|
|
||||||||
Department of Biological Sciences, Stanford University, Stanford, CA 94305
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
- and ß-chains
of the class II heterodimers, and they all share several common
sequence motifs in their promoters. These motifs are named
S4 (septamer; also called H,
or heptamer) (4, 5, 6), X1, X2, and Y boxes (7). Much evidence has been
found to support the importance of these motifs for the appropriate
expression of MHC class II genes (4, 5, 8, 9, 10, 11, 12). In addition,
these class II promoter motifs can serve as enhancers for some
heterologous promoters (10).
Intracellular class II
ß-chain heterodimers are noncovalently
associated with a nonpolymorphic glycoprotein called invariant chain
(Ii) (13). Ii regulates class II binding of antigenic peptide and
targets class II to endosomal compartments where peptide binding
occurs. The Ii gene is not in the MHC (14), and analysis of both human
(15) and mouse (16) gene sequences indicates that the structure of Ii
is not related to that of MHC class II proteins. Consistent with their
cooperative roles in the Ag presentation pathway, class II and Ii
expression are coregulated. Basal expression of these genes shows the
same tissue specificity (B cells, macrophages, dendritic cells, and
thymic epithelial cells) (17) and inducibility by cytokines (most
notably IFN-
, TNF-
, and IL-4) (18, 19, 20). This coordinate
regulation is imperative since both under- and overexpression of Ii has
been shown to impair MHC class II transport and presumably function
(21). While all cells that express class II also express Ii, some cells
are capable of producing Ii in the absence of class II. (22). As one
might expect, there are some shared elements in the regulatory regions
of the MHC class II and Ii genes. For example, it has already been
documented that the Ii upstream enhancer shares homology with class II
promoters (23, 24). Despite these similarities, differences do exist.
The Ii promoter, which confers tissue-specific expression (23), is
distinct and appears unrelated to class II (5, 7, 23, 24). In addition,
previous evidence from our laboratory suggested a distinct intronic
enhancer within the Ii gene (23). Thus, regulation of Ii is likely to
occur through many cis elements and trans-acting
factors.
The Ii gene contains at least three distinguishable transcriptional
regulatory regions: 1) an upstream enhancer, 2) a tissue specific
promoter, and 3) an intronic enhancer (Ref. 23; see Fig. 1
A). Characterization of each component in the murine Ii
chain gene has revealed the following (23). The Ii promoter fragment
from -183 to +88 has been shown to promote transcription of
chloramphenicol acetyltransferase (CAT) reporter
genes in B cells, L cell fibroblasts, and macrophages, but not in T
cells. In the murine Ii promoter, an NF-
B site located between -121
and -110 serves as a cell type-positive regulator in B cells and
macrophages. In addition, a CCAAT box is located between -89 and -84,
and an Sp1 binding site is present between -76 to -71. These elements
are positive cell type regulators, but their presence is not required
for basal transcriptional activity. Fragments beginning at -68 are
sufficient for low level basal transcriptional activity; this promoter
does contain a TATA box at -28 to -24 relative to the transcription
start site.
|
Previous studies from this laboratory indicated that an intronic enhancer is present within a 2.4-kb region in the first intron of the Ii gene (23). This enhancer fragment has been demonstrated to enhance transcription of the Ii promoter (-68 to +88), but does not enhance heterologous SV40 large T Ag promoter-driven transcription.
In this report, we identify the sequence elements that make up
the Ii intronic enhancer. Interestingly, the intronic enhancer also
contains elements that are homologous to class II promoter region X1,
X2, and Y boxes and a sequence showing homology to the S (H) box.
Mutational analyses have indicated that these elements are responsible
for the enhancing activity of this region. This intronic enhancer is
active in constitutive expression in B cells, macrophage lines, and L
cells. Furthermore, other studies have indicated that this intronic
enhancer contributes to IFN-
-induced expression of
Ii.5
| Materials and Methods |
|---|
|
|
|---|
The mouse cell lines used in this study were M12, a B cell lymphoma line (25); L cells, fibroblasts (26); and WEHI-3, a myelomonocytic cell line (27). Cell lines were grown in RPMI 1640 medium supplemented with 10% FBS, penicillin/streptomycin, L-glutamine, and 5 x 10 -5 M 2-ME and were maintained at 37°C in a 5% CO2 incubator.
