HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Mehal, W. Z. Articles by Crispe, I. N. Search for Related Content PubMed PubMed Citation Articles by Mehal, W. Z. Articles by Crispe, I. N.

TCR Ligation on CD8⁺ T Cells Creates Double-Negative Cells In Vivo¹

Wajahat Z. Mehal^2,*, and I. Nicholas Crispe^*

^* Section of Immunobiology and Section of Digestive Diseases, Yale University Medical School, New Haven, CT 06520

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
The lack of CD95 in mice is associated with an accumulation of TCRß⁺ CD4^-CD8^- (double-negative (DN)) cells in the lymph nodes (LNs) and other organs. To test the hypothesis that these DN cells arise from TCRß⁺CD8⁺ cells after activation via the TCR, we have crossed an MHC class I-restricted TCR transgene (tg) onto the lpr genotype to generate two TCR-transgenic experimental groups, TCRtg⁺ lpr/+ (CD95-intact) and TCRtg⁺ lpr/lpr (CD95-deficient). Specific peptide administration resulted in peripheral deletion of TCRß cells from the LNs of CD95-intact and CD95-deficient mice. On day 3 after peptide administration in the CD95-deficient but not the CD95-intact mice, there was a ninefold increase in the percentage of DN cells in the LN; this increase returned to control levels by day 10. Peripheral deletion was associated with an accumulation of TCRß⁺CD8^high cells in the livers of mice of both genotypes by day 3, which returned to control levels by day 10 without an increase in the percentage or total number of DN cells. Our data show that the in vivo stimulation of TCRß⁺CD8⁺ cells in the absence of CD95 results in an initial accumulation and an eventual loss of DN cells. This identifies a role for CD95 after TCRß stimulation in the efficient removal of TCRß⁺CD8⁺ cells after the down-regulation of CD8. CD95 is not essential for this process, because other mechanisms can compensate, but such mechanisms are less efficient in the LN.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mice with the lpr mutation are deficient in the transmembrane protein CD95 (Fas or APO-1) and develop a wide range of abnormalities (1, 2). These abnormalities include autoantibodies, dermatitis, nephritis, and lymphadenopathy due to an accumulation of polyclonal TCRß⁺ cells lacking CD4 and CD8 double-negative (DN)³ cells (3). The targeted disruption of the CD95 gene demonstrated that a lack of CD95 is sufficient to produce the lpr phenotype (4). At a cellular level, the most well-understood consequence of CD95 ligation is the induction of apoptosis (5, 6). The identification of the genetic defect in lpr mice and the known ability of CD95 to induce apoptosis does not fully explain the development of the lpr phenotype, since the stages of T and B cell development at which CD95 signaling has a physiologic role are not fully understood.

The most direct explanation for the origin of DN T cells in mice lacking CD95 is that the DN cells are accumulating due to a lack of CD95-induced apoptosis. This possibility links the issue of the origin of DN cells with the identification of the stage of T cell development at which CD95 has a physiologic role. Attempts to date at identifying the origin of DN cells have only been partially successful. Even before the identification of the genetic defect responsible for the lpr phenotype, it was shown that neonatal thymectomy abrogates the development of lymphadenopathy in lpr mice (7). This thymic dependence may be due to a number of factors, but the molecular evidence of the importance of CD95 in apoptosis focused attention on potential defects in thymic apoptosis. It was hypothesized that a defect in thymic apoptosis in either positive or negative selection would result in thymic accumulation, with eventual "spillover" into the periphery of the excess cells. However, direct tests of positive and negative selection in lpr mice with superantigen (8, 9) and TCR-specific peptide failed to detect an abnormality (10), which strongly suggests that the defect or defects in apoptosis that are responsible for the production of DN cells are outside the thymus.

An alternative approach is to identify the cells of origin of the DN cells. The thymic dependence of DN cells that was demonstrated by neonatal thymectomy suggests that these cells are derived from conventional T cells. Direct evidence supporting a T cell origin for DN cells came from the demonstration that the peripheral repertoire of DN cells in lpr mice is determined by positive selection on class I molecules (8). The DN T cell precursors could be CD4 or CD8 T cells that have developed in the thymus. Prior expression of the CD8 molecule is associated with demethylation of the CD8 gene; the CD8 gene in DN cells from lymph nodes (LNs) was extensively demethylated, suggesting that the precursors of DN cells were CD8⁺ (11). These results suggest that DN cells develop in the periphery from conventional thymus-derived CD8 cells.

While CD8 T cells are strong candidates for the DN precursors, the stimuli leading to the conversion of TCRß⁺CD8⁺ cells to the DN phenotype are not known. Two extreme views are that the conversion to DN followed by removal may be the default pathway for "old" CD8 cells at the end of their lifespan, or alternatively that conversion to the DN phenotype may be dependent upon a specific signal such as TCR activation. The accumulation of DN cells that occurs in lpr mice with age is consistent with both hypotheses. There is decreased lymphadenopathy in mice that are kept in a germfree environment (3), suggesting that the appearance of lymphadenopathy is associated with the degree of stimulation of the immune system. This possibility is further supported by the loss of lymphadenopathy that is seen when a TCR transgene (tg) is crossed onto the lpr genotype (12). In such TCR-transgenic lpr mice, the constant activation of T cells by environmental stimuli will be minimized due to the very limited TCR repertoire.

To directly test the hypothesis that DN cells arise from CD8 cells after activation via the TCR, we have crossed an MHC class I-restricted TCRtg onto the lpr genotype, to generate two TCR-transgenic experimental groups, TCRtg⁺ lpr/+ (CD95-intact) and TCRtg⁺ lpr/lpr (CD95-deficient). The above hypothesis predicts that peptide administration will result in the appearance of DN cells in the CD95-deficient but not the CD95-intact mice. The subsequent fate of such DN cells is not predictable a priori. The lack of CD95 may induce a total block in T cell deletion, with a persistent accumulation of DN cells, or other mechanisms may be able to compensate with the removal of the DN cells. Although the accumulation of DN cells in lpr mice occurs primarily in the LNs, other organs such as the spleen and the liver have a smaller increase in the number of DN cells (1). The liver is of particular interest, since it is a specific site for the apoptosis of activated TCRß⁺CD8⁺ cells (13) and contains a number of cellular populations with cytotoxic abilities (NK cells, NK T cells, and Kupffer cells) (14). Both the proposed function of the liver as a specific site for the apoptosis of TCRß⁺CD8⁺ cells and the presence of a variety of cells with cytotoxic abilities are very different from the LN, which is a site for Ag presentation and the priming of the cellular immune response. The role of the CD95 system in TCRß⁺CD8⁺ cell removal from the LNs and liver may also be very different.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mice

The TCR-transgenic mice used have been described previously (15). The transgenic TCR recognizes the peptide SEFLEKKRI, which corresponds to residues 560–568 of the large T Ag of SV40 in the context of the MHC class I molecule K^k, and the tg has been backcrossed to the B10.BR strain for eight generations to provide genetic homogeneity on an H-2^k background. These mice were bred with mice that were homozygous for the lpr mutation (CD95-deficient) on the MRL/Mp strain (3). The F₁ from the TCR-transgenic B10.BR and lpr MRL/Mp was backcrossed to lpr MRL/Mp mice, and the progeny were typed for tg expression and CD95 genotype. As expected, half were CD95-deficient (lpr/lpr), and the rest were CD95-intact (lpr/+), confirming the independent segregation of the TCRtg and the CD95 locus. The B10.BR and the CD95-deficient MRL/Mp.Fas^lpr mice were purchased from The Jackson Laboratory (Bar Harbor, ME).

tg and lpr typing

tg typing was performed by a FACS analysis of PBLs that had been stained with an anti-CD8 Ab (clone 53-6.7; PharMingen, San Diego, CA) and an anti-TCR Vß 8.1, 8.2, 8.3 Ab (F23.1). An animal was identified as tg⁺ if >60% of its PBL CD8⁺ T cells were F23.1-positive.

Genomic DNA was obtained from PBLs using the Wizard DNA purification kit (Promega, Madison, WI), and a three-primer PCR system was used for unambiguous typing of the CD95 genotype status from a single PCR reaction. The primers CD9512FX (ACAGCATAGATTCCATTTGCTGCT) and CD9512REV (TGAGTAATGGGCTCAGTGCAGCA) were complementary to regions 5' and 3' of the insertion in intron 2 that were responsible for the lpr genotype, generating a PCR product of 200 bp in the wild-type group but no product in the CD95-deficient group. The primer CD95Z8XTR (CAAATTTTATTGTTGCGACACCA) was complimentary to a region within the lpr insertion (2), generating a product of 250 bp in association with CD9512FX. The typing results from the possible genotypes are shown in Figure 1.

View larger version (54K): [in this window] [in a new window]   FIGURE 1. Design of primers for typing mice for the lpr/lpr and lpr/+ genotypes, with representative results. wt and lpr are known homozygous wild-type and lpr/lpr, respectively. Lanes 1 and 4 are heterozygotes (lpr/+), and lanes 2 and 3 are homozygotes (lpr/lpr).

The SV40 large T Ag peptide 560–568 (SEFLLEKRI) was used at a concentration of 100 µM in sterile PBS. Each mouse was injected i.p. daily with 0.3 ml of either SV40 large T Ag 9-mer peptide solution or PBS as a control.

Isolation of LN cells and intrahepatic lymphocytes (IHLs)

Four LNs, two axillary and two inguinal, were removed by dissection, homogenized, and rinsed in Bruff’s culture medium; cells were counted and kept on ice until staining for surface phenotype and DNA content by propidium iodide (PI).

IHLs were isolated by opening the abdominal wall in the midline and cutting the inferior vena cava. To separate the liver components, we used a digestion buffer consisting of Bruff’s medium containing 0.02% collagenase IV (Sigma, St. Louis, MO), 0.002% DNase I (Sigma), and 5% FCS. This buffer was perfused into the portal vein using a 5-ml syringe with a 21-gauge needle over 1 to 2 min. Care was taken to minimize injection of air bubbles into the portal vein, and blanching of the whole liver was used as an indicator of adequate perfusion. After perfusion, the liver was dissected out of the abdominal cavity and homogenized by forcing through a fine metal strainer. The homogenized liver was incubated with 10 ml of digestion buffer at 37°C for 30 min in a shaking water bath. The enzymatically digested cell suspension was centrifuged at 30 x g for 3 min at 4°C to remove hepatocytes and cell clumps. The supernatant was centrifuged at 120 x g for 10 min to obtain a pellet of nonparenchymal cells. The pellet had a volume that was typically 0.3 to 0.5 ml and was suspended with Bruff’s medium to a final volume of 1 ml, before mixing with 4 ml of 30% metrizamide in Bruff’s medium. This procedure resulted in 5 ml of cell suspension in 24% metrizamide, which was layered under 1 ml of Bruff’s medium and centrifuged at 1500 x g for 20 min at 4°C in 15-ml conical tubes. The cells at the interface were collected, washed with PBS, and counted before FACS analysis.

Flow cytometry

Cell concentrations were adjusted to 2 x 10⁷/ml in staining buffer (PBS with 1% BSA and 0.02% w/v sodium azide (Sigma)). A total of 50 µl of the cell suspension was incubated with the appropriate Abs on ice for 30 min, washed with staining buffer, and fixed with 2% paraformaldehyde. FACS data acquisition was ungated using a Becton Dickinson FACScan (Mountain View, CA). The Abs used for FACS staining were anti-CD8 conjugated to RED613 (clone 53-6.7) and anti-CD4 conjugated to FITC (clone H129.19) (both from Life Technologies, Gaithersburg, MD) as well as anti-TCRß conjugated to phycoerythrin (clone H57–597) and anti-B220 conjugated to phycoerythrin (clone RA3–6B2) (both from PharMingen). For PI staining, cells were used at a concentration of 10 x 10⁶/ml, washed in PBS, and incubated in PI-staining solution (0.1% sodium citrate, 0.3% Nonidet P-40, 50–100 µg/ml RNase (Sigma), and 50 µg/ml of PI) for 10 min before FACS analysis.

FACS data were analyzed using CellQuest software (Becton Dickinson), and the Student t test was used to assess the significance of differences between cell populations.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Phenotype of LN cells from class I-restricted TCR-transgenic mice

The presence of a class I-restricted TCRtg suppresses the expression of endogenously rearranged TCRs and results in a bias of the peripheral T cell pool in favor of TCRß⁺CD8⁺. The left two panels of Figure 2 show the TCRß expression of LN cells from CD95-intact (lpr/+) and CD95-deficient (lpr/lpr) mice after applying a light scatter gate to include small and large lymphocytes. The right two panels show the CD4 and CD8 expression of the same cells after further gating on the TCRß⁺ cells (region R). The presence of the TCRtg affected the proportion of CD8⁺ cells in the LNs such that >90% of the TCRß cells were CD8⁺. The presence of the lpr/lpr genotype did not alter the high percentage of TCRß⁺CD8 cells in the LNs. In particular, there was no increase in the percentage of DN T cells in the LNs of CD95-deficient mice. This phenotype was stable up to 20 wk of age.

View larger version (31K): [in this window] [in a new window]   FIGURE 2. Three-color FACS analysis of LN cells from 12-wk-old transgenic lpr/+ and lpr/lpr mice. Data acquisition was ungated. The analysis was performed by placing a size gate typical for lymphocytes followed by a gate on TCRßhigh cells (histograms on the left) so that the CD4 and CD8 expression on TCRß+ cells was displayed (dot plots on the right). The presence of the lpr defect does not alter the high frequency of CD8+ T cells of class I TCR-transgenic mice.

Peripheral deletion is operationally defined in this study as the loss of mature peripheral T cells from the LNs after activation. This loss may occur by apoptosis in situ or by the exit of the T cells from the LNs. The left two panels of Figure 3 show the TCRß expression of LN cells from CD95-intact (lpr/+) and CD95-deficient (lpr/lpr) mice at day 10 after PBS injection. As for the histograms in Figure 2, only a light scatter gate to include small and large lymphocytes was applied. The right two panels show the TCRß expression of LN cells from CD95-intact (lpr/+) and CD95-deficient (lpr/lpr) mice at day 10 after peptide injection. Peptide injection resulted in a substantial reduction in the percentage of TCRß⁺ cells in the LNs of both CD95-intact and CD95-deficient mice. Figure 4 summarizes the TCRß⁺ percentage at the two timepoints studied for the CD95-intact (upper plot) and CD95-deficient (lower plot) mice. The open circles are data from PBS-injected mice, and the closed circles are data from peptide-injected mice. In the CD95-deficient animals, the mean percentage of TCRß^high cells in the PBS-injected group was 69.5 ± 4.2 at day 3 (mean ± SD), while in the peptide-injected group it was only 40.8 ± 7.9 at day 3; this difference was highly significant (p < 0.005). At day 10, the mean percentage of TCRß^high cells in the PBS group was 73.5 ± 8.3, while it was only 22.6 ± 11.7 in the peptide group at day 10; this difference was also highly significant (p < 0.005). The LN cell counts were not significantly different between the experimental groups. At day 3, the mean LN cell number in CD95-intact mice was 18.2 x 10⁶ ± 3.8 in the PBS-injected group and 16.5 x 10⁶ ± 5.3 in the peptide-injected group. For the CD95-deficient mice, LN cell numbers at day 3 were 20.3 x 10⁶ ± 4.6 in the PBS-injected group and 19.4 x 10⁶ ± 2.8 in the peptide-injected group. Peripheral deletion from the LNs upon peptide injection was demonstrated by a loss of TCRß^high cells in lpr/lpr and lpr/+ mice. In this experimental model, we found a wide variation in the recovered LN cell numbers, but this did not compromise the detection of peripheral deletion based on the percentage of TCR^high cells on FACS analysis. The decrease in the percentage of TCRß⁺ cells in the LNs occurred without a significant increase in the frequency of subdiploid cells on PI staining.

View larger version (30K): [in this window] [in a new window]   FIGURE 3. Single-color analysis of LN cells from transgenic lpr/+ and lpr/lpr mice at 10 days after i.p. injection of PBS or specific peptide. Peripheral deletion, as judged by loss of TCRßhigh cells, occurs in both the lpr/+ and lpr/lpr animals.

View larger version (13K): [in this window] [in a new window]   FIGURE 4. Summary of peripheral deletion data at days 3 and 10 for mice of the lpr/+ (upper) and lpr/lpr (lower) genotypes. Data from PBS-injected controls are shown as , and data from peptide-injected animals are shown as •. In the lpr/lpr genotype, there was a significant difference between the peptide- and PBS-injected groups at days 3 and 10 (p < 0.05 in both cases).

Appearance of DN cells after peptide injection

A number of studies have suggested that the DN cells accumulating in lpr/lpr mice originate from CD8 cells. To determine whether the DN cells are derived from activated CD8⁺ cells, we examined CD4 and CD8 expression on T cells from the LNs of peptide-injected and control mice. Figure 5 shows the CD8 and CD4 profiles of LN cells from CD95-intact (two upper plots) and CD95-deficient (two lower plots) mice on day 3 after the injection of PBS (two left plots) or peptide (two right plots). Two gates were applied to the LN cells shown in Figure 5: a light scatter gate to include small and large lymphocytes and a gate to include only TCRß⁺ cells. The lower left quadrant of all four plots identifies TCRß⁺CD8^-CD4^- (DN) cells. The percentage of DN cells was significantly higher in the LNs of CD95-deficient mice that had been injected with peptide compared with the other three experimental groups. Further gating on the DN population also revealed that they were TCRß^low and B220⁺ (data not shown).

View larger version (65K): [in this window] [in a new window]   FIGURE 5. Three-color FACS analysis of LN cells from transgenic lpr/+ and lpr/lpr mice at 3 days after i.p. injection of PBS or specific peptide. Data acquisition was ungated. The analysis was performed by placing a size gate typical for lymphocytes followed by a gate on TCRßhigh cells, and the CD4 and CD8 expression of TCRß+ cells is shown. There is a dramatic increase in the proportion of DN TCRß+ T cells in the lpr/lpr animals that were injected with peptide.

View larger version (12K): [in this window] [in a new window]   FIGURE 6. Summary of data on the proportion of DN TCRß+ cells at days 3 and 10 for mice of lpr/+ (upper) and lpr/lpr (lower) genotypes. Data from controls are shown as , and data from peptide-injected animals are shown as •. In the lpr/lpr mice, there was a significant increase in the proportion of DN TCRß+ cells in the peptide-injected animals at day 3. This increase in DN TCRß+ cells returned to near control levels by day 10.

In CD95-deficient mice, there is accumulation of DN T cells in the LNs with age. It is not known whether any cells leave the DN pool, or whether the accumulation is due to a higher rate of entry than removal from the DN pool. Figure 6 shows that the percentage of DN cells in the LNs of CD95-deficient mice that had been injected with peptide had returned to near baseline values by day 10, which clearly demonstrates that cell loss from the DN pool is possible in the absence of CD95.

An unexpected finding was a trend in the peptide-injected mice of both genotypes for an increase in the percentage of DN cells at day 10 (Fig. 6). This increase was much smaller than the changes seen in the CD95-deficient, peptide-injected animals at day 3 and may be due to the relative loss of TCRß⁺CD8⁺ cells from the LNs or to the down-regulation of CD8 by TCRß cells (16). The number of mice at day 10 was too small to address this point definitively.

IHL numbers and phenotype

The requirement for CD95 in the process of hepatic T cell localization, accumulation, and subsequent removal is not known. Figure 7 shows the total numbers of IHLs from CD95-intact and CD95-deficient mice at 3 and 10 days after the injection of peptide or PBS. Unlike the LNs, there was a substantial increase in T cell numbers in the liver at day 3 after peptide injection. In the CD95-intact mice, the mean number of IHLs (in millions) went from 6.8 ± 3.8 in the PBS-injected group to 45.5 ± 10.3 in the peptide-injected group; in the CD95-deficient mice, the mean IHL number (in millions) went from 7.8 ± 2.4 to 35.5 ± 18.4. These increases are highly significant (p < 0.005). Although the mean increase following peptide injection at day 3 in the CD95-deficient mice was less than in the CD95-intact mice, this difference was not statistically significant. By day 10, the mean IHL numbers had decreased to baseline in mice of both genotypes. This increase in IHL numbers at day 3 in mice of both genotypes demonstrates that a hepatic accumulation of T cells was not inhibited by the lack of CD95. In addition, the return of the IHL numbers in the peptide-injected group to the same level as the PBS controls by day 10 shows that the presence of CD95 is not essential for the clearance of these IHLs.

View larger version (39K): [in this window] [in a new window]   FIGURE 7. Total numbers of IHLs per liver from the four experimental groups at days 3 and 10, showing a six- to sevenfold increase in IHL number in mice of both genotypes at day 3 after peptide injection. By day 10, the numbers of IHLs had returned to control levels.

View larger version (46K): [in this window] [in a new window]   FIGURE 8. CD4 and CD8 expression on IHLs from lpr/+ mice at 3 days after peptide injection. Acquisition was ungated, and analysis was gated on size as well as TCRß. Two CD8+ T cell populations are visible (CD8+ high (region A) and CD8+ low (region B)) as well as a DN population (region C).

View larger version (12K): [in this window] [in a new window]   FIGURE 9. Plots of the percentage of DN cells in the IHLs of lpr/+ and lpr/lpr mice at both timepoints for the PBS- and peptide-injected groups. PBS-injected = ; peptide-injected = •. There was a significant decrease in the percentage of DN cells at day 3 in the peptide-injected animals of both genotypes, which returned to near baseline at day 10.

View larger version (14K): [in this window] [in a new window]   FIGURE 10. Plots of the ratio of CD8high/CD8low in the IHLs of lpr/+ and lpr/lpr mice at both timepoints in PBS controls and peptide-injected mice. PBS-injected = ; peptide-injected = •. There was a significant increase in the CD8high/CD8low ratio at day 3 in the peptide-injected animals of both genotypes, which returned to baseline at day 10.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

The suppression of lymphadenopathy and the inhibition of the development of DN cells due to the introduction of a TCRtg was first observed in MHC class I-restricted, anti-H-Y, TCR-transgenic, CD95-deficient mice (12) and was subsequently observed in a class II-restricted, TCR-transgenic model (10). Our experimental animals were SV40 peptide-specific, MHC class I-restricted, TCR-transgenic and either CD95-intact (lpr/+) or CD95-deficient (lpr/lpr). Similar to the above studies, the presence of the TCRtg significantly affected the CD95-deficient phenotype. The TCRtg⁺ CD95-deficient animals developed minimal lymphadenopathy and maintained a LN DN T cell percentage that was similar to that seen with the CD95-intact animals (<5%) for ages up to 20 wk. There are many theoretical reasons why the introduction of a TCRtg may limit the development of DN cells. DN cells may originate from a subpopulation of T cells with a particular TCR repertoire. The introduction of a TCRtg significantly decreases the TCR repertoire, and there may therefore be fewer DN precursors in TCR-transgenic mice. Alternatively, the TCR specificity may be irrelevant to the development of DN cells, the crucial factor being activation in the absence of CD95. The present study shows that DN cells appear in the LNs of CD95-deficient mice at 3 days after specific signaling thorough the TCR. This finding demonstrates that DN cells appear as a direct consequence of signaling through the TCR. The reduction in lymphadenopathy on crossing a TCRtg onto the lpr/lpr genotype must therefore be the result of a decreased activation of T cells over time due to the very limited TCR repertoire of the TCR-transgenic animals.

Many independent lines of evidence suggest that CD8⁺ T cells are the precursors of DN cells in the lpr/lpr mouse. These include the selection of the TCR repertoire of DN cells on MHC class I molecules (8), the methylation pattern of the CD8 gene in DN cells, and the loss of lymphadenopathy in the CD95-deficient, ß₂-microglobulin knockout mouse (22, 23, 24, 25, 26). In our system, the appearance of DN cells after the stimulation of TCR on CD8 cells further strengthens this conclusion. Moreover, the ninefold increase in the percentage of DN cells without a significant increase in the total LN cell number suggests that the DN cells originated from a preexisting cell population without significant expansion. Virtually all of the TCRß⁺ high cells in the LNs are CD8⁺, and a decrease in the percentage of TCRß⁺ high cells at day 3 identifies these cells as undergoing the phenotype change to DN upon TCR stimulation. These data support a model of the down-regulation of CD8 by TCRß⁺CD8⁺ T cells upon TCR stimulation to produce a DN phenotype, without a significant expansion of the TCRß⁺CD8⁺ cells before the down-regulation of CD8 or of the DN cells after the down-regulation of CD8. The greater percentage of DN cells on day 3 after peptide administration in lpr/lpr mice compared with lpr/+ mice might be due to an increased rate of production or a decreased rate of the removal of DN cells in the lpr/lpr mice. We cannot definitively address this possibility, but the decrease in the percentage of TCRß⁺ high cells at day 3 in the lpr/+ and lpr/lpr mice upon peptide administration was similar. This similarity suggests that conversion to the DN phenotype was also similar in these genotypes, with the overall increased DN percentage being due to a delay in removal in the lpr/lpr mice.

A loss of CD8⁺ T cells from the LNs could occur by apoptosis in situ or by exit from the LNs. We were not able to detect an increase in subdiploidy by PI staining, suggesting that apoptosis in the LNs was not a prominent feature of CD8⁺ T cell loss from the LNs; however, apoptosis does occur to some degree, as demonstrated by terminal deoxynucleotidyl transferase-mediated nick-end labeling staining (27, 28). Whether cells leave the DN pool is more controversial. The removal of cells from the DN pool in lpr/lpr mice was suggested by 5-bromo-2'-deoxyuridine-labeling studies that estimated entry into the DN pool to be 15% in 12 h (12). Such a rate of influx would lead to a doubling in 2 to 3 days if cells were not also leaving the DN pool and is faster than the increase in the LN cell numbers seen in the nontransgenic CD95-deficient mice. Figure 6 shows that the increase in the percentage of DN cells at day 3 in lpr/lpr mice upon peptide injection returned to near PBS-injected control values by day 10. This loss of cells from the DN pool has not been demonstrated before and provides evidence for the presence of backup mechanisms for the removal of these cells. In both genotypes, there was a trend at day 10 for an increase in the percentage of DN cells upon peptide administration compared with PBS-injected controls. This increase may be due to a reduction in the total number of CD8⁺ T cells, but the limited number of animals available at day 10 does not allow for a definite statement on this point.

Collectively, the above data demonstrate that peripheral deletion, as defined by the loss of mature peripheral T cells from the LNs after activation, occurs in both CD95-intact and CD95-deficient mice. Although CD95 is not essential for CD8⁺ T cell peripheral deletion, it does have a role in this process, because in the absence of CD95 there is an increase in the percentage of DN cells due to delayed clearance.

The changes in the IHL numbers and phenotypes were quite different from those in the LN T cell populations. There was a six- to sevenfold increase in the IHL number at day 3 after peptide injection in both CD95-intact and CD95-deficient mice, but the increase in DN cells that was seen in the LNs of the CD95-deficient mice did not occur in the liver. The total number of DN IHLs was unchanged. The increase in the total number of IHLs and in the proportion of TCRßCD8^- high cells in the liver after peptide injection is entirely consistent with the trafficking of activated CD8⁺ T cells to the liver (13). The lack of a change in the DN cell number in the livers of CD95-deficient animals upon peptide injection demonstrates the presence of a very efficient CD95-independent mechanism in the liver for T cell removal. There are many candidates for this mechanism. The liver contains NK cells, NK T cells, and Kupffer cells, all of which have cytotoxic capabilities. At a molecular level, TNF-, perforin, and galectin-1 are all present in the liver and can induce apoptosis in activated cells (29, 30, 31, 32).

In summary, we have identified a physiologic role for CD95 after TCR stimulation. In the presence of CD95, there is an efficient removal of TCRß⁺CD8⁺ cells after the down-regulation of CD8. However, CD95 is not essential for the removal of TCRß CD8 cells; other mechanisms can compensate, although these mechanisms are less efficient. In the absence of CD95, DN cells appear due to the stimulation of TCRß⁺CD8⁺ cells via the TCR. These DN cells are not an immortal population as previously proposed (33) and are cleared by CD95-dependent and -independent mechanisms.

	Footnotes

 
¹ This work was supported by National Institutes of Health Grant 1-RO1-AI37554 and by the Liver Center at Yale University. W.Z.M. is the recipient of a Howard Hughes Medical Institute Physician Postdoctoral Fellowship.

² Address correspondence and reprint requests to Dr. Wajahat Z. Mehal, Section of Immunobiology, Yale School of Medicine, P.O. Box 208011, TE407, New Haven, CT 06520-8011.

³ Abbreviations used in this paper: DN, double-negative; LN, lymph node; tg, transgene; IHL, intrahepatic lymphocytes; PI, propidium iodide.

Received for publication December 12, 1997. Accepted for publication April 14, 1998.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Andrews, B. S., R. A. Eisenberg, A. N. Theofilopoulos, S. Izui. 1978. Spontaneous murine lupus-like syndromes: clinical and immunopathological manifestations in several strains. J. Exp. Med. 148:1198.[Abstract/Free Full Text]
2. Watanabe-Fukunaga, R., C. I. Brannan, N. G. Copeland, N. A. Jenkins, S. Nagata. 1992. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature 356:314.[Medline]
3. Steinberg, A. D.. 1994. MRL-lpr/lpr disease: theories meet Fas. Semin. Immunol. 6:55.[Medline]
4. Wu, J., T. Zhou, J. Zhang, J. He, W. C. Gause, J. D. Mountz. 1994. Correction of accelerated autoimmune disease by early replacement of the mutated lpr gene with the normal Fas apoptosis gene in the T cells of transgenic MRL-lpr/lpr mic. Proc. Natl. Acad. Sci. USA 91:2344.[Abstract/Free Full Text]
5. Itoh, N., S. Yonehara, S. Ishii, M. Yonehara, S. Mizushima, M. Sameshima, A. Hase, Y. Seto, S. Nagata. 1991. The polypeptide encoded by the cDNA for the human cell surface antigen Fas can mediate apoptosis. Cell 66:233.[Medline]
6. Owen-Schaub, L. B., S. Yonehara, W. L. Crump, E. A. Grimm. 1992. DNA fragmentation and cell death is selectively triggered in activated human lymphocytes by Fas antigen engagement. Cell. Immunol. 140:197.[Medline]
7. Steinberg, A. D., J. B. Roths, E. D. Murphy, R. T. Steinberg, E. S. Raveche. 1980. Effects of thymectomy or androgen administration upon the autoimmune disease of MRL/Mp-lpr/lpr mice. J. Immunol. 125:871.[Abstract]
8. Herron, L. R., R. A. Eisenberg, E. Roper, V. N. Kakkaniah, P. L. Cohen, B. L. Kotzin. 1993. Selection of the TCR repertoire in lpr mice. J. Immunol. 151:3450.[Abstract]
9. Kotzin, B. L., S. K. Babcock, L. R. Herron. 1988. Deletion of potentially self-reactive TCR specificities in L3T4^-, Lyt-2-T cells of lpr mice. J. Exp. Med. 168:2221.[Abstract/Free Full Text]
10. Singer, G. G., A. K. Abbas. 1994. The Fas antigen is involved in peripheral but not thymic deletion of T lymphocytes in T cell receptor transgenic mice. Immunity 1:365.[Medline]
11. Landolfi, M. M., N. van Houten, J. Q. Russell, R. Scollay, J. R. Parnes, R. C. Budd. 1993. CD2^-CD4^-CD8^- lymph node T lymphocytes in MRL lpr/lpr mice are derived from a CD2⁺CD4⁺CD8⁺ thymic precursor. J. Immunol. 151:1086.[Abstract]
12. Mountz, J. D., H. Bluethmann, T. Zhou, J. Wu. 1994. Defective clonal deletion and anergy induction in TCR transgenic lpr/lpr mice. Semin. Immunol. 6:27.[Medline]
13. Huang, L., G. Soldevila, M. Leeker, R. A. Flavell, I. N. Crispe. 1994. The liver eliminates T cells undergoing antigen-triggered apoptosis in vivo. Immunity 1:741.[Medline]
14. Crispe, I. N., W. Z. Mehal. 1996. Strange brew: T cells in the liver. Immunol. Today 17:522.[Medline]
15. Geiger, T., L. R. Gooding, R. A. Flavell. 1992. T-cell responsiveness to an oncogenic peripheral protein and spontaneous autoimmunity in transgenic mice. Proc. Natl. Acad. Sci. USA 89:2985.[Abstract/Free Full Text]
16. Renno, T., M. Hahne, J. Tschopp, H. R MacDonald. 1996. Peripheral T cells undergoing superantigen-induced apoptosis in vivo express B220 and upregulate Fas and Fas ligand. J. Exp. Med. 183:431.[Abstract/Free Full Text]
17. Drappa, J., N. Brot, K. B. Elkon. 1993. The Fas protein is expressed at high levels on CD4⁺CD8⁺ thymocytes and activated mature lymphocytes in normal mice but not in the lupus-prone strain, MRL lpr/lpr. Proc. Natl. Acad. Sci. USA 90:10340.[Abstract/Free Full Text]
18. Crispe, I. N.. 1994. Fatal interactions: Fas-induced apoptosis of mature T cells. Immunity 1:347.[Medline]
19. Mountz, J. D., T. M. Smith, K. S. Toth. 1990. Altered expression of self-reactive TCR Vß regions in autoimmune mice. J. Immunol. 144:2159.[Abstract]
20. Sytwu, H. K., R. S. Liblau, H. O. McDevitt. 1996. The roles of Fas/APO-1 (CD95) and TNF in antigen-induced programmed cell death in TCR transgenic mice. Immunity 5:17.[Medline]
21. Zimmermann, C., M. Rawiel, C. Blaser, M. Kaufman, H. Pircher. 1996. Homeostatic regulation of CD8⁺ T cells after antigen challenge in the absence of Fas (CD95). Eur. J. Immunol. 26:2903.[Medline]
22. Ohteki, T., M. Iwamoto, S. Izui, H. R. MacDonald. 1995. Reduced development of CD4–8-B220⁺ T cells but normal autoantibody production in lpr/lpr mice lacking major histocompatibility complex class I molecules. Eur. J. Immunol. 25:37.[Medline]
23. Maldonado, M. A., R. A. Eisenberg, E. Roper, P. L. Cohen, B. L. Kotzin. 1995. Greatly reduced lymphoproliferation in lpr mice lacking major histocompatibility complex class I. J. Exp. Med. 18:641.
24. Giese, T., W. F. Davidson. 1995. In CD8⁺ T cell-deficient lpr/lpr mice, CD4⁺B220⁺ and CD4⁺B220^- T cells replace B220⁺ double-negative T cells as the predominant populations in enlarged lymph nodes. J. Immunol. 154:4986.[Abstract]
25. Mixter, P. F., J. Q. Russell, F. H. Durie, R. C. Budd. 1995. Decreased CD4^-CD8^- TCR-ß⁺ cells in lpr/lpr mice lacking ß₂-microglobulin. J. Immunol. 154:2063.[Abstract]
26. Christianson, G. J., W. Brooks, S. Vekasi, E. A. Manolfi, J. Niles, S. L. Roopenian, J. B. Roths, R. Rothlein, D. C. Roopenian. 1997. ß₂-microglobulin-deficient mice are protected from hypergammaglobulinemia and have defective antibody responses because of increased IgG catabolism. J. Immunol. 159:4781.[Abstract]
27. Liblau, R. S., R. Tisch, K. Shokat, X. D. Yang, N. Dumont, C. C. Goodnow, H. O McDevitt. 1996. Intravenous injection of soluble antigen induces thymic and peripheral T cell apoptosis. Proc. Natl. Acad. Sci. USA 93:3031.[Abstract/Free Full Text]
28. Wack, A., P. Corbella, N. Harker, I. N. Crispe, D. Kioussis. 1997. Multiple sites of post-activation CD8⁺ T cell disposal. Eur. J. Immunol. 27:577.[Medline]
29. Perillo, N. L., K. E. Pace, J. J. Seilhamer, L. G. Baum. 1995. Apoptosis of T cells mediated by galectin-1. Nature 378:736.[Medline]
30. Lotan, R., P. N. Belloni, R. J. Tressler, D. Lotan, X. C. Xu, G. L. Nicholson. 1994. Expression of galectins on microvessel endothelial cells and their involvement in tumour cell adhesion. Glycoconj. J. 11:462.[Medline]
31. Winnock, M., M. G. Barcina, B. Lukomska, P. Bioulac-Sage, C. Balabaud. 1993. Liver-associated lymphocytes: role in tumor defense. Semin. Liver. Dis. 13:81.[Medline]
32. Winwood, P. J., M. J. Arthur. 1993. Kupffer cells: their activation and role in animal models. Semin. Liver. Dis. 13:50.[Medline]
33. Huang, L., K. Sye, I. N. Crispe. 1994. Proliferation and apoptosis of B220⁺CD4^-CD8^-TCR/ß^intermediate T cells in the liver of normal mice: implication for lpr pathogenesis. Int. Immunol. 6:533.[Abstract/Free Full Text]

This article has been cited by other articles:

				J. C. Crispin and G. C. Tsokos Human TCR-{alpha}{beta}+ CD4- CD8- T Cells Can Derive from CD8+ T Cells and Display an Inflammatory Effector Phenotype J. Immunol., October 1, 2009; 183(7): 4675 - 4681. [Abstract] [Full Text] [PDF]

				M. S. Ford, Z.-X. Zhang, W. Chen, and L. Zhang Double-Negative T Regulatory Cells Can Develop Outside the Thymus and Do Not Mature from CD8+ T Cell Precursors. J. Immunol., September 1, 2006; 177(5): 2803 - 2809. [Abstract] [Full Text] [PDF]

				H. Xu, H. Kurihara, T. Ito, H. Kikuchi, K. Yoshida, H. Yamanokuchi, and A. Asari The Keratan Sulfate Disaccharide Gal(6S03) {beta}1,4-GlcNAc(6S03) Modulates Interleukin 12 Production by Macrophages in Murine Thy-1 Type Autoimmune Disease J. Biol. Chem., May 27, 2005; 280(21): 20879 - 20886. [Abstract] [Full Text] [PDF]

				E. Priceputu, I. Rodrigue, P. Chrobak, J. Poudrier, T. W. Mak, Z. Hanna, C. Hu, D. G. Kay, and P. Jolicoeur The Nef-Mediated AIDS-Like Disease of CD4C/Human Immunodeficiency Virus Transgenic Mice Is Associated with Increased Fas/FasL Expression on T Cells and T-Cell Death but Is Not Prevented in Fas-, FasL-, Tumor Necrosis Factor Receptor 1-, or Interleukin-1{beta}-Converting Enzyme-Deficient or Bcl2-Expressing Transgenic Mice J. Virol., May 15, 2005; 79(10): 6377 - 6391. [Abstract] [Full Text] [PDF]

				S. C. McKarns and R. H. Schwartz Distinct Effects of TGF-{beta}1 on CD4+ and CD8+ T Cell Survival, Division, and IL-2 Production: A Role for T Cell Intrinsic Smad3 J. Immunol., February 15, 2005; 174(4): 2071 - 2083. [Abstract] [Full Text] [PDF]

				D. A. Murray and I. N. Crispe TNF-{alpha} Controls Intrahepatic T Cell Apoptosis and Peripheral T Cell Numbers J. Immunol., August 15, 2004; 173(4): 2402 - 2409. [Abstract] [Full Text] [PDF]

				Y. Do, A. Q. Rafi-Janajreh, R. J. Mckallip, P. S. Nagarkatti, and M. Nagarkatti Combined deficiency in CD44 and Fas leads to exacerbation of lymphoproliferative and autoimmune disease Int. Immunol., November 1, 2003; 15(11): 1327 - 1340. [Abstract] [Full Text] [PDF]

				X. Shi, C. Xie, D. Kreska, J. A. Richardson, and C. Mohan Genetic Dissection of SLE: SLE1 and FAS Impact Alternate Pathways Leading to Lymphoproliferative Autoimmunity J. Exp. Med., August 5, 2002; 196(3): 281 - 292. [Abstract] [Full Text] [PDF]

				L. A. Trimble, K. A. Prince, G. A. Pestano, J. Daley, and H. Cantor Fas-Dependent Elimination of Nonselected CD8 Cells and lpr Disease J. Immunol., May 15, 2002; 168(10): 4960 - 4967. [Abstract] [Full Text] [PDF]

				M. Toungouz, M. Libin, F. Bulte, L. Faid, F. Lehmann, D. Duriau, M. Laporte, D. Gangji, C. Bruyns, M. Lambermont, et al. Transient expansion of peptide-specific lymphocytes producing IFN-{gamma} after vaccination with dendritic cells pulsed with MAGE peptides in patients with mage-A1/A3-positive tumors J. Leukoc. Biol., June 1, 2001; 69(6): 937 - 943. [Abstract] [Full Text] [PDF]

				T. Dao, M. Exley, W. Z. Mehal, S. M. A. Tahir, S. Snapper, M. Taniguchi, S. P. Balk, and I. N. Crispe Involvement of CD1 in Peripheral Deletion of T Lymphocytes Is Independent of NK T Cells J. Immunol., March 1, 2001; 166(5): 3090 - 3097. [Abstract] [Full Text] [PDF]

				S. Brochu, B. Rioux-Masse, J. Roy, D.-C. Roy, and C. Perreault Massive Activation-Induced Cell Death of Alloreactive T Cells With Apoptosis of Bystander Postthymic T Cells Prevents Immune Reconstitution in Mice With Graft-Versus-Host Disease Blood, July 15, 1999; 94(2): 390 - 400. [Abstract] [Full Text] [PDF]

				M. Han, L. Harrison, P. Kehn, K. Stevenson, J. Currier, and M. A. Robinson Invariant or Highly Conserved TCR {alpha} Are Expressed on Double-Negative (CD3+CD4-CD8-) and CD8+ T Cells J. Immunol., July 1, 1999; 163(1): 301 - 311. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Mehal, W. Z. Articles by Crispe, I. N. Search for Related Content PubMed PubMed Citation Articles by Mehal, W. Z. Articles by Crispe, I. N.