HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Aguirre, S. A. Articles by McGuire, T. C. Search for Related Content PubMed PubMed Citation Articles by Aguirre, S. A. Articles by McGuire, T. C.

IL-4 Protects Adult C57BL/6 Mice from Prolonged Cryptosporidium parvum Infection: Analysis of CD4⁺ß⁺IFN-⁺ and CD4⁺ß⁺IL-4⁺ Lymphocytes in Gut-Associated Lymphoid Tissue During Resolution of Infection¹

Shirley A. Aguirre², Lance E. Perryman, William C. Davis^* and Travis C. McGuire^*

^* Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, WA 99164; and Department of Microbiology, Pathology, and Parasitology, North Carolina State University College of Veterinary Medicine, Raleigh, NC 27606

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Resistance of adult C57BL/6 mice to severe Cryptosporidium parvum infection is dependent on CD4⁺ß⁺ TCR lymphocytes. In this study, we demonstrated that treatment with anti-IFN- mAb extended oocyst excretion 18 days longer, and anti-IL-4 mAb extended oocyst excretion at least 11 days longer than isotype control mAb treatment. Analysis of the specific activity of anti-IFN- mAb present in treated mouse sera suggested that IFN- may have a limited role in the resolution phase of infection. Changes were also documented in numbers of CD4⁺ß⁺IFN-⁺ and CD4⁺ß⁺IL-4⁺ lymphocytes in Peyer’s patches and intraepithelium of adult C57BL/6 mice during resolution of C. parvum infection. Resistance to initial severe infection was associated with CD4⁺ß⁺IFN-⁺ lymphocytes, and eventual resolution of infection was associated with CD4⁺ß⁺IL-4⁺ lymphocytes. Analysis of cytokine expression following in vitro stimulation with C. parvum Ags during resolution of infection demonstrated consistent increases in CD4⁺ß⁺IL-4⁺ lymphocytes, but not CD4⁺ß⁺IFN-⁺ lymphocytes. The relevance of CD4⁺ß⁺IL-4⁺ lymphocytes in protection against C. parvum was then evaluated in C57BL/6 IL-4 gene knockout mice (IL-4^-/-). Adult IL-4^-/- mice excreted oocysts in feces approximately 23 days longer than IL-4^+/+ mice. Further, anti-IFN- mAb treatment increased the severity and the duration of infection in IL-4^-/- mice compared with those in IL-4^+/+ mice. Together, the data demonstrated that IFN- was important in the control of severity of infection, and either IFN- or IL-4 accelerated termination of infection. However, neither IL-4 nor IFN- was required for the final clearance of infection from the intestinal tract of adult mice.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
C;-5q;44qryptosporidium parvum infects intestinal epithelial cells and causes a diarrheal disease in humans and other mammals (1). The health problems caused by the presence of C. parvum in water supplies have received world-wide recognition as an emerging public health issue because infection can cause a life-threatening disease in young and immunoincompetent individuals (2, 3). Individuals with congenital T or B lymphocyte deficiencies, SCID, chemotherapy induced immunodeficiency, or AIDS are at risk of increased morbidity and potentially fatal infections following exposure to C. parvum (1, 3). C. parvum infection also causes diarrheal disease in neonatal ruminants, and these infections result in reservoirs of infectious oocysts that have environmental and zoonotic implications (3). Methods of immunologic control or intervention are needed because of the resistance of the organism to approved drug therapies or conventional water treatments and the lack of effective preventative and interventive therapies (2).

Resolution of C. parvum infection in immunologically intact individuals results in long-term protection from reinfection. Mechanisms of immunity have been dissected using several mouse models to demonstrate that CD4⁺ T lymphocytes or ß TCR⁺ lymphocytes are required for resolution of C. parvum infection (4, 5, 6, 7). The major functional subset of CD4⁺ lymphocytes involved in the protective immune response to C. parvum is not known. Murine CD4⁺ T lymphocytes are heterogeneous and are divided into two major functional subsets, Th1 and Th2 (8). Th1 lymphocytes are defined by the production of IFN-, IL-2, and TNF-ß and can activate macrophages, mediate delayed-type hypersensitivity, and aid in the production of CTL and IgG2a Abs by B lymphocytes. Th2 lymphocytes express IL-4, IL-5, IL-6, IL-9, IL-10, and IL-13 and aid in B lymphocyte production of IgE, IgA, IgG1, and IgG4 Abs. Results from treatment of adult immunocompetent BALB/c mice with anti-IFN- mAb indicated that recovery from severe C. parvum infection is independent of IFN- (4). In contrast, adoptive lymphocyte transfer experiments in SCID mice suggest that both CD4⁺ T lymphocytes and IFN- mediate resolution of established C. parvum infection (9). Recent work in C57BL/6 IFN- gene knockout (GKO)³ mice further indicates that IFN- is required to prevent fatal C. parvum infection (10).

Host intestinal epithelial cell invasion is required for C. parvum replication and disease, and this suggests that lymphocytes of the gut associated lymphoid tissue (GALT) could be an important first line of host defense for control of infection. When C. parvum oocysts are ingested, sporozoites are released into the gut lumen and then infect host intestinal epithelial cells. Within the epithelium, sporozoites develop into type I or type II meronts. Type II meronts initiate the sexual phase of the life cycle, which, upon completion, yields infectious oocysts (1). GALT that can respond to C. parvum infection is compartmentalized into Peyer’s patches (PP), intraepithelium (IE), and lamina propria (LP) (11). PP in the mouse are organized secondary lymphoid structures with clearly defined T and B lymphocyte-dependent areas and consist of B lymphocytes (80%), with the remaining cells composed of CD4⁺ lymphocytes with fewer CD8⁺ lymphocytes. In contrast, lymphocytes in the IE and LP are not organized, but are scattered in the mucosa. IE T lymphocytes are predominantly CD3⁺CD8⁺ (80%) and CD3⁺CD4⁺ ( 15%), and the CD3⁺ lymphocytes express ß TCR (45%) or TCR (55%). LP lymphocytes are predominantly CD4⁺ß TCR⁺. PP probably act as inductive sites of the host immune response to intestinal pathogens, while the LP and IE act as effector sites of the local immune response.

To further define the involvement of CD4⁺ T lymphocyte subsets in the resolution of C. parvum infection in adult C57BL/6 mice, we investigated the hypothesis that Th2 lymphocyte responses mediate control of C. parvum infection. The initial experiments demonstrated that the recovery phase of C. parvum infection proceeded despite continued anti-IFN- mAb treatment and that anti-IL-4 mAb treatment prevented early termination of C. parvum infection. Analysis of the intracellular IFN- and IL-4 expression in PP and IE CD4⁺ß⁺ T lymphocytes in adult immunocompetent C57BL/6 mice inoculated with C. parvum oocysts and treated with anti-IFN- mAb, anti-IL-4 mAb, or isotype control mAb indicated that 1) CD4⁺ß⁺IFN-⁺ lymphocytes were associated with control of severity of early infection; and 2) CD4⁺ß⁺IL-4⁺ lymphocytes were associated with the resolution phase of C. parvum infection. Further analysis of the involvement of IL-4 in resolution of infection was investigated in adult C57BL/6 IL-4 GKO (IL-4^-/-) mice. IL-4^-/- mice developed a prolonged C. parvum infection; however, these mice eventually resolved C. parvum infection with or without anti-IFN- mAb treatment. Therefore, we obtained clear evidence that IL-4 prevented prolonged C. parvum infection. In addition, adult C57BL/6 mice eventually recovered from infection in the absence of both IFN- and IL-4.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mice

C57BL/6 mice were purchased from B&K Universal (Kent, WA) and The Jackson Laboratory (Bar Harbor, ME). IL-4 knockout (IL-4^-/-) mice were obtained from The Jackson Laboratory. The IL-4 status of the IL-4^-/- and IL-4^+/+ mice was confirmed by PCR reactions on genomic DNA from tails (12) and by cytokine expression using flow cytometry. The forward and reverse primers used to detect the disrupted first exon of the IL-4 gene were CAGCTAGTTGTCATCCTGCTC and CTCGTTCAAAATGCCGATGATC, respectively. Male mice, 8 to 12 wk of age, were used.

C. parvum infection

C. parvum oocysts were obtained from Pleasant Hill Farms (Troy, ID), and the strain has been previously described (6). Mice were infected by gastric gavage with approximately 1 x 10⁷ oocysts in 50 µl of sterile PBS (6). Oocysts were counted from four or five fecal pellets collected from individual mice (13). Pellets were weighed, emulsified in 800 µl of PBS. Oocysts were obtained for counting by placing the emulsified solution over a 2-ml discontinuous sucrose gradient and collecting the oocysts at the gradient interface. The discontinuous sucrose gradient was prepared in 5-ml borosilicate tubes. The top layer contained 1.0 ml of Sheather’s solution (1/4 dilution) in PBS with 1% Tween-80, and the bottom layer contained 1.0 ml of Sheather’ solution (1/2 dilution) in PBS with 1% Tween-80. The gradient was carefully overlaid with the emulsified pellet in PBS to avoid disruption of the gradient interface and was centrifuged at 30°C for 25 min at 1000 x g. Oocysts collected at the gradient interface were resuspended in PBS. The oocysts were counted using a hemacytometer and were identified by morphology. Intestinal infection was determined histologically from Giemsa-stained sections of pylorus, duodenum, jejunum, ileum, cecum, and colon. Intestinal infectivity scores (0 to 3) were determined as previously described (14) (0, no organisms; 1, <33% of epithelium parasitized; 2, 33–66% of the epithelium parasitized; 3, >66% of the epithelium parasitized). Cumulative scores (pylorus + duodenum + jejunum + ileum + cecum + colon) were determined for each mouse, and a mean cumulative score and SD were calculated for each treatment group.

Monoclonal Ab

The mAbs used for flow cytometry were obtained from PharMingen (San Diego, CA) and included biotinylated anti-CD4 (L3T4, RM4-5), anti-ß TCR-conjugated to FITC or R-phycoerythrin (RPE; H57-597), anti-IFN--FITC (XMG1.2), and anti-IL-4-RPE (11B11). Streptavidin-Cy-Chrome (PharMingen) was used to detect biotinylated mAb. Hybridomas were obtained from American Type Culture Collection (Rockville, MD; IgG1 anti-IL-4 mAb clone IIBII and IgG1 isotype control mAb clone Y13-259) and from Dr. Alan Sher, Laboratory of Parasitic Diseases, National Institutes of Allergy and Infectious Diseases, National Institutes of Health (Bethesda, MD; IgG1 anti-IFN- mAb clone XMG.6). Ab was produced in pristane-primed athymic nude mice (Harlan Bioproducts, Madison, WI) and was purified by protein G (Pharmacia, Piscataway, NJ) column chromatography (15, 16). The mAb preparations were injected i.p. into each mouse three times during the first week and twice during the second and third weeks post-oocyst inoculation using 10 mg (anti-IL-4) and 2 mg (anti-IFN-) and an equivalent dose for the isotype control mAb per injection.

IFN- sandwich ELISA

To measure the blocking capacity (sp. act.) of rat anti-mouse IFN- mAb (XMG.6) present in the sera from mice treated with this mAb for 9 and 23 days after C. parvum inoculation, a sandwich ELISA was developed. Rat IgG1 anti-IFN- (XMG.6) mAb recovered in mouse serum was quantitated by radial immunodiffusion (The Binding Site, Birmingham, U.K.) and adjusted to 1 mg/ml. Fivefold serial dilutions of this adjusted mouse serum (1 mg/ml rat IgG1) in a 100-µl volume were incubated with 100 µl containing 4 ng/ml rIFN- (PharMingen) at room temperature for 30 min. Ninety-six-well Corning easy wash plates were previously coated with 0.5 µg/ml of purified anti-IFN- mAb (XMG1.2) diluted in coating buffer (0.015 M NaHCO₄ and 0.03 M NaH₂PO₃, pH 9.6) and incubated overnight at 4°C. The plates were washed with PBS/1% Tween-20 and blocked for 2 h at room temperature with PBS/10% FCS. One hundred microliters of the mouse serum/rIFN- mixture was added to the 96-well plate in duplicate and incubated overnight at 4°C. After washing, biotinylated anti-IFN- mAb (RA426) was added to the plate and incubated for 45 min at room temperature. The plate was washed, streptavidin-horseradish peroxidase was added, and incubation proceeded for 30 min at room temperature. Fresh o-phenylenediamine dihydrochloride substrate was added (100 µl) to the plate and incubated for 1 h. The reaction was stopped with 0.1 N HCl (100 µl), and the plate was read on a Titer-Tek Multiscan MCC/340 ELISA reader (Flow Laboratories, McLean, VA) at 492 nm. The reagents used in this sandwich ELISA were from a kit for measuring murine IFN- (PharMingen).

Three-color flow cytometry for intracellular cytokines

Lymphocytes (5 x 10⁶/ml) were incubated in 2 ml of RPMI medium with 10% FCS and 2 µM monensin (Sigma) for 4 h at 37°C to inhibit cytokine secretion and allow cytokine accumulation within cells (17, 18). The lymphocytes were washed, and Fc receptors were blocked with 2% rabbit serum in PBS for 10 min at room temperature. Lymphocytes were then washed with staining buffer (PBS containing 10% FCS and 0.1% azide) and resuspended to 1 x 10⁷ cells/ml in staining buffer; 50 µl of lymphocytes were added to the wells of a 96-well V-bottom plate, followed by 50 µl of biotinylated anti-CD4 mAb and 50 µl of anti-ß TCR-FITC or anti-ß TCR-RPE mAbs for 15 min at room temperature. Cells were washed twice with 200 µl staining buffer and then incubated with streptavidin conjugated to Cy-Chrome for 15 min at room temperature. After two wash steps, the lymphocytes were fixed and permeabilized in one step for 10 min at room temperature in HBSS containing 4% paraformaldehyde, 0.1% saponin, and 10 mM HEPES (17, 18). Cells were then washed and resuspended in 50 µl of permeabilization buffer (PBS with 10% FCS, 0.1% azide, and 0.1% saponin). Anti-IFN--FITC or anti-IL-4-RPE mAb in 50 µl was added to the cells for a final reaction volume of 100 µl and were incubated at room temperature for 30 min. Cells were washed twice in permeablization buffer and resuspended in staining buffer for flow cytometry.

The CD4⁺ lymphocyte population was analyzed for ß⁺IL-4⁺ and ß⁺IFN-⁺ lymphocytes by dual parameter FL1-FL2 dot plot. Specificity of the intracellular staining procedure was controlled by preincubation of a twofold excess (micrograms per milliliter) of rIFN- with anti-IFN- mAb or rIL-4 with anti-IL-4 mAb for 1 h at room temperature to block the binding site of the mAb. Anti-cytokine mAb preincubation with recombinant cytokine resulted in >99.7% inhibition of intracellular staining, produced <0.3% fluorescent cells, and was used to set the quadrant to determine statistics. Cell fluorescence was measured by FACScan flow cytometer (Becton Dickinson, Mountain View, CA). Two-parameter dot plots demonstrating cytokine staining were created by CellQuest software (San Jose, CA).

To determine intracellular cytokine expression in CD4⁺ß⁺ lymphocytes after stimulation with C. parvum Ags or PMA/ionomycin, PP and IE lymphocytes were pooled from five or six mice in each treatment group. Triplicate cultures (3 x 10⁶ cells/ml) were incubated for 4 h at 37°C with 5% CO₂ in RPMI medium containing 10% FCS, 20 mM sodium bicarbonate, 0.1 mM nonessential amino acids, 2 mM sodium pyruvate, 2 mM L-glutamine, 10 mM HEPES, 100 U/ml penicillin, 200 µg/ml streptomycin, 50 µM 2-ME, 2 mM monensin, and C. parvum protein Ags (100 µg/ml), PMA (10 ng/ml) with ionomycin (500 ng/ml), or no stimulation. Following incubation, cells were prepared for flow cytometric staining. The stimulation index for C. parvum Ags was calculated as: % of fluorescent CD4⁺ß⁺IFN-⁺ or CD4⁺ß⁺IL-4⁺ lymphocytes + C. parvum Ag ÷ % fluorescent CD4⁺ß⁺IFN-⁺ or CD4⁺ß⁺IL-4⁺ lymphocytes ex vivo.

PP and IE lymphocyte isolation

Small intestinal PP and IE were removed from mice of various treatment groups (five mice per group), and single cell suspensions of lymphocytes were prepared using a described protocol with modifications (19). The number of PP lymphocytes recovered from each mouse was determined, and 10 mg/ml collagenase VIII (Sigma, St. Louis. MO) was used instead of dispase. Approximately 6.7 x 10⁶ to 1.3 x 10⁷ PP lymphocytes were recovered per mouse with >95% viability. The number of IE lymphocytes recovered from each mouse was approximately 3.9 x 10⁶ to 1.1 x 10⁷ IE lymphocytes with >95% viability.

C. parvum Ags

Soluble C. parvum Ags were prepared from oocyst lysates. Approximately 10⁹ oocysts were treated with sodium hypochlorite (1.75%) to sterilize the preparation and to facilitate excystation. Oocysts were pelleted by centrifugation at 1000 x g for 10 min at 4°C, resuspended in a 50-ml conical tube of ice-cold 1.75% sodium hypochlorite, and incubated on ice for 8 min, inverting the tube once every minute. Hypochlorite was removed by washing the oocyst preparation four to six times with ice-cold sterile PBS. Washed oocysts were then resuspended in 5 ml of sterile PBS, frozen in liquid nitrogen for 1 min, and then thawed in a 37°C water bath. The freeze-thaw process was repeated 14 times to fracture oocysts, which were then left in a 37°C water bath for 3 or 4 days. Soluble C. parvum Ags were separated from insoluble oocyst shells by centrifugation, and the soluble protein concentration was determined by bicinchoniinic acid assay (Pierce, Rockford, IL). Soluble C. parvum Ag stocks were determined to be free of endotoxin by a lymphoproliferation assay using noninfected mouse spleen cells and by a Limulus amebocyte lysate assay (Sigma).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Anti-IFN- mAb treatment of adult C57BL/6 mice did not block recovery from C. parvum infection

Neutralizing mAb specific for IFN- was used to evaluate the role of IFN- in the recovery of adult C57BL/6 mice inoculated with C. parvum oocysts. Infected mice treated with anti-IFN- mAb two or three times weekly shed significantly higher numbers of oocysts in feces 4 to 26 days post-oocyst inoculation and reached a peak on day 9 that was 1000-fold greater than that in the control mAb-treated mice (Fig. 1). However, despite continued treatment of mice with anti-IFN- mAb, the infection resolved, so that oocysts were no longer detectable in feces on day 30 (Fig. 1). Mice treated with isotype control mAb resolved their mild infection by day 12, so blocking IFN- extended oocyst excretion by 18 days.

View larger version (26K): [in this window] [in a new window]   FIGURE 1. C. parvum oocyst excretion in adult C57BL/6 mice treated with anti-IFN- or isotype control mAb. Two milligrams of anti-IFN- or isotype control mAb was administered 1 day before and on the day of C. parvum inoculation and two or three times weekly thereafter. Five mice in each group were inoculated with 107 C. parvum oocysts by gastric gavage, and fecal pellets were collected for oocyst counts. The minimum number of detectable oocysts was 200/g of feces, which was depicted as zero in all the figures. The symbols (• indicates isotype control mAb group and indicates anti-IFN- mAb group) represent the mean number of excreted oocysts per gram of feces on a given day, and the vertical bars on each symbol are the SD. Similar results were seen in three separate experiments.

View this table: [in this window] [in a new window]   Table I. Concentration and specific activity of anti-IFN- (XMG.6) mAb in mice sera on days 9 and 23 after C. parvumoocyst inoculation

Adult C57BL/6 mice were treated with anti-IL-4 mAb before challenge with C. parvum oocysts, and then were treated two or three times weekly to investigate the role of IL-4 in recovery from infection. Anti-IL-4 mAb and isotype control mAb-treated mice shed similar numbers of C. parvum oocysts in feces on days 4 to 7 postinoculation (Fig. 2). However, anti-IL-4 mAb treatment caused significantly higher excretion of oocysts in feces from days 8 to 12 post-oocyst inoculation than that after isotype control mAb treatment (Fig. 2). Infected mice treated with isotype control mAb had no detectable oocysts in feces on day 12. After day 16 post-oocyst inoculation, the numbers of C. parvum oocysts in anti-IL-4 mAb-treated mice declined, but were still detectable on day 23. This result demonstrated that blocking IL-4 did not cause the early establishment of a more severe C. parvum infection as was noted when IFN- was blocked in adult C57BL/6 mice (Fig. 1). Nevertheless, blocking IL-4 increased the numbers of oocysts excreted in feces between days 8 and 23 post-oocyst inoculation and prolonged oocyst excretion by at least 11 days.

View larger version (27K): [in this window] [in a new window]   FIGURE 2. C. parvum oocyst excretion in adult C57BL/6 mice treated with anti-IL-4 or isotype control mAb. Ten milligrams per dose of anti-IL-4 or isotype control mAb was administered three times during the first week and twice during the second week of infection for a total of seven doses. Oocyst counts and inoculum were described in Fig. 1. The symbols (• indicates isotype control mAb group (n = 4) and indicates anti-IL-4 mAb group (n = 5)) represent the mean number of excreted oocysts per gram of feces on a given day, and the vertical bars on each symbol are the SD. This experiment was repeated, and similar results were obtained.

Resolution of C. parvum infection in adult C57BL/6 mice was associated with increased numbers of CD4⁺ß⁺IL-4⁺ lymphocytes in GALT

The next experiments analyzed intracellular IL-4 and IFN- expression in the CD4⁺ß⁺ lymphocyte populations from GALT during resolution of infection. The CD4⁺ß⁺ lymphocytes were evaluated because CD4⁺ T lymphocytes or ß⁺ TCR lymphocytes are required to prevent persistent C. parvum infection in adult C57BL/6 mice (6, 7). The percentage and number of GALT CD4⁺ß⁺ lymphocytes with intracellular IL-4 or IFN- on days 9 and 23 post-oocyst inoculation were determined by flow cytometry (Fig. 3, A–C). Statistical comparisons were made for changes in CD4⁺ß⁺IFN-⁺ and CD4⁺ß⁺IL-4⁺ lymphocytes on days 0, 9, and 23 post-oocyst inoculation using the Kruskal-Wallis and Mann-Whitney rank sum tests, and p < 0.05 was considered significant.

View larger version (28K): [in this window] [in a new window]   FIGURE 3. CD4+ß+IFN-+ and CD4+ß+IL-4+ lymphocyte numbers in PP and IE in uninfected mice and on days 9 and 23 post-C. parvum inoculation for the isotype control (n = 4; A), anti-IFN- mAb-treated (n = 5; B), and anti-IL-4 mAb-treated (n = 5; C) mouse groups. The columns represent the mean number of lymphocytes x 104 for four or five mice, and the vertical lines on the columns are the SD. Similar results were obtained when the experiments were repeated.

After C. parvum inoculation of anti-IFN- mAb-treated mice, CD4⁺ß⁺IFN-⁺ lymphocytes were not significantly increased in PP but were significantly increased in IE between days 0 and 9 (Fig. 3B). From days 9 to 23, CD4⁺ß⁺IFN-⁺ lymphocyte numbers increased significantly in PP, but decreased significantly in IE (Fig. 3B). CD4⁺ß⁺IL-4⁺ lymphocytes increased significantly in both PP and IE compartments on day 9; however, numbers declined significantly in both compartments from days 9 to 23 (Fig. 3B). Even though the CD4⁺ß⁺IL-4⁺ lymphocytes were decreased between days 9 and 23 postinoculation, the numbers on day 23 were still significantly elevated from day 0 and were at levels similar to those in the isotype control mAb-treated mice on day 23 (Fig. 3A). It was concluded that resolution of C. parvum infection in anti-IFN- mAb-treated mice was also associated with increased numbers of CD4⁺ß⁺IL-4⁺ lymphocytes. The changes seen in CD4⁺ß⁺IFN-⁺ lymphocytes were unexpected because anti-IFN- mAb was present extracellularly to block any secreted IFN-.

After C. parvum inoculation of anti-IL-4 mAb-treated mice, CD4⁺ß⁺IFN-⁺ lymphocytes increased significantly in PP and IE between days 0 and 9 (Fig. 3C). From days 9 to 23, CD4⁺ß⁺IFN-⁺ lymphocyte numbers decreased significantly in PP and IE (Fig. 3C). CD4⁺ß⁺IL-4⁺ lymphocytes also increased significantly in both PP and IE compartments from days 0 to 9; however, numbers declined significantly from days 9 to 23 in PP and remained the same in IE on days 9 and 23 (Fig. 3C). It was concluded that the increased numbers of CD4⁺ß⁺IFN-⁺ lymphocytes in PP and IE on day 9 did not result in early resolution of C. parvum infection. The prolonged excretion of C. parvum oocysts in the anti-IL-4 mAb-treated mice was attributed to blocking of extracellular IL-4 by the mAb treatment.

In vitro recall response of GALT to C. parvum Ags was consistently associated with increased CD4⁺ß⁺IL-4⁺ lymphocytes

To determine whether CD4⁺ß⁺ lymphocytes with intracytoplasmic IFN- and IL-4 were C. parvum Ag specific, the in vitro recall response to C. parvum Ags was investigated in mice during resolution of C. parvum infection and in uninfected control mice. The percentages of CD4⁺ß⁺IFN-⁺ and CD4⁺ß⁺IL-4⁺ lymphocytes in PP and IE after stimulation with C. parvum Ags in isotype control mAb-treated, C. parvum-infected mice and in uninfected control mice are shown in Figure 4. Stimulation of isolated lymphocytes with C. parvum Ags consistently produced stimulation indexes of 4 in PP and IE for CD4⁺ß⁺IL-4⁺ lymphocytes and 1 for CD4⁺ß⁺IFN-⁺ lymphocytes from isotype control mAb-treated mice. Similar results were obtained in mice challenged with C. parvum oocysts and treated with either anti-IFN- mAb or anti-IL-4 mAb (data not shown). A stimulation index <0 in uninfected control mice after in vitro stimulation with C. parvum Ags indicates that IL-4 expression in CD4⁺ß⁺ lymphocytes from infected mice was C. parvum Ag specific (Fig. 4). Stimulation with ionomycin and PMA was included to show nonspecific IFN- and IL-4 cytokine production by CD4⁺ß⁺ lymphocytes (Fig. 4). This nonspecific stimulation resulted in a stimulation index of >2 for IFN- and IL-4.

View larger version (23K): [in this window] [in a new window]   FIGURE 4. PP and IE lymphocyte response to recall Ag and nonspecific stimulation 23 days post-C. parvum inoculation. Lymphocytes from PP and IE were pooled from five mice in each group. Pooled PP and IE lymphocytes from naive (uninfected) untreated mice and C. parvum-infected mice treated with isotype control mAb were stimulated with C. parvum Ags or PMA plus ionomycin. The mean percentage of fluorescent cells was determined by intracytoplasmic staining for cytokine and was evaluated by flow cytometry. An asterisk over the column indicates a stimulation index of >2 after in vitro stimulation with C. parvum Ags.

To further investigate the relevance of CD4⁺ß⁺IL-4⁺ lymphocytes in the resolution of C. parvum infection in an adult C57BL/6 mouse model, initial experiments evaluated C. parvum infection in intestines from adult C57BL/6 IL-4 GKO (IL-4^-/-) mice at 30 days post-oocyst inoculation. C. parvum intestinal infection scores in IL-4^-/- mice were significantly greater than those in IL-4^+/+ mice (p = 0.004) (Table II). C. parvum organisms were consistently seen in the jejunum and ileum of IL-4^-/- mice, but were inconsistently seen in the pylorus, duodenum, cecum, and colon. No organisms were found in the intestines of IL-4^+/+ mice. Although C. parvum organisms were present in the epithelium of IL-4^-/- mice, intestinal sections lacked significant pathologic changes indicative of the resolution phase of infection. In a separate experiment to determine whether the severity of prolonged C. parvum infection in IL-4^-/- mice on day 30 could be increased by blocking the early protective effect of IFN-, IL-4^-/- and IL-4^+/+ mice were treated with anti-IFN- mAb. This treatment caused significantly higher C. parvum infection scores on day 30 in IL-4^-/- mice colon compared with those in anti-IFN- mAb treated IL-4^+/+ mice (Table II). IL-4^-/- mice had substantial numbers of organisms, and histopathologic changes were seen in the pylorus, duodenum, jejunum, ileum, and colon. The changes included crypt abscessation, epithelial hyperplasia, villus blunting, villus thickening, and infiltration of eosinophils, neutrophils, lymphocytes, and plasma cells in the LP. These observations demonstrated that C. parvum infection in adult C57BL/6 IL-4^-/- mice could be made more severe on day 30 by blocking the early protective effect of IFN- by anti-IFN- mAb treatment.

View larger version (17K): [in this window] [in a new window]   FIGURE 5. CD4+ß+IFN-+ and CD4+ß+IL-4+ lymphocyte numbers in PP and IE on day 30 post-C. parvum inoculation for the IL-4-/- and IL-4+/+ mouse groups. The U represents uninfected control mice and shows the baseline level of IFN- and IL-4 expression in CD4+ß+ lymphocytes. The I represents C. parvum-infected mice. The columns represent the mean number of lymphocytes ± SD x 104 for four or five mice, and the vertical lines on the columns are the SD. Statistical comparisons of either CD4+ß+IFN-+ or CD4+ß+IL-4+ lymphocyte numbers in the uninfected mouse group and the infected mouse group were made using the Mann-Whitney rank-sum test. p < 0.05 are indicated by an asterisk over the column and were considered significant. Comparisons of CD4+ß+IFN-+ lymphocytes in infected IL-4+/+ and infected IL-4-/- mice resulted in no significant differences. Similar results were observed in a repeat experiment.

To determine the duration of the prolonged infection in adult IL-4^-/- mice, C. parvum-infected IL-4^+/+ and IL-4^-/- mice were monitored over a 60-day period (Fig. 6). Oocyst excretion in IL-4^-/- mice was not significantly different from that in IL-4^+/+ mice on days 4 to 7 post-oocyst inoculation (Fig. 6A). However, oocyst excretion between days 8 to 30 postinoculation was significantly higher in feces from IL-4^-/- mice than in those from IL-4^+/+ mice (Fig. 6). Oocyst excretion became undetectable in feces from IL-4^+/+ mice on day 12 and in feces from IL-4^-/- mice on day 35 (Fig. 6A). These observations demonstrated that IL-4^-/- mice remained infected with C. parvum for at least 23 days longer than IL-4^+/+ mice. Nonetheless, IL-4^-/- mice resolved infection by day 35 postinoculation.

View larger version (27K): [in this window] [in a new window]   FIGURE 6. C. parvum oocyst excretion in five adult C57BL/6 mice (IL-4+/+) and five adult C57BL/6 IL-4 GKO (IL-4-/-) mice receiving no treatment (A) or anti-IFN- mAb treatment (B). Oocyst counts and inoculum are described in Figure 1. The symbols (• indicates IL-4+/+ group and indicates IL-4-/- group) represent the mean number of excreted oocysts per gram of feces on a given day, and the vertical bars on each symbol are the SD. Note the change in scale on the y-axis of A and B.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
In this work, adult C57BL/6 mouse models were used to confirm the role of IFN- in limiting the severity of early C. parvum infection. A new finding was the documentation of an important role for IL-4 in the early resolution of C. parvum infection in mice treated with anti-IL-4 mAb and in IL-4^-/- mice. Even though an early role for IFN- and subsequent roles for IFN- and IL-4 were demonstrated in protective immunity, neither was required for CD4⁺ß⁺ lymphocytes to eventually resolve C. parvum infection.

Blocking IFN- by mAb treatment resulted in a more severe early C. parvum infection in adult C57BL/6 mice. The demonstration that IFN- was necessary to limit severity of infection in adult C57BL/6 mice corroborated the results of similar experiments using anti-IFN- mAb treatment in adult BALB/c mice (4). In addition, we found that significantly lower oocyst excretion in isotype control mAb-treated C57BL/6 mice on day 9 post-oocyst inoculation was associated with increased numbers of CD4⁺ß⁺IFN-⁺ lymphocytes in both IE and PP compartments. Of interest, increased numbers of CD4⁺ß⁺IFN-⁺ lymphocytes also occurred in both IE and PP compartments in anti-IFN- mAb-treated mice. It was assumed that this accumulation of intracellular IFN- was a compensatory response to blocking extracellular IFN- with mAb or possibly that blocking IFN- by mAb treatment was ineffective at the gut level. That the anti-IFN- mAb treatment had an in vivo blocking effect on IFN- was demonstrated by the increase in severity of the gut infection in these treated mice and by the ability of mAb in sera taken from these treated mice to block IFN- in the sandwich ELISA. The early effect of IFN-, which limits C. parvum infection, may result from several general mechanisms (20), including 1) activation of macrophages, 2) increased MHC class II expression on APC, 3) induction of nitric oxide synthase and nitric oxide synthesis, 4) activation of NK cells, 5) specific cytotoxic responses, and 6) B cells switching to IgG2a. In vitro studies suggest that IFN- may also mediate early protection by inhibition of parasite replication in the epithelium. Specifically, IFN- has been shown to inhibit Toxoplasma gondii replication in a dose-dependent manner in a rat intestinal cell line IEC6 (21), and similar inhibition in a human fibroblast cell line (22) was due to induction of indolamine 2,3-dioxygenase and depletion of tryptophan (23, 24). IFN- may also alter the intestinal epithelium by decreasing chloride ion secretion and increasing ß₂ integrin-dependent neutrophil adhesion and MHC class II expression (25), resulting in resistance to penetration by C. parvum sporozoites or merozoites.

IFN- was not necessary for resolution of an established C. parvum infection in adult C57BL/6 mice treated with mAb to IFN-. Previous work using anti-IFN- mAb (1 mg/mouse/wk) treatment of adult BALB/c mice indicated that recovery from a severe self-limited C. parvum infection was independent of IFN- (4). We determined that adult C57BL/6 mice treated two or three times weekly with a higher dose (2 mg/mouse) of mAb to IFN- also resolved C. parvum infection. Our conclusion that resolution of infection was independent of IFN- was further confirmed by demonstrating that the amount and the sp. act. of the anti-IFN- mAb in sera from treated mice during high oocyst excretion on day 9 post-oocyst inoculation and in those from treated mice during low oocyst excretion on day 23 after inoculation were similar. Since blocking IFN- activity early allowed more severe infection on day 9, the same or a higher quantity of Ab with the same sp. act. should have blocked IFN- on day 23. This result indicated that some other mechanism was required for resolution of C. parvum infection in anti-IFN- mAb-treated C57BL/6 mice. These results are in contrast to those obtained in adult C57BL/6 IFN- GKO mice, which have a severe acute C. parvum infection with mucosal destruction and die as early as 2 wk post-oocyst inoculation (10). It is difficult to assess whether mechanisms other than IFN- could resolve C. parvum infection in adult C57BL/6 GKO mice because of the early death in these mice. The reason for the early death of C. parvum-infected adult GKO mice is not known, but may be due to the severity of immunologic defects present in these mice, including reduced MHC class II expression on macrophages, impaired ability of macrophages to make nitrogen intermediates, uncontrolled proliferative responses in splenocytes, enhanced T cell CTL activity, and decreased resting splenic NK cell activity (20, 26, 27, 28). Cumulative immune defects in adult C57BL/6 GKO mice deficient in IFN- since conception may be more severe than the immune defects caused by 4 wk of anti-IFN- mAb treatment in adult immunocompetent C57BL/6 mice. Even though rigorousanti-IFN- mAb treatment indicated that a depletion of IFN- alone was insufficient to block eventual recovery, some residual IFN--mediated effector mechanisms may have remained and contributed to resolution of C. parvum infection. However, the presence of similar numbers of Th1 lymphocytes in IL-4^-/- mice (which were unable to resolve C. parvum infection on day 30) and in IL-4^+/+ mice (which resolved C. parvum infection on day 30) suggests that Th1 have no role or a limited role in resolution. In addition, IL-12 treatment, which has an IFN--dependent protective effect, failed to ameliorate established C. parvum infections in neonatal immunocompetent and neonatal immunodeficient mice, supporting the lack of IFN-- and IFN--dependent effector mechanisms in this resolution (29). Further, inability of recombinant IFN- treatment to significantly reduce C. parvum infection in the large intestines and biliary tract of immunosuppressed rats also indicates that some mechanism other than IFN- resolves C. parvum infection (30).

In adult immunodeficient mouse models, a role for IFN- and IFN--mediated effects such as nitric oxide in the control of C. parvum infection was demonstrated in a number of experiments, but none of these experiments provided conclusive evidence for a role for IFN- in resolution of C. parvum infection. C. parvum infection in congenitally athymic nude adult mice was enhanced after anti-IFN- mAb treatment and remained severe after stopping the treatment (4). Administration of the nitric oxide inhibitor, N-nitro-L-arginine methyl ester, enhanced oocyst excretion in congenitally athymic nude adult mice (31). Treatment of SCID mice with anti-IFN- mAb caused enhanced C. parvum infection at 3 wk compared with that in control SCID mice (32). However, it is difficult to assess the role of IFN- in the resolution of C. parvum infection in immunodeficient mouse models that lack functional CD4⁺ lymphocytes, such as SCID mice and congenitally athymic nude mice, because it is known that CD4⁺ T lymphocytes are required for recovery (4, 6). In other experiments, C. parvum infection was not resolved in 17 days in SCID mice reconstituted with spleen cells depleted of 1) CD4⁺ T cells, 2) IFN-, and 3) both CD4⁺ T cells and IFN- (9). The conclusion made that IFN- was required to resolve C. parvum infection in these reconstituted SCID mice may have been different if the mice had been observed for longer periods, as in this study.

A prolonged, but self-limited, C. parvum infection in IL-4-deficient adult C57BL/6 mice was associated with normal Th1 responses in gut lymphocytes. Depletion of IL-4 by mAb treatment did not cause early enhanced oocyst excretion in adult C57BL/6 mice, as was seen with anti-IFN- mAb treatment, but did allow oocyst excretion to persist in feces at least 11 days longer than in isotype control mAb-treated mice. Similarly, C. parvum oocyst excretion in IL-4^-/- mice persisted 23 days longer than that in IL-4^+/+ mice. Further, IL-4^-/- mice and IL-4^+/+ mice had the same number of CD4⁺ß⁺IFN-⁺ lymphocytes in IE and PP on day 30 postinoculation, yet C. parvum organisms were present in the intestinal epithelium of IL-4^-/- mice and not in IL-4^+/+ mice. These observations demonstrated the importance of IL-4 in preventing a prolonged C. parvum infection. Unlike other infections in IL-4^-/- mice, a deficient Th1 response seen with T. gondi (33) or Leishmania major (34) or an exacerbated Th1 response seen in Mycobacterium bovis granulomas (35) was not seen in PP and IE lymphocytes of IL-4^-/- mice on day 30 post-C. parvum oocyst inoculation. Therefore, extension of the time needed for the IL-4^-/- mice to resolve C. parvum infection was attributed to a deficiency of IL-4 production.

Eventual resolution of infection in IL-4^-/- mice, with or without anti-IFN- mAb treatment, demonstrated that neither IL-4 nor IFN- was required for recovery. One explanation for resolution of the infection in these mice may still involve a Th2 response, because IL-4 is often only one of multiple signals that can induce redundant Th2 protective effects. IL-9 (36, 37) and IL-13 (38) can mimic or enhance some of the effects of IL-4. IL-4 may decrease time to recovery from C. parvum infection through its ability to drive Th2 differentiation (39, 40), cause multiple effects on the immune system, and influence gut physiology (41). Information regarding surrogate Th2 cytokine expression, such as IL-9 or IL-13, in IL-4^-/-mice is still incomplete (35, 42, 43). Even though Th2 mechanisms in the absence of IL-4 are plausible explanations for eventual resolution of C. parvum infection in IL-4^-/- mice, our findings do not discriminate between this explanation and the possibility of other Th1 mechanisms in the absence of IFN-.

Another possible explanation for the ability of IL-4^-/- mice to eventually resolve C. parvum infection is a mucosal Ab response. The gut contains high levels of IgA-producing plasma cells, and IgA can be transported across the epithelium into the gut lumen to prevent invasion of micro-organisms (8, 44, 45). IL-4^-/- mice have been shown to have normal serum levels of IgA, indicating that IL-4 has no obligatory role in differentiation of B lymphocytes to IgA-producing plasma cells (42). Other evidence for a role for Ab includes in vitro studies with human mAb specific to C. parvum, which inhibited C. parvum infection of human enterocyte lines (46), and passive administration of Ab in the form of hyperimmune bovine serum or C. parvum-neutralizing mAb, which had beneficial effects against C. parvum challenge in mice (13, 47, 48, 49) and caused clinical improvement in C. parvum-infected AIDS patients (50, 51). However, an argument against a singular role for Ab is provided by the recovery of B cell-depleted BALB/c mice from C. parvum infection (52).

Our study provided other intriguing findings that should be addressed. As might be predicted, removal of extracellular IFN- increased the numbers of CD4⁺ß⁺IL-4⁺ lymphocytes almost 10-fold in IE on day 9 compared with that in isotype control mice, consistent with Th1 and Th2 cross-regulation (8). Similarly, removal of extracellular IL-4 increased the number of CD4⁺ß⁺IFN-⁺ lymphocytes almost 3-fold in IE on day 9 compared with that in isotype control mice. However, removal of extracellular IFN- or IL-4 unexpectedly caused 2- and 3-fold increases in CD4⁺ß⁺IFN-⁺ and CD4⁺ß⁺IL-4⁺ lymphocytes, respectively, in the IE on day 9. In contrast, removal of extracellular IFN- did not affect CD4⁺ß⁺IFN-⁺ lymphocytes in PP on day 9, and removal of IL-4 caused an almost 4-fold increase in CD4⁺ß⁺IL-4⁺ lymphocytes in PP on day 9. The above observations suggest that IFN- and IL-4 expression are regulated differently in these gut compartments.

The protective immune functions we described for both IFN- and IL-4 in C. parvum infection occur in a similar manner for some other intracellular protozoal infections as well. Neutralization of endogenous IFN- by mAb treatment impairs, but does not completely abrogate, protective immunity in Plasmodium chaubaudi infection (53). Also, IL-4 deficiency did not block control of primary infection in P. chaubaudi, but did enhance later recrudescent parasitemia (54). Neutralization of IFN- by mAb treatment blocked acute resistance to T. gondii infection (55), while deficiency of IL-4 caused fatal T. gondii-induced encephalitis in IL-4^-/- C57BL/6 mice (33). Production of IFN- is associated with control of L. major infections in resistant mouse strains (56), while defective Th1 (34) or IL-4 deficiency prevented clearance of L. major organisms in adult IL-4^-/- BALB/c mice (57). Therefore, IL-4 may play a role in host protective immunity to certain intracellular protozoa in which IFN- also has a documented role. Elucidation of redundant immune mechanisms induced by C. parvum at the site of infection and a better understanding of cytokine signals involved in the Th1 and Th2 responses will help define the mechanism(s) that CD4⁺ß⁺ lymphocytes use to finally resolve C. parvum infection.

In summary, new evidence for the role of IL-4 in protective immunity in adult C57BL/6 mice against C. parvum was based on the following: 1) CD4⁺ß⁺IL-4⁺ lymphocyte numbers increased in IE and PP of mice during the resolution phase of infection; 2) blocking IL-4 by mAb treatment in adult mice prolonged oocyst excretion in feces at least 11 days longer than that in isotype control mAb treated mice; and 3) genetic deficiency of IL-4 in C57BL/6 mice prolonged oocyst excretion approximately 23 days longer than that in IL-4-intact (IL-4^+/+) mice. Even though our results demonstrated an important role for both IFN- and IL-4 in the early termination of C. parvum infection in immunocompetent and IL-4^-/- C57BL/6 mouse models, recovery of these mice from C. parvum infection occurred independent of both IFN- and IL-4. Since it is known that CD4⁺ß⁺ lymphocytes are required to terminate C. parvum infection and that Th1 and Th2 immune responses can be stimulated by more than one cytokine pathway, studies aimed at dissection of surrogate Th1 and Th2 cytokine mechanisms are warranted.

	Acknowledgments

 
We thank Doug Jasmer and Phil Cheevers for critical review of the manuscript and helpful discussions.

	Footnotes

 
¹ This work was supported by National Institutes of Health-Pathobiology Training Grant AI07367, the Department of Microbiology and Pathology of Washington State University, and Animal Health Formula Funds from Washington State University.

² Address all correspondence and reprint requests to Dr. Shirley A. Aguirre, Department of Microbiology and Immunology, D331 Fairchild Science Building, Stanford University School of Medicine, Stanford, CA 94305. E-mail address:

³ Abbreviations used in this paper: GKO, gene knockout; GALT, gut-associated lympoid tissue; PP, Peyer’s patches; IE, intraepithelium; LP, lamina propria; RPE, R-phycoerythrin.

Received for publication January 13, 1998. Accepted for publication April 16, 1998.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Fayer, R.. 1997. Cryptosporidium and Cryptosporidiosis CRC, Boca Raton, FL.
2. Guerrant, R. L.. 1997. Cryptosporidiosis: an emerging, highly infectious threat. Emerg. Infect. Dis. 3:51.[Medline]
3. Meinhardt, P. L., D. P. Casemore, K. B. Miller. 1996. Epidemiologic aspects of human cryptosporidiosis and the role of waterborne transmission. Epidemiol. Rev. 18:118.[Free Full Text]
4. Ungar, B. L., T. C. Kao, J. A. Burris, F. D. Finkelman. 1991. Cryptosporidium infection in an adult mouse model: independent roles for IFN- and CD4⁺ T lymphocytes in protective immunity. J. Immunol. 147:1014.[Abstract]
5. Perryman, L. E., P. H. Mason, C. E. Chrisp. 1994. Effect of spleen cell populations on resolution of Cryptosporidium parvum infection in SCID mice. Infect. Immun. 62:1474.[Abstract/Free Full Text]
6. Aguirre, S. A., P. H. Mason, L. E. Perryman. 1994. Susceptibility of major histocompatibility complex (MHC) class I- and MHC class II-deficient mice to Cryptosporidium parvum infection. Infect. Immun. 62:697.[Abstract/Free Full Text]
7. Waters, W. R., J. A. Harp. 1996. Cryptosporidium parvum infection in T-cell receptor (TCR)-- and TCR--deficient mice. Infect. Immun. 64:1854.
8. Mosmann, T. R., R. L. Coffman. 1989. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7:145.[Medline]
9. Chen, W., J. A. Harp, A. G. Harmsen. 1993. Requirements for CD4⁺ cells and interferon in resolution of established Cryptosporidium parvum infection in mice. Infect. Immun. 61:3928.[Abstract/Free Full Text]
10. Theodos, C. M., K. L. Sullivan, J. K. Griffiths, S. Tzipori. 1997. Profiles of healing and nonhealing Cryptosporidium parvum infection in C57BL/6 mice with functional B and T lymphocytes: the extent of interferon modulation determines the outcome of infection. Infect. Immun. 65:4761.[Abstract]
11. Ogra, P. L., M. E. Lamm, J. R. McGhee, J. Mestecky, W. Strober, J. Bienenstock. 1994. Handbook of Mucosal Immunology Academic Press, San Diego.
12. Kuhn, R., K. Rajewsky, W. Muller. 1991. Generation and analysis of interleukin-4 deficient mice. Science 254:707.[Abstract/Free Full Text]
13. Perryman, L. E., K. A. Kegerris, P. H. Mason. 1993. Effect of orally administered mAb on persistent Cryptosporidium parvum infection in scid mice. Infect. Immun. 61:4906.[Abstract/Free Full Text]
14. Riggs, M. W., L. E. Perryman. 1987. Infectivity and neutralization of Cryptosporidium parvum sporozoites. Infect. Immun. 55:2081.[Abstract/Free Full Text]
15. Savelkoul, H. F., A. C. Vossen, E. G. Breedland, G. J. Tibbe. 1994. Semi-preparative purification and validation of monoclonal antibodies for immunotherapy in mice. J. Immunol. Methods 172:33.[Medline]
16. Darby, C. R., K. Hamano, K. J. Wood. 1993. Purification of monoclonal antibodies from tissue culture medium depleted of IgG. J. Immunol. Methods 159:125.[Medline]
17. Jung, T., U. Schauer, C. Heusser, C. Neumann, C. Rieger. 1993. Detection of intracellular cytokines by flow cytometry. J. Immunol. Methods 159:197.[Medline]
18. Sander, B., J. Andersson, U. Andersson. 1991. Assessment of cytokines by immunofluorescence and the paraformaldehyde-saponin procedure. Immunol. Rev. 119:65.[Medline]
19. Taguchi, T., J. R. McGhee, R. L. Coffman, K. W. Beagley, J. H. Eldridge, K. Takatsu, H. Kiyono. 1990. Analysis of Th1 and Th2 cells in murine gut-associated tissues: frequencies of CD4⁺ and CD8⁺ T cells that secrete IFN- and IL-5. J. Immunol. 145:68.[Abstract]
20. Boehm, U., T. Klamp, M. Groot, J. C. Howard. 1997. Cellular responses to interferon-. Annu. Rev. Immunol. 15:749.[Medline]
21. Dimier, I. H., D. T. Bout. 1993. Rat intestinal epithelial cell line IEC-6 is activated by recombinant interferon- to inhibit replication of the coccidian Toxoplasma gondii. Eur. J. Immunol. 23:981.[Medline]
22. Pfefferkorn, E. R., P. M. Guyre. 1984. Inhibition of growth of Toxoplasma gondii in cultured fibroblasts by human recombinant interferon. Infect. Immun. 44:211.[Abstract/Free Full Text]
23. Gupta, S. L., J. M. Carlin, P. Pyati, W. Dai, E. R. Pfefferkorn, Jr M. J. Murphy. 1994. Antiparasitic and antiproliferative effects of indoleamine 2,3- dioxygenase enzyme expression in human fibroblasts. Infect. Immun. 62:2277.[Abstract/Free Full Text]
24. Pfefferkorn, E. R.. 1984. Interferon blocks the growth of Toxoplasma gondii in human fibroblasts by inducing the host cells to degrade tryptophan. Proc. Natl. Acad. Sci. USA 81:908.[Abstract/Free Full Text]
25. Colgan, S. P., C. A. Parkos, J. B. Matthews, D. A. L. , C. S. Awtrey, A. H. Lichtman, C. Delp, -A rcher, J. L. Madara. 1994. Interferon- induces a cell surface phenotype switch on T84 intestinal epithelial cells. Am. J. Physiol. 267:C402.[Abstract/Free Full Text]
26. Dalton, D. K., S. Pitts-Meek, S. Keshav, I. S. Figari, A. Bradley, T. A. Stewart. 1993. Multiple defects of immune cell function in mice with disrupted interferon- genes. Science 259:1739.[Abstract/Free Full Text]
27. Flynn, J. L., J. Chan, K. J. Triebold, D. K. Dalton, T. A. Stewart, B. R. Bloom. 1993. An essential role for interferon in resistance to Mycobacterium tuberculosis infection. J. Exp. Med. 178:2249.[Abstract/Free Full Text]
28. Graham, M. B., D. K. Dalton, D. Giltinan, V. L. Braciale, T. A. Stewart, T. J. Braciale. 1993. Response to influenza infection in mice with a targeted disruption in the interferon gene. J. Exp. Med. 178:1725.[Abstract/Free Full Text]
29. Jr Urban, J. F., R. Fayer, S. J. Chen, W. C. Gause, M. K. Gately, F. D. Finkelman. 1996. IL-12 protects immunocompetent and immunodeficient neonatal mice against infection with Cryptosporidium parvum. J. Immunol. 156:263.