DNA constructs
All constructs were made in the pCAT basic vector available from
Promega (Madison, WI). The control plasmid was pCAT control containing
an SV40 promoter and enhancer driving CAT expression and
available from the same vendor. Ii promoter and enhancer fragments were
cloned, respectively, into the promoter region polylinker in pCAT basic
and into the unique BamHI site 3' of the CATgene. The promoter and enhancer regions for most constructs were
generated by PCR amplification or appropriate sequences from the
pIiSst2.4 plasmid (14), which contains the Ii promoter region from
-843 to +88, and the 2.4-kb Sst intronic enhancer (nucleotides (nt)
25064905) fragment. The sequences and locations of the primers used
are given in Table I
.
|
DNA transfections
Cells (5 x 106) were electroporated with 20 µg of cesium chloride-banded plasmid. The conditions used were 250 V and 960 µF in 300 µl of complete medium using 0.4-cm gap Invitrogen cuvettes (San Diego, CA) and a Bio-Rad GenePulser electroporator (Bio-Rad, Hercules, CA). Cells were then recultured in complete medium and grown for 48 h before harvesting for CAT assays.
CAT assays
CAT assays were performed essentially as described previously by Gorman et al. (29). Briefly, extracts from 5 x 106 cells were quick frozen and thawed three times in 150 µl of 0.25 M Tris, pH 7.5, before heat inactivation at 70°C for 7 min. Then, 100 µl of this extract was mixed with 100 µl 0.25 M Tris, pH 7.5, 25 µl water, 25 µl 10 mM chloramphenicol, and 0.2 µCi [3H]acetyl coenzyme A. These reactions were then overlaid with Econofluor scintillation fluid (Dupont-NEN, Boston, MA) and allowed to react for 2 h before counting on a beta scintillation counter. The cpm values were then normalized to the protein content in the extract. Protein determinations were done using a Bradford assay (30) in a microtiter plate with 5 µl of extract according to the manufacturers directions (Bio-Rad). All experiments contained a control transfection of the pCAT control plasmid for normalization of CAT expression levels.
Electrophoretic mobility shift assays
Nuclear extracts were prepared from log phase M12 cells
according to the method of Dignam (31). Protein concentrations were
measured by the Bradford assay (30), using bovine
-globulin as a
standard. The Q fragment (50 ng) was labeled by Klenow filling in of
the BamHI 5' overhang with [
-32P]dGTP (50
µCi) and [
-32P]dATP (50 µCi). In general, 30,000
cpm of probe, corresponding to 0.5 ng of labeled fragment, was
incubated with
20 µg of M12 nuclear extract. One microgram of
poly(dI:dC) as well as 200 ng of the pCAT basic vector were added as
nonspecific competitors. Buffer conditions were as described (32). Cold
competitors were added 10 min before labeled probe and allowed to
anneal at 0°C for 45 min before resolution on native 4%
polyacrylamide gels. Gels were then dried and autoradiographed.
RT-PCR analysis
Total RNA from murine spleen cells or L cell fibroblasts was isolated using Trizol reagent (Life Technologies, Grand Island, NY) according to manufacturers instructions. RT-PCR reactions were then set up using specific primers for either CIITA or ß-actin. The CIITA primers were: sense 5', GGGTCTTACCTGCCGGAGTTG; and anti-sense 5', GTCAGCTGCAGATGGTGTGAAG. The ß-actin primers were: sense 5', CTTTTCCAGCCTTCCTTC; and anti-sense 5', GCAGTAATCTCCTTCTGCATC. The amplified product for CIITA is 700 bp, and the amplified product for ß-actin is 510 bp. Decreasing twofold dilutions of total RNA were used to synthesize first-strand cDNA and amplified by 40 cycles of PCR using the Access RT-PCR Kit from Promega according to manufacturers instructions.
| Results |
|---|
|
|
|---|
Previous work had demonstrated that a promoter fragment from -68
to +88 was sufficient to mediate basal transcription in B cells and L
cell fibroblasts (23). To confirm and extend these observations, Ii
promoter fragments were generated beginning at -284, -147, -95, and
-59 and extending to +88 using primers designated in Table I
(Fig.
1A). These fragments were
subcloned into the promoter cloning site in the pCAT basic vector and
then tested in transient transfection assays for promoter activity in
M12, WEHI-3, and L cells.
As seen in Figure 1
B, promoter fragments beginning at -284
or -147 show strong promoter activity in all of the cell types tested.
Deletion to -95 decreases promoter activity somewhat, and deletion to
-59 reduces expression dramatically. These results are largely as
expected based on previous findings in M12 and L cells (23). The -284
plasmid contains the IFN-
-responsive upstream enhancer; deletion of
these elements to -147 ablates IFN-
responsiveness (not tested in
these experiments) but does not negate the tissue-specific promoter
activity. Deletion to -95 removes the NF-
B site, which has been
shown to be a cell type-specific positive regulator, thus accounting
for this decrease (23). Deletions to -68, which remove a CAAT box and
Sp1 binding site, have previously been shown to allow some basal
transcription in B cells (23), and these data show that a fragment
beginning at -59 is still weakly active in all cell lines tested.
Having established that the minimal promoter fragment was -59 to +88,
this promoter fragment was tested for its ability to be enhanced by the
intronic region of the Ii gene that contains the putative intronic
enhancer, in an effort to identify this enhancer.
The Ii intronic enhancer is located in the 5' region of the first intron
To screen the first intron of the Ii gene for enhancer activity,
PCR primers were designed to amplify the 2.4-kb region, originally
described as a SacI fragment (23). These primers, designed
to introduce convenient BamHI cloning sites, are described
in Table I
. These enhancer fragments were then cloned 3' of the CAT
gene in the pCAT basic vector containing the -59 to +88 promoter
fragment. Figure 2
A shows a
schematic of the Ii genomic organization and the approximate location
of the amplified regions. Transfection of the 2.4-kb enhancer fragment
in conjunction with the -59 promoter showed significant enhancement of
CAT activity over transfections of the promoter alone (see Fig. 3
A). To define further the
boundaries of this intronic enhancer, a series of 3' nested deletions
were generated by PCR. These deletions left fragments of 1.25, 845, and
405 bp for analysis. The approximate locations of these fragments are
also shown in Figure 2
A. Transfections of all of these
enhancer fragments in conjunction with the -59 promoter fragment
resulted in significant enhancer activity over the transfections of
promoter-alone constructs in all cell lines tested (Fig. 3
A). The fact that the 845-bp fragment results in less
expression than the 405-bp fragment in L cells suggests that there may
be negative regulatory elements located between nt 2930 and 3354, which
are active in this cell type.
|
|
The Ii minimal promoter contains all elements needed to cooperate with the Ii intronic enhancer
The next question investigated was whether the -59 promoter
contained all of the promoter elements necessary for maximal
enhancement by the 405 bp Ii intronic enhancer. This concern was
prompted by previous data showing that the Ii upstream enhancer
required the presence of an Sp1 site in the promoter for activity (23).
To assess the requirements for enhancement by the 405-bp fragment, the
405-bp intronic enhancer was cloned 3' of the -284 promoter and the
-59 promoter, or 3' of the SV40 promoter. These constructs were then
transiently transfected into M12 cells and assayed for CAT activity.
Data for the transfections into M12 cells are presented in Figure 3
B. The 405-bp intronic enhancer is at least as active with
the -59 promoter as it is with the -284 promoter, giving 17-fold
enhancement, indicating that the region of the Ii promoter that is
responsive to this enhancer is located in the -59-bp region. As
reported earlier for the 2.4-kb intronic enhancer fragment (23), the
405-bp intronic enhancer fragment does not enhance the heterologous
SV40 promoter. Transfections into WEHI-3 and L cells showed similar
results (data not shown).
The Ii intronic enhancer is contained within a 150-bp region
Having established that the -59 promoter was a suitable minimal
promoter to use in these analyses, the 405-bp fragment was subdivided
to identify the essential enhancer elements. A series of new PCR
primers were designed (Table I
) to PCR amplify a set of nested
deletions of the 405-bp fragment, as shown in Figure 2
B.
Constructs containing fragments of the 405-bp intronic
enhancer-containing region corresponding to A, B, C, D, E, F, G, H, J,
K, L, and Q were tested in M12 cells. Figure 4
shows the results of these
transfections normalized to the pCAT control plasmid. Transfection of
the p59 (-59 to +88) promoter alone gave minimal activity.
