| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037; and
Department of Microbiology and Immunology, and Program in Molecular Biology, Stritch School of Medicine, Loyola University Chicago, Maywood, IL 60153
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
L chains. These findings demonstrate
that early pre-B cells are selected for maturation on the basis of the
structure of a µ-chain, in particular its
VH-D-JH joining or CDR3 sequence, and that one
mechanism for this selection is the capacity of a µ-chain to assemble
with SL chain. Therefore, we propose a new function of SL chain in
early B cell development: SL chain is part of a quality control
mechanism that tests a µ-chain for its ability to pair with
conventional L chains. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
VH-D-JH recombination might frequently generate
IgH genes that encode "dysfunctional" H chains. By our definition,
dysfunctional µ-chains contain unusual
VH-D-JH joinings, or
complementarity-determining region 3 (CDR3) sequences, that interfere
with the correct folding of VH regions and thus with an H
chain’s ability to form heterodimers with an L chain. We have
suggested that, before early pre-B cells clonally expand, they should
be screened for "functional" H chains (10) that could ultimately
pair with Ig L chains (11). For several reasons, surrogate light (SL)
chain, which consists of the two polypeptides VpreB and 
5 (Refs. 12
and 13; reviewed in 14 , represents a perfect candidate molecule
that could not only screen a pro-B/early pre-B cell for the presence of
a µ-chain but also serve as a template to assess the proper folding
of a µ-chain (2, 10, 11) and thus test its ability to pair with IgL
chains (11). First, SL chain is detected throughout the pro-B/early
pre-B cell stage (3, 15). Second, it structurally resembles a
conventional L chain (reviewed in Refs. 14 and 16). Third, it forms
with µ-chain a signal-transducing pre-B cell receptor complex
(pre-BCR) (17, 18, 19, 20, 21, 22, 23, 24) that can be detected on the surface of ex vivo
isolated early pre-B cells (25). Fourth, although homozygous 5 gene
knock-out mice have almost normal numbers of pro-B cells, they show a
marked decrease in small pre-B cells (26), suggesting that 5 is
required for the efficient transition of cells from the pro-B to the
small pre-B cell stage. Based on these characteristics of SL chain and
the fact that H chain is absolutely required for early B cell
differentiation (5, 6, 7, 8, 9), we propose that early pre-B cells that
synthesize dysfunctional µ-chains do not undergo clonal expansion and
maturation, because these H chains fail to form with SL chain a
signal-transducing pre-BCR. Such a quality control mechanism would
ensure that only cells having the potential to become surface
IgM+ B cells clonally expand and enter the pre-B cell pool.
We predict that a dysfunctional µ-chain fails not only to pair with
SL and conventional L chains chain but also to trigger maturation of
pro-B/early pre-B cells.
Our model predicts that µ-chains, depending on their CDR3 sequences, might differ in their ability to foster maturation of early pre-B cells. This idea is supported by studies that examined the ratio of productive to nonproductive rearrangements in pro-B and small pre-B cells. Because only µ-positive early pre-B cells develop into small pre-B cells, productive IgH rearrangements are enriched in small pre-B cells compared with that in pro-B/early pre-B cells (2, 27). Surprisingly, however, in pre-B cells only 20 to 30% of the rearrangements that utilize the VH81X gene segment, a member of the D-proximal VH7183 family (28, 29), are productive (10, 30), whereas, as expected, 70 to 85% of the VH-D-JH rearrangements utilizing other VH gene segments encode a µ-chain (2, 27, 30, 31). Thus, most VH81X-D-JH rearrangements seem to result in the synthesis of dysfunctional µ-chains that do not promote clonal maturation of B220+CD43+ pro-B/early pre-B cells into B220+CD43- small pre-B cells, possibly because these chains fail to associate with SL chain. The strongest support for this idea comes from our recent studies that identified for the first time two VH81X-µ-chains that do not form with SL chain a transport-competent µ-SL surface complex in Abelson virus-transformed pre-B cell lines (11). In addition, a more recent report showed that all seven productive VH81X rearrangements isolated from c-kit+, cytoplasmic µ+ bone marrow cells of normal mice encode 81X-µ-chains that, when tested in an Abelson virus-transformed cell line, fail to pair with SL chain (32).
If the association of a µ-chain with SL chain is required for
pro-B/early pre-B cells to mature, then a µ-chain unable to associate
with SL chain should not mediate the pro-B to small pre-B transition.
In addition, one might expect that a SL chain nonpairing µ-chain
fails to pair with most if not all IgL chains. Consistent with our
hypotheses, we found that the assembly-dysfunctional
VH81X-µ-chains, which is encoded by a transgene, cannot
rescue B cell development in gene knock-out mice that have lost the
capability to synthesize their own µm chains.
Furthermore, the same µ-chain fails to pair with four distinct L
chains. These findings not only demonstrate for the first time that the
capacity of a µ-chain to promote differentiation of pro-B/early pre-B
cells depends on its ability to assemble with SL chain but also
strongly suggest a new function of SL chain in early B cell
development, that is, that SL chain serves as a folding template that
tests the ability of µ-chain to pair with conventional L chains.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
All cell lines used in this study were grown in complete RPMI
1640 medium (33). The BINE.µ line was generated by transfecting
BINE4.8, an Ig-negative subclone (11) of the Abelson leukemia
virus-transformed pre-B cell line 18-81, with the µ-chain-encoding
plasmid vector, pµgpt (34). BC2-µ (35, 36) and NYCH.µk (34)
are VH81X-IgM- and VHJ558-IgM/-secreting
hybridoma lines, respectively. NTG-µ was generated by fusing
LPS-activated spleen cells from a C57/BL6 mouse with the plasmacytoma
Ag8.653 (37). BC2- was isolated by the limiting dilution method from
BC2-µ and NYCH.µ hybridoma cultures, respectively. The loss
of the productive µ gene was verified by Southern and Western blot
analyses (not shown).
Antibodies
The monoclonal rat anti-mouse Cµ2 Ab, b7-6, and the
monoclonal hamster anti-mouse 5 Ab, FS1, were described
previously (11). Unconjugated affinity-purified goat Abs specific for
mouse µ and chains were purchased from Southern Biotechnology
(Birmingham, AL). The following monoclonal anti-mouse Abs and
respective isotype-matched control Abs were purchased from PharMingen
(San Diego, CA): allophycocyanin- and phycoerythrin (PE)-conjugated rat
anti-B220 (clone RA3-6B2), biotin-conjugated rat anti-HSA
(clone M1/69), PE-conjugated rat anti-BP1 (clone BP-1),
FITC-conjugated rat anti-IgMa (clone DS-1),
biotin-conjugated mouse anti-mouse µb (clone AF6-78),
PE-conjugated rat anti-CD19 (clone 1D3), and biotin-conjugated rat
anti-CD43 (clone S7) Abs. FITC-conjugated monoclonal mouse
anti-mouse µa Abs (clone RS-3.1; 38 were
generated by coupling protein A-purified Abs with the fluorescein
labeling kit from Boehringer Mannheim (Indianapolis, IN).
Biotin-conjugated Abs were detected with either
allophycocyanin-conjugated streptavidin (PharMingen) or
Red613-streptavidin (Life Technologies, Gaithersburg, MD). Amino methyl
coumarin (AMCA)-conjugated goat anti-mouse µ Abs were purchased
from Chemicon (Temecula, CA), the rat monoclonal anti-mouse µ Ab
LO-MM-9 from Zymed (San Francisco, CA), and FITC-conjugated goat
anti-mouse µ Abs from Southern Biotechnology. The optimal
dilution of each Ab was determined in flow cytometric analyses of cell
lines and single-cell bone marrow and spleen suspensions.
Plasmid construction and transfection of DNA into cultured cell lines
The construction of p81Fµneo, a gift from M. Wabl
and J. Bachl (University of California, San Francisco, CA) was
previously described (11). The nucleotide sequence of the complete
VH81XDJH region in p81Fµneo was
confirmed by dideoxy dsDNA sequencing (39). pT1gpt is a
-encoding mammalian expression vector (40). Transfections of the
pre-B cell line BINE4.8 and the hybridomas NYCH.µ, NTG-µ, and
BC2- were performed with purified plasmids as described (11). Stable
transfectants were selected in RPMI 1640 medium supplemented either
with G418 (1.2–1.8 mg/ml) or with mycophenolic acid (1.25 µg/ml) and
xanthine (250 µg/ml), then screened for µ and synthesis
by cytoplasmic immunofluorescence (34).
PCR analysis of ear DNA
Ear DNA was isolated as described by Chen and Evans (41). Briefly, an ear punch was incubated for 30 min at 55°C in 20 µl of 50 mM Tris, pH 8.0, 20 mM NaCl, 1 mM EDTA, 1% SDS, and 1 mg/ml proteinase K. Two hundred microliters of deionized water was added, and the mixture was boiled for 10 min and stored at 4°C.
One microliter of ear or tail DNA was incubated for 3 min at 95°C followed by 35 cycles each for 30 s at 94°C, 30 s at 58°C, and 1 min at 72°C in a total volume of 50 µl of 1x PCR buffer (Perkin-Elmer, Branchburg, NJ; 10 mM Tris, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin) with 200 µM dNTPs (Pharmacia, Uppsala, Sweden), 10 pmol each of the 81X.FOR (CCTGTGAATCCAATGAATACGAATTCCCTTCCCATGA) and the JH2.BAC oligonucleotides (TGCGGCCGCTGAGGAGACTGTGAGAGTGGTGCCTTGGCCCC), and 1.25 U of AmpliTaq polymerase (Perkin-Elmer). Twenty-five microliters of each PCR reaction was digested with 10 U of HpaI (Life Technologies, Gaithersburg, MD) for 1 h at 37°C. Digested and undigested reactions were separated on a nondenaturing 7% polyacrylamide/TBE (Tris-borate-EDTA) gel, and the DNA was visualized by ethidium bromide staining.
Southern blot analysis of tail DNA
Tail DNA was isolated as described by Hogan et al. (42). Approximately 1 cm of tail was removed, placed into a 1.5-ml microcentrifuge tube with 700 µl of 50 mM Tris, pH 8.0, 100 mM EDTA, 100 mM NaCl, and 1% SDS, and minced with scissors. Proteinase K (Boehringer Mannheim; final 500 µg/ml) was added, and the mixture was incubated for 8 to 18 h at 55°C. After that, RNA was digested with RNase A (Boehringer Mannheim; final 0.4 µg/ml) at 37°C for 1 to 2 h. The digestion mixture was extracted once with an equal volume of equilibrated phenol, once with phenol/chloroform/isoamylalcohol (25 + 24 + 1) and once with chloroform/isoamylalcohol (24 + 1). DNA was precipitated from the aqueous phase with isopropanol, washed in 70% ethanol, dried, and dissolved in 500 µl of 10 mM Tris, pH 8.0/1 mM EDTA.
Five micrograms of tail DNA was digested with appropriate restriction endonucleases according to manufacturer’s instructions, separated on an 0.8% agarose gel in TAE buffer (43), and transferred to Genescreen (DuPont, Boston, MA). Filters were hybridized in 20 ml of hybridization mix (10% dextran sulfate, 1% SDS, 1 M NaCl) for 12 h at 65°C with 32P-nick-translated or random-primed DNA probes. The blots were washed in 0.1x SSC/0.1% SDS at 65°C until no background activity was detectable with a Geiger probe. Radioactive-labeled bands were visualized by autoradiography. DNA probes were isolated by gel electrophoresis from digests of the appropriate cloning vectors. A 1.0-kb SmaI-ApaI Cµ cDNA probe and a 1-kb XbaI intronic mouse IgH enhancer probe were isolated from the expression vector pµgpt (34), an 0.8-kb XbaI-EcoRI genomic mouse 5'-Jk probe from a pGEM cloning vector (44), and a 0.46-kb EcoRI-BamHI VH81X probe from plasmid pTA-V81XF. pTA-V81XF was generated by cloning a completely rearranged VH81XDJH region—which was isolated from total RNA of F cells by RT-PCR using a degenerate VH (VH1BACK) and a universal JH primer (VH1FOR-2) as described (11)—into the cloning vector pTA (Invitrogen, Carlsbad, CA).
Metabolic labeling, immunoprecipitation, and gel electrophoresis
Labeling, immunoprecipitations, and electrophoretic analyses
were performed as described (11). Briefly, 5 x 106
cells/ml were metabolically labeled with 75 µCi/ml
Tran-35S-label (1076 Ci/mmol; ICN, Costa Mesa, CA) for
3 h and lysed on ice for 30 min in NaCl/EDTA/Tris (NET) lysis
buffer. Proteins were precipitated from lysates with either mAbs
against mouse µ (clone b7-6), mouse 5 (clone FS-1), or goat Abs
against mouse µ or , followed by the appropriate secondary Abs and
Staphylococcus aureus. Immunoprecipitated proteins were
separated by Laemmli SDS-PAGE and detected by fluorography as described
earlier (45).
Generation of transgenic mice
Mice used in this study were bred and maintained under specific
pathogen-free conditions in animal housings at Loyola University
Medical Center and at The Scripps Research Institute. The
VH81X-µ gene used to generate transgenic 81Fµ mice is
shown in Figure 1
A. The 16.5-kb
SalI-XhoI fragment from the vector
p81Fµneo (Fig. 1A) was gel purified,
electroeluted, and passed over a Qiagen column (Qiagen, Santa Clarita,
CA). Pronuclei of C57BL/6 mice were first injected with about 10 pmol
of the purified 16.5-kb SalI-XhoI fragment and
then reimplanted in pseudopregnant C57BL/6 foster mice. Offspring were
first screened for the presence of the transgene by a
transgene-specific PCR assay; the HpaI site in the D segment
of the 81Fµ gene (Fig. 1B) allowed us to distinguish
transgenic from endogenous VH81X DNA rearrangements,
because only a PCR fragment derived from transgenic VH81X
rearrangements will be cleaved by HpaI into a 260-bp and a
40-bp fragment (data not shown). Southern blot analyses confirmed the
integration of the entire transgenic 81Fµ gene into the genome of
PCR-positive transgenic C57BL/6 mice, because we detected with a Cµ
probe the expected 4.3- and 6.6-kb fragments and with a
VH81X probe the expected 4.3-kb fragment (Fig. 1A) in the transgenic founder lines F29, F30, F41, and F58,
but not in the nontransgenic littermates, F34 and F40 (results not
shown).
|
double knock-out mice (a
gift from N. Lonberg, GenPharm, Mountain View, CA). Male 81Fµ
transgene-positive heterozygous
JH+/-/Jk+/- mice were
back-crossed to homozygous female JHT/JT
knock-out mice. F1' progeny were screened for the presence
of the 81Fµ transgene by PCR and Southern blot analysis (data not
shown). To determine the status of the JH and
J loci in F1' progeny, Southern blot
analyses were performed on StuI-digested tail DNA (8) with a
1-kb XbaI IgH enhancer probe (34) and on
PstI-digested DNA with an 0.8-kb
EcoRI-XbaI 5' J probe (44),
respectively. Flow cytometry
Bone marrow cells were obtained by flushing the femora and tibiae of transgenic and nontransgenic littermates with ice-cold RPMI/10% FCS or HBSSF (HBSS supplemented for flow cytometry (F) with 0.1% BSA (fraction V) and 0.02% NaN3). Total spleen cells were isolated by gently homogenizing a spleen through a mesh into ice-cold RPMI/10% FCS or HBSSF. Peritoneal cells were obtained by flushing the peritoneal cavity with 5 ml of ice-cold RPMI/10% FCS or HBSSF/5% FCS. Blood was collected from the tail vein into a 1.5-ml microcentrifuge tube containing 10 µl of heparin (1000 U/ml; Elkins-Sinn, Cherry Hill, NJ). The blood was then overlaid onto Ficoll-Paque (Pharmacia) and centrifuged at room temperature. The nucleated cells were removed with a Pasteur pipet, washed once in ice-cold HBSSF, and resuspended in 100 µl of ice-cold HBSSF for flow cytometric analysis. All other cell suspensions were washed once in ice-cold PBSF (PBS supplemented for flow cytometry (F) with 0.1% NaN3 and 1% BSA) or HBSSF and subjected to flow cytometric analysis as described below and in the figure legends.
To perform as many as three-color analyses, 1 to 2 x 106 bone marrow, spleen, blood, and peritoneal cells were membrane stained for 10 to 30 min on ice with 40 µl of the appropriate fluorochrome-conjugated primary Abs diluted in PBSF or HBSSF. Cells were then washed three times in ice-cold PBSF or HBSSF, incubated, if necessary, with appropriate secondary staining reagents, and washed again three times in ice-cold PBSF or HBSSF. Multiparameter analysis of 20,000 cells was performed with a FACStarPlus (Loyola University and Scripps Research Institute Flow Facility) on cells contained within the lymphocyte gate, as defined by forward and side light scatter analysis. FACS diagrams were generated with the Lysis II (Loyola University Chicago) or the CellQuest (Scripps Research Institute) software programs.
To detect intracellular µ-chains, 1 to 2 x 106 bone marrow cells were first membrane stained as described above and washed three times in 4 ml ice-cold PBSF. The cells were then fixed on ice for 10 min in 1 ml PBS containing 4% paraformaldehyde, permeabilized by washing the fixed cells thre times in 4 ml ice-cold permeabilization buffer (PBS, 10 mM HEPES, 0.1% saponin), stained with FITC-conjugated anti-mouse µ Abs, washed twice in 4 ml of ice-cold permeabilization buffer and once in 4 ml ice-cold PBSF, and finally subjected to flow cytometric analysis as described above.
To perform five-color flow cytometric analysis of total bone marrow cells, 106 bone marrow cells were washed in HBSSF, first stained with FITC-conjugated anti-CD43 Abs on ice for 15 min, washed with HBSSF, and then stained with allophycocyanin-conjugated anti-B220 and biotin-conjugated anti-HSA Abs in HBSSF on ice for 15 min. The cells were then washed in ice-cold HBSSF and stained with PE-conjugated anti-BP-1 Abs and Red613-streptavidin (Life Technologies). The cells were washed again in ice-cold HBSSF, fixed at room temperature in 1 ml of PBS containing 4% paraformaldehyde, and washed several times in PBS supplemented with 3% heat-inactivated FCS. The pelleted cells were permeabilized in 1 ml of freshly prepared ice-cold PBS/0.1% saponin, stained with AMCA-conjugated anti-mouse-µ Abs for 15 min at room temperature, washed in ice-cold HBSSF, and suspended in 0.5 ml of ice-cold HBSSF, and 20,000 cells were collected and analyzed on a FACSVantage in three-laser configuration (Becton Dickinson) at the Scripps Research Institute Flow Facility.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Generation of transgenic mice synthesizing an assembly-dysfunctional µ-chain
To generate a 81Fµ-transgenic mouse, we first obtained the
plasmid vector p81Fµneo that contains the 81Fµ gene on a
16.5-kb SalI-XhoI fragment (Fig.
1A). An HpaI site
in the D segment of the transgenic 81Fµ gene, which was introduced
during the construction of the p81Fµneo vector, converted
the amino acid residue at position 99 of 81Fµ-chains from glycine to
valine (Fig. 1
B). However, this mutation did not restore the
ability of the 81Fµ-chain to form a transport-competent µ-SL
complex, because 5 did not coprecipitate with transfected
81Fµ-chains (Fig. 1C-a, lane 3), and
transfected 81Fµ-chains were not detected on the cell surface (Fig. 1C-b, BINE.81Fµ). In contrast, 5 and VpreB
coprecipitated with a µ-chain bearing a VHJ558 region
(Fig. 1C-a, lane 5), and the same chain could be detected on
the cell surface of transfected BINE 4.8 cells (Fig. 1C-b,
BINE.µ).
The isolated 16.5-kb SalI-XhoI fragment encoding
81Fµ-chains of the a allotype and neomycin
phosphotransferase (Fig. 1A) was injected into C57BL/6
pronuclei that encode Cµ regions of the b allotype. At
approximately 4 wk of age, tail or ear DNA was isolated from offspring
and screened, as described in the experimental procedures, by PCR for
the presence of the transgenic VH81X-D-JH
rearrangement. The integration of the entire transgene was
confirmed by Southern blot analysis as described in the
experimental procedure. Of the 56 transgenic progeny, a total of 5 mice
tested positive for the transgene by PCR and Southern blot analysis
(data not shown). When we compared Southern hybridization signals of
the transgenic Cµ fragments with that of endogenous Cµ fragments,
we found that one mouse (F29) contained two copies and the other four
about nine copies of the transgene (data not shown). Unfortunately, the
F29 founder died before a line could be established.
Analysis of transgenic and endogenous surface IgM on splenic, bone marrow, and peritoneal B cells from 81Fµ-transgenic mice
µ-Chain encoded by the transgene is of the a
allotype, whereas µ-chains encoded by endogenous IgH genes are of the
b allotype. Thus, it should be straightforward to determine
whether B cells synthesize transgenic µa and endogenous
µb chains by using Abs that distinguish between these
allotypic differences (antiallotypic µ Abs). The antiallotypic Abs
used in this study, however, detect µ-chains only when associated
with conventional or L chains, but they do not react with free
µ-chains or µ-chains that are bound to SL chains (L.H. and H.-M.J.,
unpublished observations). These findings are supported by an earlier
observation that several other antiallotypic µ Abs failed to detect
µ-chains in L chain-negative bone marrow pre-B cells (46). One
explanation is that the allotypic epitope, which is located in the
first constant domain (Cµ1) of the µ gene (47), is established only
when µ-chains associate with conventional L chains.
When we subjected single spleen cell suspensions from one of the
transgenic lines (F30) to flow cytometric analyses using Abs against
the pan-B cell marker B220 and the µa and
µb allotypes, in transgene-positive mice we detected only
B220+ B cells that reacted with anti-µb
Abs (Fig. 2). The same result was
obtained when we analyzed single-cell suspensions from the bone marrow
and peritoneal cavity (data not shown). To exclude the possibility that
this finding was due to a particular transgenic line, we analyzed by
flow cytometry whether transgenic µa and endogenous
µb are present on the surface of B cells from the bone
marrow and spleen of three other transgene-positive founders. The
results for these founders were the same as for the transgenic F30 line
(Fig. 2), that is, B cells in these mice stained with
anti-µb but not with anti-µa Abs
(data not shown). Thus, peripheral B cells in transgenic mice deposit
only IgM of the endogenous allotype b on the surface. In
addition, we detected in 3- to 5-mo-old transgenic and nontransgenic
mice no significant differences in the number of splenic
B220+ B lymphocytes (Fig. 2 legend), suggesting that the
presence of the transgene did not impair the generation of peripheral
B220+ B lymphocytes in adult mice.
|
light chains carrying distinct V region sequences (Fig. 6).
Thus, the 81Fµ-chain very likely fails to assemble in the transgenic
mouse with most if not all conventional L chains and should be trapped
within the endoplasmic reticulum by the H chain-binding protein BiP
(48) in surface IgMb-positive B cells. Another explanation
is that the transgene is not expressed at the protein level in
peripheral B cells. Because neither antiallotypic µ nor
anti-idiotypic Abs that would detect free intracellular
81Fµa and endogenously derived µb chains
within the same cell are yet available, we cannot distinguish between
the two possibilities. However, we will show below that the transgenic
81Fµ-chain is already synthesized in early pro-B cells.
|
Ig promoter and enhancer elements are already transcriptionally active in early B lymphoid progenitors in which endogenous IgH rearrangements have not yet occurred (49, 50, 51). Therefore, depending on the transgene’s integration site, transgenic µ-chain could already be synthesized in B cell progenitors that did not yet rearrange their IgH gene segments and thus do not synthesize µ-chains encoded by endogenous IgH rearrangements. In this case, 81Fµ-chains should easily be detected in these early B cell progenitors with Abs that react with µ-chains regardless of allotype and whether they associate with SL or L chain. According to the classification of Hardy and coworkers (52), B lineage cells in the bone marrow of mice can be divided into subpopulations on the basis of cell surface markers. Early B cell progenitors (pre-pro-B, pro-B, and early pre-B cells) are surface B220- and CD43-positive and can be subdivided on the basis of BP-1 and HSA surface markers into fraction A, B, C, and C' cells. These cells develop into small cytoplasmic µ-positive B220+CD43- pre-B cells (fraction D cells) from which surface IgM+ immature (fraction E) and mature (fraction F) B lymphocytes emerge. About half of the fraction A cells, all of which carry the surface markers B220 and CD43 but do not synthesize HSA and BP-1 (52), are committed to the B cell lineage (53). But more importantly for this study, these cells do not synthesize endogenous µ-chains, because they have not yet generated functional IgH genes (27, 52). Therefore, if we detect µ-chains in a large portion of fraction A cells from 81Fµ transgene-positive mice, we can conclude that 81Fµ-chains are synthesized.
To determine whether fraction A cells in transgenic mice synthesize
µ-chains, we performed a five-color flow cytometric analysis with
bone marrow cells from transgenic and nontransgenic littermates. Bone
marrow cells from 8-wk-old transgenic and nontransgenic littermates
were isolated and membrane stained with Abs against the surface markers
B220, CD43, HSA, and BP-1. To reveal intracellular µ staining, the
cells were then fixed, permeabilized, and stained with a mAb that
reacts with µ-chains regardless of whether they bind to SL or L
chains. Multiparameter flow analysis (Fig. 3) revealed that about 50% of the
fraction A cells (Fig. 3d, gates G1 + G2 + G4) from
81Fµ-transgenic littermates reacted with anti-µ Abs. In
contrast, only a few fraction A cells from nontransgenic littermates
stained with anti-µ Abs. From these results and the finding that
only about half of the fraction A cells are true B lymphoid precursors
(53), we conclude that transgenic 81Fµ-chains are synthesized in most
"fraction A" B lineage cells that do not yet produce endogenous
µ-chains.
|
d, G1 + G2 +
G4) was at least comparable with that in nontransgenic "fraction
E/F" B cells (Non-Tg in Fig. 3d, G1 + G3). It is
noteworthy, however, that the synthesis of high levels of dysfunctional
81Fµa chain very early in B cell development (Fig. 3d) does not preclude the generation of
IgM+ B cells utilizing only endogenous µb
chains (Fig. 2). The assembly-dysfunctional 81Fµ-chain does not rescue B cell development in JH knock-out mice
A functional transgenic µ-chain can rescue the block in early B cell development caused by homozygous deletion of the complete JH cluster, because, in contrast to embryonic stem cells that carry only the homozygous JH deletion, those that carry a homozygous deletion of the JH region and contain a transfected functional µ gene developed into small pre-B and surface IgM+ B cells in the RAG-2-deficient blastocyst complementation assay (54). Therefore, if only those early pre-B cells that assemble a µ-SL chain complex clonally mature and differentiate into small pre-B cells, we would not expect to detect pre-B and B cells in 81Fµ-transgenic mice that carry a homozygous deletion of the complete JH cluster (JHT mice).
To test this idea, we first bred a male 81Fµ-transgenic C57BL/6 mouse
(line F30, Fig. 3) with female mice that contain homozygous deletions
of the JH and the complete Jk-Ck
regions (JHT/JkT mice). A male 81Fµ
transgene-positive F1 mouse
(JH+/-/Jk+/-) was
then backcrossed to female JHT/JkT knock-out
mice. Offspring were screened by a transgene-specific PCR assay for the
presence of the 81Fµ transgene and by Southern blot analysis for the
deletion of both JH and the presence of at least one
Jk locus, as described in Materials and Methods
(data not shown).
To determine whether the transgenic 81Fµ-chain can rescue the block
in B cell development of JHT mice, that is, to trigger
CD43+B220+ pro-B cells to differentiate into
B220+CD43- pre-B and surface IgM+
B cells, bone marrow cells were isolated and stained with Abs against
the surface markers B220, CD43, and µ. Flow cytometry of bone marrow
cells from both 81Fµ-transgenic and nontransgenic
JHT/Jk+/- littermates detected
similar levels of CD43+B220+ pro-B cells (Fig. 4A, middle diagrams). However,
consistent with our hypothesis, levels of
B220+CD43- pre-B cells were drastically
reduced (Fig. 4A), and B220+/surface
IgM+ B cells could not be detected in the bone marrow (Fig. 4A, lower diagrams), spleen (Fig. 4B), and
peritoneum (Fig. 4C) of both 8-wk-old transgenic 81Fµ and
nontransgenic JHT/Jk+/- mice.
|
75% of the
B220+CD43+ bone marrow cells (Fig. 5c, gates G1) reacted with the
rat anti-µ Abs (Fig. 5d). To confirm these findings,
CD43+B220+ pro-B cells were isolated by FACS,
spun on a slide, fixed in ethanol, and stained with FITC-conjugated
polyclonal goat anti-µ Abs. Fluorescence microscopy confirmed the
flow data, that is, we found in two independent experiments that
60% of sorted B220+/CD43+ pro-B cells in
81Fµ transgene-positive
JHT/Jk+/- mice stained with
anti-µ Abs, whereas, as expected, none of the pro-B cells from a
nontransgenic JHT/Jk+/- mouse
reacted with the rat anti-µ Abs (data not shown).
|
The SL chain nonpairing 81F-µ-chain does not pair with conventional IgL chains
Surface IgM+ B cells accumulate at a low rate in
peripheral lymphatic organs of SL chain-deficient mice (26, 55). It has
been proposed that surface IgM+ B cells can originate via a
SL chain-independent pathway from a small percentage of µ-positive
early pre-B cells that rearrange their VL gene segments
early (discussed in Refs. 56 and 57). One possible explanation why we
did not detect in 81Fµ-transgenic
JHT/J+/- mice at least some
surface IgM+ B cells is that the 81Fµ-chain that fails to
associate with SL also cannot pair with IgL chains. Indeed, when we
analyzed immunoprecipitated µ and L chains from 81Fµ- and L
chain-positive hybridoma and pre-B cell lines, we found that our
81Fµ-chain does not pair with four distinct -chains. For example,
Abs against mouse µ precipitated µ- but not -chains from
extracts of the two hybridomas BC2-.81Fµ (Fig. 6A, lane 7) and NTG-.81Fµ
(Fig. 6B, lane 8), each of which synthesizes transfected
81Fµ and a distinct endogenously encoded -chain. In contrast, each
-chain paired with its corresponding endogenous µ-chain in the
original IgM-secreting hybridomas BC2-µ (Fig. 6A, lanes
1–3; and Refs. 35 and 36) and NTG-µ (Fig. 6B, lanes 1,
2, 5, and 6. Identical results were obtained (not
shown) when we analyzed two other 81Fµ-synthesizing transfectants
that produce -chains encoded either by the endogenous gene of
the hybridoma NYCH (34) or by the expression vector pT1gpt (40).
Interestingly, our 81Fµ-chain failed to bind to the BC2--chain
that pairs with the functional 81X-µ-chain of wild-type BC2-µ
cells (Fig. 6A; Refs. 35 and 36). From these findings, we
suggest that a µ-chain that does not bind SL chain might also fail to
pair with most if not all conventional IgL chains. Consequently, early
pre-B cells synthesizing dysfunctional µ-chains do not develop
further because dysfunctional µ-chains fail to pair not only with SL
but also with L chains.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
5 (26). Furthermore, mutant µ-chains
that fail to assemble with the B-lymphoid-specific signal-transducing
Ig
ß complex do not rescue B cell development in mice deficient for
the recombination-activating gene 1 (RAG1) (59). These
studies strongly supported the hypothesis that only early pre-B cells
that assemble an integral membrane pre-BCR complex consisting of
µm, SL chain, and Igß are permitted to proceed at a
normal rate to the next developmental stage (60).
Although synthesis of µ is absolutely required for early B cell
maturation, the low proportion of productive to nonproductive
VH81X-D-JH rearrangements in small pre-B and
immature B cells (10, 31) suggests that not all µ-chains foster
maturation of early pre-B cells, possibly because some µ-chains,
depending on their CDR3 structure, fail to interact with SL chain. The
finding that two VH81X-µ-chains that differ only in their
CDR3 sequences failed to assemble with SL chain into a
transport-competent pre-BCR (11) supports the idea that the structure
of a µ-chain affects the formation of pre-BCR (2, 10, 11). However,
one transgenic VH81X-µ-chain has been described that is
fully competent to foster clonal maturation in transgenic mice (35, 36). Because two VH81X-µ-chains differ only in the amino
acid sequence of their CDR3 regions, the CDR3 structure might be
critical in fostering the maturation of early pre-B cells, possibly
because the CDR3 amino acid sequence determines whether a µ and SL
chain can form a pre-BCR. We now provide strong experimental evidence
that supports our hypothesis that early pre-B cells are selected for
maturation on the basis of the structure of the
VH-D-JH joining sequence. In addition, our
findings demonstrate that one mechanism for this selection is the
capacity of a µ-chain to assemble with SL chain. These conclusions
are based on the finding that a transgenic VH81X-µ-chain
that does not pair with SL chain fails to rescue B cell development in
JH knock-out mice, that is, in transgenic JH
knock-out mice we detected normal numbers of CD43+ pro-B
but essentially no CD43- pre-B or surface IgM+
B cells (Fig. 4).
However, mature Ag-responsive B cells accumulate at a low rate in
peripheral lymphatic organs of SL chain-deficient mice (26, 55), a
finding that challenges the conclusion that the assembly of a pre-BCR
is absolutely required for cells to transit from the pro-B to the small
pre-B cells stage. It has been proposed that mature B cells in
5-deficient mice originate via SL chain-independent pathway from a
small percentage of µ-positive early pre-B cells that rearrange their
VL gene segments early (57, 61, 62, 63). In a normal mouse,
however, premature synthesis of L chains is rare (27). Thus, to mature,
most early pre-B cells depend on the synthesis of a functional pre-BCR.
As in 5-deficient mice, we also expected to find some surface
81Fµ-IgM+ B cells in 81Fµ-transgenic JH
knock-out mice. However, we detected a total failure of B cell
maturation beyond the CD43+ stage in 3-mo-old transgenic
JH knock-out mice. This may not be surprising if the
81Fµ-chain not only fails to pair with SL chain but also with most,
if not all, conventional L chains. We have suggested that SL chain
might have two functions (11). First, it is an essential component in
the formation of a signal-transducing pre-BCR; second, it serves as a
folding template to screen µ-chains for their ability to assemble
with L chains. This dual function of SL chain would ensure that only
those early pre-B cells synthesizing µ-chains that are able to form
µL complexes are expanded. If this were the case, then we would
expect that µ-chains that failed to bind SL chain would not assemble
with most if not all IgL chains. As anticipated, the 81Fµ-chain did
not assemble with four distinct L chains (Fig. 6). Considering that
early L chain synthesis may be sufficient to ensure a diverse B cell
repertoire in 5-deficient mice, the absence of any detectable
surface IgM+ B cells in spleen and peritoneum of 3-mo-old
81Fµ-transgenic JHT-knock-out mice suggests that few if
any L chains could form the necessary IgM complexes with the
transgene-encoded dysfunctional µ-chain. The synthesis of a L chain
that is able to assemble with 81Fµ-chain might, nevertheless, be a
rare event occurring only occasionally in transgenic JHT
offspring. To determine whether synthesis of such L chains occurs
during an animal’s lifetime, peripheral B cells of aged transgenic
JH knock-out mice will be analyzed in future studies for
the presence of surface 81F-IgM.
However, VH81X-µ-chains with
VH-D-JH joining sequences other than those used
in this study might associate with SL and a conventional L chain and,
therefore, promote B cell development. In fact, two mouse fetal liver
hybridomas that secrete IgM Abs with VH81X regions have
been described (64). Furthermore, productive
VH81X-D-JH rearrangements have been isolated by
PCR and RT-PCR from mature peripheral B cells of neonatal as well as
adult mice (10, 31). Finally, a transgenic VH81X-µ-chain
that binds to Ig-chains (Fig. 6A, lanes 1–3), and thus,
by our definition, is a functional µ-chain, mediates allelic
exclusion and B cell maturation (35, 36). In contrast to our
dysfunctional 81Fµ-chain, this functional 81X-µ-chain, as
predicted, pairs with SL chain (Keyna et al., manuscript in
preparation) and rescues B cell development in JHT
knock-out mice (F. Martin and J. F. Kearney, unpublished
observations). Therefore, we conclude that the capability of a
µ-chain to foster maturation of early pre-B cells depends on its CDR3
structure.
VH-(D)-JH recombination creates an enormous diversity in the CDR3 sequence of IgH and IgL chains because numerous VH, (D), and JH segments can be used; the D segment in IgH rearrangements can be read in all three reading frames; bases at VH-D-JH junctions can be deleted by exonuclease activity; and extra bases can be inserted by terminal deoxynucleotidyl transferase (nontemplated N nucleotide insertion) and by P nucleotide addition. Therefore, it is likely that many heavy chain CDR3 (HCDR3) sequences disfavor the correct folding of a VH domain and, thus, the assembly of a µ-chain with SL or L chains. In fact, during the review of this manuscript, a report appeared that demonstrated that about half of all newly formed productive VH-D-JH rearrangements encode µ-chains that do not pair with SL chain (32). Seven of these nonpairing µ-chains utilize VH81X, three contain VHQ52, and nine use VHJ558 regions, indicating that the SL chain nonpairing "phenomenon" is not restricted to µ-chains utilizing a VH81X region. Candidates for CDR3 sequences that might prevent the association of a µ-chain with SL chain are those that contain stretches of loop-disfavoring hydrophobic residues or loop-forming cysteines (65).
Although CDR3 sequences might be critical in the determination of
whether a µ-chain will assemble with SL chain, the generation of
dysfunctional µ-chains might be more prevalent for µ-chains
utilizing VH genes segments such as the VH81X,
than for µ-chains using other VH gene segments. In fact,
the VH81X segment contains several unusual framework amino
acid residues that are conserved among most other VH gene
segments. For example, tryptophan at codon 47 is replaced by leucine
(28). This may account for the paradoxical finding that, while
VH81X gene segments are very frequently incorporated into
VH-D-JH rearrangements in pro-B cells, B cells
with productive VH81X rearrangements are rare (10, 28, 31, 64). The degree of nucleotide insertion into the CDR3 region (N
insertion), which occurs in B cells originating from adult bone marrow
but not from fetal liver (reviewed in 66 , might also contribute
to the inability of a VH81X-µ-chain to pair with SL or L
chains. Consistent with this possibility, a VH81X-µ-chain
that pairs with L (see Fig. 6A, lanes 1–3) and SL chain
(U.K. and H.-M.J., unpublished observations) lacks N nucleotides (35, 36), whereas two SL chain-nonpairing V81X-µ-chains, including 81Fµ,
contain N insertions (11). This might explain why the ratio of
productive to nonproductive VH81X rearrangements decreases
in bone marrow-derived B cells compared with the ratio observed in B
cells derived from fetal liver (30). Therefore, SL chain might also be
critical for the excluding of particular N-containing VH
regions from the adult Ab repertoire, and thus, for changes in the
VH repertoire observed between fetal and adult mice (66).
The assembly of a pre-BCR complex alone might not be sufficient to
signal pro-B/early pre-B cells to mature. Transport of the pre-BCR to a
"signal-competent compartment," such as a subcompartment in the
endoplasmic reticulum or the cell surface, and its interaction with a
cross-linking hypothetical ligand, produced either within a pro-B/early
pre-B cell or on the surface of other bone marrow cells, might also be
required to provide the necessary survival, proliferation, and/or
differentiation signals. In fact, a µ-chain utilizing a particular
VH12-D-JH rearrangement does not foster
maturation of early pre-B cells despite the fact that this chain forms
a surface µ-SL complex with SL chain in transfected BINE4.8 pre-B
cells (67). The authors speculated that pro-B cells synthesizing this
particular VH12 µ-chain do not receive a signal, because
the pre-BCR fails to interact with a hypothetical ligand. Furthermore,
in contrast to our assembly dysfunctional 81F-µ-chain, transgenic
µ-chains lacking either the entire VHDJH (68)
or the VHDJH-Cµ1 domains (69) induce
maturation of pre-B cells and prevent endogenous VH to
DJH rearrangements regardless of whether 5 is
synthesized, suggesting that the overall structure of a µ-chain
determines whether pre-BCR assembly is critical for B cell maturation
and induction of allelic exclusion at the H chain gene locus.
While our studies clearly demonstrate that a µ-chain that does not
assemble with SL chain fails to pair with four distinct -chains as
well as to foster maturation of CD43+ pro-B cells, they are
less informative concerning the question of whether a
µm-SL complex is required to mediate allelic exclusion at
the H chain locus. In most other transgenic experiments, a µ-chain
that fosters maturation of early pre-B cells also mediates allelic
exclusion of IgH genes. Thus, µ-chains that do not interact with
Igß (59) or lack their membrane domain (58, 70) can neither foster
maturation of early pre-B cells nor mediate allelic exclusion of
endogenous IgH genes. Flow cytometric analysis revealed similar numbers
of peripheral B220+ B cells in our transgenic and
nontransgenic C57BL/6 littermates (Fig. 2). Furthermore, all
B220+ splenic B cells in transgenic mice synthesize surface
IgM receptors composed of only endogenously derived µ-chains (Fig. 2), despite the fact that most pre-pro-B cells (fraction A cells),
which do not yet contain productive IgH rearrangements, synthesize
transgenic 81Fµ-chains (Fig. 3). These findings suggest that at least
one µ-chain that cannot pair with SL chain, and thus does not foster
maturation of early pre-B cells, also cannot mediate allelic exclusion
at the H chain locus. Because we do not have Abs available that would
allow the simultaneous detection of endogenous and transgenic
81Fµ-chains in pre-B or B cells, we cannot distinguish whether
peripheral B cells originated either from early pre-B cells that
synthesize both endogenous and transgenic µ-chains or from pro-B
cells that have first down-regulated the expression of the transgene
and then rearranged their endogenous IgH genes. Thus, at this point, we
cannot address the question of whether the dysfunctional µ-chain
mediates allelic exclusion.
Our findings, together with previous work by others (reviewed in
Refs. 57, 61, 71, and 72), strongly suggest that the differentiation of
early pre-B cells into small pre-B cells is mediated by a pre-BCR
consisting of µm, SL, and the signal-transducing
molecules Igß. SL chain could participate in this process by
serving as a folding template to facilitate the assembly and transport
of a complete pre-BCR to a signal-competent compartment. In addition,
SL chain could also participate in the signaling process, either
directly by interacting with a cross-linking ligand, or indirectly by
inducing a conformational epitope required for µ-chains to interact
with a ligand. Our findings demonstrate that regardless of the
mechanism by which SL chain participates in pre-BCR signaling, it
constitutes a critical component of a quality control mechanism that
ensures that only early pre-B cells with a functional µ-chain, that
is, one that will pair with conventional L chains, expand and mature.
Thus, at this checkpoint, early pre-B cells are not only screened for a
productive IgH rearrangement but also for a µ-chain that will likely
pair with a conventional L chain.
|
Acknowledgments |
|---|
hybridoma; and Dr. Zachau (University of München, Germany) for
the pT1gpt plasmid. |
Footnotes |
|---|
2 G.H.K. and L.H. contributed equally to this work.
3 Address correspondence and reprint requests to Dr. Hans-Martin Jäck, Section of Molecular Immunology, Department of Medicine III, University of Erlangen-Nürnberg, Schwabachanlage 10, D-91058 Erlangen, Germany. E-mail address:
4 Abbreviations used in this paper: H, heavy; µ, heavy chain of IgM; µm, µ-chain; SL, surrogate light; pro-B cell, progenitor B cell; pre-B cell, precursor B cell; pre-BCR, pre-B cell receptor complex; CDR3, complementarity-determining region 3; PE, phycoerythrin; AMCA, amino methyl coumarin; HBSSF, HBSS supplemented for flow cytometry (F) with 0.1% BSA (fraction V) and 0.02% NaN3; PBSF, PBS supplemented for flow cytometry (F) with 0.1% NaN3 and 1% BSA.
Received for publication November 10, 1997. Accepted for publication April 6, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
5 surrogate light chain in early bone marrow precursor B cells of normal and B cell-deficient mutant mice. Cell 77:133.[Medline]
chain (CD25, TAC) expression defines a crucial stage in pre-B cell development. Int. Immunol. 6:1257.5 with a 16-kilodalton protein in mouse pre-B cell lines is not dependent on the presence of Ig H chain protein. J. Immunol 145:905.[Abstract]
5 pre-B cell-specific genes can associate with each other and with µ heavy chain. J. Exp. Med. 172:969.
2 tetramers in pre-B cells by the 18K -immunoglobulin light chain. Nature 329:172.[Medline]
5 is expressed on the surface of mouse pre-B cell lines and can function as a signal transducing molecule. Int. Immunol. 3:1129. locus. Int. Immunol. 4:637.
L complex: similar behavior of preB and intermediate preB-B cells in transducing ability. Int. Immunol. 5:467.5 protein in B cell development. Cell 69:823.[Medline]
light chain genes. EMBO J. 12:821.[Medline]
5 gene. Eur. J. Immunol. 23:1284.[Medline]
) transgene, but not V()J() gene segment targeted into the Ig(k) locus, can rescue B cell development in 5-deficient mice. Immunity 5:229.[Medline]
This article has been cited by other articles:
|
|
 |
|
  P. B. Nakajima, K. Kiefer, A. Price, G. C. Bosma, and M. J. Bosma Two Distinct Populations of H Chain-Edited B Cells Show Differential Surrogate L Chain Dependence J. Immunol., March 15, 2009; 182(6): 3583 - 3596. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Yoshikawa, Y. Kawano, Y. Minegishi, and H. Karasuyama The skewed heavy-chain repertoire in peritoneal B-1 cells is predetermined by the selection via pre-B cell receptor during B cell ontogeny in the fetal liver Int. Immunol., January 1, 2009; 21(1): 43 - 52. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Vettermann, K. Herrmann, C. Albert, E. Roth, M. R. Bosl, and H.-M. Jack A Unique Role for the {lambda}5 Nonimmunoglobulin Tail in Early B Lymphocyte Development J. Immunol., September 1, 2008; 181(5): 3232 - 3242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Odinsen, S. Owusu-Ofori, A. Dompreh, F. Sarkodie, O. Opare-Sem, D. Parker, and J.-P. Allain Antibody Detection and Kinetics of Antibody Production during Early Stages of Immunization with Hepatitis B Virus Vaccine Clin. Vaccine Immunol., December 1, 2007; 14(12): 1623 - 1628. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Martin, L. Lu, M. Cascalho, and G. E. Wu Maintenance of Surrogate Light Chain Expression Induces Developmental Delay in Early B Cell Compartment J. Immunol., October 15, 2007; 179(8): 4996 - 5005. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Lutz, W. Muller, and H.-M. Jack VH Replacement Rescues Progenitor B Cells with Two Nonproductive VDJ Alleles J. Immunol., November 15, 2006; 177(10): 7007 - 7014. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. R. Hardy B-1 B cell development. J. Immunol., September 1, 2006; 177(5): 2749 - 2754. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Kawano, S. Yoshikawa, Y. Minegishi, and H. Karasuyama Pre-B Cell Receptor Assesses the Quality of IgH Chains and Tunes the Pre-B Cell Repertoire by Delivering Differential Signals J. Immunol., August 15, 2006; 177(4): 2242 - 2249. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Schelonka, I. I. Ivanov, D. H. Jung, G. C. Ippolito, L. Nitschke, Y. Zhuang, G. L. Gartland, J. Pelkonen, F. W. Alt, K. Rajewsky, et al. A Single DH Gene Segment Creates Its Own Unique CDR-H3 Repertoire and Is Sufficient for B cell Development and Immune Function J. Immunol., November 15, 2005; 175(10): 6624 - 6632. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Kawano, S. Yoshikawa, Y. Minegishi, and H. Karasuyama Selection of stereotyped VH81X-{micro}H chains via pre-B cell receptor early in ontogeny and their conservation in adults by marginal zone B cells Int. Immunol., July 1, 2005; 17(7): 857 - 867. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. I. Ivanov, R. L. Schelonka, Y. Zhuang, G. L. Gartland, M. Zemlin, and H. W. Schroeder Jr. Development of the Expressed Ig CDR-H3 Repertoire Is Marked by Focusing of Constraints in Length, Amino Acid Use, and Charge That Are First Established in Early B Cell Progenitors J. Immunol., June 15, 2005; 174(12): 7773 - 7780. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Jackson and J. D. Capra IgH V-Region Sequence Does Not Predict the Survival Fate of Human Germinal Center B Cells J. Immunol., March 1, 2005; 174(5): 2805 - 2813. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Edry and D. Melamed Receptor Editing in Positive and Negative Selection of B Lymphopoiesis J. Immunol., October 1, 2004; 173(7): 4265 - 4271. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Otero and R. C. Rickert CD19 Function in Early and Late B Cell Development. II. CD19 Facilitates the Pro-B/Pre-B Transition J. Immunol., December 1, 2003; 171(11): 5921 - 5930. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Martin, H. Bradl, T. J. Collins, E. Roth, H.-M. Jack, and G. E. Wu Selection of Ig {micro} Heavy Chains by Complementarity-Determining Region 3 Length and Amino Acid Composition J. Immunol., November 1, 2003; 171(9): 4663 - 4671. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Schuh, S. Meister, E. Roth, and H.-M. Jack Cutting Edge: Signaling and Cell Surface Expression of a {micro}H Chain in the Absence of {lambda}5: A Paradigm Revisited J. Immunol., October 1, 2003; 171(7): 3343 - 3347. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Mielenz, A. Ruschel, C. Vettermann, and H.-M. Jack Immunoglobulin {micro} Heavy Chains Do Not Mediate Tyrosine Phosphorylation of Ig{alpha} from the ER-cis-Golgi J. Immunol., September 15, 2003; 171(6): 3091 - 3101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Bradl, J. Wittmann, D. Milius, C. Vettermann, and H.-M. Jack Interaction of Murine Precursor B Cell Receptor with Stroma Cells Is Controlled by the Unique Tail of {lambda}5 and Stroma Cell-Associated Heparan Sulfate J. Immunol., September 1, 2003; 171(5): 2338 - 2348. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Gauthier, B. Rossi, F. Roux, E. Termine, and C. Schiff Galectin-1 is a stromal cell ligand of the pre-B cell receptor (BCR) implicated in synapse formation between pre-B and stromal cells and in pre-BCR triggering PNAS, October 1, 2002; 99(20): 13014 - 13019. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. A. Hayden, P. Riegert, and G. H. Kline Detection of Functional VH81X Heavy Chains in Adult Mice with an Assessment of Complementarity-Determining Region 3 Diversity and Capacity to Form Pre-B Cell Receptor J. Immunol., August 15, 2002; 169(4): 1970 - 1977. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Shimizu, C. Mundt, S. Licence, F. Melchers, and I.-L. Martensson VpreB1/VpreB2/{lambda}5 Triple-Deficient Mice Show Impaired B Cell Development but Functional Allelic Exclusion of the IgH Locus J. Immunol., June 15, 2002; 168(12): 6286 - 6293. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Bradl and H.-M. Jack Surrogate Light Chain-Mediated Interaction of a Soluble Pre-B Cell Receptor with Adherent Cell Lines J. Immunol., December 1, 2001; 167(11): 6403 - 6411. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. H. Kline, T. A. Hayden, and P. Riegert The Initiation of B Cell Clonal Expansion Occurs Independently of Pre-B Cell Receptor Formation J. Immunol., November 1, 2001; 167(9): 5136 - 5142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Li, L. Fernandez, K. C. O'Connor, T. Imanishi-Kari, and B. D. Stollar The Rearranged VH Domain of a Physiologically Selected Anti-Single-Stranded DNA Antibody as a Precursor for Formation of IgM and IgG Antibodies to Diverse Antigens J. Immunol., October 1, 2001; 167(7): 3746 - 3755. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Fang, B. P. Smith, and C. A. J. Roman Conventional and Surrogate Light Chains Differentially Regulate Ig {micro} and D{micro} Heavy Chain Maturation and Surface Expression J. Immunol., October 1, 2001; 167(7): 3846 - 3857. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Martinez-M., S. Minguet, P. Gonzalo, P. G. Soro, B. de Andres, A. Izcue, M. A. R. Marcos, and M.-L. Gaspar Long-lived polyclonal B-cell lines derived from midgestation mouse embryo lymphohematopoietic progenitors reconstitute adult immunodeficient mice Blood, September 15, 2001; 98(6): 1862 - 1871. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Wang, J. Ye, L. W. Arnold, S. K. McCray, and S. H. Clarke A VH12 Transgenic Mouse Exhibits Defects in Pre-B Cell Development and Is Unable to Make IgM+ B Cells J. Immunol., August 1, 2001; 167(3): 1254 - 1262. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kouro, K. Nagata, S. Takaki, S. Nisitani, M. Hirano, M. I. Wahl, O. N. Witte, H. Karasuyama, and K. Takatsu Bruton's tyrosine kinase is required for signaling the CD79b-mediated pro-B to pre-B cell transition Int. Immunol., April 1, 2001; 13(4): 485 - 493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. W. LeBien Fates of human B-cell precursors Blood, July 1, 2000; 96(1): 9 - 23. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Donohoe, G. B. Beck-Engeser, N. Lonberg, H. Karasuyama, R. L. Riley, H.-M. Jack, and B. B. Blomberg Transgenic Human {lambda}5 Rescues the Murine {lambda}5 Nullizygous Phenotype J. Immunol., May 15, 2000; 164(10): 5269 - 5276. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Kato, T. Miyazaki, T. Nakamura, and A. Kudo Inducible differentiation and apoptosis of the pre-B cell receptor-positive pre-B cell line Int. Immunol., March 1, 2000; 12(3): 325 - 334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. C. Bosma, Y. Chang, H. Karasuyama, and M. J. Bosma Differential effect of an Ig {micro} transgene on development of pre-B cells in fetal and adult SCID mice PNAS, October 12, 1999; 96(21): 11952 - 11957. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Melchers Fit for life in the immune system? Surrogate L chain tests H chains that test L chains PNAS, March 16, 1999; 96(6): 2571 - 2573. [Full Text] [PDF]
|
|
|
|
|
|
A. J. Marshall, N. Doyen, L. A. Bentolila, C. J. Paige, and G. E. Wu Terminal Deoxynucleotidyl Transferase Expression During Neonatal Life Alters DH Reading Frame Usage and Ig-Receptor-Dependent Selection of V Regions J. Immunol., December 15, 1998; 161(12): 6657 - 6663. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Hess, A. Werner, T. Wirth, F. Melchers, H.-M. Jack, and T. H. Winkler Induction of pre-B cell proliferation after de novo synthesis of the pre-B cell receptor PNAS, February 13, 2001; 98(4): 1745 - 1750. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
