|
|
||||||||

T Cell Growth Arrest Mediated Through WC11

*
Department of Immunology, Institute for Animal Health, Pirbright, Surrey, United Kingdom; and
Ludwig Institute for Cancer Research and Department of Medical Microbiology, Imperial College School of Medicine at St Marys Hospital, London, United Kingdom
| Abstract |
|---|
|
|
|---|

T cell-specific surface receptor, WC1, induces
G0/G1 growth arrest, reversible with Con A, in
proliferating IL-2-dependent 
T cells. We now show that this
reversible WC1-induced cell cycle arrest is correlated with induction
of the cyclin kinase inhibitor p27kip1 and an associated
down-regulation in cyclins A, D2, and D3 expression, along with
dephosphorylation of pocket proteins p107, p130, and pRb. Together with
diminished pocket protein phosphorylation, p107 expression levels are
significantly down-regulated in response to WC1 stimulation. This
coordinated sequence of signaling events is focused on E2F regulation
so that, downstream of the pocket proteins, WC1 stimulation results in
a diminished DNA binding activity for free E2F as a consequence of
reduced E2F1 expression, whereas E2F4 expression is unaffected.
Consistent with this interpretation, overexpression of E2F1 overcomes
the growth-arresting effects induced by WC1 stimulation. Finally, in
accordance with our previous observations at both the cellular and
molecular level, subsequent mitogen stimulation can reverse all the
above changes induced by WC1. These results, focused on E2F regulation,
therefore provide a first insight into the effects of both positive
(mitogen) and negative (anti-WC1) stimuli on cell cycle control in
IL-2-dependent 
T cells. | Introduction |
|---|
|
|
|---|

T lymphocyte is preferentially targeted to
the mucosal surfaces, whereas in ruminants large numbers may also be
found in peripheral blood (1). Their functions are varied, but in
certain respects they appear to form part of the innate immune system
rather than the acquired. Indeed the ability of 
T cells to
respond faster to Ag than their
ß T cell counterparts (2), allied
to their ability to secrete various cytokines, has led to the
possibility that 
T cells may regulate both the acquired and
innate immune responses (3). Extracellular signals that regulate 
T cell proliferation would therefore be central to modulating an immune
response directed through them. In contrast to the well-studied
ß
T cells, however, little is known about the mechanisms that regulate

T cell proliferation, although, interestingly, 
T cells do
not recognize Ag in the context of MHC, as do
ß T cells (4).
Recently, we demonstrated that IL-2-dependent 
T cells can be
arrested in the presence of IL-2 at the G0/G1
phase of the cell cycle when WC1, a large type 1 transmembrane protein,
is engaged by a corresponding mAb (5, 6). This is accompanied by
extensive intracellular tyrosine dephosphorylation of several proteins,
including the MAP3 kinase
erk2 (6). Furthermore, the process can be reversed or overridden,
allowing the 
T cells to reenter the cell cycle, by mitogen
stimulation through the TCR, provided IL-2 is present. It should be
noted that, while expression of WC1 has to date not been detected in
mouse or human 
T cells, they nevertheless do possess the gene
and may yet be found to express it (7).
Mitogenic stimuli, such as IL-2 and TCR stimulation, exert their
effects primarily during the G1 phase of the cell cycle
before a major restriction point "R" in mammalian cell cycle
progression. After this point the cell becomes refractory to further
extracellular stimuli and is now committed to one round of the cell
division (8). Likewise, growth-inhibiting stimuli, such as cell-cell
contact inhibition or TGF-ß stimulation, also exert their effects
during G1 (9). The pocket proteins pRb, p107, and p130 play
a key role in cell cycle regulation (reviewed by Grana in 10 .
During G1, pRb and p130 are responsible for controlling
cell cycle progression and function to regulate the transcriptional
activity of the E2F family of proteins (11, 12, 13, 14, 15). The pocket proteins
are regulated by the cyclin-cdk complexes, which control serine and
threonine phosphorylation, hyperphosphorylation rendering them
inactive, thus preventing E2F sequestration. Control of the cyclin-cdk
complexes is itself subject to regulation by a group of proteins called
cyclin kinase inhibitors (cki) through physical association (10). It is
at this level that IL-2 and platelet-derived growth factor (PDGF) can
exert their mitogenic effect by down-regulating the expression of a
cki, p27kip1 (16, 17, 18). Growth inhibitory stimuli, on the other hand,
such as TGF-ß and cell-cell contact inhibition, increase p27kip1
expression (9). Interestingly, TCR stimulation also results in p27kip1
induction, halting proliferation until a second signal through IL-2
removes p27kip1 expression (17). This would explain the necessity for
IL-2 after TCR stimulation of S-59 
T cells in overcoming
WC1-induced growth arrest (5).
In this work we have investigated the cell cycle mechanism through which WC1 induces growth arrest. This has been achieved by assessing the effects of both negative (anti-WC1) and positive (Con A) stimuli at various levels of cell cycle control: E2F transcriptional/DNA binding activity, pocket protein phosphorylation, and expression status, and the effect of these stimuli on cyclin and cki expression levels.
| Materials and Methods |
|---|
|
|
|---|
IL-2-dependent ovine S-59 
T lymphocytes having a
phenoytpe similar to that found in peripheral blood (5, 19) were
cultured in Iscoves modified MEM supplemented with 10 U/ml IL-2 as
previously described (6). For anti-WC1 or mitogen treatment, S-59
cells were incubated with 20 µg/ml mAb SC-29 or 10 µg/ml Con A at
37°C. Mouse mAbs against WC1 (SC-29; IgG1) and IgM
(ILA-30; IgG1) were described previously (6). Abs for
Western blotting against E2F1 (C-20), E2F4 (C-108), pRb (C-15), p107
(C-18), p130 (C-20), cyclin D2 (M-20), cyclin D3 (C-16), cyclin A
(C-19), cyclin E (M-20), and p27kip1 (N-20) were purchased from Santa
Cruz Biotechnology (Santa Cruz, CA). Horseradish peroxidase
(HRP)-labeled goat anti-rabbit Ig and rabbit anti-goat Ig were
obtained from Southern Biotechnology Associates (Birmingham, AL). Abs
for supershift analysis were obtained as follows; rabbit anti-p130
antiserum was kindly provided by Dr. A. Giordano (Jefferson Medical
School, Philadelphia, PA); mouse anti-pRb mAb (21C9) and
mouse anti-p107 mAb (SD15) were generous gifts from Dr. S.
Mittnacht (Institute of Cancer Research, London, U.K.) and Prof. N.
Dyson (Massachusetts General Hospital Cancer Center, Boston,
MA), respectively; rabbit anti-E2F1, anti-E2F4, and
anti-DP1 antisera were raised against peptides corresponding to
unique carboxyl-terminal regions of the respective proteins. Mouse
anti-human IL-2
-chain (mAb 7G7/B6) (20) was kindly provided by
Dr. T. Wileman (Institute for Animal Health, Pirbright, U.K.)
and found not to cross react with ovine S-59 
T cells.
Flow cytometric analysis
Cell cycle analysis was performed by flow cytometry with a Becton Dickinson FACScan using Lysis II software. Briefly, cells were harvested, washed with PBS, then ethanol fixed and RNase digested, followed by propidium iodide staining as described previously (5).
Western blotting
Cells (5 x 106) were lysed with 40 µl RIPA lysis buffer (1% (v/v) Triton X-100, 1% (v/v) deoxycholate, 0.1% (v/v) SDS, 50 mM Tris, pH7.4, 150 mM NaCl, 0.1% (w/v) sodium azide, 1 mM EDTA and EGTA, 0.5 mM sodium orthovanadate, 10 mM sodium fluoride, 10 mM sodium pyrophosphate, 100 µg/ml aprotonin, 10 µg/ml soybean trypsin inhibitor, 1 µg/ml leupeptin, 5 µg/ml each of TLCK and TPCK, and 1 mM PMSF) for 30 min on ice. The lysate was minifuged at 14000 rpm for 5 min at 4°C, and the supernatant was assayed for total protein content using the Pierce (Chester, U.K.) BCA protein assay. The lysate (10 µg of protein) was resolved by reducing SDS PAGE, and the proteins were then transferred to nitrocellulose membrane. The membrane was blocked with 10% (w/v) dried milk (Marvel) in PBST (PBS containing 0.05% (v/v) Tween 20) for 1 h at room temperature, followed by probing with primary Ab (1:1000 dilution in blocking solution) overnight at 4°C. After extensive washing with PBST (20 min per wash, repeated 6 times), primary Ab was detected with the appropriate secondary Ab (diluted 1:1000 in blocking solution) for 30 min at room temperature. After three further PBST washes, 20 min each, the blot was visualized with the Pierce Supersignal/Supersignal-ultra chemiluminescence system.
Gel retardation and supershift assays
These assays were essentially performed as previously described (21). Briefly, after treating 5 x 106 S-59 cells with anti-WC1 followed by Con A (as required) for the appropriate time period, the cells were harvested and washed with PBS, and then whole cell extracts were prepared as previously described (22). Protein content was quantified using the Pierce BCA protein assay. Whole cell extract (20 µg) was incubated for 10 min at 30°C with 1 to 2 ng 32P-labeled DNA probe (dsDNA containing the distal E2F binding site from the type 5 E2a promoter: TAGTTTTCGCGCTTAAATTTGA) in 20 µl binding buffer, which also contains the mutant E2F binding site oligo (TAGTTTTCGATATTAAATTTGA) as described elsewhere (22). The reaction mix was then separated by 4% (v/v) PAGE using a x0.3 TBE running buffer. The gels were then fixed in 10% (v/v) glacial acetic acid, 10% (v/v) ethanol for 30 min, dried, and autoradiographed. Supershift assays were performed by adding 1 µl of concentrated Ab to the gel shift reaction mix and allowing it to incubate for 5 min at 30°C before addition of the radiolabeled probe.
E2F1 overexpression assay
The expression vectors used in these experiments have been
described elsewhere; expression vectors containing E2F1 (23) and mutant
E2F1 (23) were kindly provided by Prof. J. Nevins (Duke University
Medical Center, Durham, NC), and the expression vector
containing human IL-2
-chain (24) was generously provided by Dr. T.
Wileman. S-59 
T cells (1 x 107) were
either left untreated or cotransfected with 5 µg E2F1 or mutant E2F1
expression vector with 1 µg IL-2
-chain expression vector using the
Promega (Southampton, U.K.) Superfect transfection system as per
the manufacturers instructions for nonadherent cells. After 24 h
expression, the cells were harvested, and human
IL-2
-chain-expressing cells were positively purified using a mouse
anti-human IL-2
-chain mAb on a miniMACS cell purification system
(Miltenyi Biotech, Bisley, U.K.). The purified cells were then
incubated for a further 18 h with anti-WC1 (mAb SC-29) or an
isotype-matched negative control mAb (anti-IgM; ILA-30), followed
by pulse labeling with tritiated thymidine for 6 h as previously
described (5). The effect of anti-WC1 treatment on cell
proliferation (cell cycle progression) is expressed as a percentage
thymidine uptake (mean ± SEM for triplicate determinations)
relative to that for negative control mAb-treated cells for each
transfection condition. The data are also presented as percentage
recovery of cells overcoming anti-WC1-induced growth arrest by
wild-type E2F1 overexpression relative to those cells expressing mutant
E2F1. This is calculated as follows: [(X-Y)/(100-Y)] x 100, where
X = percent thymidine uptake for anti-WC1-treated cells of
interest and Y = percent thymidine uptake for cells expressing
mutant E2F1 treated with anti-WC1.
| Results |
|---|
|
|
|---|
The reversibility of WC1-induced growth arrest of 
T
lymphocytes with mitogen is demonstrated in Figure 1
. This shows the cell cycle analysis
profile for 
T cells left untreated, incubated with 20 µg/ml
anti-WC1 mAb only for 24 h, and treated with anti-WC1 mAb
for 24 h followed by 10 µg/ml Con A for a further 24 h. The
untreated 
T cells contain 59% G0/G1
cells and 38% of cells in S/G2/M phase. When the cells are
incubated with anti-WC1 only, the number of cells entering
G0/G1 phase increased to 76%, and the
percentage of cells in S/G2/M phase decreased to 20%,
indicative of cell cycle arrest in G0/G1 phase.
However, when the cells were subsequently incubated with Con A after
anti-WC1 treatment, the 
T cells returned to normal cell
cycling with a cell cycle profile similar to that for untreated cells,
with the percentage distribution consisting of 62% in
G0/G1 and 35% in S/G2/M phase.
|
Since it is difficult to distinguish between G0 and
G1 phases of the cell cycle by FACS analysis, another
approach is needed to determine exactly where WC1 activation exerts its
affect on the cell cycle. Three major pocket proteins, the
retinoblastoma protein (Rb), p107, and p130, each having an influence
at different stages during G0/G1 of the cell
cycle, were investigated. Using Western blot analysis, Figure 2
shows that 24-h treatment of 
T
cells with an anti-WC1 mAb resulted in a dramatic dephosphorylation
of Rb from the hyperphosphorylated form, as seen by its increased
mobility on SDS PAGE. Similarly, both p107 and p130 also underwent
dephosphorylation. Dephosphorylation of p107, on the other hand, was
accompanied by a general decrease in the overall expression level of
p107 after 24 h anti-WC1 treatment. Mitogen stimulation with
10 µg/ml Con A after prior WC1 ligation resulted in an increase in
the slower migrating hyperphosphorylated form for all three pocket
proteins Rb, p107, and p130. After 6 h Con A treatment, some
phosphorylation of pRb and p130 had commenced and by 12 h was more
pronounced and apparently complete for p130. Only after 24 h was
pRb phosphorylation complete. In addition, the expression status of
p107 after 24 h mitogen treatment returned to a level comparable
to that before WC1 ligation, although significantly more p107 was in a
hyperphosphorylated form.
|
To determine what effect regulation of pocket protein status may
have on regulation of the cell cycle at a transcriptional level, we
examined the effect of anti-WC1 treatment on E2F activity. Using a
32P-labeled DNA oligomer coding for the E2F binding domain
and incubating it with nuclear extracts from untreated and anti-WC1
mAb-treated 
T cells, WC1 receptor stimulation resulted in
decreased free-E2F DNA binding over a 24-h period (band A in
Fig. 3
A). It is also apparent
that other higher order E2F/protein complexes were not affected by WC1
ligation (bands B and C in Fig. 3
A).
When the 
T cells were then stimulated with 10 µg/ml Con A, the
free E2F DNA binding returns after 12 h. Interestingly, however, a
reduction in free E2F DNA binding was again seen after 24 h Con A
stimulation, while the effect on higher order E2F/protein complexes
remained unaffected throughout the 24 h stimulation with Con A.
|
T cells. Indeed, other DP proteins have
been shown to be expressed in a tissue-restricted manner. (25, 26).
Alternatively, an equally plausible explanation may simply be that our
anti-DP1 Ab, which is active against murine DP1, is unable to
recognize ovine DP1. As regards the pocket proteins, treatment with
anti-p130 decreases the intensity for both bands B
and C, whereas anti-p107 appears to affect only
band C. Anti-Rb, on the other hand, affected only
band B by decreasing its intensity slightly (Fig. 3
To determine whether this decrease in free E2F binding activity is due
to reduced expression of E2F1 or E2F4, Western blots of 
T cells
after treatment with anti-WC1 for up to 24 h were probed for
both E2F1 and E2F4 (Fig. 4
). As can be
seen, there was an almost complete abolition in expression of E2F1,
whereas expression of E2F4 appeared to be unaffected by anti-WC1
stimulation. Subsequent stimulation with Con A for a further 24 h
returned E2F1 expression to its original level. Expression of E2F4,
however, exhibited a small transient decrease after only 1 h Con A
stimulation, returning to normal levels after 6 h stimulation with
Con A.
|
Since WC1 ligation down-regulates E2F1 expression, resulting in
G1 arrest, we determined whether E2F1 was indeed an
important downstream target of WC1 by investigating the effect of E2F1
overexpression on WC1-induced growth arrest. S-59 
T cells were
transfected with a vector expressing either E2F1 or an inactive mutant
E2F1 in conjunction with a fivefold less concentration of an expression
vector expressing human IL-2
-chain. Therefore, purification of human
IL-2
-chain-expressing cells, in theory, yielded cells expressing
either E2F1 or the mutant E2F1. These various cell populations were
then assayed in a standard thymidine uptake proliferation assay after
being treated with either anti-WC1 mAb or an isotype-matched
negative control mAb. As expected, addition of anti-WC1 led to a
decrease in thymidine uptake in both normal untransfected (26%) and
mutant (inactive) E2F1 transfected cells (37%), the results being
expressed as a percentage relative to cells incubated with a negative
control isotype-matched mAb (Fig. 5
).
However, when cells overexpressing E2F1 were incubated with
anti-WC1, there was clearly an increase in thymidine uptake (58%),
in comparison with untransfected or control cells transfected with
mutant E2F1. When these results are reexpressed as a percentage of
cells that recover from or override WC1-induced growth arrest due to
E2F1 overexpression in comparison with those expressing mutant E2F1, we
observe that there is a 33% increase in recovery (inset to
Fig. 5
). Therefore, these results show that E2F1 overexpression can
partly override WC1-induced growth arrest, implicating E2F1 as a
downstream target of WC1 receptor activation.
|
To identify what factors upstream of Rb might be involved in
pocket protein dephosphorylation, we looked at the effects of WC1
activation on A, D, and E cyclins (Fig. 6
). In addition, we also determined
whether or not there was any induction in expression for the cki
proteins. Using a Western blot to detect cyclins D2 and D3, Figure 6
shows that 24-h anti-WC1 treatment of 
T cells resulted in a
decrease in expression for cyclins D2 and D3. Following activation with
10 µg/ml Con A, cyclin D2 and D3 expression returned to their
original levels. Cyclin D1 could not be detected (data not shown), due
either to the Abs used being unable to cross react with ovine cyclin D1
or, alternatively, no cyclin D1 being expressed by these cells, since
lymphocytes generally do not express cyclin D1 (27). With respect to
the other cyclins studied, no significant effect on cyclin E expression
was observed. However, there was no expression of cyclin A (the faster
migrating band highlighted by an arrow in Fig. 5
) after 18 h
anti-WC1 treatment and no subsequent recovery in expression until
after 24 h Con A stimulation. The slower migrating band is either
a nonspecific band detected with this Ab or a possible
posttranslationally modified form of cyclin A that migrates more slowly
on SDS PAGE and appears unaffected by anti-WC1 treatment.
|
|
| Discussion |
|---|
|
|
|---|

T cells upon WC1 receptor activation. This growth
arrest can be overridden by simultaneous or subsequent mitogen
stimulation, allowing the cells to reenter the cell cycle, thereby
providing a unique model for studying both positive and negative
signaling mechanisms controlling cell cycle progression within a poorly
understood component of the immune system, namely the 
T
lymphocyte.
The Rb family of pocket proteins are important negative regulators of
the cell cycle through the sequestration of transcription factors by
the hypophosphorylated forms (28). Our experiments showed that WC1
receptor activation resulted in dephosphorylation of the pocket
proteins p107, p130, and pRb, along with a down-regulation in p107
expression (Fig. 2
). Smith et al. (29) have suggested that p130 is the
principal pocket protein expressed during G0,
distinguishing this cell cycle stage from G1, where pRb is
also present. The decrease in p107 expression after WC1 stimulation
would agree with early G1 arrest, since one report suggests
that p107 expression is not seen until mid-late G1 into S
phase (14). It is unlikely, therefore, that p107 plays a role in
WC1-induced early G1 growth arrest. After WC1-induced
G1 arrest, mitogen-stimulated cell cycle reentry for S-59

T cells would appear to follow a similar course of events for
pRb and p130 to that described for serum-stimulated synchronized T98G
cells by Mayo et al. (30). The expression of p107 after 24 h
mitogen stimulation, coinciding with p130 and pRb phosphorylation,
would indicate that the 
T cells have reentered the cell cycle by
progressing out of G1 into S phase. Indeed, there is an
inverse relationship between expression of p107 and inactivation of
p130 by phosphorylation, and it is suggested that E2F complexes
containing p130 might suppress p107 expression during
G0/G1 (29). Not surprisingly, this 24-h lag
phase prior to 
T cells reentering the cell cycle at S phase
mirrors the apparent 24-h lag phase reported previously when measuring

T cell proliferation by thymidine uptake (5). In summary, WC1
stimulation induces the accumulation of the hypophosphorylated form of
pocket protein, thereby allowing them to sequester E2F transcription
factors.
Since the most well-defined target of hypophosphorylated pocket
proteins is the E2F family of transcription factors, the next logical
step was to focus on the role of these proteins in the control of

T cell proliferation. Analysis of E2F activity by band shift
assay in conjunction with supershift analysis demonstrated that WC1
ligation resulted in decreased binding of free E2F to a radio-labeled
E2F DNA probe (band A, Fig. 3
). This would appear to
be a reflection of substantially lower E2F1 levels, since E2F4
expression was unaffected (Fig. 4
). Overexpression of E2F1 might
therefore be expected to overcome WC1-induced growth arrest. Indeed,
when 
T cells were transiently transfected with E2F1 under the
control of a CMV promoter, E2F1 overexpression overcame WC1-induced
growth arrest with approximately 33% recovery in cell proliferation
(Fig. 5
). Total reversal of WC1-induced growth arrest did not occur,
presumably as a result of one or more of the following possibilities:
1) dephosphorylated pocket protein inactivating some of the
overexpressed E2F1 activity, 2) the increased susceptibility of the
cells to apoptosis as a result of E2F1 overexpression, 3) the level of
E2F1 expression in each cell being unequal leading to varying degrees
of overcoming WC1 induced growth arrest, and 4) the number of purified
IL-2
-chain-expressing cells also expressing E2F1. Nevertheless,
these results therefore show that down-regulation of free E2F1 activity
through WC1 ligation is responsible for the induction of 
T cell
growth arrest.
The pocket protein p130 can complex with E2F4 in G0 or
early G1 (13, 14) and this can regulate E2F1 gene
expression in a negative manner (31). Therefore, the observed decrease
in E2F1 expression upon anti-WC1 treatment in our experiments (Fig. 4
) may possibly be the result of transcriptional shut-off of the E2F1
gene by a p130/E2F4 complex. However, our band shift experiments (Fig. 3
A) did not indicate any significant change in the level of
higher order complexes containing p130 and E2F4 (bands
B and C) upon WC1 ligation. The reason for this
in unclear. It is possible, however, that the repression on E2F1
transcription by a p130/E2F4 complex is manifested through subtle
changes in p130 phosphorylation status, as seen in Figure 2
.
Furthermore, pRb dephosphorylation would result in sequestration and
inactivation of any remaining free E2F1, thereby halting transcription
of E2F1-regulated genes. This provides a powerful means of shutting off
cell cycle progression within early to mid G1 phase of the
cell cycle.
The observation that mitogen stimulation overrides WC1-mediated cell
cycle arrest is attributable to the observed induction of both pRb and
p130 phosphorylation (Fig. 2
). For example, as shown elsewhere,
sequestration and inactivation of de novo E2F1 by pRb would not occur
as pRb becomes phosphorylated (28). In addition, p130 phosphorylation
within p130/E2F4 complexes could remove the repression this complex
exerts over E2F1 expression (31). Consequently, E2F1 expression levels
rise as seen here (Fig. 4
), leading to increased free E2F DNA binding
activity (Fig. 3
A) and cell cycle reentry. Moreover, as
these synchronized cells start to progress out of G1,
regulation of E2F4 transcriptional activity comes under the control of
p107 as it begins to be expressed (14, 32). Therefore the expression of
p107 after 24-h mitogen stimulation not only clearly indicates that the

T cells have moved out of G1 into S phase but may
also account for the loss of some free E2F DNA binding activity (Fig. 3
A) attributable to E2F4 expression (Fig. 4
). However,
although increased p107 expression may account for the loss of free
E2F4 DNA binding activity, the loss of free E2F1 activity, on the other
hand, may be more attributable to the increase in cyclin A expression
after 24 h Con A stimulation (Fig. 6
). Indeed, Dynlacht et al.
(33) and Krek et al. (34) have shown that, as cyclin A accumulates in
S-phase, it binds to E2F1/DP1 complexes, and the associated kinase
activity results in phosphorylation of this complex, culminating in a
loss of free E2F1/DP1 binding activity. The net effect of both these
events results in the loss of free E2F DNA binding activity seen in
Figure 3
A after 24-h Con A stimulation. Such a sequence of
events would serve to tightly regulate and prevent high levels of free
E2F activity upon leaving G1 phase, which would result in
inopportune apoptosis (35, 36). In summary, mitogen stimulation with
Con A is initially able to overcome WC1-induced 
T cell growth
arrest through an accumulation in hyperphosphorylated pocket protein
with a consequent increase in E2F1 expression, driving cell cycle
progression out of G1. The question that arises, therefore,
is: How is pocket protein phosphorylation status regulated in S-59

T cells?
Pocket protein phosphorylation is regulated by cyclin-cdk complexes,
and their activity in turn is negatively regulated by the ckis, such as
p27kip1 (37). Upon analysis of the cyclins and the cki p27kip1, we
found that an inverse correlation existed between p27kip1 and cyclin A
or D expression in S-59 
T cells. Moreover, the apparent
abolishment of cyclin A expression upon WC1 ligation (Fig. 6
) may be
the result of induction of p27kip1 expression, since it is reported to
down-regulate cyclin A gene expression (38). However, the link between
cyclin D and p27kip1 expression is not as clear. Nevertheless, the
decreases in cyclin A and D expression, coupled with the increase in
p27kip1 upon WC1 ligation, would have a strong down-regulatory effect
on, for example, cyclin A-cdk2 and cyclin D-cdk4 activity (37), as well
as subsequent pocket protein phosphorylation (10). With regard to
mitogen stimulation, it would appear that mitogen can relax the
repression that WC1 exerts on IL-2 signaling, allowing p27kip1
degradation to proceed and cyclin D levels to initially rise. This is
followed later by a rise in cyclin A expression, coinciding with a rise
in p107 expression after 24-h mitogen stimulation (Figs. 2
and 6
). In
support of this conclusion, IL-2 signaling can be linked to p27kip1
degradation through the MAP kinase pathway (39, 40). In addition, we
found that WC1-arrested 
T cells remain locked in
G0/G1 growth arrest when stimulated with
mitogen in the absence of IL-2 (5). Similarly, Firpo et al. showed that
mitogen stimulation actually maintained growth arrest in resting cells
by inducing p27kip1 expression, as seen here with Con A stimulation
(Fig. 7
), until subsequent costimulation with IL-2 occurs (17).
We may therefore conclude that IL-2-dependent 
T cell growth,
allowing cells to transit G1 so as to continue cell
cycling, is maintained by free E2F activity as a result of pocket
protein phosphorylation through a down-regulation in expression of the
cki p27kip1 and an initial elevation in cyclin D levels. WC1 ligation,
on the other hand, can inhibit IL-2 signaling through dephosphorylation
and inactivation of MAP kinase (6). Consequently, this would allow
p27kip1 levels to rise, triggering the cascade of events downstream of
p27kip1, as described here, resulting in G1 cell cycle
arrest. Mitogen stimulation, on the other hand, can override WC1,
presumably by preventing WC1 from inhibiting IL-2-dependent signaling
pathways. In conclusion, these results, focused on E2F and pocket
protein regulation, provide an insight into the mechanisms through
which immunologically important growth regulatory stimuli signal within
the context of 
T cell cycle control.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Paul A. Kirkham at his current address: Novartis Horsham Research Center, Wimblehurst Road, Horsham, West Sussex, RH12 4AB, U.K. E-mail address: ![]()
3 Abbreviations used in this paper: MAP, mitogen-activated protein; cki, cyclin kinase inhibitor; pRb, pocket retinoblastoma protein. ![]()
Received for publication December 3, 1997. Accepted for publication April 9, 1998.
| References |
|---|
|
|
|---|

cells. Annu. Rev. Immunol. 11:637.[Medline]
and interleukin-4 in response to Th1-stimulating and Th2-stimulating pathogens by 
T-cells in vivo. Nature 373:255.[Medline]

T cells. Curr. Opin. Immunol. 9:57.[Medline]

T-cells: T-cells with B-cell like recognition properties. Curr. Biol. 5:1116.[Medline]

T cell specific surface receptor (WC1) signaling G0/G1 cell cycle arrest. Eur. J. Immunol. 27:105.[Medline]

T-cells induced by mAb against WC1 correlates with activation of multiple tyrosine phosphatases and dephosphorylation of MAP kinase erk2. Eur. J. Immunol. 27:717.[Medline]

T lymphocytes. J. Immunol. 152:3476.[Abstract]

T-cell lines with cells of other phenotypes. Vet. Immunol. Immunopathol. 35:59.
This article has been cited by other articles:
![]() |
H. Takamatsu, P. S. Mellor, P. P. C. Mertens, P. A. Kirkham, J. N. Burroughs, and R. M. E. Parkhouse A possible overwintering mechanism for bluetongue virus in the absence of the insect vector J. Gen. Virol., January 1, 2003; 84(1): 227 - 235. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Kirkham, H.-H. Takamatsu, E. W.-F. Lam, and R. M. E. Parkhouse Ligation of the WC1 Receptor Induces {gamma}{delta} T Cell Growth Arrest Through Fumonisin B1-Sensitive Increases in Cellular Ceramide J. Immunol., October 1, 2000; 165(7): 3564 - 3570. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Wilson, M. K. Aydintug, and M. A. Jutila A Circulating Bovine {gamma}{delta} T Cell Subset, Which Is Found in Large Numbers in the Spleen, Accumulates Inefficiently in an Artificial Site of Inflammation: Correlation with Lack of Expression of E-Selectin Ligands and L-Selectin J. Immunol., April 15, 1999; 162(8): 4914 - 4919. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Peiretti, S. Lopez, P. Deprez-Beauclair, B. Bonardo, I. Juhan-Vague, and G. Nalbone Inhibition of p70S6 Kinase during Transforming Growth Factor-beta 1/Vitamin D3-induced Monocyte Differentiation of HL-60 Cells Allows Tumor Necrosis Factor-alpha to Stimulate Plasminogen Activator Inhibitor-1 Synthesis J. Biol. Chem., August 17, 2001; 276(34): 32214 - 32219. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |