|
|
||||||||


*
Therapeutic Immunology Group, Sir William Dunn School of Pathology, Oxford, United Kingdom;
National Institute for Medical Research, Division of Molecular Immunology, London, United Kingdom.
| Abstract |
|---|
|
|
|---|
10 TCR genes from a T cell clone that is
specific for the male Ag (H-Y) in the context of H2-Ek. In
addition, the RAG-1-/- background was bred onto these
mice to eliminate any endogenous TCR rearrangements. As expected,
clonal deletion was found to be complete in the thymus of male
A1(M)xRAG-1-/- mice, while only CD4+
T cells were positively selected and found in the periphery of females.
Female A1(M)xRAG-1-/- mice were able to rapidly reject
(in <14 days) male (but not female) skin grafts in a CD4-dependent
fashion. After multiple grafts, it was confirmed that no
CD8+ T cells or surface Ig+ B cells were
present. An immunofluorescent analysis of spleen cells after grafting
showed that the majority of T cells expressed activation markers (CD44,
CD25, and intracytoplasmic IL-2) and a significant proportion were
making IFN-
and IL-4. Surprisingly, the transfer of either Th1 or
Th2 CD4+ T cell lines from these mice into T cell-depleted
recipients was sufficient to cause a specific rejection of male
skin. | Introduction |
|---|
|
|
|---|
One of the main functions of CD4+ T cells is to provide help for the development of both cytotoxic T cells and B cells. It has been shown that the rejection of minor transplantation Ags is particularly dependent upon help; one example of the need for such help is that the participation of both CD4+ (anti-H-Y) and CD8+ (anti-Qa1) T cells is essential for rapid rejection in normal mice (9). Similarly, CD4+ T cells is generally required to elicit both graft rejection and the priming of CD8+ CTLs against both multiple (10) and "single" (11) minor transplantation Ag differences. Indeed, the so-called single minor transplantation Ags, such as the male Ag H-Y, are thought to be coded by small clusters of genes that provide multiple MHC class II and class I epitopes (for presentation mainly to CD4+ and CD8+ cells, respectively); in turn, these epitopes provide sufficient helper and effector activity, resulting in graft rejection (12, 13, 14). A dependence upon help is also seen when CD8+ T cells alone reject single (mutant) MHC class I differences, as this rejection is only observed when the frequency of IL-2producing CD8+ cells is particularly high (15, 16).
The question arises as to whether CD4+ cells are only required to provide help or whether they can act to reject independently of CD8+ cells, as was originally suggested from the CD4 and CD8 depletion studies (1, 6) and experiments in which the adoptive transfer of purified CD4+ T cells into nude mice was sufficient to reject MHC class II-mismatched skin (17). This question has been addressed in CD8-depleted mice that can reject MHC class I allogeneic or mutant skin. This situation is in some ways analogous to a single peptide "epitope" of a minor transplantation Ag, because the MHC class I can be processed to a peptide that is indirectly presented to CD4+ T cells by the MHC class II of recipient APCs (18, 19, 20). However, it remains unclear whether Ab to the intact MHC class I molecules on the graft (20, 21, 22) or a direct (i.e., CD4-independent) recognition of MHC class I (23) is also involved in these experiments. Experiments that have used mice in which there is no MHC class I expression to promote the development of CD8+ cells have also failed to resolve the mechanisms of graft rejection; it now seems that MHC class I-restricted, cytotoxic cells can still be generated when mice are challenged with allogeneic skin or MHC class I-expressing tumor cells (24, 25). Similarly, although CD8-/- mice normally reject MHC-incompatible skin and CD4-/- mice have been found to accept such grafts indefinitely (26), this finding is confounded by the observation that mice that express neither CD4 nor CD8 can still reject allogeneic (but not minor-mismatched) skin effectively (27), although it has been shown that purified CD4+ cells from CD8-/- mice can indeed reject either MHC class I or MHC class II disparate skin after transfer to nude recipients (28).
In addition, there is the question of whether graft rejection is
mediated by the specialization of CD4+ or CD8+
T cells expressing different patterns of cytokines, as is seen in the
Th1 or Th2 subsets. It has been suggested for both graft rejection and
some autoimmune models that the effector cells should have a Th1
(IFN-
and IL-2) phenotype, while Th2 responses (IL-4 and IL-10)
might be protective or regulatory (29, 30). However, there is recent
data that suggest that, under some circumstances, CD4+ Th2
cells may also be able to induce autoimmune diseases (31, 32) or reject
cardiac allografts (33, 34, 35).
We have taken the approach of generating mice that carry only a single transgenic TCR against the male minor transplantation Ag in the context of MHC class II (H-Y+ H2-Ek). We show that these mice are able to rapidly reject male, but not female, skin grafts. The RAG-1-/- background makes it possible to rule out any potential involvement of endogenous TCRs that might have allowed the recognition of Ag in the context of MHC class I and also any involvement of B cells or Ab. The female recipients also showed an absolute positive selection of transgenic TCR-positive cells into the CD4 compartment (and complete thymic deletion in the males); therefore, CD8+ T cells can be further ruled out. In addition, we generated Th1 and Th2 lines from these mice, and found that both were able to elicit male skin graft rejection after transfer into T cell-depleted recipients. To our knowledge, this provides the first direct evidence that all of the T cell functionality that is required for the skin graft rejection of a minor transplantation Ag can be provided by either Th1 or Th2 CD4+ cells.
| Materials and Methods |
|---|
|
|
|---|
CBA/Ca (Harlan/Olac, Bicester, U.K.) mice were bred under specific pathogen-free conditions, and all experimental mice were maintained in the animal facility of the Sir William Dunn School of Pathology (Oxford, U.K.) in a filtered cage system (Maximizer, Thorens Caging, Hazelton, PA). RAG-1-/- mice that had been bred onto an H-2k background were obtained from Dr. B. Stockinger (National Institute of Medical Research, London, U.K.).
Generation of A1(M) transgenic mice
To generate transgenic mice, we used the TCR
- and
ß-chain from the A1 CD4+ T cell clone that had been
isolated from CBA/Ca mice (Ref. 36 and our unpublished
observations). The A1 clone recognizes the minor
histocompatibility Ag H-Y, which is present in male mice but absent in
female mice, in the context of H2-Ek. TCR expression was
identified using primers that were specific for the V
and Vß gene
families (37); the TCR genes were cloned and sequenced to check for
productive rearrangement. The
-chain was found to be encoded by
LV
10-J
30-C
, and the ß-chain was encoded by
LVß5.1-Vß8.2-Dß2-Jß2.3-Cß2 (EMBL accession nos. AJ000157 and
AJ000158, respectively). EcoRI-EcoRI fragments
containing the productively rearranged
- or ß-chains were
generated by RT-PCR. The oligonucleotides used for the amplification of
the
-chain were GCGAATCACAAGCACCATGAAGAGGCTG and
GCGAATTCCAGACCTCAACTGGACCACAG. The oligonucleotides used for the
amplification of the ß-chain were GCGAATTCAGAGGAAGCATGTCTAACACT
and GCGAATTCAGGATGCATAAAAGTTTGTCTCAGG. The full-length cDNAs were
cloned into the human CD2 minigene (VA) in pBluescript (Dr. D.
Kioussis, National Institute of Medical Research, London, U.K.).
SalI-XbaI fragments were used for microinjections
into CBA/Ca oocytes. Transgenic A1(M) founders were maintained on the
CBA/Ca background and bred to homozygosity. Southern blot analysis
indicated that the A1(M) line carried a single copy per haplotype of
each of the transgenic V
- and ß-chains.
Skin grafting
Pieces of tail skin that were
0.5 cm2 were
grafted onto the lateral thoracic wall of anesthetized recipient mice
as described previously (1, 2). When two grafts were given
simultaneously, they were placed side by side in the same prepared
graft bed. Plaster casts were removed on day 7, and the grafts were
observed daily; rejection was defined as the day when no viable graft
tissue could be seen. Statistical significance was determined using the
log rank method (38). All procedures were conducted in accordance with
the U.K. Home Office Animals (Scientific Procedures) Act of
1986.
Immunofluorescent analysis and Abs
The thymus, spleen, or lymph nodes were removed, and E were
lysed by isotonic shock. Cells were labeled in PBS containing 0.1%
(w/v) NaN3, 1% (w/v) BSA, and 5% (v/v) heat-inactivated
normal rabbit serum (to block FcRs) at 4°C. The Abs used were: CD3
(KT3-FITC), Vß8 (KJ16-FITC), Vß8.2 (F23.2-FITC), CD4-phycoerythrin
(PE)5 (P2942; Sigma, St. Louis, MO), CD8
-quantum red
(QR) (R3762; Sigma), B220-QR (R4262; Sigma), CD25 (PC61-biotin),
CD44-QR (R5638; Sigma), streptavidin-APC (13049A; PharMingen,
San Diego, CA), and FITC goat anti-mouse IgG (F0257; Sigma).
After labeling and washing, cells were fixed in 1% formalin and stored
in the dark at 4°C. Four-color analysis was performed using a FACSort
(Becton Dickinson, Oxford, U.K.) with dual laser (488 nm and 633 nm)
excitation in combination with data acquisition and cross-beam color
compensation using CellQuest 3.1 software. At least 50,000 events were
stored in list mode for further analysis and gating on forward and side
scatters.
Intracytoplasmic cytokine staining was performed using spleen cells
that had been given a 4-h stimulation in vitro with 50 ng/ml PMA
(P8139; Sigma) plus 500 ng/ml ionomycin (I0634; Sigma) in phenol
red-free RPMI 1640 medium plus 10% FCS at 37°C with the addition of
10 µg/ml brefeldin A (B7651; Sigma) added to the spleen cells for the
second 2 h (39). After washing, cells were fixed in 2% v/v
formaldehyde in PBS for 20 min at 4°C, washed, and permeabilized with
PBS plus 0.5% saponin (S-2149; Sigma). The following Ab conjugates
were added in saponin buffer for 30 min at 4°C: anti-IL-2
(S4B6-FITC) (18004A; PharMingen), anti-IL-4 (11B11-FITC) (18194A;
PharMingen), anti-IFN-
(XMG1.2-FITC) (18114A; PharMingen. The
cells were extensively washed in saponin buffer followed by PBS plus
0.1% azide plus 1% BSA plus 5% heat-inactivated normal rabbit serum.
Cells were finally labeled with Abs to surface CD4 and CD44, fixed in
1% formalin, and analyzed on a FACSort as described above.
The conditions of stimulation, staining, and analysis were such that
normal CBA/Ca CD4+ spleen cells were essentially negative
for all cytokine stains.
Treatment with CD4 mAb
The nondepleting rat IgG2a anti-mouse CD4 mAb (YTS 177.9 (2)) was made by growing the hybridoma in a hollow fiber bioreactor and was purified under sterile and low endotoxin conditions by precipitation with 50% saturated ammonium sulfate (see the following Internet address: http://www.molbiol.ox.ac.uk/pathology/tig/mprod.html). Starting on the day of grafting, grafted A1(M)xRAG-1-/- mice were given 5 x 1 mg of mAb i.p. over a 2-wk period.
Generation of Th1 and Th2 lines
Spleen cells were taken from an A1(M)xRAG-1-/-
mouse that had been grafted 7 days earlier with male plus female tail
skin, and 0.5 x 106 cells were cultured together with
5 x 106 mitomycin C-treated male CBA/Ca stimulators
in 2 ml RPMI 1640 and 10% FCS plus either 50 U/ml of human
rIL-2 (to generate the R2.2 Th1 line) or 200 U/ml of mouse rIL-4 (to
generate the R2.4 Th2 line). These cell lines were maintained by
restimulation with male cells in the appropriate cytokine at 2-wk
intervals. Cytokine production and specificity were checked using
[3H]thymidine incorporation, IFN-
- and IL-4-specific
ELISAs (PharMingen), and intracytoplasmic staining as described above.
To determine whether these lines could reject male skin grafts,
107 viable (histopaque 1083; Sigma) Th1 or Th2 cells were
injected i.v. at 10 days after the last in vitro restimulation into
adult thymectomized (ATX), T cell-depleted (with depleting CD4 plus CD8
mAbs (29)) female CBA/Ca mice that had been given a male plus a female
skin graft in the same bed.
| Results and Discussion |
|---|
|
|
|---|
The thymus, spleens, and lymph nodes from A1(M) mice were analyzed by three-color immunofluorescence to determine whether the expression of transgenic TCR would lead to the predicted functional modification of the T cell repertoire (data not shown). The thymi of female A1(M) mice were found to have a strong bias toward the generation of CD4+CD8- rather than CD8+CD4- T cells, as expected from an increased positive selection of the MHC class II-restricted anti-H-Y TCR. This bias led to a CD4/CD8 ratio in the peripheral lymphoid organs that was in excess of 10:1 and also to the expression of the Vß8.2 transgenic receptor on >90% of CD3+ cells. In contrast, male A1(M) mice had smaller thymi (0.75 ± 0.14 x 108 total thymocytes compared with 1.9 ± 0.23 x 108 at 7 wk of age in females), a mature CD4/CD8 ratio that was close to 1:1, and a similar expression of Vß8.2 to nontransgenic CBA/Ca mice, suggesting the clonal deletion of anti-H-Y-transgenic T cells and the escape of endogenous TCR rearrangements. These A1(M) mice were then crossed onto a RAG-1-/- background to eliminate all B cells and T cells expressing other TCR molecules encoded by endogenous TCR rearrangements, so that any ability of H-Y-specific CD4+ T cells to reject male skin grafts could be unambiguously identified.
Positive selection in female and negative selection in male A1(M)xRAG-1-/- mice
Immunofluorescent staining of A1(M)xRAG-1-/- mice
confirmed that the anti-H-Y TCR was functional, since positive
selection and the generation
CD3+CD4+CD8- thymocytes was only
observed in female thymi (Fig. 1
); male
thymi were much smaller, with very few
CD4+CD8- cells. When we looked in more detail
at these few CD4+CD8- cells, we found that
they were present in similar numbers in both male
A1(M)xRAG-1-/- mice and RAG-1-/- controls,
and that none of them expressed CD3 but were mostly CD11c+
(data not shown), suggesting that they may be related to
CD4+ immature dendritic cells (40) rather than to T cells
that have somehow escaped deletion. The staining of lymph nodes (Fig. 2
) confirmed that only CD4+
and not CD8+ T cells were present in female
A1(M)xRAG-1-/-, and that clonal deletion in the male
reduced the number of CD4+ cells down to the level seen in
RAG-1-/- mice (again, these were
CD3-CD11c+). The expression of the TCR in
female A1(M)xRAG-1-/-, as measured by CD3 (Fig. 2
) or
Vß8.2 (data not shown) staining, was lower than that seen in a normal
CBA/Ca mouse (
30% of the median fluorescence level) but was similar
to that of the A1(M) founders (data not shown), which may be a property
of the CD2 expression system (G. Stockinger, unpublished
observations).
|
|
In initial experiments in two laboratories, a total of eight
female A1(M)xRAG-1-/- mice were given single male skin
grafts, four of which were rapidly rejected (within 16 days); two
additional grafts were eventually rejected in a chronic fashion.
Subsequently, a group of five female A1(M)xRAG-1-/- mice
were simultaneously grafted with male and female CBA/Ca skin in the
same graft bed. All of the male grafts were rapidly rejected (within 14
days), while the female grafts remained perfectly healthy (Fig. 3
). A second group of five mice were
grafted in an identical fashion but were also treated with saturating
amounts of a mAb that blocks CD4 function in vivo. All these grafts
were accepted, proving that the rejection was both CD4-dependent and
male-specific. The experiment shown in Figure 3
has been repeated two
additional times with similar results; it is not clear why the mice in
the initial experiments rejected more slowly (although it might be
relevant that these mice were still heterozygous for the A1(M) TCR at
that time).
|
The A1(M)xRAG-1-/- mice should have no
CD8+ T cells or Ab-producing B cells that might be able to
act as effectors of graft rejection; the absence of these cells was
checked by staining spleen cells from two female
A1(M)xRAG-1-/- mice that had been allowed to reject two
sequential male grafts and had been grafted with a third male skin 7
days previously, such that if there was any hypothetical expansion of,
for example, a novel CD8+ population during graft
rejection, this expansion should become visible. However, it was
confirmed that there was no CD3+CD8+ staining
above background (Fig. 4
), and that CD25
expression was limited to the CD3+CD4+ subset
(data not shown). Similarly, there were no surface Ig+ B
cells that might have been able to contribute an Ab response (although
there is no convincing evidence that Ab responses are made to H-Y or to
other minor transplantation Ags in normal mice (41)). There was clear
evidence that the male graft was indeed being recognized by the
transgenic anti-male TCR on CD4+ T cells, as the
majority (
70%) of these could be categorized as memory or recently
activated cells (expressing CD44) and produced both IFN-
, and to a
lesser extent, IL-4 (Fig. 4
). All T cells (both CD44+ and
CD44-) appeared to be expressing IL-2 by this method of
intracytoplasmic staining.
|
The demonstration of staining for both IFN-
and IL-4 in the
spleen (Fig. 4
) and draining lymph nodes (similar data not shown) of
A1(M)xRAG-1-/- mice rejecting a male skin graft raised
the question of which of the CD4+ Th cell subsets (i.e.,
Th1 or Th2) were acting as effector cells. Skin graft rejection has
generally been thought of as a Th1-mediated process, while Th2
responses have been considered as nonpathogenic or even protective (29, 30). To test which of these subsets was responsible for this rejection,
we generated both Th1 and Th2 CD4+ T cell lines from a
skin-grafted A1(M)xRAG-1-/- mouse by repeated
stimulation in vitro with male spleen cells in the presence of either
IL-2 or IL-4 to promote Th1 or Th2 development, respectively. The Th1
and Th2 lines that were generated, which express the same transgenic A1
TCR (confirmed by Vß8.2 staining, data not shown), were found to be
specific for male, compared with female, syngeneic spleen cells in
terms of proliferation and appropriate cytokine production (Table I
); in addition, the lines were of a
stable phenotype even if restimulated in the presence of the
"opposite" cytokine (data not shown). Surprisingly, we found that
both the Th1 and Th2 lines were able to cause a rapid and specific
rejection of male skin after transfer into athymic, T cell-depleted
recipient mice (Fig. 5
), although the Th2
line rejected slightly slower with equivalent numbers of cells
transferred (p < 0.02). It should be noted
that male-specific skin graft rejection was also obtained in similar
experiments using a CD4+ Th2 clone from A1(M) female mice
(data not shown).
|
|
One limitation of the approach we have taken is that, while we observe that male skin grafts can be rejected by either Th1 or Th2 CD4+ T cells, this is in a situation in which the frequency of Ag-specific T cells is essentially 100%. In a normal mouse, the frequency of T cells that are specific for H-Y is significantly lower, and it may be important to determine the relative efficiency of rejection of different T cell subpopulations. This determination could be done by transferring various numbers of A1(M)xRAG-1-/- T cells or clones into male skin-grafted normal female CBA/Ca (as these are "nonresponders" to H-Y (12)), and preliminary experiments suggest that 107 Th1 cells (R2.2) but not an equal number of Th2 cells (R2.4) can reject male skin in this situation; a similar situation is seen after the transfer of autoimmune Th2 cells into intact mice (31, 32). However, until we have clones from mice that are fully backcrossed (the mice used in our study are only four generations from 129 x A/J and are therefore allogeneic to CBA/Ca), we cannot reliably determine the minimum number that can cause rejection in such immunocompetent chimeras.
While it is therefore clear that the transgenic TCR+CD4+ T cells in A1(M)xRAG-1-/- females are sufficient to reject male skin, it remains to be determined whether this rejection is due to CD4+ T cell-mediated cytotoxicity or to help for macrophages or another Ag-nonspecific effector cell. Recent data suggesting that neither Fas/FasL nor perforin (43) are required for the CD4-mediated rejection of MHC class I disparate skin would tend to favor the latter hypothesis. It also remains to be determined whether Th1 and Th2 CD4+ T cell subsets cause skin graft rejection by a common mechanism or whether they represent alternative routes to achieve the same end. Regardless of the mechanism, this result would seem to make it unlikely that deviating an immune response from Th1 to Th2 would be protective or therapeutic in the context of clinical transplantation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Institute of Molecular Medicine and Genetics, Medical College of Georgia, Augusta, GA 30912-2600. ![]()
3 Current address: Transplantation Biology Group, Clinical Sciences Centre, Imperial Colllege School of Medicine Hammersmith Hospital, Ducane Road, London W12 0NN, U.K. ![]()
4 Address correspondence and reprint requests to Dr. Stephen P. Cobbold, Therapeutic Immunology Group, Sir William Dunn School of Pathology, South Parks Road, Oxford OX1 3RE, U.K. E-mail address: ![]()
5 Abbreviations used in this paper: PE, phycoerythrin; QR, quantum red; ATX, thymectomized; MST, median survival time. ![]()
Received for publication February 4, 1998. Accepted for publication April 13, 1998.
| References |
|---|
|
|
|---|
and interleukin-4 in response to Th1- and Th2-stimulating pathogens by 
T cells in vivo. Nature 373:255.[Medline]
This article has been cited by other articles:
![]() |
W. F. N. Chan, H. Razavy, and C. C. Anderson Differential Susceptibility of Allogeneic Targets to Indirect CD4 Immunity Generates Split Tolerance J. Immunol., October 1, 2008; 181(7): 4603 - 4612. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Robertson, F. A. Brook, R. L. Gardner, S. P. Cobbold, H. Waldmann, and P. J. Fairchild Embryonic stem cell-derived tissues are immunogenic but their inherent immune privilege promotes the induction of tolerance PNAS, December 26, 2007; 104(52): 20920 - 20925. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Daley, J. Ma, E. Adams, S. P. Cobbold, and H. Waldmann A Key Role for TGF-beta Signaling to T Cells in the Long-Term Acceptance of Allografts J. Immunol., September 15, 2007; 179(6): 3648 - 3654. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Yates, A. M. Paterson, K. F. Nolan, S. P. Cobbold, N. J. Saunders, H. Waldmann, and P. J. Fairchild Induction of Regulatory T Cells and Dominant Tolerance by Dendritic Cells Incapable of Full Activation J. Immunol., July 15, 2007; 179(2): 967 - 976. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. De Riva, C. Bourgeois, G. Kassiotis, and B. Stockinger Noncognate Interaction with MHC Class II Molecules Is Essential for Maintenance of T Cell Metabolism to Establish Optimal Memory CD4 T Cell Function J. Immunol., May 1, 2007; 178(9): 5488 - 5495. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Robertson, J.-G. Chai, M. Millrain, D. Scott, F. Hashim, E. Manktelow, F. Lemonnier, E. Simpson, and J. Dyson Natural Regulation of Immunity to Minor Histocompatibility Antigens J. Immunol., March 15, 2007; 178(6): 3558 - 3565. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bourgeois and B. Stockinger CD25+CD4+ Regulatory T Cells and Memory T Cells Prevent Lymphopenia-Induced Proliferation of Naive T Cells in Transient States of Lymphopenia J. Immunol., October 1, 2006; 177(7): 4558 - 4566. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Laffont, J. D. Coudert, L. Garidou, L. Delpy, A. Wiedemann, C. Demur, C. Coureau, and J.-C. Guery CD8+ T-cell-mediated killing of donor dendritic cells prevents alloreactive T helper type-2 responses in vivo Blood, October 1, 2006; 108(7): 2257 - 2264. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Kassiotis, D. Gray, Z. Kiafard, J. Zwirner, and B. Stockinger Functional Specialization of Memory Th Cells Revealed by Expression of Integrin CD49b J. Immunol., July 15, 2006; 177(2): 968 - 975. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bourgeois, G. Kassiotis, and B. Stockinger A Major Role for Memory CD4 T Cells in the Control of Lymphopenia-Induced Proliferation of Naive CD4 T Cells J. Immunol., May 1, 2005; 174(9): 5316 - 5323. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Kassiotis and B. Stockinger Anatomical Heterogeneity of Memory CD4+ T Cells Due to Reversible Adaptation to the Microenvironment J. Immunol., December 15, 2004; 173(12): 7292 - 7298. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. B. Herrera, D. Golshayan, R. Tibbott, F. S. Ochoa, M. J. James, F. M. Marelli-Berg, and R. I. Lechler A Novel Pathway of Alloantigen Presentation by Dendritic Cells J. Immunol., October 15, 2004; 173(8): 4828 - 4837. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Mellor, P. Chandler, B. Baban, A. M. Hansen, B. Marshall, J. Pihkala, H. Waldmann, S. Cobbold, E. Adams, and D. H. Munn Specific subsets of murine dendritic cells acquire potent T cell regulatory functions following CTLA4-mediated induction of indoleamine 2,3 dioxygenase Int. Immunol., October 1, 2004; 16(10): 1391 - 1401. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Cobbold, R. Castejon, E. Adams, D. Zelenika, L. Graca, S. Humm, and H. Waldmann Induction of foxP3+ Regulatory T Cells in the Periphery of T Cell Receptor Transgenic Mice Tolerized to Transplants J. Immunol., May 15, 2004; 172(10): 6003 - 6010. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Richards, S. L. Dalheimer, B. D. Ehst, T. L. Vanasek, M. K. Jenkins, M. I. Hertz, and D. L. Mueller Indirect Minor Histocompatibility Antigen Presentation by Allograft Recipient Cells in the Draining Lymph Node Leads to the Activation and Clonal Expansion of CD4+ T Cells That Cause Obliterative Airways Disease J. Immunol., March 15, 2004; 172(6): 3469 - 3479. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tone, Y. Tone, E. Adams, S. F. Yates, M. R. Frewin, S. P. Cobbold, and H. Waldmann From The Cover: Mouse glucocorticoid-induced tumor necrosis factor receptor ligand is costimulatory for T cells PNAS, December 9, 2003; 100(25): 15059 - 15064. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Koike, H. Yamagishi, Y. Hatanaka, A. Fukushima, J.-w. Chang, Y. Xia, M. Fields, P. Chandler, and M. Iwashima A Novel ERK-dependent Signaling Process That Regulates Interleukin-2 Expression in a Late Phase of T Cell Activation J. Biol. Chem., April 25, 2003; 278(18): 15685 - 15692. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Kassiotis, R. Zamoyska, and B. Stockinger Involvement of Avidity for Major Histocompatibility Complex in Homeostasis of Naive and Memory T Cells J. Exp. Med., April 21, 2003; 197(8): 1007 - 1016. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sahara and N. Shastri Second Class Minors: Molecular Identification of the Autosomal H46 Histocompatibility Locus as a Peptide Presented by Major Histocompatibility Complex Class II Molecules J. Exp. Med., February 3, 2003; 197(3): 375 - 385. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Coudert, C. Coureau, and J.-C. Guery Preventing NK Cell Activation by Donor Dendritic Cells Enhances Allospecific CD4 T Cell Priming and Promotes Th Type 2 Responses to Transplantation Antigens J. Immunol., September 15, 2002; 169(6): 2979 - 2987. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Surquin, A. Le Moine, V. Flamand, N. Nagy, K. Rombaut, F.-X. Demoor, P. Stordeur, I. Salmon, J.-C. Guery, M. Goldman, et al. Skin Graft Rejection Elicited by {beta}2-Microglobulin as a Minor Transplantation Antigen Involves Multiple Effector Pathways: Role of Fas-Fas Ligand Interactions and Th2-Dependent Graft Eosinophil Infiltrates J. Immunol., July 1, 2002; 169(1): 500 - 506. [Abstract] [Full Text] [PDF] |
||||
![]() |
|