocytes
recognizes foreign Ag associated with self-MHC molecules (1, 2, 3). The
mutually exclusive pattern of expression of the coreceptor molecules,
CD8 and CD4, distinguishes the two sublineages of
ß-TCR T cells:
CD8+CD4- cytotoxic T cells, which recognize Ag
bound to class I MHC, and CD8-CD4+ helper T
cells, which recognize Ag bound to class II MHC (4, 5, 6). Numerous
studies have shown that CD8 and CD4 play crucial roles in the
development and function of
ß-TCR T cells as a result of binding
of nonpolymorphic regions of class I and class II proteins,
respectively, and possibly through signaling (5, 7, 8, 9, 10, 11).
Developing thymocytes, which give rise to mature
CD8+CD4- and CD8-CD4+
T cells, go through progressive stages of CD4 and CD8 expression in the
thymus, from initially expressing neither (the double-negative
(DN)4 stage), to coexpressing
both (the double-positive (DP) stage), to expressing one or the other
(the single-positive (SP) stage) (5, 12, 13). Loss of CD8 or CD4
expression during the DP to SP transition is associated with thymic
selection for recognition of self-MHC, further differentiation into
mature thymocytes, which express increased levels of the
ß-TCR/CD3
complex, commitment to the cytotoxic or helper sublineage, and
induction of sublineage-specific (i.e., CD8+/cytotoxic vs
CD4+/helper) patterns of gene expression (12, 13, 14, 15). As the
pattern of coreceptor expression is so strongly correlated with
differentiation and selection, delineation of the underlying
transcriptional control mechanisms should contribute to our
understanding of T cell development and commitment to the helper or
cytotoxic sublineage. However, the requirement that the CD8 and CD4
genes be activated and coexpressed in the same cell during the early to
intermediate stages of thymic differentiation (i.e., the DP stage) yet
be expressed in mutually exclusive sublineages at a later stage (i.e.,
the SP stage) presents a unique problem in gene regulation. Further, it
is unclear at what level the underlying regulatory mechanisms are
influenced by the events of T cell differentiation and selection,
although a role for the Notch signaling pathway has been suggested
(16).
Studies of mouse CD4 regulation have identified transcriptional
enhancers at
13 kb (17, 18) and 24 kb (19) upstream and a
negative-acting element within the first intron (20, 21). At least some
of these elements are also associated with the human CD4 gene, although
their locations may not be absolutely conserved (22, 23, 24). While initial
identification of most of these elements involved DNase
I-hypersensitive site (HSS) mapping and transfection assays, their
functional roles in vivo have been confirmed in transgenic mice. DNase
I hypersensitivity and transfection studies have also been used to
identify candidate cis-active elements located nearby or
within the CD8
gene (25, 26, 27). However, what role these elements may
play in vivo is unclear.
Several aspects of CD8
expression suggest that its regulatory
mechanisms may be more complex than those of CD4. For example,
in thymus-derived
ß-TCR cells, CD8 is invariably expressed as a
heterodimer composed of the products of two linked genes,
CD8
(or Lyt2) and CD8ß (or
Lyt3), while CD4 is expressed only as a homodimer encoded by
a single gene (5). Coexpression, combined with the close chromosomal
linkage, suggests that both genes may share cis-active
regulatory mechanisms. However, coexpression is not always the case, as
most mouse intestinal intraepithelial T lymphocytes (iIELs) which
express the 
-TCR express CD8
in the absence of CD8ß (i.e.,
CD8
+ß- (28, 29)). Also, within
ß-TCR
iIEL cells, both CD8
+ß- and
CD8
+ß+ cells are present in the
CD4-negative subpopulation, while CD4-positive cells are either
CD8
+ß- or
CD8
-ß- (28, 29). Thus, differential
regulation of CD8
and CD8ß does occur in some cell types.
To begin to delineate the mechanisms underlying stage-specific
regulation of CD8
/Lyt2 expression in thymic differentiation, we have
studied a series of CD8
/Lyt2 gene constructs in thymocytes and T
cells of conventional and CD8
-deficient/"knock-out"
transgenic mice. While these studies were in progress, Hostert et al.
(30) reported that the CD8
gene in a P1 bacteriophage clone
containing about 80 kb of the CD8 locus was expressed in a tissue- and
sublineage-specific manner in transgenic mice. Rather than starting
with such large DNA segments, our approach toward identifying important
CD8 cis-active regulatory elements was to examine the effect
on expression of adding defined segments of native 5' and/or 3'
flanking DNA to a cloned genomic CD8
gene construct, which on its
own was not expressed in transgenic mice. Here, we show that while
constructs with up to 12 kb of 5' and 4.5 kb of 3' flanking DNA were
not expressed in T or non-T cells of transgenic mice, stage- and
sublineage-specific expression of CD8
in thymic-derived
ß-TCR T
cells was observed upon inclusion of an additional 5' 40-kb segment of
the CD8 locus. Further studies aimed at determining the location and
mechanism of action of the relevant cis-active element(s)
within this 40-kb 5' region uncovered at least two distinct
stage-specific CD8
cis-acting regulatory mechanisms, one
that mediates expression in developing thymic
ß-TCR T cells up to
an intermediate DP stage and another that acts after this stage in SP
thymocytes and peripheral T cells.
| Materials and Methods |
|---|
|
|
|---|
The structure of the mouse CD8 locus, including the genes for
CD8
/Lyt2 and CD8ß/Lyt3, is shown schematically in Figure 1
. The fragments used for microinjection
were generated as described below. Fragment A was a 5.1-kb
HindIII-SalI fragment containing a hybrid
Lyt2.1/Lyt2.2 gene with
0.3 and 0.7 kb, respectively, of 5'
and 3' flanking DNA (31). This fragment also contained 0.28 kb of
plasmid vector DNA at the 3' end, which was used as a
transgene-specific probe for identifying transgenic mice. The fragment
A construct was generated by first subcloning the 5.2-kb
HindIII fragment of the mouse Lyt-2.2 gene into pBR322. A
2.3-kb 5' HindIII-XbaI fragment containing the
first three exons of the Lyt-2.2 gene was replaced with a 2-kb 5'
HindIII-BamHI fragment of the Lyt-2.1 gene (which
also contained the first 3 exons) after blunt-ending BamHI
and Xbal sites of each fragment. This manipulation generated a hybrid
DNA molecule consisting of the first three exons of the Lyt-2.1 gene
and the last two exons of the Lyt-2.2 gene. Since the first three exons
of the gene encode the protein region conferring the serologic
difference between the Lyt-2.1 and Lyt-2.2 molecules, the protein made
from the hybrid DNA is recognized by a mAb against Lyt-2.1 (32, 33). As
an additional means of distinguishing the transgenic and endogenous
genes, a fragment of
300 bp was deleted from intron 3 of the hybrid
construct. PCR of tail or PBL DNA with primers flanking this region
amplified a fragment of
600 bp from the endogenous gene and 300 bp
from the transgene. The primers in intron 3 used for this purpose were
5'-GGGCGTTCCAGCTGACCTATAG and 5'-TGGAAGGCAGAGGCAGGCGGAT (32).
|
7 and 0.7 kb
of 5' and 3' flanking DNA. This fragment was generated from the
fragment A construct by replacing the 2-kb Lyt2.1
HindIII-BamHI fragment with a 9-kb Lyt2.1
BamHI-BamHI fragment. This 9-kb fragment was
inserted at the same XbaI site by blunt-end ligation. The
injected fragment retained the 300-bp deletion in intron 3, but
contained no vector DNA. Transgenic offspring were identified by PCR
analysis of tail or PBL DNA.
Fragment C was a 22-kb SalI-SalI fragment with
12 and 4.5 kb of 5' and 3' flanking DNA. The generation of
this construct involved multiple steps, the first one being addition of
a 4.5-kb 3' flanking fragment, which extended to a 3' PvuII
site, to the 5-kb Lyt2.1/Lyt2.2 hybrid gene (from fragment A
above), through a shared SacI site in the 3' untranslated
region. A 0.6-kb SacI fragment from the 3' untranslated
region of the human CD4 cDNA was subsequently inserted into
this SacI site for use as a specific probe for transgenic
DNA and RNA. Finally, the 5' segment up to an internal KpnI
site of this construct was replaced with a
SalI/KpnI 5' flanking/coding fragment, originally
derived from a phage clone from a Lyt2.1 (DBA/2) genomic library (32),
by ligation through the shared KpnI site. The resulting
purified fragment used for microinjection contained no vector
DNA.
Fragment D was a SalI-linearized cosmid (cos Ly317)
isolated from a genomic library from mice expressing Lyt3.2 (34). This
fragment contained the complete Lyt3/CD8ß gene,
1.5 kb and 25 kb
of 5' and 3' flanking DNA and overlapped the Lyt2.1 fragment C
construct by 2 to 3 kb. Fragment D contained vector pTL5 DNA at its 3'
end. Fragment E was a 23-kb ScaI fragment purified from the
above cos Ly317 clone. Fragment F was a 17-kb BamHI
fragment subclone from a genomic library from mice expressing Lyt3.1.
DNA microinjection into mouse embryos
DNA fragments of the above described constructs were purified
and microinjected into fertilized one-cell (B6SJL)F2/J
embryos for generation of transgenic mice as described (35). Fragments
A, B, or C were microinjected at 2 to 5 ng/µl. For coinjection of
fragment C together with fragment D, E, or F, both fragments were mixed
at a final concentration of
1 to 2 ng/µl each. Transgenic mice and
progeny were named as described previously (36). When more than one
integration was identified among offspring of a single founder, the
individual integrations were maintained separately in offspring and
represented as A, B, etc. (e.g., 24A). Transgenic lines were
established by breeding with nontransgenic C57BL/6J or
(B6/SJL)F1 (Lyt2.2) mates. The fragment (C+D) line 24A
transgenic/CD8
knock-out line was generated by repeated crossing of
line 24A offspring with mice that were homozygous for the Lyt2/CD8
mutation (9).
Analysis of nucleic acids
Tail skin DNA was prepared from 3-wk-old mice (37) and analyzed directly by hybridization for transgenic DNA by dot blotting and/or by Southern blot hybridization (36, 38).
Total RNA was prepared from mouse tissues by extraction with guanidinium isothiocyanate as described (35, 38, 39). RNA concentrations were determined by measuring the absorbance of 260 nm. Purified RNAs were denatured in 2.2 M formaldehyde and 50% formamide at 65°C, electrophoresed in 1% agarose gels containing 1.1 M formaldehyde and (1 x MOPS), and transferred to nitrocellulose (38). Hybridization of DNA and RNA blots was at 42°C in 50% formamide/5x SSC, as described (36), for 24 to 48 h with DNA probes labeled by the random primer technique to a sp. act. of 4 to 8 x 108 cpm/µg. The final blot washing conditions were 0.1x SSC/0.1% SDS at 55 to 60°C. Blots were exposed to Kodak XAR-5 film with intensifying screens at -70°C.
The method of detection and hybridization probes used for
identification of transgenic DNA were as follows: for fragment A, dot
and Southern blot hybridization with a pBR322-derived probe; for
fragment B, PCR analysis of tail or PBL DNA; for fragment C, dot and
Southern blot hybridization with the human CD4 0.6-kb SacI
fragment inserted into the 3' untranslated region of the Lyt2.1 gene;
for fragment D, dot and Southern blot hybridization with a
vector-derived probe; for fragment E or F, single copy probes located
within these fragments were used to confirm cointegration with fragment
C by the appearance of bands of increased intensity and/or unique
junction fragments. Lyt2.1 (fragment C+D) transgenic mice that were
homozygous or heterozygous for the disrupted or wild-type endogenous
CD8
gene were distinguished by the unique band pattern obtained for
Southern blot hybridization of EcoRI-digested tail DNA with
a Lyt2 cDNA probe.
For fragments A, B, and C, transgenic RNA was tested for by RT-PCR
using primers flanking the position of a polymorphic KpnI
site in the transmembrane-encoding exon. The primers, located in exon 1
(5'-ACAACAAGATAACGTGGGACGA) and in the 3' untranslated region of
exon 5 (5'-GTAGTAGTTGTAGCTTCCTGGCG), are conserved between both the
transgenic Lyt2.1 and endogenous Lyt2.2 alleles (32) and amplify a band
of 516 bp from reverse-transcribed RNA products from thymus and
lymphoid tissues from nontransgenic Lyt2.1 (DBA/2J) and Lyt2.2 (B6 or
B6/SJL) mouse strains. As some Lyt2.1 strains, including the Lyt2.1
transgene constructs A, B, and C, contain a single nucleotide
substitution that creates a KpnI recognition sequence, the
amplified band can be cut to two smaller fragments of 339 and 177 bp.
Since the strains used for transgenic production and breeding, B6/SJL
and B6, do not contain this polymorphism, RT-PCR products from lymphoid
tissues of these mice are not cleaved by KpnI. For
transgenic mice, endogenous Lyt2.2 and transgenic Lyt2.1
KpnI-treated RT-PCR products were distinguished by size on
2.2% agarose gels by ethidium bromide staining and by blot
hybridization with an oligonucleotide probe end-labeled with
[
-32P]ATP (NEN, Boston, MA; 6000 Ci/mmol) and
T4 polynucleotide kinase (Life Technologies, Gaithersburg, MD) (38).
This oligonucleotide (5' ATCAAGGACAGCAGAAGGGCCA) is from exon 3 and
is conserved between both the Lyt2.1 and Lyt2.2 alleles (Lyt2.1/2.2
probe) (32). Hybridization was at 53°C in 50% formamide/5x SSPE
with final blot washing conditions of 0.1x SSC/0.1%SDS at 65°C.
Transcription of the fragment C transgene was also analyzed by Northern blot hybridization using the human CD4 3' untranslated "tag" as a transgene-specific probe. In some cases, blots were stripped as described (36) and analyzed for endogenous Lyt2 expression using a full-length Lyt2 cDNA probe. Quantitation of Northern blot and RT-PCR blot hybridization signals was done by PhosphorImaging (Molecular Dynamics, Sunnyvale, CA).
Flow cytometry
Flow cytometry was conducted with cells prepared from the
indicated tissues. Thymocytes were prepared as described (36, 40), and
splenic and lymph node lymphocytes were purified by passage over
Lympholyte-M (Cedarlane, Hornby, Ontario, Canada). Indirect
immunofluorescence was conducted by incubating 1 to 2 x
106 cells with primary mAbs, followed by appropriate
secondary reagents. Cells (104) for each sample were
analyzed on a FACScan flow cytometer (Becton Dickinson). The percentage
of positive cells was calculated using FACScan research software
programs. mAbs used were as follows: anti-Lyt2.1 (Cedarlane; or
American Type Culture Collection (ATCC), Manassas, VA, ATCC HB129
(33)); anti-Lyt-2.2 (ATCC TIB210/mAb 2.43 (41)); anti-Lyt2/CD8
(biotin conjugate from Becton Dickinson, reacts with both Lyt2.1 and
Lyt2.2); anti-CD4 (phycoerythrin conjugate from Becton Dickinson;
biotin conjugate from PharMingen, San Diego, CA); anti-CD3
(biotin conjugate from PharMingen; Quantum Red conjugate from Sigma,
St. Louis, MO). Staining with unconjugated mAbs was detected with
fluorescently labeled secondary Ig reagents (Accurate Scientific,
Westbury, NY), as indicated. Biotin-conjugated Abs were detected
with streptavidin-labeled-FITC (Life Technologies) or phycoerythrin
(Becton Dickinson).
| Results |
|---|
|
|
|---|
in developing thymocytes
and T cells, we studied the expression in transgenic mice of a series
of mouse CD8
gene constructs containing increasing amounts of native
5' and/or 3' flanking DNA. To distinguish transgenic and endogenous
CD8
, we took advantage of the existence of two CD8
alleles, using
transgene constructs encoding the Lyt2.1 allele for microinjection of
F2 hybrid embryos from breedings of C57BL/6J and SJL/J
strains, both of which carry the Lyt2.2 allele (42). Although the
Lyt2.1 and Lyt2.2 alleles can be distinguished with mAbs (32),
additional modifications were engineered into the Lyt2.1 transgene
constructs to facilitate specific detection of transgenic DNA and RNA
(see below, Materials and Methods and legend to Fig. 1
Figure 1
gives a schematic representation of the CD8 locus on
chromosome 6 in the mouse (34). Initial studies were conducted with a
5.1-kb and a 12-kb construct (fragments A and B in Fig. 1
). Both
contained the intact Lyt2.1 gene and had
0.7 kb of native 3'
flanking DNA, but differed in the amount of flanking 5' DNA. Fragment A
contained 0.3 kb of native 5' DNA, while fragment B contained
7 kb
of 5' flanking DNA. Seven founder mice were generated with fragment A,
while 10 were generated with fragment B. Founders were bred with
C57BL/6J or (B6/SJL)F1 mates, and transgenic offspring were
identified and characterized. The transgene copy number for fragment A
and B lines ranged from
1 to 30 copies per cell (not shown). Flow
cytometric analysis of thymus, spleen, and lymph node cells from
offspring of each line with a Lyt2.1-specific mAb failed to detect
expression in any of these tissues (not shown). As Lyt2.1 mRNA
expressed from either construct would not be distinguishable from
endogenous Lyt2.2 mRNA by Northern blot hybridization, we used RT-PCR
in conjunction with an allelic polymorphism to test for transcription
of the Lyt2.1 transgene (see details in Materials and
Methods). A nucleotide substitution in exon 3 of the Lyt2.1 allele
generates a KpnI restriction site that is absent from the
Lyt2.2 allele (32). While the amplified product of 516 bp observed for
lymphoid tissues from a nontransgenic DBA/2J mouse (endogenous allele
is Lyt2.1) could be cut by KpnI to give two bands of the
expected sizes of 339 and 177 bp, the 516-bp RT-PCR band observed for
lymphoid tissues from nontransgenic B6/SJL or B6 mice (endogenous
allele is Lyt2.2) was not cut with KpnI (not shown). Using
this assay, we were unable to detect transgenic Lyt2.1 expression in
lymphoid or nonlymphoid tissues from any of the fragment A and B lines,
even when the products were analyzed by blot hybridization with a
32P-labeled oligonucleotide probe conserved in both alleles
(not shown).
Failure of the fragment A and B Lyt2.1 transgenes to be expressed was
not due to a problem in transcription, processing, or translation,
because both constructs were expressed at the level of RNA and surface
protein in transfected fibroblasts (not shown) and T cell lines (Ref.
43, and unpublished results). Further, in additional transgenic
experiments, a Lyt2.1 construct consisting of the same coding region
but with the 5' flanking region replaced with that of the ß-actin
gene (44) led to high level constitutive expression in most tissues of
all lines (31). Thus, the likely explanation for lack of expression of
fragment A or B in transgenic mice was that essential
cis-acting transcriptional control sequences located further
5' and/or 3' were not present within these fragments. To test for such
sequences, a 22-kb Lyt2.1 construct with
12 kb of 5' and 4.5 kb of
3' flanking DNA (fragment C in Fig. 1
) was used to produce transgenic
mice. Eight transgenic lines were generated and analyzed for expression
by flow cytometry, Northern blot hybridization, and RT-PCR. As for
fragments A and B, we were unable to detect expression in either
lymphoid or nonlymphoid tissues of any of these lines. The absence of
even low levels of transgenic RNA indicated that essential
cis-active transcriptional regulatory sequences were located
further than 12 kb upstream and/or 4.5 kb downstream of the gene.
As shown schematically in Figure 1
, the gene for mouse CD8
lies
36 kb 3' of the gene for CD8ß (34). As CD8
and CD8ß are
frequently coexpressed, this close chromosomal proximity suggests that
these genes may share cis-active regulatory sequences and
that these elements may be located some distance away from either gene.
Until relatively recently, it was not possible to clone the entire CD8
locus as a single contiguous DNA molecule because the size exceeded the
capacity of conventional cosmid cloning vectors. While larger capacity
cloning systems are now available (45, 46) and have been used to
introduce larger segments of DNA into transgenic mice, the large size
can complicate subsequent attempts to identify and study regions of
interest. As an alternate approach, we and others have found that
coinjection of two or more different DNA molecules into fertilized
embryos frequently leads to cointegration at the same chromosomal site
(unpublished observations). Homologous recombination between
overlapping coinjected fragments has also been reported (47). To test
for cis-active regulatory elements located further 5' of
fragment C, this fragment was coinjected with a 40-kb linearized cosmid
clone that extended in the 5' direction (fragment D in Fig. 1
). This
clone contained the intact mouse CD8ß gene (Lyt3.2 allele) with
1.5 kb of 5' and 25 kb of 3' flanking DNA, all intergenic DNA
between the CD8
and CD8ß genes, and overlapped the 5' end of
fragment C by
2 to 3 kb. The rationale for coinjecting these two
constructs was that if fragment D contained cis-acting
regulatory information required for transcription of the CD8
gene,
then these sequences might be able to activate expression of the
fragment C CD8
/Lyt2.1 transgene if, in the process of chromosomal
integration, fragments C and D became linked in a
cis-orientation, regardless of whether this occurred
through homologous recombination involving the overlapping region.
Four transgenic founders (Nos. 6, 24, 31, and 33) were identified, by
hybridization of tail DNA with the fragment C-specific human CD4 probe
followed by the fragment D-specific vector probe, as carrying both
coinjected fragments. Upon breeding, founders 6, 31, and 33 transmitted
fragment C to
50% of their offspring. In all cases, fragment D
cosegregated with fragment C, indicating that both fragments were
cointegrated on a single chromosome. A higher than expected number of
founder 24 offspring was found to inherit both fragments, which was
subsequently shown to be due to two transgene integrations that
segregated among offspring. Both integrations contained fragments C and
D and were readily distinguished by hybridization band pattern and
intensity. These two integrations were maintained independently and
referred to as 24A and 24B. Fluorescent in situ hybridization (FISH)
chromosomal mapping analysis of lines 24A and 6 confirmed that both
fragments were located at a single chromosomal position (not shown).
Together, these findings strongly suggest that in these two (and
probably all five) lines, both fragments C and D were cointegrated in a
cis orientation at a single locus. DNA blot hybridization
analyses for each line indicated a copy number of 2 to 10 copies
per cell. Although both fragments appeared to be integrated without
rearrangement, we did not attempt to determine their relative
orientation at a single integration site.
Expression of the Lyt2.1 transgene was analyzed for each fragment (C+D)
line by flow cytometry. Figure 2
A shows the results relative
to endogenous Lyt2 expression for cells from thymus ((i) Thy), lymph
node (Fig. 2
A(ii), L.N.), and spleen (Fig. 2
A(iii), Spl.) for line 24A (Lyt2.1 Tg(C+D), left
panels). Cells from nontransgenic (B6/SJL)F1 (Non-Tg;
right panels) or B6 (data not shown) mice did not react with
the Lyt2.1-specific mAb, as they are homozygous for the Lyt2.2 allele.
In contrast, Lyt2.1 expression was detected for each of these tissues
for line 24A (left panels). For lymph node (ii) and
spleen (iii) cells, essentially all Lyt2.1-expressing cells were also
positive for endogenous Lyt2 (detected with either a Lyt2.2-specific
mAb or Lyt2 monomorphic mAb), although there was some heterogeneity in
the level of Lyt2.1 expression (Fig. 2
A). Furthermore, as
shown in Figure 2
B(ii) for lymph node (spleen not shown),
all Lyt2.1+ cells were negative for CD4 expression, and all
CD4+ cells were negative for Lyt2.1 expression, similar to
endogenous Lyt2.2. Altogether, these results indicate that the fragment
C+D construct contains cis-active sequence information able
to direct Lyt2.1 expression in peripheral T cells in a
CD8-sublineage-specific pattern similar to the endogenous Lyt2.2
allele.
|
3.6-fold less than
for Lyt2.2+CD4+ cells (i.e., 20.9 vs 75.6%,
Fig. 2While the above pattern of expression in thymic, splenic, and lymph node cells was observed for all transgenic offspring of line 24A, expression of transgenic Lyt2.1 was not observed for offspring of lines 24B, 31, or 33 (not shown). Approximately half of the transgenic offspring analyzed from line 6 showed a similar pattern of Lyt2.1 expression as observed for line 24A, although the apparent level of expression was less (not shown).
To assess the tissue-specific distribution of expression of the Lyt2.1
transgene at the level of RNA, Northern blot hybridization analyses
were conducted (Fig. 3
). Panels
A and C were obtained by hybridization of tissue RNA
samples from line 24A offspring with the Lyt2.1 transgene-specific
0.6-kb human CD4 3' tag probe (see Fig. 1
and Materials and
Methods). This probe detected the native
CD4 transcript in the human
CD4+ T cell line Jurkat and did not cross-hybridize with
transcripts in lymphoid or nonlymphoid tissue RNAs from nontransgenic
mice (Fig. 3
, A and C, Non-Tg spleen/Spl,
thymus/Thy). In contrast, a band of
2 to 2.3 kb, the size expected
for the transgenic Lyt2.1 transcript, was detected in thymus (Thy in
Fig. 3
, A and C) and lymph node (not shown) RNA
from 8 of 8 line 24A transgenic offspring analyzed (Lyt2.1 Tg(C+D)).
While no band was apparent for the 24A spleen RNA sample shown in A, a
faint band was observed with a 2.5-fold greater loading of the same
sample (not shown), a sample from a transgenic sibling (Fig. 3
C), and when poly(A)+ RNA was analyzed (not
shown). Other than thymus, lymph node, and spleen, Lyt2.1 transcripts
were not detected in any other tissues of line 24A mice (Fig. 3
, A and C). Similar analyses for lines 24B, 31, and
33 failed to detect Lyt2.1 transcripts in total RNA from any lymphoid
or nonlymphoid tissues (not shown). A low level of Lyt2.1 transcripts
was observed for one of two thymus RNA samples analyzed for line 6 (not
shown).
|
mRNA (2.02.3 kb
vs 1.61.8 kb) due to the tag inserted into the 3' untranslated
region, the pattern and level of expression detected for transgenic and
nontransgenic (Non-Tg) offspring were similar, indicating that the
level of Lyt2.1 expression was probably considerably less than that of
Lyt2.2.
The elevated level of Lyt2 RNA in thymus compared with spleen (Fig. 3
B) is expected because the majority of cells in the thymus
(i.e., 85%) are at the DP stage, while in the spleen only
30% of
lymphoid cells are T cells, and of these, about 1/3 are
CD8+. The observation that the ratio of the level of
transgenic Lyt2.1 RNA in spleen relative to thymus (determined by
PhosphorImaging; see Fig. 3
C) is similar to that for
endogenous Lyt2 for transgenic and nontransgenic mice (from Fig. 3
B; i.e.,
0.1) is consistent with the flow cytometry
results showing that the fragment C+D construct is expressed in a
similar distribution of cells as endogenous Lyt2 (see below).
To estimate the level of RNA derived from the Lyt2.1 transgene relative
to the endogenous allele, a transgene-specific KpnI
polymorphism was used in conjunction with RT-PCR blot hybridization
analysis of thymus, spleen, and lymph node cDNA from a line 24A mouse.
The specificity of this approach (see Materials and Methods
for details) for distinguishing the two alleles is shown in Figure 3
D for RT-PCR products from nontransgenic strains that carry
the Lyt2.1 allele and the KpnI polymorphism (DBA/2J) or the
Lyt2.2 allele without the KpnI polymorphism (B6/SJL)F1.
Hybridization of blots of splenic RT-PCR products from DBA/2J and
(B6/SJL)F1 mice with a radiolabeled oligonucleotide probe
conserved between both strains (Lyt2.1/2.2 probe) revealed the single
expected 516-bp band (left (KpnI -)
tracks of DBA/2J and B6/SJL lanes).
While KpnI treatment did not alter the size of the
(B6/SJL)F1 Lyt2.2 band (compare KpnI + and -),
the 516-bp DBA/2J band was cleaved by KpnI to two bands of
about 339 and 177 bp (detected by ethidium bromide staining, data not
shown), of which only the smaller one hybridized with the oligo probe.
When a similar analysis was conducted for line 24A transgenic spleen
(right lanes, Lyt2.1/T4 Tg), the probe detected both
the 516-bp band (corresponding to expression of the endogenous Lyt2.2
gene) and the 177-bp band (corresponding to expression of the Lyt2.1
transgene). Both bands were also observed for line 24A thymus and lymph
node but not for other tissues (not shown). Band quantitation showed
that the level of Lyt2.1 (transgenic) RNA in line 24A spleen, thymus,
and lymph node was
10% of that from the endogenous (Lyt2.2) locus.
To determine whether expression of the Lyt2.1 C+D transgene construct
was regulated appropriately during thymic differentiation, three-color
flow cytometry was conducted. CD3 is a useful marker for distinguishing
thymic subpopulations as the levels of the TCR/CD3 complex increase
with maturation (48). Figure
4 shows the
results of this analysis for expression of Lyt2.1 (x-axis,
left panels) and endogenous Lyt2.2 (x-axis,
right panels) with respect to CD4 (y-axis,
all panels) and CD3. Figure 4
A shows the results
for the total thymocyte population (All), while B through
D shows the results for cells expressing low (CD3 low),
intermediate (CD3 int.), and high (CD3 hi) levels of CD3. As already
noted in Figure 2
B(i), significant populations of
Lyt2.1+CD4+ (i.e., DP; 17.2%) and
Lyt2.1+CD4- (i.e., SP; 1.0%) cells were
detected in total thymocytes (Fig. 4
A, All/left
panel). While these phenotypes and the approximate ratio of DP to
SP cells for Lyt2.1 (17.2:1.0%) and endogenous Lyt2.2 (80.4:3.9%) are
appropriate, the frequency of cells expressing the transgene is less
than that of cells expressing the endogenous allele at both stages. The
observation that Lyt2.1 is apparently not expressed in all Lyt2.2
thymocytes is reflected in the increased number of cells that appear to
be Lyt2.1-CD4+ (i.e., 79%). Given the normal
distribution of CD4 and Lyt2.2 staining for thymocytes of the same
animal (Fig. 4
A, right; 14.5%
Lyt2.2-CD4+), this apparent increase probably
results from the lack of detectable expression of Lyt2.1 on a
proportion of thymocytes that in other respects are at the DP stage.
|
91.5% of cells coexpressed Lyt2.2+ and CD4+
(right), while 17.1% of cells were
Lyt2.1+/CD4+ (left). Although
the frequency of Lyt2.1+DP cells is less than for
Lyt2.2+DP cells, these results show that the C+D construct
contains cis-active information able to mediate expression
at this early stage. As discussed below, it is most likely that the
lower than expected number of cells expressing the transgene is due to
the lower quantitative level of expression. As expected, there were
essentially no Lyt2.2+CD4- or
Lyt2.2-CD4+ (right) SP
CD3low cells. Similarly, there were no
Lyt2.1+CD4- SP cells detected. However,
regarding total thymocytes, there was a larger than expected number of
cells that appeared to be Lyt2.1-CD4+ SP. An
overall similar result was observed when cells expressing intermediate
levels of CD3 (Fig. 4
At the CD3hi stage (CD3 hi; Fig. 4
D),
similar to expression of Lyt2.2, there was a significantly increased
frequency of Lyt2.1+CD4- SP cells and a
decreased frequency of Lyt2.1+CD4+DP cells
compared with the CD3low and CD3int
populations. While these changes between the CD3int and
CD3hi stages were similar for both the Lyt2.1- and
Lyt2.2-expressing populations, the frequency of transgene-expressing
cells was still less than for the endogenous allele. Finally, the
relative frequencies of Lyt2.1-CD4+ and
Lyt2.2-CD4+ SP cells were much more similar
(i.e., 75.2 and 65%) than at earlier stages.
Although these results indicate that the fragment C+D construct
contains cis-active sequence information able to mediate
stage-specific expression in a significant proportion of DP and SP
thymocytes, it was possible even in these cells that there were subtle
differences in the timing of activation or extinction of Lyt2.1
expression compared with the endogenous locus. This might be the result
if there are additional cis-elements beyond the region
covered by fragments C+D or from the influence of DNA sequences at the
site of transgene integration (i.e., position effects). A more rigorous
test of the appropriateness of the observed expression pattern would be
provided by demonstrating that the distribution of expressed transgenic
CD8
contributed functionally to thymic differentiation and selection
and the generation of mature CD8+ CTL. However, as
transgenic Lyt2.1 expression was low compared with the endogenous
allele, it would be difficult to address this issue in normal
transgenic mice. Therefore, line 24A transgenic mice were crossed
multiple times to CD8
-deficient knock-out mice (9) to examine
expression and function of the Lyt2.1 transgene in the absence of
endogenous CD8
expression. Offspring that were homozygous for the
endogenous CD8
/Lyt2.2 mutant allele and that carried the Lyt2.1
transgene were identified by DNA blot hybridization (not shown).
Figure 5
shows two-color CD4/Lyt2.1 flow
cytometry results obtained for thymocytes (Fig. 5
A, Thy.)
and lymph node cells (Fig. 5
B, L.N.) for
nontransgenic/CD8
homozygous knock-out (Non Tg/CD8-/-;
right panels, A and B) and Lyt2.1
transgenic (line 24A)/CD8
homozygous knock-out
(Lyt2.1Tg(C+D)/CD8-/-; left panels, Fig. 5
, A and B) mice. As expected (9), neither Lyt2.1-
or Lyt2.2-expressing cells were detected in thymocytes or lymph nodes
from nontransgenic/knock-out mice (Fig. 5
, A and
B, right profiles of
upper/Lyt2.1 and lower/Lyt2.2 panels).
In contrast, Lyt2.1+CD4+ DP (24.1% of total)
and Lyt2.1+/CD4- SP (0.6% of total)
thymocytes (Fig. 5
A, upper panel, left
profile) were detected in Lyt2.1 transgenic/CD8
knock-out mice.
As for Lyt2.1 transgenic/wild-type mice (Fig. 4
), there was a greater
than expected number of cells that appeared to be
Lyt2.1-CD4+ SP. In the transgenic/wild-type
mice, these cells were actually at the DP stage, as they expressed the
endogenous Lyt2.2 allele. Despite the absence of Lyt2.2 expression in
the transgenic/knock-out mice, we assume that most of these
CD8-CD4+ SP cells are also at the DP stage
with respect to other phenotypic markers. Both lymph node (Fig. 5
B, left profile, upper panel) and spleen (not shown) cells
of the transgenic/knock-out mice also contained significant populations
of Lyt2.1+CD4- (6.3%) and
Lyt2.1-CD4+ (54.4%) SP cells. Taken together,
these results demonstrate that the fragment C+D construct contains
cis-regulatory information able to direct a temporal and
spatial pattern of Lyt2.1 expression sufficient to mediate the
development of thymic and peripheral CD8+ SP T cells. The
reduced relative number of Lyt2.1-expressing cells in lymph nodes and
spleen (not shown) of transgenic mice deficient for endogenous CD8
(Fig. 5
B) compared with mice that are not (Fig. 2
B(ii)) probably results from a decreased percentage of
cells that survive thymic selection due to the lower overall level of
coreceptor expression.
|
in both DP and SP thymocytes as well as in
peripheral CD8+ T cells. To sublocalize this
cis-active information and to investigate whether there is
one or more than one element responsible for stage- and
sublineage-specific expression, we used the same approach as described
above to test the activity of two subfragments of D (i.e., E and F) in
mediating expression of the fragment C CD8
transgene construct.
Fragment E was a 23-kb ScaI fragment covering the intergenic
region between CD8
and CD8ß (i.e., the 3' portion of D), while
fragment F was a 17-kb BamHI fragment covering most of the
CD8ß gene region (i.e., the 5' portion of D; see Fig. 1
Flow cytometric, RNA blot hybridization, and RT-PCR analyses of tissues
of transgenic offspring for all four C+E lines failed to detect
expression in thymocytes, splenic or lymph node T cells, or any other
tissue (not shown). In contrast, expression of transgenic Lyt2.1 was
detected in thymocytes but not peripheral T cells of offspring of two
of the three C+F lines. No expression in any tissue could be detected
in the third line. Figure 6
A
shows the 2-color staining results (CD4 vs Lyt2.1) for thymocytes from
an offspring of C+F line 42 (Lyt2.1 Tg(C+F), left) compared
with a nontransgenic sibling ((Non Tg, right). Similar to
the results obtained for fragment C+D transgenic mice (Fig. 2
B(i)), there was a significant fraction of CD4-expressing
cells that coexpressed transgenic Lyt2.1 (i.e.,
64%). All of these
cells coexpressed endogenous Lyt2.2 (not shown) and thus appear to be
typical DP thymocytes. There was also a very small population of cells
that was negative for CD4 and expressed low levels of Lyt2.1 (i.e.,
0.58%). As for thymocytes from C+D mice, the level of transgenic
Lyt2.1 expression was heterogeneous, giving rise to a higher than
expected number of cells that appeared to be SP
CD4+Lyt2.1- (
32.9%). As staining of
this same population for endogenous Lyt2.2 expression gave a normal
distribution of DP and SP cells (not shown), this apparently increased
number of CD4 SP cells was due to undetected surface expression of
Lyt2.1 in a fraction of cells that were actually DP rather than a
distortion in T cell development resulting from expression of the
transgene.
|
|
expression in DP thymocytes and SP peripheral
CD8+ T cells. While fragment D contains regulatory
sequences able to mediate Lyt2.1 expression in both developing and
mature T cells, fragment F contains cis information able to
mediate expression in DP thymocytes only (i.e., not in SP
CD8+ peripheral T cells). These results suggest that during
T cell development there is a "switch" in transcriptional control
of CD8
expression from a cis-mechanism(s) active in DP
cells, which is dependent on cis sequences within fragment
F, to another mechanism(s) active in SP CD8+ cells, which
depends on cis sequences within fragment D but absent from
F. To determine at what stage(s) in thymic development this switch
occurs, three-color flow cytometry was conducted for thymocytes of C+F
mice using CD3 expression level to distinguish different stages of
maturation. Figure 8
|
| Discussion |
|---|
|
|
|---|
gene
itself. Based on the lack of even low level RNA or surface protein
expression of Lyt2.1 constructs containing up to 12 kb of 5' and/or 4.5
kb of 3' native flanking DNA (fragments A, B, and C in Fig. 1
in thymus-derived
ß-TCR T cells
depends on cis-active regulatory elements located
beyond this region.
Previous studies from others identified candidate
cis-regulatory elements within the CD8
gene (27) and in
the immediate 5' flanking region (25, 26) by homology with known
elements, by transfection, or by mapping of DNase I-HSS. More recent
DNase I-HSS mapping of a much larger segment of the CD8 locus
identified four clusters of HSS as additional candidate regulatory
elements (30). Non-tissue-specific cluster I was located
20 kb
downstream of the CD8
gene, while tissue-specific clusters II and
III were located within
6.5 kb 5' and between
14 to 22 kb 5' of
the CD8
gene, respectively. Cluster IV was within and 3' of
the CD8ß gene (30). Lack of expression of CD8
transgene fragments
A, B, or C indicates that candidate cis elements identified
within the CD8
gene or in the immediate 5' flanking region (25, 26),
including cluster II HSS (30), are not sufficient for directing
expression in differentiating and mature CD8+
ß-TCR T
cells.
Our finding that inclusion of an additional 40-kb segment of upstream
flanking DNA (fragment D) together with the fragment C CD8
gene led
to a pattern of transgenic Lyt2.1 expression in DP and SP thymocytes
and peripheral CD8+CD4- and
CD8-CD4+ T cells, which essentially paralleled
the endogenous Lyt2.2 allele, indicates that this upstream region
contains transcriptional control sequences able to direct stage- and
sublineage-specific expression of CD8
in thymus-derived
ß-TCR T cells. As fragment D includes the CD8ß/Lyt3 gene, it is
possible that these cis sequence(s) normally serve to
mediate expression of both genes. To assess fragment D-derived CD8ß
(Lyt3.2) expression, we are breeding the Lyt2.1 fragment C+D
transgene onto a background that carries the alternate endogenous
Lyt3.1 allele (AKR) or with CD8ß knock-out mice.
Although an appropriate distribution of Lyt2.1 expression was observed
in a proportion of fragment C+D transgenic lines, the level of
expression was less than the endogenous locus. In lymph node and spleen
of line 24A, for example, in which virtually all Lyt2.2+
cells coexpressed the Lyt2.1 C+D transgene (Fig. 2
A, ii and
iii), RT-PCR analysis indicated that the level of transgenic RNA was no
more than
10% of that of the endogenous allele (Fig. 3D
). Transgene
expression level in the thymus also appeared to be quantitatively less
than for Lyt2.2, although the complexity of CD8-expressing thymic
subpopulations makes precise quantitation difficult (see below).
One possible explanation for the reduced level of transgenic CD8
expression in C+D mice is that additional cis-regulatory
information, such as a locus control region (LCR), which influences the
quantitative level of expression, may lie beyond the 60-kb C+D region.
LCRs have been identified for several genes, including the human
ß-globin locus (49), the 
-TCR locus (50), and HLA class I genes
(35, 51), and have been shown to direct RNA expression at a level
comparable with the chromosomal locus, regardless of the integration
site. Hostert et al. reported that an 80-kb mouse CD8
P1 clone was
expressed in transgenic mice at a level similar to or greater than the
endogenous allele in four of six transgenic lines (30). However, in
some of these lines expression was observed in only 80 to 97% of the
expected CD8+ subset (30). This result, combined with lack
of expression in the other two lines, was taken to indicate that this
P1 clone lacked LCR-like elements, either because there is no CD8 LCR
or because it lies beyond the region included. This P1 clone extended
from just 5' of the CD8ß gene, similar to fragment D in our studies,
to more than 20 kb 3' of the CD8
gene and included DNase I-HSS
clusters I through IV (30). As fragment C+D (as well as a CD8 P1 clone
we have studied (52); see below) appears to differ from this P1 clone
only in the amount of 3' DNA flanking the CD8
gene, HSS cluster I or
other downstream elements may be responsible for the increased
expression observed by this other group.
A second possible explanation for the lower than expected level of fragment C+D expression is that optimal transcription may be possible only when the 2 fragments are integrated relative to each other in their native chromosomal upstream/downstream configuration, possibly thereby permitting efficient formation of transcription factor-dependent enhancer/promoter interactions. Arguing against this view, however, is our recent finding that a 85-kb transgenic P1 phage clone, containing the entire region covered by fragments C+D as well as additional upstream and downstream DNA as a single contiguous molecule (52), gave results similar to the C+D construct (unpublished results).
Other than the reduced level, the only other difference in the
distribution of transgenic and endogenous CD8
-expressing cells in
C+D mice was an apparent increase in
Lyt2.1-CD4+ thymocytes at the
CD3low and CD3int stages. As most of these
cells expressed endogenous Lyt2.2 and thus were actually at the DP
Lyt2.2+CD4+ stage, it is likely this results
from a combination of the low level of expression of the Lyt2.1
transgene and naturally heterogeneous CD8 levels between cells during
the DN to DP to SP transitions. RT-PCR analysis of purified thymocytes
with this Lyt2.1-Lyt2.2+CD4+
surface phenotype is being conducted to quantitate the level of
transgenic Lyt2.1 RNA expression in these cells.
The ability of the Lyt2.1 fragment C+D transgene to "rescue" the
development of CD8+ DP and SP T cells in the CD8
knock-out background provides functional confirmation that this
construct contains cis-active regulatory information
sufficient to mediate appropriate stage- and sublineage-specific CD8
coreceptor expression. The reduced level of total CD8
expression
(i.e., transgenic plus endogenous) is probably responsible for the
decreased frequency of transgene-expressing rescued cells in the
knock-out vs wild-type backgrounds. As the rescued CD8+ SP
T cells are responsive to alloantigen and foreign Ag (not shown), even
low level expression of this coreceptor is sufficient to mediate
development of fully functional CTLs.
Compared with transgene fragment C+D, the results obtained for fragment
C+F were quite different. First, in contrast to C+D, the C+F construct
was not expressed in peripheral CD8+
ß-TCR T cells.
Second, while C+F was expressed appropriately in DP thymocytes bearing
low and intermediate levels of CD3, it was not expressed in more mature
DP or SP thymocytes that expressed high levels of CD3. The C+D
construct was expressed at all appropriate stages of thymic
development, including the CD3hi DP and SP populations.
In contrast, we were unable to detect expression in any cell type of mice derived from microinjection of fragments C+E. While this manuscript was under review, two papers were published (57, 58) indicating that an intergenic subregion containing DNase I-HSS cluster III and that overlapped with the 3' end of fragment E was able to direct expression in mature SP CD8+ T cells, but not in immature DP cells. Possible explanations for this apparent difference include alteration of the cis activity of resident regulatory elements due to the specific structure of fragment E; an unfavorable pattern of cointegration of fragments C and E; partial disruption of DNase I-HSS cluster III, as it is located close to the end of fragment E; and/or analysis of only a limited number of mice. We are currently analyzing the activity of additional subregions of fragments D and E.
The results presented in this paper indicate that stage-specific
expression of CD8
in DP as opposed to SP thymus-derived
ß-TCR T
cells is mediated by the differential activity of distinct
stage-specific cis-active regulatory mechanisms. One
cis mechanism (i.e., mechanism I) depends on sequence
information within fragment F and is able to direct expression of
transgenic CD8
in developing thymocytes up to the CD3int
stage but not in CD3hi DP or SP thymocytes or SP
CD8+ peripheral T cells. As transgenic CD8
expression
was detected in CD8+CD3hi DP and SP T cells in
the thymus and the periphery of C+D but not C+F mice, the results imply
that a second cis-active mechanism (i.e., mechanism II),
presumably involving DNase I-HSS cluster III (57, 58), mediates
expression in these more mature cells. Thus, around this intermediate
to late DP stage of T cell development, a "molecular switching" of
the cis-active control of CD8
expression occurs from
mechanism I to II. An important question is whether the switch occurs
before (i.e., leading up to and possibly involved in the triggering of)
or subsequent to (i.e., possibly as a result of) thymic selection (12, 14, 15, 53, 54, 55, 56). Switching before selection will indicate that the DP
to SP transition in transcriptional control of CD8
is not determined
by TCR-dependent selection-associated signaling events, while switching
after selection is consistent with this possibility. Experiments in
progress should answer this questio