Introduction of the 405-bp intronic enhancer showed an
25-fold
enhancement. Transfection of all of the alphabet subfragment
constructs, except for C and J, showed a high level of enhancement.
Transfection of the C enhancer fragment resulted in a <2-fold
induction over the -59 promoter alone in four different experiments.
This result suggested that the enhancer activity probably resided
downstream of the binding sites for primers 16 and 17 (nt 27202875;
see Fig. 2
B). In addition, the J fragment showed almost no
activity. The Q fragment, which was the smallest region tested,
initially gave high enhancer activity. This result suggested that the
intronic enhancer could be narrowed down to this
150-bp region
delineated by primers 16 and 19 (between nt 2720 and 2875). Although
the B and L fragments, which share a 3' boundary at oligo 18, showed
enhancer activity, individual experiments that directly compared
fragment B, L, and Q consistently showed the activity of the Q fragment
to be higher. This led us to believe that enhancer motifs were entirely
encompassed by the Q fragment (position 27202875 in the genomic
sequence (33)).
|
Analysis of the sequence of the Q fragment (nt 27212875)
revealed several interesting homologies (Table II
; Fig. 5
A) (33). The most striking of
these was the presence of a CRE.1 site between positions 2805 and 2810.
This CGTCAT sequence turned out to be highly homologous to the X2 box,
previously described for class II promoter regions, and the Ii
upstream enhancer (23, 24, 34). In addition, the sequence GCAACA
appears between positions 2795 and 2800. This sequence aligns well with
previously identified X1 boxes (Table II
). A classical Y box is also
located 15 bp downstream of X2. These striking homologies suggested
that the classical class II promoter elements had been duplicated as
transcriptional control regions in both the Ii upstream and intronic
enhancer.
|
|
Alignment of the sequences upstream of the X boxes in the Q fragment
revealed modest homology to some of the previously identified S (also
called H or W) motifs (24, 34). To test the involvement of this region,
two new fragments were made and tested. These fragments were named R
and T. The R fragment was made by PCR amplification using primers 6 bp
3' of the GGGCATT (S box) sequence. The T fragment extends from nt 2767
to 2876. The T fragment preserves the X and Y boxes but lacks the
putative S motif. These fragments were subcloned as enhancer fragments
downstream of the -59 promoter CAT vector and tested in M12 cells.
Figure 5
shows that both the R and T fragments have some enhancer
activity; however, neither one is as effective as the Q fragment. These
results are consistent with previously published data for class II
genes showing that both the X1/X2 boxes, as well as the S region, are
needed for full promoter activity (24, 34). These elements in the Ii
intronic enhancer are not cell type specific, and they contribute to
the activity of the Q fragment enhancer in monocytes and L cells as
well (data not shown).
Nuclear extracts contain factors that bind to the Ii intronic enhancer region
To determine whether nuclear proteins bind to these regulatory
elements, a series of electrophoretic mobility shift assays were
performed on the intronic enhancer fragments. The Q fragment was end
labeled and incubated with nuclear extracts from M12 B lymphoma cells.
As shown in Figure 6
, the band pattern
shows three major protein complexes binding to the Q fragment. By
analyzing the banding pattern of the cold competitor-containing
reactions, it is possible to assign these complexes to particular
motifs. Cold competition with a fragment that spans both the S and X1
elements eliminates the highest mobility band, No. 1 (2805 fragment,
lane 3). A fragment that spans S, X, and Y elements
eliminates both band 1 and the middle band, No. 2 (2834 fragment,
lane 8). A cold probe that is initiated within the X region
and spans the Y box competes the second band (fragment 4, lane
4). This probe would not be expected to compete with X box-binding
factors, because the X motif is so close to the 5' end of fragment 4,
and the X box-binding proteins only bind efficiently to longer
fragments that contain the X motif within the center (W. Reith,
unpublished observations; and our unpublished observations).
Furthermore, this No. 4 fragment does not contain the pyrimidine region
just 5' of the X box corresponding to half of the EFC/MDBP site, which
may be necessary for X box binding activity (reviewed in 35 . The
fastest migrating species, No. 3, is competed only by the intact Q
fragment and fragment 4 (lanes 4 and 7).
Based on these results, it is possible to assign the fastest migrating
species to a region downstream of the Y box, most likely to a
polypyrimidine tract in this location in probe Q. This band is seen
only in B cell lines (data not shown). The middle band, No. 2, is most
likely due to factors that bind to the Y box, and the slowest migrating
band, No. 1, is probably due to X box-binding factors. We have
been unable to shift any factors binding to the S region, either on the
intact Q fragment or on isolated smaller fragments from this
region.
|
promoter could compete for factors binding to the
Ii intronic enhancer. The slowest migrating species, No. 1, seen in
lane 2, is greatly diminished by cold competition using a
DNA fragment that contains the upstream enhancer region
(lane 5), or it is somewhat diminished using a
fragment from the class II A
promoter region containing S, X1, X2,
and Y (lane 6). Cold competition with the Ii upstream
enhancer (lane 5) decreased binding of all three
protein species. Competition with the A
promoter fragment decreased
binding of only the X- and Y-binding proteins.
Although the Ii intronic enhancer shares regulatory elements and
transacting factors with MHC class II, one important distinction is
that the Ii gene does not require CIITA for expression. This is
demonstrated by the fact that this enhancer is active in L cells that
are CIITA deficient. Figure 7
demonstrates RT-PCR analysis of our L cell fibroblast line as compared
with spleen cells. As seen in this figure, spleen cells have a readily
apparent 700-bp amplification product corresponding to CIITA, which
titrates from 5 µg to 40 ng of input RNA, most likely representing
mRNA from splenic B cells. However, no such band is detected in the L
cell RT-PCR reactions, even with the highest concentration of RNA
tested (5 µg) and 40 cycles of PCR. These results demonstrate that
the L cells used in these studies are CIITA deficient.
|
| Discussion |
|---|
|
|
|---|
and E
Y box sequences (see Table II
gene, but somewhat different from the upstream
enhancer. However, the putative S region from the intronic enhancer is
quite distinct from other S regions, but may have strong enhancing
activity even on its own (see Fig. 5
gene
contains an intronic enhancer, and it may also represent a duplication
of the H-X-Y regulatory motifs (12).
Thus, the Ii has duplicated the class II promoter region in at least
two regulatory motifs. Although the sequences that comprise these
motifs are different from each other, preliminary evidence suggests
that the same nuclear factors may be able to recognize both the
upstream and the intronic enhancer regions. Evidence for this is
provided by the cold competition experiments shown in Figure 6
.
Despite these similarities in sequence elements, there are unique aspects to the transcriptional regulation from these sites. For example, the upstream enhancer requires the Sp1 binding site (GC box) in the promoter for activity and can enhance Sp-1-containing heterologous promoters such as SV40, whereas the intronic enhancer does not require Sp1 binding sites and cannot enhance SV40 promoter-driven transcription (Ref. 23; and these results). Clearly then, the promoter requirements for these two enhancing activities are different, suggesting distinct interactions between promoter-binding proteins and/or the transcription initiation complex and the proteins binding to the two enhancers. These results indicate that the Ii intronic enhancer may be uniquely designed to cooperate only with its cognate promoter.
The intronic enhancer not only is important for basal transcription but
is also involved in cytokine-induced gene regulation. Recent work in
our laboratory by Cao et al.5 has shown that this intronic
region of the gene is partially responsible for the increased
transcription of the Ii gene in response to IFN-
, consistent with
the roles of the homologous regions in the Ii upstream enhancer and
class II promoters on IFN-
induction of transcription. This suggests
that the IFN-
-induced coactivator of MHC and Ii expression, CIITA,
is able to interact with X and Y box-binding proteins associated with
the intronic enhancer, as well as the upstream enhancer, to activate Ii
transcription. Furthermore, the severely diminished activity of the
mutated X box fragment (Fig. 5
) suggests that, in the context of the
entire enhancer, higher order protein interactions are probably
necessary for full enhancer activity, in a manner analogous to that
seen for class II promoters (reviewed in 35 .
In patients suffering from some forms of the disease bare lymphocyte
syndrome (BLS), it has long been noted that they display greatly
reduced levels of mRNA for class I and class II proteins (35, 36).
However, it is of interest that the level of Ii message was merely
reduced, but not absent (reviewed in 24 . One possibility is that
the intronic region of the Ii gene may play some role in this residual
expression. As BLS-inducing mutations have identified X box-binding
proteins (37) and CIITA (35), it made sense that class I and
class II promoter regions would be impaired without these components.
To address the question of whether or not CIITA expression was
necessary for Ii intronic enhancer function, we tested our L cell line
for CIITA expression. L cells have previously been reported to lack
CIITA expression (38), and our results corroborate this finding, yet
the Ii intronic enhancer still functions effectively in these cells.
Therefore, it seems that the X box-binding factors may be critical for
basal Ii expression, however, CIITA may only be required for
IFN-
-induced Ii expression. Therefore, either the Ii promoter alone
or the intronic enhancer may be sufficient to give a reduced level of
Ii expression in either BLS cell lines or in the CIITA knock-out mouse
(39). This supposition is further supported by the data shown in
Figure 1
(p-95 construct). The observations that Ii expression is
maintained in class II-deficient cell lines and that some
nonprofessional APCs express Ii in the absence of class II (reviewed in
24 could be used to suggest that the Ii gene is an ancestrally
more primitive gene. It is possible that the Ii gene first evolved as a
chaperone for some protein(s) other than class II, and that when the
class II genes evolved, they acquired the transcriptional regulatory
regions from one or both of the Ii enhancers.
While the 155-bp region we have identified in the Ii intronic enhancer
contains the majority of the enhancing activity seen within the
intronic region, it is possible that there are additional positive
regulatory elements (for example in enhancer fragments E, F, and H) as
well as negative regulatory elements (for example, fragment A)
contained within the 405-bp intronic region. Searches for sequences
homologous to known cis-acting elements suggest that there
is an AP-1 site centered at nt 2565 in the 5' end of the 405-bp region.
The 3' end of the 405-bp enhancer contains two PU boxes or Ets-1
sites centered at positions 2874 and 2888. In addition, there are
several homologies to
-IFN response elements (
IRE) centered at
positions 2695, 2813, and 2903. Scanning mutations in these regions
should be informative for dissecting the functions and possible
interplay among these regions. Characterization of the proteins binding
to the regulatory regions of the class II promoters and the two Ii
chain enhancers should reveal the mechanisms regulating class II
expression and Ag presenting function.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Internal Medicine, University of Michigan, 6200 MSRB III, Ann Arbor, MI 48109-0638. ![]()
3 Address correspondence and reprint requests to Dr. Patricia Jones, Department of Biological Sciences, Stanford University, Stanford, CA 94305-5020. E-mail address: ![]()
4 Abbreviations used in this paper: S, septamer; Ii, class II-associated invariant chain; CAT, chloramphenicol acetyltransferase; pCAT, chloramphenicol acetyltransferase plasmid; CIITA, class II-associated transactivator; nt, nucleotide; BLS, bare lymphocyte syndrome. ![]()
5 Z. A. Cao, B. B. Moore, and P. P. Jones. 1997. The Ii intronic enhancer confers
-IFN inducibility to the Ii gene. Submitted for publication. ![]()
Received for publication March 6, 1997. Accepted for publication April 16, 1998.
| References |
|---|
|
|
|---|
responsive element important in human HLA-DR
gene expression in a glioblastoma multiform line. Proc. Natl. Acad. Sci. USA 85:8618.
gene: transcriptional function and interaction with nuclear proteins. Mol. Cell. Biol. 9:50.
inducible regulation of the HLA-DR
gene. Proc. Natl. Acad. Sci. USA 85:8598.
chain of class II histocompatibility antigens and its implications for the protein structure. Proc. Natl. Acad. Sci. USA 80:7395.
and TNF-
on the expression of an MHC class II antigen on a murine macrophage cell line. J. Immunol. 137:2853.[Abstract]
. J. Immunol. 136:940.[Abstract]
This article has been cited by other articles:
![]() |
M. Krawczyk, N. Peyraud, N. Rybtsova, K. Masternak, P. Bucher, E. Barras, and W. Reith Long Distance Control of MHC Class II Expression by Multiple Distal Enhancers Regulated by Regulatory Factor X Complex and CIITA J. Immunol., November 15, 2004; 173(10): 6200 - 6210. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yamashita, K. Wakazono, T. Sugimura, and T. Ushijima Profiling and selection of genes differentially expressed in the pylorus of rat strains with different proliferative responses and stomach cancer susceptibility Carcinogenesis, June 1, 2002; 23(6): 923 - 928. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |