|
|
||||||||


*
Tumor Immunology Program, German Cancer Research Center, Heidelberg, Germany; and
Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140
{FOOT;f3}
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
, TNF, and lymphotoxin,
whereas the Th2 subset produces IL-4, IL-5, IL-6, and IL-10 (2, 5, 6, 7, 8).
Th1-type cytokines are associated with cell-mediated immune functions,
whereas Th2-type cytokines assist humoral immune responses.
Differential production of cytokines by Th cell subsets, therefore, may
have profound effects on the type of immune response. IL-4 has multiple biologic activities, affecting cells of most hemopoietic lineages, and plays a central role in the pathogenesis of allergic inflammation (for reviews, see Refs. 9 and 10). In particular, IL-4 has a unique function in directing development of Th cells into the Th2 phenotype (8, 11, 12, 13, 14, 15). Although the role of IL-4 in regulation of the immune response is well characterized, the molecular mechanisms underlying the control of tissue-specific IL-4 gene expression are not completely known.
Analysis of human and murine IL-4 promoters has revealed multiple regulatory sequences located in the first 310 bp of the promoter (16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29). Five DNA sequences (designated P0, P1, P2, P3, and P4 sites) homologous to the DNA binding sequence of NF-AT have been identified (20, 21, 22). NF-AT was found to bind to several P sites (30, 31, 32, 33) and confer cyclosporin A (CsA)3-sensitive and ionomycin-inducible activity. NF-AT is not restricted to Th2 cells, since it is involved in trans-activation of Th1 cytokine IL-2 (34). Therefore, NF-AT does not qualify as a bonafide regulatory factor to discriminate Th1- or Th2-specific gene transcription. Nonetheless, preferential binding of NF-AT to the P4 and P1 sites in Th2 cells has been reported (32, 35). The P1 site was shown to confer significant Th2-specific transcriptional activity (35). Th2-specific activity of the IL-4 promoter has also been localized to the P0 site (22). However, the molecular basis for the Th2 specificity of the P0 site has not been analyzed. Recently, a half c-Maf binding site (MARE) was identified downstream of the P0 site (29). Recombinant c-Maf and NF-ATp proteins were shown to bind together to a DNA probe containing the P0 and MARE sites (29). c-Maf was found to be expressed in Th2, but not in Th1, clones and, therefore, is a candidate for driving Th2-specific IL-4 promoter activity. In this report, we provide the first detailed analysis of the proximal regulatory elements of the human IL-4 gene. We show that NF-AT, Fos, and octamer proteins interact with the P0 site. Binding of NF-AT to the P0 site requires the adjacent octamer-like sequence. We also provide the first report that in the absence of the MARE site, Th2-specific DNA/protein interaction was observed at the P0 and octamer-like sites. Furthermore, we investigated the role of each site by mutagenesis/transfection studies and show that the P0 and octamer-like sites are essential for the overall activity of the human IL-4 promoter. The MARE site of the human IL-4 promoter, in contrast to the mouse IL-4 MARE site, does not appear to be critical for transcriptional activity in IL-4-producing Jurkat T cells.
| Materials and Methods |
|---|
|
|
|---|
The cell lines used in this study were the human T lymphoblastoid cell line Jurkat J16, the human Th1 (PPD) and Th2 (TT3) cell clones (1, 32), and the mouse Th2 cell clone D10 and the mouse Th1 cell clone (Cl) 29. Culture conditions for the cells were described previously (1, 32).
Antibodies
Abs specific for Oct-1 and Oct-2 (33) were supplied by Dr. T. Wirth (Institut für Medizinishe Strahlen und Zellforschung, Wurzburg, Germany). The anti-NF-ATc mAb (MA3-024) was purchased from Affinity BioReagents (Golden, CO). Abs specific for c-Fos and c-Jun were purchased from Oncogen Science (Dianova, Hamburg, Germany). The anti-c-Jun/AP-1 (D, broadly reactive with c-Jun, JunB, and JunD p39 proteins) and anti-c-JunD (329) Abs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Ab specific for c-Jun B was supplied by Dr. P. Angel (German Cancer Research Center, Heidelberg, Germany).
Nuclear extract preparation and electrophoretic mobility shift assays (EMSA)
Nuclear extracts from D10, Cl 29, human Th1, and Th2 cells were prepared as described previously (32). The pGST-NF-ATc and pGST-NF-ATp bacterial expression vectors were supplied by Dr. E Serfling (Institute of Pathology, University of Wurzburg, Wurzbury, Germany). The pGST-NF-ATp plasmid contains the NaeI/SmaI fragment of NF-ATp cDNA spanning the DNA binding and protein interaction domains of NF-ATp (27). The pGST-NF-ATc plasmid contains NF-ATc peptides from amino acids 293 to 716 (36).
The recombinant NF-AT-GST fusion proteins were isolated from the NF-ATc- and NF-ATp-expressing Escherichia coli XL blue strains as follows. Twenty-five milliliters of an overnight culture of bacteria was inoculated into 500 ml of Luria Bertani medium containing 100 µg/ml ampicillin and 0.1% glucose. After 3-h incubation at 37°C, 0.4 mM isopropyl ß-D-thiogalactoside (IPTG) were added, and the bacteria were cultured at room temperature for another 30 min. The bacteria were harvested, washed with PBS once, and suspended in 30 ml of PBS supplemented with 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.1 mM PMSF, and 1% Triton X-100. The bacteria were sonificated and centrifuged at 10,000 rpm for 20 min. The supernatant was collected and incubated with 100 to 150 µl of 50% slurry glutathione beads (Pharmacia Biotech, Freiburg, Germany) at 4°C overnight by rotating. The beads were spun down at 6,000 rpm for 1 min and washed with PBS three times. Finally, the NF-AT-GST fusion proteins were eluted by incubation of the beads with 100 µl of a solution containing 10 mM reduced glutathione and 50 mM Tris-HCl, pH 8.0, at 4°C for 2 h (or at room temperature for 30 min).
EMSA was performed as described previously (18). Competition
experiments were performed by mixing the appropriate competitor DNA to
the binding reaction before adding the end-labeled probe. The synthetic
oligonucleotides used for EMSA and for competition experiments were the
binding sites for: P0 -68/-45 (hIL-4),
gatcCAATGTAAACTCATTTTCCCTCGG and GTTACATTTGAGTAAAAGGGAGCCctag; P1
-79/-54 (hIL-4), gatcCGAAAATTTCCAATGTAAACTCATTG and
GCTTTTAAAGGTTACATTTGAGTAACctag; Maf -59/-28 (hIL-4),
CTCATTTTCCCTCGGTTTCAGCAATTTTAAATC and
GAGTAAAAGGGAGCCAAAGTCGTTAAAATTTAG; P0octmu (hIL-4),
GCCTGCAGGTCATTTTCCCTCGGTTTCAGCAATTTTAAATC and
CGGTCGTCCAGTAAAAGGGAGCCAAAGTCGTTAAAATTTAG; AP-1 (SV40),
gatcCGGTTGCTGACTAATTG and GCCAACGACTGATTAACctag; AP-3,
gatcTGTGGAAAGTCCCA and ACACCTTTCAGGGTctag; NF-AT (hIL-2),
gatcCGGAGGAAAAACTGTTTCATACAGAAGGCGTG and
GCCTCCTTTTTGACAAAGTATGTCTTCCGCACctag; NF-
B,
agctTCAGAGGGGACTTTCCGAGAGGCG and AGTCTCCCCTGAAAGGCTCTCCGCctag;
SP-1 (HIV-1), gatcTGGAGGCGTGGCG and ACCTCCGCACCGCctad; Oct-1/Oct-2
(SV40), GGCAGAAGTATGCAAAGCATGCATC and CCGTCTTCATACGTTTCGTACGTAG;
and C/EBP, gatcTCAATTGGGCAATCAGG and AGTTAACCCGTTAGTCCctag.
Methylation interference
Both end-labeled strands of the human IL-4 -68 to -45 fragment were partially methylated with dimethylsulfate for 5 min as described previously (18). The methylated DNA fragment was used for a preparative EMSA. Bound and free DNA were recovered from the gel by electroelution and subjected to cleavage by 1 M piperidine for 40 min at 90°C. The cleaved probes were dried and analyzed on a sequencing gel.
Plasmid construction and mutations
The CAT reporter plasmid pCAT6-IL4(-269/+11) was constructed as
described previously (25). The luciferase reporter construct pLuc-IL4
(-269/+11) plasmid was constructed by cutting the IL-4 promoter
fragment -269/+11 from pCAT6-IL-4(-269/+11) with HindIII
and BamHI and recloning into the HindIII and
BglII sites of pTATALuc vector (a gift from T. Wirth,
Institut für Medizinische Strahlen und Zellforschung). The
mutated pCAT6-IL-4(-269/+11) and pLuc-IL4(-269/+11) constructs (in
Figs. 10
and 11
) were generated by oligonucleotide-directed PCR
mutagenesis. Mutations were confirmed by sequencing analysis.
|
|
The CAT reporter constructs were transfected into Jurkat T cells using the DEAE-dextran method as described previously (37). The luciferase reporter constructs (10 µg) were transfected by electroporation. Jurkat cells (4 x 106/ml) in RPMI 1640 medium were electroporated using a Bio-Rad Gene Pulser (Bio-Rad, Munich, Germany) set at 960 µF and 240 V. The transfected cells were allowed to recover overnight and divided into aliquots. One aliquot was further treated with 10 ng/ml PMA (Sigma, Deisenhofen, Germany) and 1 µM ionomycin (Calbiochem, La Jolla, CA) for 8 h. Luciferase activity was determined in 10 µl of cell extract using the luciferase assay substrate (Promega, Heidelberg, Germany) with a Duolumat LB9507 luminometer (Berthold, Germany).
RNA isolation and RT-PCR
Total cellular RNA was prepared using the RNeasy kit (Qiagen, Hilden, Germany) according to the manufacturers instructions. RNA (1 µg) was reverse transcribed with oligo (dT). PCR amplification was then performed for 35 cycles with specific primers (Stratagene, Heidelberg, Germany) for the human IL-4 (456-bp PCR product) and the human ß-actin (661-bp PCR product) protein, respectively. The PCR products were then subjected to agarose gel electrophoresis.
| Results |
|---|
|
|
|---|
The P0 site was previously shown to be active in Th2 D10 cells but
not in a Th1 cell clone (22). Therefore, we chose D10 cells to
investigate the Th2-specific P0-binding nuclear factors. An
oligonucleotide containing the P0 DNA sequence (-68 to -45; Fig. 1
) was used as a probe in EMSA. This P0
probe contains two DNA sequences, a NF-AT consensus sequence, P0 (20),
and an octamer-like sequence (21). The experiments showed that
induction of the Th2 D10 cells by PMA resulted in formation of one
inducible complex on the P0 probe (Fig. 2
A, lane 3).
Activation of the cells with PMA plus ionomycin generated a slower
shifting complex (Fig. 2
A, lane 4). Stimulation
of D10 cells by ionomycin alone did not induce DNA binding activities
on the P0 probe. We designated these two inducible complexes NF-P0b and
NF-P0a, respectively. A weak, fast shifting complex was also
detectable. Since this complex was not consistently present, and its
binding activity was not specifically competed by the oligonucleotides
tested, it was considered to be due to an unspecific DNA-protein
interaction. In contrast to the P0 probe, a P1 probe containing the
NF-AT consensus (20), and the same octamer-like sequence (Fig. 1
) did
not generate a PMA-inducible complex. A PMA/ionomycin-inducible complex
was detected by the P1 probe, which was previously shown to contain
NF-ATp (and/or NF-ATc) (24) (Fig. 2
B). When we used an
oligonucleotide containing the binding site for the constitutive
protein SP-1 as a control, the SP-1 binding activity could be
detected in all nuclear extracts (Fig. 2
C).
|
|
The octamer-like site is required for inducible binding of nuclear factors to the P0 site
MARE was previously identified downstream of the P0 site (29).
Using recombinant c-Maf and NF-ATp proteins in EMSA, c-Maf and NF-ATp
were shown to bind together to the P0 and MARE sites (29). To
investigate whether NF-P0a and NF-P0b can also be formed on the P0 and
MARE sites, a Maf probe (-59 to -27) containing the P0 and MARE
sequences (29) and a P0octmu probe (-68 to -31) containing P0, MARE,
and a mutated octamer sequence (Fig. 1
) were used for EMSA. The
experiments showed that mutation (the P0octmu probe) or deletion (the
Maf probe) of the octamer-like sequence abolished binding of NF-P0a and
NF-P0b to DNA (Fig. 3
A,
lanes 36). Multiple constitutive complexes were observed
when a double amount of nuclear proteins was used in EMSA (Fig. 3
A, lanes 7 and 8).
|
The P0-binding complexes contain octamer proteins
The octamer-like sequence between the P1 and P0 sites was
previously shown to weakly bind recombinant Oct-1 and Oct-2 proteins
(33). To investigate whether NF-P0a and NF-P0b contain octamer
proteins, a competition EMSA was conducted using an oligonucleotide
containing a typical octamer motif from the SV40 enhancer. The
experiment showed that formation of both NF-P0a and NF-P0b was
specifically competed by the octamer oligonucleotide but not by an
unrelated oligonucleotide containing a binding site for AP-3 (Fig. 4
A). To further analyze
whether octamer proteins are components of NF-P0a and NF-P0b, EMSA was
conducted in the presence or the absence of Abs against Oct-1 and
Oct-2. As shown in Figure 4
B, formation of both NF-P0a and
NF-P0b complexes was inhibited by anti-Oct-1 and anti-Oct-2
Abs. Thus, NF-P0a and NF-P0b contain octamer proteins.
|
|
Since NF-P0b and NF-P0a are induced by PMA and PMA/ionomycin,
respectively, we investigated the components of these complexes by
competition EMSA using oligonucleotides containing binding sites for
known inducible factors. The experiment showed that formation of both
NF-P0a and NF-P0b was competed by an excess of the unlabeled
oligonucleotides containing the AP-1 or the IL-2 NF-AT binding site,
but not by the oligonucleotides containing the NF-
B or AP-3 site
(Fig. 6
A). This indicates that
proteins of the AP-1 and of the NF-AT family may participate in the
formation of the P0-binding protein complexes. NF-P0b is induced by PMA
and is resistant to CsA. However, binding of NF-P0b to the P0 site
could be competed by the IL-2 NF-AT binding site. This may be due to
the fact that the IL-2 NF-AT binding sequence contains an AP-1 binding
site (38).
|
NF-P0a contains NF-AT
The NF-AT binding sequence was first identified as a regulatory
element of the IL-2 promoter (34). The IL-2 NF-AT binding site is
composed of two DNA sequences, a NF-AT consensus and a weak AP-1 site.
By itself, neither NF-AT nor AP-1 can stably bind to the IL-2 NF-AT
site. Assembly of NF-AT with AP-1 is required for stable binding of
NF-AT to the IL-2 promoter. In contrast, the P1 site of the IL-4
promoter can interact directly with NF-AT (24). Since all P sites of
the IL-4 promoter share DNA sequence similarity, it has been proposed
that all P sites may interact directly with NF-AT (38). To investigate
whether the P0 site can stably interact with NF-AT, recombinant NF-ATc
and NF-ATp were used for EMSA. The P1 probe was included as a positive
control. The experiments confirmed that NF-ATc/p strongly bind to the
P1 probe. In contrast, only a very weak binding activity with rNF-ATp
and no binding activity with rNF-ATc were observed when the same amount
of recombinant proteins was used with the P0 probe (Fig. 7
A). This indicates that NF-AT
has a much lower affinity for the P0 than for the P1 site.
|
Difference in binding of nuclear factors to the P0 site in Th1 and Th2 cells
We have shown that in the mouse Th2 D10 cells, AP-1, NF-AT, and
octamer proteins may interact with the P0 and the octamer-like site.
The P0 site was previously reported to be functionally active in Th2,
but not in Th1, cells (22). However, AP-1, NF-AT, and Oct-1/Oct-2 are
not restricted to Th2 cells (24). To investigate whether the P0-binding
complexes observed in Th2 D10 cells are differentially expressed in Th1
cells, we prepared nuclear extracts from mouse Th1 cell clone 29 that
does not produce IL-4 (39). A comparative study showed that the nuclear
extract from clone 29 had a much lower level of binding activity on the
P0 site than that from D10 cells (Fig. 8
A). To further investigate
the molecular basis of the Th2 specificity of the P0 site, nuclear
extracts were prepared from noninduced and PMA/ionomycin-activated
human Th1 and Th2 cell clones. EMSA analysis of the nuclear extracts
showed that an inducible P0-binding complex was formed by Th2 but not
by Th1 cell-derived nuclear extracts (Fig. 8
B). We have
independently generated human Th1 and Th2 cells three times. The same
observation was obtained. This is not due to a difference in the amount
of NF-AT in Th1 and Th2 cells. When the same nuclear extracts were
incubated with a 32P-labeled IL-2 NF-AT binding
oligonucleotide, a very similar binding of the NF-AT/AP-1 complex to
the probe was obtained (Fig. 8
C). Equal loading of nuclear
extracts was controlled using the SP-1 binding site (Fig. 8
D). Formation of this inducible complex was inhibited by
CsA. In contrast to extracts from mouse D10 cells, the human Th2
nuclear extracts did not form the CsA-resistant NF-P0b complex (see
Fig. 2
D). Serologic analysis of the inducible Th2-specific
complex showed that anti-Fos, anti-Jun, and anti-NF-ATc Abs
blocked formation of this complex (Fig. 9
A). Therefore, NF-AT and
proteins of AP-1 family are involved in formation of the P0 binding
complex. In contrast to the mouse D10 cells (see Fig. 4
B),
anti-Oct-1/2 Abs did not react with the inducible complex
formed by the human Th2 nuclear extracts (Fig. 9
A). However,
the octamer-like sequence is required for inducible binding. As shown
in Figure 9
B, the IL-4 Maf probe that lacks the octamer-like
sequence did not form the inducible complex. These experiments
demonstrate that nuclear proteins of Th1 and Th2 cells may interact
differentially with the IL-4 promoter at the P0 and the octamer-like
sites.
|
|
The P1 site was previously shown to be essential for the functional activity of the human IL-4 promoter (16). However, the octamer-like, P0, and MARE sites of the human IL-4 promoter have not been analyzed. To investigate the functional relevance of these sites on the human IL-4 promoter, we chose a IL-4-producing Jurkat subline, J16, for the functional studies. J16 cells express a high level of IL-4 mRNA upon stimulation with PMA and ionomycin for 4 h. Stimulation of J16 cells with ionomycin alone also induces expression of IL-4 mRNA. However, the production of IL-4 mRNA was significantly dropped after 8-h stimulation (data not shown). Therefore, both the PMA and the ionomycin signal are required for maintenance of high level IL-4 expression.
To investigate the biologic function of the octamer-like, P0, and MARE
sites of the human IL-4 promoter, site-directed mutations were
generated. The wild-type and the mutated IL-4 promoter fragments were
placed in front of the luciferase reporter gene. Activities of the IL-4
promoter were analyzed by transient transfection of the constructs into
Jurkat J16 cells. Mutation experiments showed that a 6-bp exchange at
the MARE site did not affect the overall promoter activity (Fig. 10
, A and B). The
inducibility of the promoter was reduced after mutation at this site
(Fig. 10
C). This reduction was mainly due to an increase in
the basal promoter activity at the noninduced stage (Fig. 10
A). Mutations of the octamer-like and of the P0 sites
reduced the promoter inducibility by approximately 20 and 40%,
respectively (Fig. 10
C). In contrast to the MARE site,
mutations of the octamer-like and the P0 site greatly reduced the
overall promoter activity (Fig. 10
, A and B).
Also, mutation of the P1 site reduced by 90% the inducible and overall
promoter activity, as previously reported (16, 21). These experiments
demonstrate that the octamer-like and the P0 site are important for the
functional activity of the human IL-4 promoter.
To further define the functional role of the MARE site, we generated
two human IL-4 promoter/CAT reporter constructs containing a 7-bp
exchange or a 13-bp deletion at the MARE site. Mutations of the MARE
site led only to a 25% reduction in promoter activity (Fig. 11
, A and B).
Deletion of 13 bp at the MARE site reduced by approximately 70% the
basal but not the inducible activity of the promoter (Fig. 11
). The
great reduction of the basal promoter activity was probably due to
disruption of the distance between the TATA box and the P0 and other
regulatory elements. Thus, the MARE site does not appear to be
essential for function of the human IL-4 promoter in Jurkat T cells.
| Discussion |
|---|
|
|
|---|
The P0 probe contains the octamer-like sequence. However, no significant DNA binding to the P0 probe was detected in nonstimulated nuclear extracts. This is in agreement with our observations that by themselves, Oct-1 and Oct-2 bound weakly to the IL-4 octamer-like sequence (33). The P0 region also does not contain an AP-1 binding site as demonstrated by footprinting analysis using recombinant Fos and Jun proteins (31). Upon induction of D10 cells, NF-P0a and NF-P0b bind to the P0 and the octamer-like sequences. Both NF-P0a and NF-P0b were found to contain AP-1 family and octamer proteins.
Based on a comparison of the different NF-AT binding sequences identified to date, the NF-AT binding site is present as a 9-bp element positioned next to an AP-1 element. NF-AT and AP-1 are shown to cooperatively bind to many promoters (40). Although all P sites of the IL-4 promoter share DNA sequence similarities, they bind to NF-AT with different affinities (41). In general, the NF-AT sites in which the GGAAA core sequence is preceded by a T rather than by an A bind NF-AT proteins more strongly (40). The NF-AT binding sequence in the P1 site contains four T next to the GGAAA core sequence, while the NF-AT consensus sequence in the P0 site does not (41). This may explain why rNF-ATp binds poorly to the P0 probe and no binding activity was detectable with rNF-ATc in EMSA. Although P0 is a weak NF-AT site, the PMA/ionomycin-induced complex NF-P0a contains NF-ATc, as detected by anti-NF-ATc Abs. These data indicate that proteins of the AP-1 family, octamer proteins, and NF-AT may cooperatively bind to the P0 site, an otherwise very weak binding site for each individual factor.
Interestingly, our experiments show that inducible binding of nuclear factors to the P0 site was detectable with nuclear extracts of normal human Th2 but not Th1 cells. This may partially explain the Th2 specificity of the P0 site observed previously (22). NF-AT and proteins of the AP-1 family are not restricted to Th2 cells. Yet, specific binding of these proteins to the P0 site was observed only in Th2 cells. Similar observations have recently been reported for NF-AT that binds to the P4 and P1 sites only in Th2 cells (32, 35). This suggests that another tissue-specific factor(s) or tissue-specific post-translational modifications of DNA binding proteins may contribute to the Th2-specific interaction of the ubiquitous nuclear factors to the P4, P1, and P0 sites of the IL-4 promoter. This suggestion is supported by the recent finding that the recombinant c-Maf, an oncogene product expressed exclusively in Th2 cells, binds to the MARE and P0 sites in association with the recombinant NF-AT (29). Since the P0 probe used in our experiments and the Th2-specific P4 and P1 binding activities (32, 35) do not contain a MARE site, we assume that c-Maf is not the only factor conferring Th2-specific expression to the IL-4 gene.
In this study, we also investigated the functional role of the P0 and the octamer-like site in regulating the activity of the human IL-4 promoter. We show that the octamer-like site, although not essential for the inducibility of the IL-4 promoter, plays an important role in the overall promoter activity. Binding of NF-AT to the P0 site may have been abolished by the mutations introduced at the octamer-like site. Since NF-AT may cooperate also with c-Maf to bind to the P0 site (29), mutations at the octamer-like site do not seem to be critical for the inducibility of the IL-4 promoter.
We show that the P0 site by itself is a weak binding site for NF-AT. Mutations at the P0 site resulted in an approximately 40% reduction of the promoter inducibility and a 70% decrease in the overall promoter activity. Therefore, the P0 site is important for human IL-4 promoter activity.
Subtle differences between the human and the murine systems were
observed. Oct-1 and Oct-2 were identified in the P0 binding complexes
formed by the D10 cells. However, the octamer proteins were not found
in the P0 binding complex formed by the human Th2 cells. Also, the
PMA-inducible CsA-resistant NF-P0b was not detected in extracts from
the human Th2 cells. Furthermore, the MARE site has recently been shown
to play a critical role in regulation of the murine IL-4 promoter (42).
However, nucleotide substitution at the MARE site did not significantly
influence the overall activity of the human IL-4 promoter. The 13-bp
deletion of the MARE site, although it significantly reduced the basal
activity of the human IL-4 promoter, did not influence its
inducibility. In EMSA, the DNA probe containing the P0 and the MARE
sites did not show significant inducible binding activities (Fig. 3
).
Instead, multiple constitutive complexes were generated by both
noninduced and induced nuclear extracts (Fig. 3
). The MARE site was
previously identified as a weak NF-IL-6 binding site (25). Thus, c-Maf
and NF-IL-6, both b-ZIP proteins, may interact at this site (29). The
multiple constitutive complexes observed with the MARE probe in our
experiment might be generated by such interactions. CD4+
Th2 cells are generally considered the principal producers of IL-4 in
an immune response. However, other cell types, like mast cells,
basophils, and CD4- T cells, are found to produce IL-4 as
well (43, 44, 45, 46, 47, 48, 49). Although the MARE site does not seem to be essential for
the activity of the human IL-4 promoter in Jurkat T cells, the
importance of this site for IL-4 transcription in other IL-4-producing
cells needs to be examined.
Previously, we showed that NF-IL-6 is involved in
trans-activation of the IL-4 promoter and that NF-IL-6 mRNA
is detectable in IL-4-producing cells but not in the Th1 clone 29 (25).
This indicates that NF-IL-6 may be restricted to only certain T cell
subsets. Recently, high mobility group (HMG) I(Y) chromosomal
proteins, which by themselves are unable to stimulate or inhibit
promoter activity, were found to compete with NF-AT for binding to the
P1 site (27). HMG I(Y) was found expressed at different levels
in different T cell lines and, therefore, may be another candidate for
the differential regulation of the IL-4 promoter activity in different
T cell populations. A potential NF-
B binding site was identified
that shares the NF-AT binding sequence at the P1 site (26). NF-
B is
well known to activate IL-2 gene expression. Opposite effects of the
two subunits of the NF-
B heterodimer, p65 (RelA), and p50 (NF-
B1)
on IL-2 and IL-4 promoter activities in the human Jurkat T cell line
were reported (26). Therefore, NF-
B may also play a role in
differential regulation of Th1 and Th2 cytokines. Stat6, the
IL-4-induced transcription factor, was found to interact with the P2
site (28). Stat6 activation correlated consistently and uniquely with
IL-4-induced Th2 differentiation. Very recently, GATA-3 was found in
Th2 cells and was shown to activate the IL-4 promoter in B lymphoma M12
cells. Antisense GATA-3 inhibited the expression of all Th2 cytokine
genes in Th2 D10 cells (50). Taken together, we suggest that the
Th2-specific expression of the IL-4 gene is controlled by a multifactor
system. The findings described here provide additional evidence that
differential interaction of transcription factors with
promoter/enhancer elements of cytokine genes is one of the mechanisms
responsible for the tissue-specific expression of type 1 or type 2
cytokines.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Division of Biology, 147-75, California Institute of Technology, Pasadena, CA 91125. ![]()
3 Abbreviations used in this paper: CsA,
cyclosporin A; EMSA, electrophoretic mobility shift assay; GST,
glutathione-S-transferase; AP-1, activating protein-1;
CAT, chloramphenicol acetyltransferase; SP-1, sequence-specific
transcription factor; HMG, high mobility group. ![]()
Received for publication December 8, 1997. Accepted for publication March 30, 1998.
| References |
|---|
|
|
|---|
-IFN, and interleukin 3 and 4 is random in murine alloreactive T-lymphocyte clones. Proc. Natl. Acad. Sci. USA 85:9189.
and IL-4 on the in vitro development of human Th1 and Th2 clones. J. Immunol. 148:2142.[Abstract]
and
) exert opposite regulatory effects on the development of cytolytic potential by Th1 and Th2 human T cell clones. J. Immunol. 149:2977.[Abstract]
-producing T cells studied by lineage ablation of IL-4-producing cells. Cell 75:985.[Medline]
B: implication for differential gene expression in T helper cell subsets. Proc. Natl. Acad. Sci. USA 92:11623.
), macrophage-activating factors (MAFs), and colony-stimulating factors (CSFs) secreted by T cell clones in limiting dilution microcultures, long-term cultures, and by T cell hybridomas. Immunol. Rev. 76:5.[Medline]
ß-TCR+ CD4- CD8- T cells produce IL-4. J. Immunol. 149:1211.[Abstract]
This article has been cited by other articles:
![]() |
U. De Fanis, F. Mori, R. J. Kurnat, W. K. Lee, M. Bova, N. F. Adkinson, and V. Casolaro GATA3 up-regulation associated with surface expression of CD294/CRTH2: a unique feature of human Th cells Blood, May 15, 2007; 109(10): 4343 - 4350. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zeng, X. Zhang, Z. Huang, L. Cheng, S. Yao, D. Qin, X. Chen, Q. Tang, Z. Lv, L. Zhang, et al. Intracellular Tat of Human Immunodeficiency Virus Type 1 Activates Lytic Cycle Replication of Kaposi's Sarcoma-Associated Herpesvirus: Role of JAK/STAT Signaling J. Virol., March 1, 2007; 81(5): 2401 - 2417. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ryzhov, A. E. Goldstein, I. Biaggioni, and I. Feoktistov Cross-Talk between Gs- and Gq-Coupled Pathways in Regulation of Interleukin-4 by A2B Adenosine Receptors in Human Mast Cells Mol. Pharmacol., August 1, 2006; 70(2): 727 - 735. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nirula, M. Ho, H. Phee, J. Roose, and A. Weiss Phosphoinositide-dependent kinase 1 targets protein kinase A in a pathway that regulates interleukin 4 J. Exp. Med., July 10, 2006; 203(7): 1733 - 1744. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro T-helper cell type-2 regulation in allergic disease Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-M. Hu, S. Y. Jang, J. C. Fanzo, and A. B. Pernis Modulation of T Cell Cytokine Production by Interferon Regulatory Factor-4 J. Biol. Chem., December 13, 2002; 277(51): 49238 - 49246. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. T. F. Schwenger, C. C. Kok, E. Arthaningtyas, M. A. Thomas, C. J. Sanderson, and V. A. Mordvinov Specific Activation of Human Interleukin-5 Depends on de Novo Synthesis of an AP-1 Complex J. Biol. Chem., November 27, 2002; 277(49): 47022 - 47027. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takeba, H. Nagafuchi, M. Takeno, J.-i. Kashiwakura, and N. Suzuki Txk, a Member of Nonreceptor Tyrosine Kinase of Tec Family, Acts as a Th1 Cell-Specific Transcription Factor and Regulates IFN-{gamma} Gene Transcription J. Immunol., March 1, 2002; 168(5): 2365 - 2370. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Andersen and M. G. Rosenfeld POU Domain Factors in the Neuroendocrine System: Lessons from Developmental Biology Provide Insights into Human Disease Endocr. Rev., February 1, 2001; 22(1): 2 - 35. [Abstract] [Full Text] |
||||
![]() |
E. A. WIERENGA and G. MESSER Regulation of Interleukin 4 Gene Transcription . Alterations in Atopic Disease? Am. J. Respir. Crit. Care Med., September 1, 2000; 162(3): S81 - 85. [Full Text] [PDF] |
||||
![]() |
L. H. Glimcher and K. M. Murphy Lineage commitment in the immune system: the T helper lymphocyte grows up Genes & Dev., July 15, 2000; 14(14): 1693 - 1711. [Full Text] |
||||
![]() |
C. Cerdan, E. Serfling, and D. Olive The C-class chemokine, lymphotactin, impairs the induction of Th1-type lymphokines in human CD4+ T cells Blood, July 15, 2000; 96(2): 420 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Hehner, M. Li-Weber, M. Giaisi, W. Droge, P. H. Krammer, and M. L. Schmitz Vav Synergizes with Protein Kinase C{Theta} to Mediate IL-4 Gene Expression in Response to CD28 Costimulation in T Cells J. Immunol., April 1, 2000; 164(7): 3829 - 3836. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-i. Kashiwakura, N. Suzuki, H. Nagafuchi, M. Takeno, Y. Takeba, Y. Shimoyama, and T. Sakane Txk, a Nonreceptor Tyrosine Kinase of the Tec Family, Is Expressed in T Helper Type 1 Cells and Regulates Interferon {gamma} Production in Human T Lymphocytes J. Exp. Med., October 18, 1999; 190(8): 1147 - 1154. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Wierenga, M. Walchner, G. Kick, M. L. Kapsenberg, E. H. Weiss, and G. Messer Evidence for suppressed activity of the transcription factor NFAT1 at its proximal binding element P0 in the IL-4 promoter associated with enhanced IL-4 gene transcription in T cells of atopic patients Int. Immunol., February 1, 1999; 11(2): 297 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Q. Cron, S. J. Bort, Y. Wang, M. W. Brunvand, and D. B. Lewis T Cell Priming Enhances IL-4 Gene Expression by Increasing Nuclear Factor of Activated T Cells J. Immunol., January 15, 1999; 162(2): 860 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
I.-C. HO, J.I. KIM, S.J. SZABO, and L.H. GLIMCHER Tissue-specific Regulation of Cytokine Gene Expression Cold Spring Harb Symp Quant Biol, January 1, 1999; 64(0): 573 - 584. [Abstract] [PDF] |
||||
![]() |
M. Li-Weber, M. Giasi, and P. H. Krammer Involvement of Jun and Rel Proteins in Up-regulation of Interleukin-4 Gene Activity by the T Cell Accessory Molecule CD28 J. Biol. Chem., December 4, 1998; 273(49): 32460 - 32466. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Guo, V. Casolaro, E. Seto, W.-M. Yang, C. Chang, M.-C. Seminario, J. Keen, and S. N. Georas Yin-Yang 1 Activates Interleukin-4 Gene Expression in T Cells J. Biol. Chem., December 21, 2001; 276(52): 48871 - 48878. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |