The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirkham, P. A.
Right arrow Articles by Parkhouse, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirkham, P. A.
Right arrow Articles by Parkhouse, E.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 1998, 161: 1630-1636.
Copyright © 1998 by The American Association of Immunologists

Transcription Factor E2F Controls the Reversible {gamma}{delta} T Cell Growth Arrest Mediated Through WC11

Paul A. Kirkham2,*, Eric W.-F. Lam{dagger}, Haru-Hisa Takamatsu*, R. Michael* and E. Parkhouse*

* Department of Immunology, Institute for Animal Health, Pirbright, Surrey, United Kingdom; and {dagger} Ludwig Institute for Cancer Research and Department of Medical Microbiology, Imperial College School of Medicine at St Mary’s Hospital, London, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-2-stimulated expansion of T cells requires continued and sequential passage of the dividing cells through a major cell cycle check point in the G1 phase. We have previously shown that a {gamma}{delta} T cell-specific surface receptor, WC1, induces G0/G1 growth arrest, reversible with Con A, in proliferating IL-2-dependent {gamma}{delta} T cells. We now show that this reversible WC1-induced cell cycle arrest is correlated with induction of the cyclin kinase inhibitor p27kip1 and an associated down-regulation in cyclins A, D2, and D3 expression, along with dephosphorylation of pocket proteins p107, p130, and pRb. Together with diminished pocket protein phosphorylation, p107 expression levels are significantly down-regulated in response to WC1 stimulation. This coordinated sequence of signaling events is focused on E2F regulation so that, downstream of the pocket proteins, WC1 stimulation results in a diminished DNA binding activity for free E2F as a consequence of reduced E2F1 expression, whereas E2F4 expression is unaffected. Consistent with this interpretation, overexpression of E2F1 overcomes the growth-arresting effects induced by WC1 stimulation. Finally, in accordance with our previous observations at both the cellular and molecular level, subsequent mitogen stimulation can reverse all the above changes induced by WC1. These results, focused on E2F regulation, therefore provide a first insight into the effects of both positive (mitogen) and negative (anti-WC1) stimuli on cell cycle control in IL-2-dependent {gamma}{delta} T cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In man and in mice, the {gamma}{delta} T lymphocyte is preferentially targeted to the mucosal surfaces, whereas in ruminants large numbers may also be found in peripheral blood (1). Their functions are varied, but in certain respects they appear to form part of the innate immune system rather than the acquired. Indeed the ability of {gamma}{delta} T cells to respond faster to Ag than their {alpha}ß T cell counterparts (2), allied to their ability to secrete various cytokines, has led to the possibility that {gamma}{delta} T cells may regulate both the acquired and innate immune responses (3). Extracellular signals that regulate {gamma}{delta} T cell proliferation would therefore be central to modulating an immune response directed through them. In contrast to the well-studied {alpha}ß T cells, however, little is known about the mechanisms that regulate {gamma}{delta} T cell proliferation, although, interestingly, {gamma}{delta} T cells do not recognize Ag in the context of MHC, as do {alpha}ß T cells (4). Recently, we demonstrated that IL-2-dependent {gamma}{delta} T cells can be arrested in the presence of IL-2 at the G0/G1 phase of the cell cycle when WC1, a large type 1 transmembrane protein, is engaged by a corresponding mAb (5, 6). This is accompanied by extensive intracellular tyrosine dephosphorylation of several proteins, including the MAP3 kinase erk2 (6). Furthermore, the process can be reversed or overridden, allowing the {gamma}{delta} T cells to reenter the cell cycle, by mitogen stimulation through the TCR, provided IL-2 is present. It should be noted that, while expression of WC1 has to date not been detected in mouse or human {gamma}{delta} T cells, they nevertheless do possess the gene and may yet be found to express it (7).

Mitogenic stimuli, such as IL-2 and TCR stimulation, exert their effects primarily during the G1 phase of the cell cycle before a major restriction point "R" in mammalian cell cycle progression. After this point the cell becomes refractory to further extracellular stimuli and is now committed to one round of the cell division (8). Likewise, growth-inhibiting stimuli, such as cell-cell contact inhibition or TGF-ß stimulation, also exert their effects during G1 (9). The pocket proteins pRb, p107, and p130 play a key role in cell cycle regulation (reviewed by Grana in 10 . During G1, pRb and p130 are responsible for controlling cell cycle progression and function to regulate the transcriptional activity of the E2F family of proteins (11, 12, 13, 14, 15). The pocket proteins are regulated by the cyclin-cdk complexes, which control serine and threonine phosphorylation, hyperphosphorylation rendering them inactive, thus preventing E2F sequestration. Control of the cyclin-cdk complexes is itself subject to regulation by a group of proteins called cyclin kinase inhibitors (cki) through physical association (10). It is at this level that IL-2 and platelet-derived growth factor (PDGF) can exert their mitogenic effect by down-regulating the expression of a cki, p27kip1 (16, 17, 18). Growth inhibitory stimuli, on the other hand, such as TGF-ß and cell-cell contact inhibition, increase p27kip1 expression (9). Interestingly, TCR stimulation also results in p27kip1 induction, halting proliferation until a second signal through IL-2 removes p27kip1 expression (17). This would explain the necessity for IL-2 after TCR stimulation of S-59 {gamma}{delta} T cells in overcoming WC1-induced growth arrest (5).

In this work we have investigated the cell cycle mechanism through which WC1 induces growth arrest. This has been achieved by assessing the effects of both negative (anti-WC1) and positive (Con A) stimuli at various levels of cell cycle control: E2F transcriptional/DNA binding activity, pocket protein phosphorylation, and expression status, and the effect of these stimuli on cyclin and cki expression levels.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissue culture, cell treatment, and Abs

IL-2-dependent ovine S-59 {gamma}{delta} T lymphocytes having a phenoytpe similar to that found in peripheral blood (5, 19) were cultured in Iscove’s modified MEM supplemented with 10 U/ml IL-2 as previously described (6). For anti-WC1 or mitogen treatment, S-59 cells were incubated with 20 µg/ml mAb SC-29 or 10 µg/ml Con A at 37°C. Mouse mAbs against WC1 (SC-29; IgG1) and IgM (ILA-30; IgG1) were described previously (6). Abs for Western blotting against E2F1 (C-20), E2F4 (C-108), pRb (C-15), p107 (C-18), p130 (C-20), cyclin D2 (M-20), cyclin D3 (C-16), cyclin A (C-19), cyclin E (M-20), and p27kip1 (N-20) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Horseradish peroxidase (HRP)-labeled goat anti-rabbit Ig and rabbit anti-goat Ig were obtained from Southern Biotechnology Associates (Birmingham, AL). Abs for supershift analysis were obtained as follows; rabbit anti-p130 antiserum was kindly provided by Dr. A. Giordano (Jefferson Medical School, Philadelphia, PA); mouse anti-pRb mAb (21C9) and mouse anti-p107 mAb (SD15) were generous gifts from Dr. S. Mittnacht (Institute of Cancer Research, London, U.K.) and Prof. N. Dyson (Massachusetts General Hospital Cancer Center, Boston, MA), respectively; rabbit anti-E2F1, anti-E2F4, and anti-DP1 antisera were raised against peptides corresponding to unique carboxyl-terminal regions of the respective proteins. Mouse anti-human IL-2{alpha}-chain (mAb 7G7/B6) (20) was kindly provided by Dr. T. Wileman (Institute for Animal Health, Pirbright, U.K.) and found not to cross react with ovine S-59 {gamma}{delta} T cells.

Flow cytometric analysis

Cell cycle analysis was performed by flow cytometry with a Becton Dickinson FACScan using Lysis II software. Briefly, cells were harvested, washed with PBS, then ethanol fixed and RNase digested, followed by propidium iodide staining as described previously (5).

Western blotting

Cells (5 x 106) were lysed with 40 µl RIPA lysis buffer (1% (v/v) Triton X-100, 1% (v/v) deoxycholate, 0.1% (v/v) SDS, 50 mM Tris, pH7.4, 150 mM NaCl, 0.1% (w/v) sodium azide, 1 mM EDTA and EGTA, 0.5 mM sodium orthovanadate, 10 mM sodium fluoride, 10 mM sodium pyrophosphate, 100 µg/ml aprotonin, 10 µg/ml soybean trypsin inhibitor, 1 µg/ml leupeptin, 5 µg/ml each of TLCK and TPCK, and 1 mM PMSF) for 30 min on ice. The lysate was minifuged at 14000 rpm for 5 min at 4°C, and the supernatant was assayed for total protein content using the Pierce (Chester, U.K.) BCA protein assay. The lysate (10 µg of protein) was resolved by reducing SDS PAGE, and the proteins were then transferred to nitrocellulose membrane. The membrane was blocked with 10% (w/v) dried milk (Marvel) in PBST (PBS containing 0.05% (v/v) Tween 20) for 1 h at room temperature, followed by probing with primary Ab (1:1000 dilution in blocking solution) overnight at 4°C. After extensive washing with PBST (20 min per wash, repeated 6 times), primary Ab was detected with the appropriate secondary Ab (diluted 1:1000 in blocking solution) for 30 min at room temperature. After three further PBST washes, 20 min each, the blot was visualized with the Pierce Supersignal/Supersignal-ultra chemiluminescence system.

Gel retardation and supershift assays

These assays were essentially performed as previously described (21). Briefly, after treating 5 x 106 S-59 cells with anti-WC1 followed by Con A (as required) for the appropriate time period, the cells were harvested and washed with PBS, and then whole cell extracts were prepared as previously described (22). Protein content was quantified using the Pierce BCA protein assay. Whole cell extract (20 µg) was incubated for 10 min at 30°C with 1 to 2 ng 32P-labeled DNA probe (dsDNA containing the distal E2F binding site from the type 5 E2a promoter: TAGTTTTCGCGCTTAAATTTGA) in 20 µl binding buffer, which also contains the mutant E2F binding site oligo (TAGTTTTCGATATTAAATTTGA) as described elsewhere (22). The reaction mix was then separated by 4% (v/v) PAGE using a x0.3 TBE running buffer. The gels were then fixed in 10% (v/v) glacial acetic acid, 10% (v/v) ethanol for 30 min, dried, and autoradiographed. Supershift assays were performed by adding 1 µl of concentrated Ab to the gel shift reaction mix and allowing it to incubate for 5 min at 30°C before addition of the radiolabeled probe.

E2F1 overexpression assay

The expression vectors used in these experiments have been described elsewhere; expression vectors containing E2F1 (23) and mutant E2F1 (23) were kindly provided by Prof. J. Nevins (Duke University Medical Center, Durham, NC), and the expression vector containing human IL-2{alpha}-chain (24) was generously provided by Dr. T. Wileman. S-59 {gamma}{delta} T cells (1 x 107) were either left untreated or cotransfected with 5 µg E2F1 or mutant E2F1 expression vector with 1 µg IL-2{alpha}-chain expression vector using the Promega (Southampton, U.K.) Superfect transfection system as per the manufacturer’s instructions for nonadherent cells. After 24 h expression, the cells were harvested, and human IL-2{alpha}-chain-expressing cells were positively purified using a mouse anti-human IL-2{alpha}-chain mAb on a miniMACS cell purification system (Miltenyi Biotech, Bisley, U.K.). The purified cells were then incubated for a further 18 h with anti-WC1 (mAb SC-29) or an isotype-matched negative control mAb (anti-IgM; ILA-30), followed by pulse labeling with tritiated thymidine for 6 h as previously described (5). The effect of anti-WC1 treatment on cell proliferation (cell cycle progression) is expressed as a percentage thymidine uptake (mean ± SEM for triplicate determinations) relative to that for negative control mAb-treated cells for each transfection condition. The data are also presented as percentage recovery of cells overcoming anti-WC1-induced growth arrest by wild-type E2F1 overexpression relative to those cells expressing mutant E2F1. This is calculated as follows: [(X-Y)/(100-Y)] x 100, where X = percent thymidine uptake for anti-WC1-treated cells of interest and Y = percent thymidine uptake for cells expressing mutant E2F1 treated with anti-WC1.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
WC1 induces G0/G1 cell cycle arrest, reversible through mitogen stimulation

The reversibility of WC1-induced growth arrest of {gamma}{delta} T lymphocytes with mitogen is demonstrated in Figure 1Go. This shows the cell cycle analysis profile for {gamma}{delta} T cells left untreated, incubated with 20 µg/ml anti-WC1 mAb only for 24 h, and treated with anti-WC1 mAb for 24 h followed by 10 µg/ml Con A for a further 24 h. The untreated {gamma}{delta} T cells contain 59% G0/G1 cells and 38% of cells in S/G2/M phase. When the cells are incubated with anti-WC1 only, the number of cells entering G0/G1 phase increased to 76%, and the percentage of cells in S/G2/M phase decreased to 20%, indicative of cell cycle arrest in G0/G1 phase. However, when the cells were subsequently incubated with Con A after anti-WC1 treatment, the {gamma}{delta} T cells returned to normal cell cycling with a cell cycle profile similar to that for untreated cells, with the percentage distribution consisting of 62% in G0/G1 and 35% in S/G2/M phase.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 1. WC1-induced growth arrest is reversed by subsequent Con A stimulation. S-59 {gamma}{delta} T cells were left untreated or treated with 20 µg/ml anti-WC1 mAb for 24 h. Half the WC1-stimulated cells were also incubated for a further 24 h with 10 µg/ml Con A. The cells were harvested, and DNA content was analyzed by FACS after propidium iodide staining of RNase-digested, fixed cells. All other conditions are as detailed in Materials and Methods.

 
WC1 diminishes pocket protein phosphorylation and expression

Since it is difficult to distinguish between G0 and G1 phases of the cell cycle by FACS analysis, another approach is needed to determine exactly where WC1 activation exerts its affect on the cell cycle. Three major pocket proteins, the retinoblastoma protein (Rb), p107, and p130, each having an influence at different stages during G0/G1 of the cell cycle, were investigated. Using Western blot analysis, Figure 2Go shows that 24-h treatment of {gamma}{delta} T cells with an anti-WC1 mAb resulted in a dramatic dephosphorylation of Rb from the hyperphosphorylated form, as seen by its increased mobility on SDS PAGE. Similarly, both p107 and p130 also underwent dephosphorylation. Dephosphorylation of p107, on the other hand, was accompanied by a general decrease in the overall expression level of p107 after 24 h anti-WC1 treatment. Mitogen stimulation with 10 µg/ml Con A after prior WC1 ligation resulted in an increase in the slower migrating hyperphosphorylated form for all three pocket proteins Rb, p107, and p130. After 6 h Con A treatment, some phosphorylation of pRb and p130 had commenced and by 12 h was more pronounced and apparently complete for p130. Only after 24 h was pRb phosphorylation complete. In addition, the expression status of p107 after 24 h mitogen treatment returned to a level comparable to that before WC1 ligation, although significantly more p107 was in a hyperphosphorylated form.



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 2. WC1 induces pocket protein dephosphorylation and changes in expression, which is reversed by Con A stimulation. S-59 {gamma}{delta} T cells were treated with 20 µg/ml anti-WC1 mAb, then 10 µg/ml Con A for the indicated times. Cells were lysed, and detergent soluble proteins were resolved by 5% SDS PAGE, transferred to nitrocellulose, then analyzed by Western blot for pRb, p107, and p130, as described in Materials and Methods. Slower moving hyperphosphorylated and faster moving hypophosphorylated protein is marked as hyper and hypo respectively.

 
WC1 down-regulates the E2F family of transcription factors

To determine what effect regulation of pocket protein status may have on regulation of the cell cycle at a transcriptional level, we examined the effect of anti-WC1 treatment on E2F activity. Using a 32P-labeled DNA oligomer coding for the E2F binding domain and incubating it with nuclear extracts from untreated and anti-WC1 mAb-treated {gamma}{delta} T cells, WC1 receptor stimulation resulted in decreased free-E2F DNA binding over a 24-h period (band A in Fig. 3GoA). It is also apparent that other higher order E2F/protein complexes were not affected by WC1 ligation (bands B and C in Fig. 3GoA). When the {gamma}{delta} T cells were then stimulated with 10 µg/ml Con A, the free E2F DNA binding returns after 12 h. Interestingly, however, a reduction in free E2F DNA binding was again seen after 24 h Con A stimulation, while the effect on higher order E2F/protein complexes remained unaffected throughout the 24 h stimulation with Con A.



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 3. Band shift analysis identifies reduced free E2F DNA binding activity following anti-WC1 treatment, but reinstated after subsequent Con A stimulation. A, Whole cell extracts, prepared from S-59 {gamma}{delta} T cells treated with 20 µg/ml anti-WC1 mAb and 10 µg/ml Con A as indicated, are incubated with a 32P-labeled oligonucleotide containing an E2F DNA binding site as a probe. The reaction mixes are resolved by 4% PAGE, fixed, dried and then autoradiographed. Free E2F DNA binding activity is identified as band A, higher order E2F DNA binding complexes as bands B and C. Supershift analysis to determine the composition of the various E2F DNA binding complexes was performed on untreated S-59 {gamma}{delta} T cells (B) and cells treated with 20 µg/ml anti-WC1 for 24 h (C). The Abs used for supershift analysis are as indicated in the figure. Further details are described in Materials and Methods.

 
Using Abs against the pocket proteins pRb, p107, and p130 and against the E2F proteins E2F1 and E2F4, supershift analysis enabled the partial characterization of the DNA-protein complexes seen in the band shift assay (Fig. 3GoA). Figure 3Go, B and C, displays the results of the supershift assay while the cells are still cycling in the absence of anti-WC1 (Fig. 3GoB) and when arrested in the presence of anti-WC1 (Fig. 3GoC). The Abs to E2F1 and E2F4 remove the lower band (marked A) in Figure 3GoB, indicating that this complex contains both transcription factors E2F1 and E2F4. Anti-E2F4 is also able to shift both bands marked B and C in Figure 3Go, B and C. However, an Ab against DP1, a heterodimerization partner for E2F protein, was unable to supershift any of the bands observed in Figure 3Go, B and C. A likely explanation for this is that other DP proteins may play a more influential role in ovine {delta} T cells. Indeed, other DP proteins have been shown to be expressed in a tissue-restricted manner. (25, 26). Alternatively, an equally plausible explanation may simply be that our anti-DP1 Ab, which is active against murine DP1, is unable to recognize ovine DP1. As regards the pocket proteins, treatment with anti-p130 decreases the intensity for both bands B and C, whereas anti-p107 appears to affect only band C. Anti-Rb, on the other hand, affected only band B by decreasing its intensity slightly (Fig. 3Go, B and C). This suggests that band B contains the pocket proteins pRb and p130 in association with E2F4, whereas band C contains the pocket proteins p107 and p130 in association with E2F4. Therefore, these supershift results (Fig. 3Go, B and C) in association with the band shift result (Fig. 3GoA) indicate that WC1 receptor activation decreases free E2F DNA binding for the transcription factors E2F1 and E2F4 (band A). Moreover, this effect is subsequently reversed by Con A treatment. No affect appears to occur on higher order E2F DNA binding protein complexes (bands B and C), which consist of the proteins pRb, p130, and E2F4 (band B) and p107, p130, and E2F4 (band C).

To determine whether this decrease in free E2F binding activity is due to reduced expression of E2F1 or E2F4, Western blots of {gamma}{delta} T cells after treatment with anti-WC1 for up to 24 h were probed for both E2F1 and E2F4 (Fig. 4Go). As can be seen, there was an almost complete abolition in expression of E2F1, whereas expression of E2F4 appeared to be unaffected by anti-WC1 stimulation. Subsequent stimulation with Con A for a further 24 h returned E2F1 expression to its original level. Expression of E2F4, however, exhibited a small transient decrease after only 1 h Con A stimulation, returning to normal levels after 6 h stimulation with Con A.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 4. E2F1 but not E2F4 expression is affected by WC1 stimulation whereas Con A stimulation transiently decreases E2F4 expression. S-59 {gamma}{delta} T cells were treated with 20 µg/ml anti-WC1 mAb, then 10 µg/ml Con A for the indicated times. E2F1 and E2F4 protein expression levels were then analyzed by Western blot of detergent-soluble proteins that had been resolved by 10% SDS PAGE and transferred to nitrocellulose. Further details are described in Materials and Methods.

 
E2F1 overexpression overrides WC1-induced growth arrest

Since WC1 ligation down-regulates E2F1 expression, resulting in G1 arrest, we determined whether E2F1 was indeed an important downstream target of WC1 by investigating the effect of E2F1 overexpression on WC1-induced growth arrest. S-59 {gamma}{delta} T cells were transfected with a vector expressing either E2F1 or an inactive mutant E2F1 in conjunction with a fivefold less concentration of an expression vector expressing human IL-2{alpha}-chain. Therefore, purification of human IL-2{alpha}-chain-expressing cells, in theory, yielded cells expressing either E2F1 or the mutant E2F1. These various cell populations were then assayed in a standard thymidine uptake proliferation assay after being treated with either anti-WC1 mAb or an isotype-matched negative control mAb. As expected, addition of anti-WC1 led to a decrease in thymidine uptake in both normal untransfected (26%) and mutant (inactive) E2F1 transfected cells (37%), the results being expressed as a percentage relative to cells incubated with a negative control isotype-matched mAb (Fig. 5Go). However, when cells overexpressing E2F1 were incubated with anti-WC1, there was clearly an increase in thymidine uptake (58%), in comparison with untransfected or control cells transfected with mutant E2F1. When these results are reexpressed as a percentage of cells that recover from or override WC1-induced growth arrest due to E2F1 overexpression in comparison with those expressing mutant E2F1, we observe that there is a 33% increase in recovery (inset to Fig. 5Go). Therefore, these results show that E2F1 overexpression can partly override WC1-induced growth arrest, implicating E2F1 as a downstream target of WC1 receptor activation.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 5. Overexpression of E2F1 overrides WC1-induced growth arrest. S-59 {gamma}{delta} T cells were cotransfected with mutant E2F1 or wild-type E2F1 along with human IL-2{alpha}-chain-expressing vectors, then left to express for 24 h. Human IL-2{alpha}-chain-expressing cells were positively purified then treated, along with untransfected cells as a control, with 20 µg/ml anti-WC1 or anti-IgM (negative control mAb) for 24 h, which incorporated [3H]thymidine pulse labeling for the final 6 h. Thymidine incorporation is expressed as percent thymidine uptake (mean ± SEM; n = 3) for anti-WC1-treated cells relative to those treated with anti-IgM (negative control mAb). The inset to Figure 5Go represents the data redisplayed as percent recovery of cells relative to that for cells expressing mutant E2F1. Further details are described in Materials and Methods.

 
WC1 activation induces p27kip1 expression and down-regulation of cyclin D and cyclin A

To identify what factors upstream of Rb might be involved in pocket protein dephosphorylation, we looked at the effects of WC1 activation on A, D, and E cyclins (Fig. 6Go). In addition, we also determined whether or not there was any induction in expression for the cki proteins. Using a Western blot to detect cyclins D2 and D3, Figure 6Go shows that 24-h anti-WC1 treatment of {gamma}{delta} T cells resulted in a decrease in expression for cyclins D2 and D3. Following activation with 10 µg/ml Con A, cyclin D2 and D3 expression returned to their original levels. Cyclin D1 could not be detected (data not shown), due either to the Abs used being unable to cross react with ovine cyclin D1 or, alternatively, no cyclin D1 being expressed by these cells, since lymphocytes generally do not express cyclin D1 (27). With respect to the other cyclins studied, no significant effect on cyclin E expression was observed. However, there was no expression of cyclin A (the faster migrating band highlighted by an arrow in Fig. 5Go) after 18 h anti-WC1 treatment and no subsequent recovery in expression until after 24 h Con A stimulation. The slower migrating band is either a nonspecific band detected with this Ab or a possible posttranslationally modified form of cyclin A that migrates more slowly on SDS PAGE and appears unaffected by anti-WC1 treatment.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 6. WC1 and Con A stimulation effect cyclin D and A expression but not cyclin E. Western blot analysis was used to determine expression level status for cyclins D2, D3, A, and E in S-59 {gamma}{delta} T cells treated with 20 µg/ml anti-WC1, then 10 µg/ml Con A for the times indicated. Further details are in Materials and Methods and as previously described.

 
In other cell systems, the cki proteins p21cip1 and p27kip1 have been shown to be involved in the induction of cell cycle arrest. Both of these proteins were therefore analyzed by Western blot to determine whether WC1 stimulation and subsequent Con A treatment could effect their expression status. Figure 7Go illustrates that p27kip1 expression is induced after only 18 h WC1 receptor ligation with mAb anti-WC1. Stimulation with mitogen (10 µg/ml Con A) eventually resulted in decreased p27kip1 expression as seen by Western blot, correlating with the induction of cell cycling (Fig. 1Go). However, 6 h after Con A stimulation, there is a further rise in p27kip1 levels before falling away by 12 h. The implication of this is discussed later. The cki, p21cip1, could not be detected by Western blot, having used several different Abs against p21cip1.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 7. WC1 stimulation induces p27kip1 expression, which is subsequently decreased by mitogen stimulation with Con A. S-59 {gamma}{delta} T cells were analyzed by Western blot for p27kip1 having been treated with 20 µg/ml anti-WC1, then 10 µg/ml Con A for the times indicated. Further details are in Materials and Methods and as previously described.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study outlines the biochemical events that regulate the cell cycle leading to reversible G1 growth arrest in IL-2-dependent {gamma}{delta} T cells upon WC1 receptor activation. This growth arrest can be overridden by simultaneous or subsequent mitogen stimulation, allowing the cells to reenter the cell cycle, thereby providing a unique model for studying both positive and negative signaling mechanisms controlling cell cycle progression within a poorly understood component of the immune system, namely the {gamma}{delta} T lymphocyte.

The Rb family of pocket proteins are important negative regulators of the cell cycle through the sequestration of transcription factors by the hypophosphorylated forms (28). Our experiments showed that WC1 receptor activation resulted in dephosphorylation of the pocket proteins p107, p130, and pRb, along with a down-regulation in p107 expression (Fig. 2Go). Smith et al. (29) have suggested that p130 is the principal pocket protein expressed during G0, distinguishing this cell cycle stage from G1, where pRb is also present. The decrease in p107 expression after WC1 stimulation would agree with early G1 arrest, since one report suggests that p107 expression is not seen until mid-late G1 into S phase (14). It is unlikely, therefore, that p107 plays a role in WC1-induced early G1 growth arrest. After WC1-induced G1 arrest, mitogen-stimulated cell cycle reentry for S-59 {gamma}{delta} T cells would appear to follow a similar course of events for pRb and p130 to that described for serum-stimulated synchronized T98G cells by Mayo et al. (30). The expression of p107 after 24 h mitogen stimulation, coinciding with p130 and pRb phosphorylation, would indicate that the {gamma}{delta} T cells have reentered the cell cycle by progressing out of G1 into S phase. Indeed, there is an inverse relationship between expression of p107 and inactivation of p130 by phosphorylation, and it is suggested that E2F complexes containing p130 might suppress p107 expression during G0/G1 (29). Not surprisingly, this 24-h lag phase prior to {gamma}{delta} T cells reentering the cell cycle at S phase mirrors the apparent 24-h lag phase reported previously when measuring {gamma}{delta} T cell proliferation by thymidine uptake (5). In summary, WC1 stimulation induces the accumulation of the hypophosphorylated form of pocket protein, thereby allowing them to sequester E2F transcription factors.

Since the most well-defined target of hypophosphorylated pocket proteins is the E2F family of transcription factors, the next logical step was to focus on the role of these proteins in the control of {gamma}{delta} T cell proliferation. Analysis of E2F activity by band shift assay in conjunction with supershift analysis demonstrated that WC1 ligation resulted in decreased binding of free E2F to a radio-labeled E2F DNA probe (band A, Fig. 3Go). This would appear to be a reflection of substantially lower E2F1 levels, since E2F4 expression was unaffected (Fig. 4Go). Overexpression of E2F1 might therefore be expected to overcome WC1-induced growth arrest. Indeed, when {gamma}{delta} T cells were transiently transfected with E2F1 under the control of a CMV promoter, E2F1 overexpression overcame WC1-induced growth arrest with approximately 33% recovery in cell proliferation (Fig. 5Go). Total reversal of WC1-induced growth arrest did not occur, presumably as a result of one or more of the following possibilities: 1) dephosphorylated pocket protein inactivating some of the overexpressed E2F1 activity, 2) the increased susceptibility of the cells to apoptosis as a result of E2F1 overexpression, 3) the level of E2F1 expression in each cell being unequal leading to varying degrees of overcoming WC1 induced growth arrest, and 4) the number of purified IL-2{alpha}-chain-expressing cells also expressing E2F1. Nevertheless, these results therefore show that down-regulation of free E2F1 activity through WC1 ligation is responsible for the induction of {gamma}{delta} T cell growth arrest.

The pocket protein p130 can complex with E2F4 in G0 or early G1 (13, 14) and this can regulate E2F1 gene expression in a negative manner (31). Therefore, the observed decrease in E2F1 expression upon anti-WC1 treatment in our experiments (Fig. 4Go) may possibly be the result of transcriptional shut-off of the E2F1 gene by a p130/E2F4 complex. However, our band shift experiments (Fig. 3GoA) did not indicate any significant change in the level of higher order complexes containing p130 and E2F4 (bands B and C) upon WC1 ligation. The reason for this in unclear. It is possible, however, that the repression on E2F1 transcription by a p130/E2F4 complex is manifested through subtle changes in p130 phosphorylation status, as seen in Figure 2Go. Furthermore, pRb dephosphorylation would result in sequestration and inactivation of any remaining free E2F1, thereby halting transcription of E2F1-regulated genes. This provides a powerful means of shutting off cell cycle progression within early to mid G1 phase of the cell cycle.

The observation that mitogen stimulation overrides WC1-mediated cell cycle arrest is attributable to the observed induction of both pRb and p130 phosphorylation (Fig. 2Go). For example, as shown elsewhere, sequestration and inactivation of de novo E2F1 by pRb would not occur as pRb becomes phosphorylated (28). In addition, p130 phosphorylation within p130/E2F4 complexes could remove the repression this complex exerts over E2F1 expression (31). Consequently, E2F1 expression levels rise as seen here (Fig. 4Go), leading to increased free E2F DNA binding activity (Fig. 3GoA) and cell cycle reentry. Moreover, as these synchronized cells start to progress out of G1, regulation of E2F4 transcriptional activity comes under the control of p107 as it begins to be expressed (14, 32). Therefore the expression of p107 after 24-h mitogen stimulation not only clearly indicates that the {gamma}{delta} T cells have moved out of G1 into S phase but may also account for the loss of some free E2F DNA binding activity (Fig. 3GoA) attributable to E2F4 expression (Fig. 4Go). However, although increased p107 expression may account for the loss of free E2F4 DNA binding activity, the loss of free E2F1 activity, on the other hand, may be more attributable to the increase in cyclin A expression after 24 h Con A stimulation (Fig. 6Go). Indeed, Dynlacht et al. (33) and Krek et al. (34) have shown that, as cyclin A accumulates in S-phase, it binds to E2F1/DP1 complexes, and the associated kinase activity results in phosphorylation of this complex, culminating in a loss of free E2F1/DP1 binding activity. The net effect of both these events results in the loss of free E2F DNA binding activity seen in Figure 3GoA after 24-h Con A stimulation. Such a sequence of events would serve to tightly regulate and prevent high levels of free E2F activity upon leaving G1 phase, which would result in inopportune apoptosis (35, 36). In summary, mitogen stimulation with Con A is initially able to overcome WC1-induced {gamma}{delta} T cell growth arrest through an accumulation in hyperphosphorylated pocket protein with a consequent increase in E2F1 expression, driving cell cycle progression out of G1. The question that arises, therefore, is: How is pocket protein phosphorylation status regulated in S-59 {gamma}{delta} T cells?

Pocket protein phosphorylation is regulated by cyclin-cdk complexes, and their activity in turn is negatively regulated by the ckis, such as p27kip1 (37). Upon analysis of the cyclins and the cki p27kip1, we found that an inverse correlation existed between p27kip1 and cyclin A or D expression in S-59 {gamma}{delta} T cells. Moreover, the apparent abolishment of cyclin A expression upon WC1 ligation (Fig. 6Go) may be the result of induction of p27kip1 expression, since it is reported to down-regulate cyclin A gene expression (38). However, the link between cyclin D and p27kip1 expression is not as clear. Nevertheless, the decreases in cyclin A and D expression, coupled with the increase in p27kip1 upon WC1 ligation, would have a strong down-regulatory effect on, for example, cyclin A-cdk2 and cyclin D-cdk4 activity (37), as well as subsequent pocket protein phosphorylation (10). With regard to mitogen stimulation, it would appear that mitogen can relax the repression that WC1 exerts on IL-2 signaling, allowing p27kip1 degradation to proceed and cyclin D levels to initially rise. This is followed later by a rise in cyclin A expression, coinciding with a rise in p107 expression after 24-h mitogen stimulation (Figs. 2Go and 6Go). In support of this conclusion, IL-2 signaling can be linked to p27kip1 degradation through the MAP kinase pathway (39, 40). In addition, we found that WC1-arrested {gamma}{delta} T cells remain locked in G0/G1 growth arrest when stimulated with mitogen in the absence of IL-2 (5). Similarly, Firpo et al. showed that mitogen stimulation actually maintained growth arrest in resting cells by inducing p27kip1 expression, as seen here with Con A stimulation (Fig. 7Go), until subsequent costimulation with IL-2 occurs (17).

We may therefore conclude that IL-2-dependent {gamma}{delta} T cell growth, allowing cells to transit G1 so as to continue cell cycling, is maintained by free E2F activity as a result of pocket protein phosphorylation through a down-regulation in expression of the cki p27kip1 and an initial elevation in cyclin D levels. WC1 ligation, on the other hand, can inhibit IL-2 signaling through dephosphorylation and inactivation of MAP kinase (6). Consequently, this would allow p27kip1 levels to rise, triggering the cascade of events downstream of p27kip1, as described here, resulting in G1 cell cycle arrest. Mitogen stimulation, on the other hand, can override WC1, presumably by preventing WC1 from inhibiting IL-2-dependent signaling pathways. In conclusion, these results, focused on E2F and pocket protein regulation, provide an insight into the mechanisms through which immunologically important growth regulatory stimuli signal within the context of {gamma}{delta} T cell cycle control.


    Acknowledgments
 
We thank Prof. Nick Dyson, Dr. Antonio Giordano, Dr. Sybille Mittnacht, Prof. Joseph Nevins, Dr. Jonathan Pines, and Dr. Tom Wileman for providing us with various reagents.


    Footnotes
 
1 This research was supported by a Biotechnology and Biological Sciences Research Council (BBSRC) grant under an Intracellular Signaling Program Grant AI 201/439. Back

2 Address correspondence and reprint requests to Dr. Paul A. Kirkham at his current address: Novartis Horsham Research Center, Wimblehurst Road, Horsham, West Sussex, RH12 4AB, U.K. E-mail address: Back

3 Abbreviations used in this paper: MAP, mitogen-activated protein; cki, cyclin kinase inhibitor; pRb, pocket retinoblastoma protein. Back

Received for publication December 3, 1997. Accepted for publication April 9, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Haas, W., P. Pereira, S. Tonegawa. 1993. {gamma}{delta} cells. Annu. Rev. Immunol. 11:637.[Medline]
  2. Ferrick, D. A., M. D. Schrenzel, T. Mulvania, B. Hsieh, W. G. Ferlin, W. Lepper. 1995. Differential production of IFN-{gamma} and interleukin-4 in response to Th1-stimulating and Th2-stimulating pathogens by {gamma}{delta} T-cells in vivo. Nature 373:255.[Medline]
  3. Boismenu, R., W. L. Havran. 1997. An innate view of {gamma}{delta} T cells. Curr. Opin. Immunol. 9:57.[Medline]
  4. Chien, Y. H., R. Jores. 1995. {gamma}{delta} T-cells: T-cells with B-cell like recognition properties. Curr. Biol. 5:1116.[Medline]
  5. Takamatsu, H. H., P. A. Kirkham, R. M. E. Parkhouse.. 1997. A {gamma}{delta} T cell specific surface receptor (WC1) signaling G0/G1 cell cycle arrest. Eur. J. Immunol. 27:105.[Medline]
  6. Kirkham, P. A., H. H. Takamatsu, R. M. E. Parkhouse. 1997. Growth arrest of {gamma}{delta} T-cells induced by mAb against WC1 correlates with activation of multiple tyrosine phosphatases and dephosphorylation of MAP kinase erk2. Eur. J. Immunol. 27:717.[Medline]
  7. Wijngaard, P. L. J., N. D. Machugh, M. J. Metzelaar, S. Romberg, A. Bensaid, L. Pepin, W. C. Davis, H. C. Clevers. 1994. Members of the novel WC1 gene family are differentially expressed on subsets of bovine CD4- CD8- {gamma}{delta} T lymphocytes. J. Immunol. 152:3476.[Abstract]
  8. Pardee, A. B.. 1989. G1 events and regulation of cell proliferation. Science 246:603.[Abstract/Free Full Text]
  9. Polyak, K., J. Y. Kato, M. J. Solomon, C. J. Sherr, J. Massague, J. M. Roberts, A. Koff. 1994. p27(Kip1), a cyclin-cdk inhibitor, links transforming growth factor-ß and contact inhibition to cell-cycle arrest. Genes Dev. 8:9.[Abstract/Free Full Text]
  10. Grana, X., E. P. Reddy. 1995. Cell cycle control in mammalian cells: role of cyclins, cyclin dependent kinases (cdks), growth suppressor genes and cyclin dependent kinase inhibitors (ckis). Oncogene 11:211.[Medline]
  11. Lees, J. A., M. Saito, M. Vidal, M. Valentine, T. Look, E. Harlow, N. Dyson, K. Helin. 1993. The retinoblastoma protein binds to a family of E2F transcription factors. Mol. Cell. Biol. 13:7813.[Abstract/Free Full Text]
  12. Hijmans, E. M., P. M. Voorhoeve, R. L. Beijersbergen, L. J. Vantveer, R. Bernards. 1995. E2F5, a new E2F family member that interacts with p130 in vivo. Mol. Cell. Biol. 15:3082.[Abstract]
  13. Vairo, G., D. M. Livingston, D. Ginsberg. 1995. Functional interaction between E2F4 and p130: evidence for distinct mechanisms underlying growth suppression by different retinoblastoma protein family members. Genes Dev. 9:869.[Abstract/Free Full Text]
  14. Cobrinik, D., P. Whyte, D. S. Peeper, T. Jacks, R. A. Weinberg. 1993. Cell cycle specific association of E2F with the p130 E1A-binding protein. Genes Dev. 7:2392.[Abstract/Free Full Text]
  15. Nevins, J. R.. 1992. E2F: a link between the Rb tumor suppressor protein and viral oncoproteins. Science 258:424.[Abstract/Free Full Text]
  16. Nourse, J., E. Firpo, W. M. Flanagan, S. Coats, K. Polyak, M. H. Lee, J. Massague, G. R. Crabtree, J. M. Roberts. 1994. Interleukin-2 mediated elimination of the p27(Kip1) cyclin dependent kinase inhibitor prevented by rapamycin. Nature 372:570.[Medline]
  17. Firpo, E. J., A. Koff, M. J. Solomon, J. M. Roberts. 1994. Inactivation of a Cdk2 inhibitor during interleukin-2 induced proliferation of human T-lymphocytes. Mol. Cell. Biol. 14:4889.[Abstract/Free Full Text]
  18. Agrawal, D., P. Hauser, F. McPherson, F. Dong, A. Garcia, W. J. Pledger. 1996. Repression of p27(Kip1) synthesis by platelet derived growth factor in BALB/C 3T3 cells. Mol. Cell. Biol. 16:4327.[Abstract]
  19. Takamatsu, H., T. Collen, M. S. Denyer, M. Windsor. 1993. Interaction of sheep peripheral blood {gamma}{delta} T-cell lines with cells of other phenotypes. Vet. Immunol. Immunopathol. 35:59.
  20. Rubin, L. A., C. C. Kurman, W. E. Biddison, N. D. Goldman, D. L. Nelson. 1985. A mAb 7G7/B6, binds to an epitope on the human interleukin-2 (Il-2) receptor that is distinct from that recognized by Il-2 or anti-Tac. Hybridoma 4:91.[Medline]
  21. Lam, E. W. F., R. J. Watson. 1993. An E2F binding site mediates cell cycle regulated repression of mouse b-Myb transcription. EMBO J. 12:2705.[Medline]
  22. Bandara, L. R., E. W. F. Lam, T. S. Sorensen, M. Zamanian, R. Girling, N. B. La Thangue. 1994. DP1 a cell cycle regulated and phosphorylated component of transcription factor DRTF1/E2F which is functionally important for recognition by pRb and the adenovirus E4-Orf-6/7 protein. EMBO J. 13:3104.[Medline]
  23. Johnson, D. G., J. K. Schwarz, W. D. Cress, J. R. Nevins. 1993. Expression of transcription factor E2F1 induces quiescent cells to enter S-phase. Nature 365:349.[Medline]
  24. Bonifacino, J. S., C. K. Suzuki, R. D. Klausner. 1990. A peptide sequence confers retention and rapid degradation in the endoplasmic reticulum. Science 247:79.[Abstract/Free Full Text]
  25. Zhang, Y., S. P. Chellappan. 1995. Cloning and characterization of human DP2, a novel dimerization partner of E2F. Oncogene 10:2085.[Medline]
  26. Ormondroyd, E., S. De-la-Luna, N. B. La Thangue. 1995. A new member of the DP family, DP-3, with distinct protein products suggests a regulatory role for alternative splicing in the cell cycle transcription factor DRTF1/E2F. Oncogene 11:1437.[Medline]
  27. Sherr, C. J.. 1996. Cancer cell-cycles. Science 274:1672.[Abstract/Free Full Text]
  28. Weinberg, R. A.. 1995. The retinoblastoma protein and cell-cycle control. Cell 81:323.[Medline]
  29. Smith, E. J., G. Leone, J. Degregori, L. Jakoi, J. R. Nevins. 1996. The accumulation of an E2F-p130 transcriptional repressor distinguishes a G0 cell state from a G1 cell state. Mol. Cell. Biol. 16:6965.[Abstract]
  30. Mayol, X., J. Garriga, X. Grana. 1995. Cell cycle dependent phosphorylation of the retinoblastoma related protein p130. Oncogene 11:801.[Medline]
  31. Johnson, D. G.. 1995. Regulation of E2F1 gene expression by p130 (Rb2) and D-type cyclin kinase activity. Oncogene 11:1685.[Medline]
  32. Shirodkar, S., M. Ewen, J. A. Decaprio, J. Morgan, D. M. Livingston, T. Chittenden. 1992. The transcription factor E2F interacts with the retinoblastoma product and a p107 cyclin-A complex in a cell cycle regulated manner. Cell 68:157.[Medline]
  33. Dynlacht, B. D., O. Flores, J. A. Lees, E. Harlow. 1994. Differential regulation of E2F transactivation by cyclin/cdk2 complexes. Genes Dev. 8:1772.[Abstract/Free Full Text]
  34. Krek, W., M. E. Ewen, S. Shirodkar, Z. Arany, W. G. Kaelin, D. M. Livingston. 1994. Negative regulation of the growth-promoting transcription factor E2F1 by a stably bound cyclin A-dependent protein kinase. Cell 78:161.[Medline]
  35. DeGregori, J., G. Leone, A. Miron, L. Jakoi, J. R. Nevins. 1997. Distinct roles for E2F proteins in cell growth control and apoptosis. Proc. Natl. Acad. Sci. USA 94:7245.[Abstract/Free Full Text]
  36. Shan, B., A. A. Farmer, W. H. Lee. 1996. The molecular basis of E2F1/DP1 induced S-phase entry and apoptosis. Cell Growth Differ. 7:689.[Abstract]
  37. Polyak, K., M. H. Lee, H. Erdjumentbromage, A. Koff, J. M. Roberts, P. Tempst, J. Massague. 1994. Cloning of p27(Kip1), a cyclin-dependent kinase inhibitor and a potential mediator of extracellular antimitogenic signals. Cell 78:59.[Medline]
  38. Schulze, A., K. Zerfassthome, J. Berges, S. Middendorp, P. Jansendurr, B. Henglein. 1996. Anchorage-dependent transcription of the cyclin A gene. Mol. Cell. Biol. 16:4632.[Abstract]
  39. Perkins, G. R., J. Marvel, M. K. L. Collins. 1993. Interleukin-2 activates extracellular signal regulated protein kinase-2. J. Exp. Med. 178:1429.[Abstract/Free Full Text]
  40. Kawada, M., S. Yamagoe, Y. Murakami, K. Suzuki, S. Mizuno, Y. Uehara. 1997. Induction of p27(Kip1) degradation and anchorage independence by Ras through the MAP kinase signaling pathway. Oncogene 15:629.[Medline]



This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
H. Takamatsu, P. S. Mellor, P. P. C. Mertens, P. A. Kirkham, J. N. Burroughs, and R. M. E. Parkhouse
A possible overwintering mechanism for bluetongue virus in the absence of the insect vector
J. Gen. Virol., January 1, 2003; 84(1): 227 - 235.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. A. Kirkham, H.-H. Takamatsu, E. W.-F. Lam, and R. M. E. Parkhouse
Ligation of the WC1 Receptor Induces {gamma}{delta} T Cell Growth Arrest Through Fumonisin B1-Sensitive Increases in Cellular Ceramide
J. Immunol., October 1, 2000; 165(7): 3564 - 3570.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Wilson, M. K. Aydintug, and M. A. Jutila
A Circulating Bovine {gamma}{delta} T Cell Subset, Which Is Found in Large Numbers in the Spleen, Accumulates Inefficiently in an Artificial Site of Inflammation: Correlation with Lack of Expression of E-Selectin Ligands and L-Selectin
J. Immunol., April 15, 1999; 162(8): 4914 - 4919.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Peiretti, S. Lopez, P. Deprez-Beauclair, B. Bonardo, I. Juhan-Vague, and G. Nalbone
Inhibition of p70S6 Kinase during Transforming Growth Factor-beta 1/Vitamin D3-induced Monocyte Differentiation of HL-60 Cells Allows Tumor Necrosis Factor-alpha to Stimulate Plasminogen Activator Inhibitor-1 Synthesis
J. Biol. Chem., August 17, 2001; 276(34): 32214 - 32219.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirkham, P. A.
Right arrow Articles by Parkhouse, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirkham, P. A.
Right arrow Articles by Parkhouse, E.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS