The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hattori, S.
Right arrow Articles by Shirai, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hattori, S.
Right arrow Articles by Shirai, T.
The Journal of Immunology, 1998, 161: 1231-1238.
Copyright © 1998 by The American Association of Immunologists

L-Selectin-Specific Autoantibodies in Murine Lupus: Possible Involvement in Abnormal Homing and Polarization of CD4+ T Cell Subsets1

Susumu Hattori*, Hiroyuki Nishimura*,{dagger}, Hiromichi Tsurui*, Masayuki Kato{dagger}, Naoki Endo{dagger}, Masaaki Abe*, Shin Akakura*, Kenichi Mitsui*, Sho Ishikawa*, Sachiko Hirose* and Toshikazu Shirai2,*

* Department of Pathology, Juntendo University School of Medicine, Hongo Bunkyo-ku, Tokyo, Japan; and {dagger} Toin Human Science and Technology Center, Toin University of Yokohama, Kurogane-cho, Aoba-ku, Yokohama.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
One notable functional abnormality in murine and human systemic lupus erythematosus (SLE) is the defect in the production of IL-2 in association with the deficit in naive CD4+ T cells. The mechanism is unknown, but one idea is that naturally occurring autoantibodies with specificities to the naive CD4+ T cell subpopulation are related to this event. We selected hybridoma monoclonal autoantibodies from SLE-prone (New Zealand Black (NZB) x New Zealand White (NZW))F1 mice that reacted with restricted populations of CD4+ T cells. One of these, H32, was specific for L-selectin, as determined by 1) distribution of Ag H32 on lymphoid cells similar to Mel-14, an epitope of L-selectin; 2) shedding of 80-kDa molecules with epitope H32 from the surface of lymph node cells coincidentally with Mel-14, when stimulated with phorbol ester; 3) cross-inhibitory activities on Ag binding between H32 and Mel-14; and 4) reactivity of H32 with recombinant mouse L-selectin. Pretreatment of 51Cr-labeled lymphocytes from BALB/c mice with H32 significantly inhibited their homing to lymph nodes in vivo. The BALB/c splenic H32+ CD4+ T cell subset produced few cytokines except IL-2, thus corresponding to naive ThP-type cells. This subset was markedly selectively depleted in aged (NZB x NZW)F1 mice. There was an age-associated increase in frequencies and titers of anti-L-selectin autoantibodies in sera from (NZB x NZW)F1 mice. Thus, abnormalities of naive CD4+ T cell subset, including IL-2 production in subjects with SLE, are at least partly attributed to the generation of autoantibodies to L-selectin.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Varieties of anti-lymphocyte autoantibodies are present in sera from the great majority of patients with systemic lupus erythematosus (SLE)3 as well as in murine lupus (1, 2). Although the significance of anti-lymphocyte autoantibodies in SLE is still unclear, their association with clinical indexes and immune dysregulation characteristic of this disease suggests their relationship to immune system functional abnormalities in patients with SLE (3, 4, 5). Potential mechanisms by which these autoantibodies could alter immune system functions include immune elimination of target lymphocytes either by killing or by altering their pattern of migration and modulation of functioning molecules on the lymphocyte surface by promoting shedding or capping (1).

One notable functional abnormality of peripheral CD4+ T cells found in murine lupus is the defect in the production of IL-2 (6, 7, 8). In SLE-prone BXSB male mice, the age-associated decreases in IL-2 production and in the message transcription by CD4+ T cells are associated with the decrease in the number of CD4+ T cells that phenotypically corresponds to naive CD4+ T cells (9). Development of florid SLE in (NZB x NZW)F1 female mice is associated with the deficit in the production of and responsiveness to IL-2 by T cells (6, 7, 8) and with a marked decrease in the number of CD4+ T cells positive for CD45RC, an alternative exon 6-dependent epitope of CD45 (10). Upon in vitro polyclonal stimulation in normal healthy mice, this CD45RC+ CD4+ T cell subset produces few cytokines except IL-2, hence corresponding to naive ThP-type cells.

The pathogenesis of the selective depletion of ThP-type cells is unknown. One idea is that naturally occurring autoantibodies with specificities to the ThP-type naive CD4+ T cell subset may be responsible, because a variety of anti-T cell autoantibodies, some with distinct and restricted specificities, are produced in murine lupus (11, 12, 13, 14, 15, 16, 17). In patients with SLE, naturally occurring autoantibodies to isoforms of CD45 molecules (leukocyte common Ags) were identified (18). Since the epitopes on alternative structures of CD45 isoforms such as CD45RA, alternative exon 4-dependent epitope, in humans and CD45RC in mice serve as markers for naive CD4+ T cells (9, 19), we speculated that such autoantibodies may be responsible for the ThP-type cell abnormality. Alternatively, autoantibodies to other cell surface structures preferentially expressed on ThP-type cells may be involved. Our studies indicate that in (NZB x NZW)F1 mice, there exists a type of autoantibody specific for L-selectin (CD62L), a homing receptor of lymphocytes, which is preferentially expressed on ThP-type naive CD4+ T cells. This has the potential to prevent the homing of lymphocytes, a finding that implicates the role of this type of autoantibodies for the age-associated selective decrease in ThP-type naive CD4+ T cells in (NZB x NZW)F1 mice.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice

BALB/c and (NZB x NZW)F1 mice were originally obtained from Shizuoka Laboratory Animal Center (Shizuoka, Japan) and were maintained in the animal facilities at Juntendo University (Tokyo, Japan).

Monoclonal Abs

The mAbs JH6.2 (anti-CD45RC) (10) and NTA260 (16) were developed as previously described. Other mAbs used were anti-CD4 (GK1.5, Becton Dickinson, Mountain View, CA), Mel-14 (L-selectin-specific rat IgG mAb), anti-IFN{gamma} (PharMingen, San Diego, CA), anti-B220 (6B2) (20), anti-CD3 (2C11) (21), anti-CD25 (PC-61 and 3C7) (22, 23), anti-IL-4 (11B11) (24) and anti-IL-10 (provided by Dr. H. Ishida, Kyoto University, Kyoto, Japan). Two IgM mAbs originated from an 8-mo-old female (NZB x NZW)F1 mouse (clones HOG.10 and ROB.8) with unknown specificity were used for control studies. A mouse IgM mAb (clone 3H2.10) derived from a BALB/c mouse and a rat IgG mAb (clone 5.1.9) from a Lewis rat were also used for control studies. These two mAbs were of unknown specificity and did not react with lymphoid cells from mice and rats, as determined by flow cytometric analyses. Hybridoma mAbs against murine T cells were produced by fusing spleen cells from an 8-mo-old female (NZB x NZW)F1 mouse that produces a high serum level of naturally occurring autoantibodies against thymocytes with P3X63-Ag8-653 myeloma cells, as described by Oi and Herzenberg (25). Two weeks after the initiation of culture, supernatants were screened by complement-dependent cytotoxicity test and flow cytometric analysis for reactivity to thymocytes and spleen cells from young BALB/c mice.

Flow cytometric analysis

Lymphocytes (1 x 106) were stained with an appropriate amount of biotinylated mAb, followed by either FITC-conjugated or phycoerythrin (PE)-conjugated streptavidin. For two-color analysis, cells were incubated with biotinylated mAb 1 and FITC-conjugated mAb 2, followed by PE-conjugated streptavidin. Flow cytometric analysis and cell sorting were performed using FACStar (Becton Dickinson) and LYSYS II software (Becton Dickinson).

Bioassay for cytokine

In vitro production of IL-2 and IL-4 by CD4+ T cells upon stimulation with immobilized anti-CD3 mAb (2C11) was measured by proliferative responses of the HT 2 cell line, as described by Cherwinski et al. (26). A sandwich ELISA was performed to measure mouse IL-10 and IFN-{gamma} levels in the culture supernatants of CD4+ T cell subsets, as previously described (27).

Recombinant mouse L-selectin/human Fc ({gamma}) chimeric protein

Poly(A)+ mRNA was isolated from spleen cells from a 2-mo-old NZB mouse and was reverse transcribed with Moloney murine leukemia virus reverse transcriptase (Life Technologies, Gaithersburg, MD) using a random hexamer primer, as previously described (28). A murine cDNA encoding the lectin-, epidermal growth factor-like-, and a part of CR domains of mouse L-selectin (29) was amplified by PCR using a pair of oligonucleotide primers with sequences CGGTCGACGAGGCTGAGGCTGCAGAGAGACT and GAGGATCCGATGCTCCACACTGTGTTTCTG, in which sequences for the recognition by restriction endonucleases SalI and BamHI, respectively, were added at the 5' termini. The amplified cDNA cleaved by these restriction enzymes was inserted at the BamHI-SalI site of the plasmid pSKM13+ (Stratagene, La Jolla, CA). The mouse L-selectin cDNA fragment was isolated and subsequently ligated to a pCDrLEC-IgG vector digested with restriction endonucleases XhoI and BamHI (30), an expression vector for the recombinant fusion protein of the rat L-selectin and human Ig (IgG1) constant region (provided by Dr. Masayuki Miyasaka, Osaka University, Osaka, Japan). The resultant vector pCDmLEC-IgG was propagated in Escherichia coli, then transfected into COS-7 cells (31). Recombinant mouse L-selectin/human Fc({gamma}) chimeric protein secreted in the culture medium was purified using a protein G-Sepharose column (Pharmacia Biotech, Uppsala, Sweden).

Stimulation of lymph node cells with phorbol ester

Mesenteric lymph node cells from 2-mo-old BALB/c mice were cultured in RPMI 1640 medium containing 10% FCS, 50 µM 2-ME, and varying concentrations (0.1–100 ng/ml) of PMA (Sigma, St. Louis, MO) for 1 h at 37°C. After washing once with ice-cold PBS, cells were subjected to flow cytometric analysis to determine the cell surface expression of H32 and Mel-14, as described above.

Immunoblotting of soluble L-selectin

Lymph node cells (4 x 108) were cultured in 1 ml of the serum-free RPMI 1640 medium containing PMA (100 ng/ml) for 20 min at 37°C. Culture supernatant (50 µl) was subjected to SDS-acrylamide gel electrophoresis with 2-ME, as described by Laemmli (32). The gel was transferred electrophoretically to a Clear Blot Membrane-P (Atto Co., Tokyo, Japan). The blotted membrane was first incubated with biotinylated H32 (5 µg/ml), followed by alkaline phosphatase-conjugated avidin (Vector Laboratories, Burlingame, CA). Bands were visualized using nitro blue tetrazolium and 5-bromo-4-chloro-3-indoryl phosphate substrate solutions (Promega Biotec, Madison, WI).

Cross-inhibition studies

Lymph node cells from 2-mo-old BALB/c mice at 1 x 106 cells/20 µl of PBS containing 0.2% BSA were incubated first with varying concentrations of H32 (1–10,000 µg/ml) or Mel-14 mAbs (15–1,500 µg/ml) for 30 min on ice. As isotype-matched control mAbs for H32 and Mel-14, a mouse IgM mAb (clone HOG.10) and rat IgG mAb (clone 5.1.9) were used, respectively. Following incubation, 20 µl of either biotin-conjugated Mel-14 or H32 at suboptimum concentrations for staining (1 µg/ml for Mel-14 and 10 µg/ml for H32) was added, and the plates were incubated for an additional 30 min on ice. Cells were then washed three times with PBS containing 0.2% BSA and incubated with FITC-conjugated streptavidin for 30 min on ice. After washing with PBS, the intensity of immunofluorescence was measured using FACStar (Becton Dickinson).

Test for lymphocyte homing

BALB/c mouse lymph node cells were labeled with [51Cr]sodium chromate in sterile isotonic solution (Amersham/Searle Corp., Arlington Heights, IL), according to the method of Bainbridge and Gowland (33). Cells in RPMI 1640 with 15% FCS were incubated with [51Cr]sodium chromate for 30 min at 37°C at a concentration of 0.93 MBq/108 cells. After washing twice in medium RPMI 1640 with 15% FCS, aliquots of 5 x 106 radiolabeled cells were incubated with 0.25 ml of pooled sera from 2-mo-old BALB/c mice, either alone (Control-1) or together with mAb H32 or a control (NZB x NZW)F1 IgM mAb HOG.10 that is nonreactive to murine lymphocytes (Control-2) at a concentration of 100 µg mAb/ml for 60 min at 4°C, and the mixture was then given i.v. to five 2-mo-old BALB/c mice. Twenty-four hours later, the radioactivities in the blood (0.25 ml), lymph nodes (bronchial, axillary, inguinal, and mesenteric), spleen, liver, and thymus were measured using a Microbeta Plus scintillation counter (Wallac, Purku, Finland). Results are expressed as a percentage of localized labeled cells in recipient tissues relative to the injected dose.

Reactivity of mAbs to recombinant L-selectin

To examine the binding ability of mAbs to immobilized recombinant mouse L-selectin molecules, a sandwich ELISA was performed. Microtiter plates (Dynatech Laboratories, Chantilly, VA) were coated with purified rabbit anti-human IgG Abs (Jackson Laboratories, West Grove, PA), washed with PBS, blocked with 3% BSA in PBS, and reacted with the supernatant of COS-7 cell culture containing recombinant mouse L-selectin/human Fc ({gamma}) chimeric protein. Binding of biotinylated H32, Mel-14, and MRL-2 (rat L-selectin-specific) mAbs toward recombinant L-selectin was detected using alkaline phosphatase-conjugated avidin and p-nitrophenyl phosphate.

ELISA to detect L-selectin-specific autoantibodies

In the ELISA to detect L-selectin-specific autoantibodies in sera from mice, precoating of the microtiter plates with rabbit anti-human IgG Abs to capture mouse L-selectin/human Fc ({gamma}) chimeric protein resulted in nonspecific binding of mouse natural heteroantibodies to rabbit Igs. To exclude these, microtiter plates were directly coated with purified recombinant mouse L-selectin/human Fc({gamma}) overnight at 4°C, blocked with 3% BSA in PBS, and reacted with mouse sera serially diluted in PBS containing 40 µg/ml of human IgG and 0.05% Tween-20 for 2 h at 4°C. After extensive washings in PBS containing 0.1% BSA and 0.05% Tween-20, binding of Abs was examined using alkaline phosphatase-conjugated anti-mouse Igs and p-nitrophenyl phosphate. Data were expressed as {delta} OD, by subtracting OD405 with medium alone from that with test serum samples.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Generation of L-selectin-specific hybridoma mAb from untreated (NZB x NZW)F1 mouse

An IgM hybridoma mAb H32, selected from 8-mo-old (NZB x NZW)F1 mouse spleen cell hybridomas for the reaction to a limited population of 2-mo-old syngeneic mouse lymphocytes from various sources, was cytotoxic in nature in the presence of rabbit complement. Flow cytometric analyses showed that Ag H32 was positive for approximately 30% thymocytes, 37% spleen cells, 60% mesenteric lymph node cells, 53% peritoneal lymphocytes, 20% PBL, and 10% bone marrow cells from 2-mo-old BALB/c mice. Because such distribution of H-32 Ag was similar to that of Mel-14, expressions of H32 and Mel-14 on CD3+ T and B220 (6B2)+ B cells were compared, using two-color flow cytometric analyses of spleen cells from 2-mo-old BALB/c mice. As shown in Figure 1Go, H32 and Mel-14 Ags showed much the same distribution. A control IgM mAb from a (NZB x NZW)F1 mouse with unknown specificity was negative for the staining in the same experiments (data not shown).



View larger version (57K):
[in this window]
[in a new window]
  		FIGURE 1. Two-color flow cytometric profiles of spleen cells from 2-mo-old BALB/c mice for B220 (6B2) vs H32 (a), for 6B2 vs Mel-14 (b), for CD3 vs H32 (c), and for CD3 vs Mel-14 expression (d). Spleen cells were incubated with the following combinations of mAbs: PE-conjugated 6B2 and FITC-conjugated H32 (a), PE-conjugated 6B2 and FITC-conjugated Mel-14 (b), PE-conjugated anti-CD3 and FITC-conjugated H32 (c), and PE-conjugated anti-CD3 and FITC-conjugated Mel-14 (d).

 
Figure 2Go shows that pretreatment of cells with nonbiotinylated mAb Mel-14 completely inhibited the subsequent staining with biotinylated H32 (Fig. 2Go, a–e). A control rat IgG mAb (clone 5.1.9) failed to compete with H32 (Control 1, Fig. 2Go, f–j). Pretreatment of cells with nonbiotinylated mAb H32 also inhibited the staining with biotinylated Mel-14 almost completely (Fig. 2Go, k–o), suggesting that mAbs H32 and Mel-14 probably recognize the same epitope. Again, a control (NZB x NZW)F1 IgM mAb HOG.10 did not inhibit the binding of Mel-14 (Control 2, Fig. 2Go, p–t).



View larger version (37K):
[in this window]
[in a new window]
  		FIGURE 2. Competitive binding of mAbs H32 and Mel-14 to lymph node cells from 2-mo-old BALB/c mice. Lymph node cells (1 x 106) were first incubated with varying concentrations (0, 1.5, 15, 150, and 1500 µg/ml) of unconjugated Mel-14 (a–e) or a control rat IgG mAb (Control-1; f–j), followed by a suboptimum concentration of biotinylated H32 (10 µg/ml). Alternatively, cells were first incubated with varying concentrations (0, 10, 100, 1,000, and 10,000 µg/ml) of unconjugated H32 (k–o) or a control mouse IgM mAb (Control-2; p–t), followed by a suboptimum concentration of biotinylated Mel-14 (1 µg/ml). The cells were then stained with FITC-conjugated avidin and were subjected to flow cytometry analysis.

 
L-selectin expressed on peripheral lymphocytes is shed from the cell surface when cells are stimulated by phorbol ester (34). As shown in Figure 3Go, both Mel-14 and H32 epitopes disappeared when the cells were exposed to 1 ng/ml or more of PMA.



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 3. Disappearance of Mel-14 and H32 expressions on lymph node cells upon treatment with varying concentrations of PMA in vitro. Mesenteric lymph node cells from 2-mo-old BALB/c mice were incubated in serum-free RPMI 1640 medium containing varying concentrations of PMA at 37°C for 20 min. The cells were subsequently stained with biotinylated mAb (Mel-14, H32, or CD4) followed by FITC-avidin.

 
Figure 4Go shows data on the immunoblotting analysis, using culture supernatants of mesenteric lymph node cells prestimulated with PMA. The molecular mass of the shed H32 Ag was estimated to be 80 kDa, in keeping with the reported molecular size of L-selectin molecule (35).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 4. Immunoblotting analysis with H32 mAb of the culture supernatant of lymph node cells treated with PMA. Mesenteric lymph node cells from 2-mo-old BALB/c mice were incubated in serum-free RPMI 1640 medium containing PMA (100 ng/ml) at 37°C for 20 min. Proteins in the culture supernatants were concentrated by precipitation with saturated ammonium sulfate, then subjected to SDS-PAGE with 2-ME. The gel was transferred electrophoretically to a Clear Blot Membrane-P (Atto Co., Tokyo, Japan). Bands were visualized using nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indoryl phosphate (BCIP) substrate solutions (Promega Biotec), as described in Materials and Methods. Lane 1, The blot was incubated with biotinylated H32 (5 µg/ml) followed by alkaline phosphatase-conjugated avidin; lane 2 (control), The blot was incubated with PBS followed by alkaline phosphatase-conjugated avidin.

 
To examine the reactivity of H32 to L-selectin, recombinant chimeric proteins, rat L-selectin/human Fc({gamma}) and mouse L-selectin/human Fc({gamma}), were immobilized on plates coated with rabbit anti-human IgG Abs, and binding of biotinylated Mel-14 and H32 mAbs was examined. As shown in Table IGo, both Abs reacted to mouse, but not to rat, L-selectin chimeric protein.


View this table:
[in this window]
[in a new window]
  		Table I. Binding of H32 mAb to immobilized recombinant mouse L-selectin molecules1

 
Inhibitory effect of H32 on homing of L-selectin-positive lymphocytes

We then asked whether mAb H32 would affect the homing of lymphocytes into lymphoid tissues. BALB/c mice at 2 mo of age were given i.v. a mixture of 51Cr-labeled lymph node cells (5 x 106 cells) and mAb H32 that had been incubated for 60 min at 4°C. As controls, mice were given 51Cr-labeled lymph node cells either alone (Control-1) or mixed with the control (NZB x NZW)F1 IgM mAb HOG.10 (Control-2). Twenty-four hours later, tissue and blood samples from the recipients were examined for radioactive content. As shown in Table IIGo, compared with average proportions of radioactivities recovered from the control groups, the experimental group showed a marked decrease in the recovery in lymph nodes and, in turn, an increase in the spleen, indicating the inhibitory effect of mAb H32 on homing of recirculating lymph node cells into lymph nodes. Similar findings were obtained in experiments using mAb Mel-14 (data not shown). The increase in the proportion of radioactivity in the spleen, but not other tissues, suggests that the spleen is the major site of terminal accumulation of sensitized cells.


View this table:
[in this window]
[in a new window]
  		Table II. Inhibitory effect of H32 mAb on homing of lymph node cells1

 
Selective age-associated decrease of H32+ CD4+ T cell subsets with ThP-type functions in (NZB x NZW)F1 mice

Figure 5Go shows the two-color flow cytometric profile of spleen cells and peripheral lymph node cells from 2-mo-old BALB/c mice for the expression of CD4 vs H32. The CD4+ T cells were clearly separated into two subsets, one positive and one negative for H32. Such distribution of H32 on CD4+ T cells was similar to that of CD45RC Ag, which is mainly distributed on naive CD4+ T cells (10). We then determined functional properties of FACS-sorted H32+ CD4+ and H32- CD4+ splenic T cells in terms of the potential to produce IL-2 and IL-4 upon stimulation with immobilized anti-CD3 mAb in vitro in either the presence or the absence of accessory cells. In accordance with the previous report by Croft et al. (36) demonstrating the functional difference between L- selectin+ naive and L-selectin- memory CD4+ T cells, we found that H32+CD4+ T cells responded to immobilized anti-CD3 Abs to produce IL-2 only in the presence of accessory cells, while H32- CD4+ T cells produced both IL-2 and IL-4 in either the presence or the absence of accessory cells (data not shown).



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 5. Two-color flow cytometric analysis of spleen cells and peripheral lymph node cells from 2-mo-old BALB/c mice for CD4 vs H32. The cells were stained and analyzed described as in Figure 1Go. The values in the figures represent the population (percentage) in total CD4+ T cells.

 
As shown in Figure 6Go, splenic CD4+ T cells from 2-mo-old (NZB x NZW)F1 mice contained both H32+ CD4+ and H32- CD4+ T cells (Fig. 6Goa), while splenic CD4+ T cells from 8-mo-old mice were mostly composed of H32- cells (Fig. 6Gob). In keeping with our earlier findings of CD4+ T cells stained with mAbs CD45RC and NTA260 (8), double staining of cells with mAbs H32 and NTA260 clearly separated CD4+ T cells from 2-mo-old (NZB x NZW)F1 mice into four phenotypically distinct subsets (Fig. 6Goc). Notably, there was a marked age-associated decrease in CD4+ T cell subsets with each H32+ NTA260-, H32+ NTA260+, and H32- NTA260+ phenotype, and the remainder was virtually composed of H32- NTA260- CD4+ T cells (Fig. 6God).



View larger version (37K):
[in this window]
[in a new window]
  		FIGURE 6. Age-associated changes in H32 expression on splenic CD4+ T cells from (NZB x NZW)F1 mice. Spleen cells from 2-mo-old (a and c) and 8-mo-old (b and d) (NZB x NZW)F1 mice were stained with a mixture of FITC-conjugated anti-CD4 (GK1.5) and biotinylated H32, followed by PE-conjugated avidin. The stained cells were subjected to two-color flow cytometric analysis for CD4 vs H32 (a and b). Alternatively, cells were stained with FITC-conjugated NTA260, biotin-conjugated H32, and PE-conjugated CD4, and finally with allophycocyanine-conjugated avidin. The stained cells were subjected to three-color analysis, and profiles for NTA260 vs H32 expression of CD4+ T cells are shown (c and d).

 
Age-associated increase in serum levels of L-selectin-specific autoantibodies in (NZB x NZW)F1 mice

Figure 7Go shows data of binding activities of sera from young and old BALB/c and (NZB x NZW)F1 mice to the recombinant mouse L-selectin/human Fc ({gamma}) chimeric protein. To exclude the possible involvement of anti-human Fc ({gamma}) reactivities in mouse sera, all sera were serially diluted in PBS containing human IgG. While sera from young and old BALB/c and young (NZB x NZW)F1 mice showed only low levels of reactivity, sera from aged (NZB x NZW)F1 mice exhibited increased binding activities in a high frequency. Such reactivities of sera from the aged (NZB x NZW)F1 mice were blocked by preincubation of the sera with soluble mouse L-selectin chimeric protein, but not with human IgG, in a dose-dependent manner (data not shown).



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 7. Age-associated increase in serum levels of L-selectin-specific autoantibodies in (NZB x NZW)F1 mice. Sera from 2-mo-old (a) and 8-mo-old BALB/c (b) and from 2-mo-old (c) and 8-mo-old (NZB x NZW)F1 (d) mice were serially diluted in PBS containing human IgG (40 µg/ml) and reacted with plate-coated recombinant mouse L-selectin/human Fc ({gamma}) chimeric protein for 2 h at 4°C. Bindings of autoantibodies to plate-coated recombinant L-selectin were detected as described in Materials and Methods.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The present studies provide evidence that in SLE-prone (NZB x NZW)F1 mice, there exists a type of autoantibody specific for L-selectin that has the potential to eliminate L-selectin-positive CD4+ T cells either by killing or by preventing their homing to lymph nodes. Thus, the abnormal deficit of a ThP-type naive CD4+ T cell subset bearing L-selectin molecules as well as the well documented defect in IL-2 production by T cells in aged (NZB x NZW)F1 mice can be at least partly attributed to the effect of this type of autoantibodies.

The L-selectin molecule, characterized as a homing receptor of lymphocytes, is an integral membrane glycoprotein (95 kDa) with a short intracytoplasmic domain. The outer membrane region of the molecule is composed of three known types of modules, i.e., Ca2+-dependent lectin domain at the N-terminus, a domain with sequence homology with epidermal growth factor, and two copies of units characteristic of complement binding proteins (29, 37). As mAb Mel-14 recognizes the lectin domain of the molecule (38), and as mAbs H32 and Mel-14 showed cross-inhibitory effects on binding to L-selectin molecules, the H32 epitope probably also resides on the lectin domain of the molecule. L-selectin is differentially expressed on peripheral CD4+ T cells and has served as a marker for naive CD4+ T cells (39, 40). Indeed, the mAb H32 separated peripheral CD4+ T cells from young BALB/c mice into two functionally distinct subpopulations: 1) H32+ CD4+ T cells producing IL-2, but not other cytokines, when stimulated with immobilized anti-CD3 mAb, thus representing the property of naive cells analogous to ThP-type clones (36, 41); and 2) H32- CD4+ T cells producing IL-2, IL-4, IL-10, and IFN-{gamma} upon stimulation, hence presumably including Th1-, Th2-, and Th0-type CD4+ T cells (41, 42, 43). Thus, it is reasonable to speculate that autoantibodies with specificities to L-selectin are at least in part involved in the age-associated selective depletion of ThP-type naive CD4+ T cells in (NZB x NZW)F1 mice.

The significance of the observed deficit in L-selectin-positive, naive CD4+ T cells in autoimmune disease of (NZB x NZW)F1 mice is unclear. In this context, there was a marked difference in the accessory cell dependency in cytokine production between H32+CD4+ and H32- CD4+ T cells, in which the former, but not the latter, was dependent. As accessory cell-dependent naive CD4+ T cells are susceptible to anergy, when stimulated in the absence of accessory signals (44), the age-associated decrease in H32+ CD4+ T cells in (NZB x NZW)F1 mice may promote the loss of peripheral tolerance of CD4+ T cells to self peptides. If so, then, why is the Ag expressed on naive T cells preferentially targeted? As large numbers of naive lymphocytes undergo apoptosis in lymphoid organs, they may provide nuclear and cellular autoantigens, including L-selectin, that are recognized to be immunogenic in individuals with genetic susceptibility to systemic autoimmune diseases.

Our studies implicate two mutually unexclusive roles of L-selectin-specific autoantibodies for immunologic abnormalities in these mice: 1) a selective depletion of L-selectin-positive CD4+ T cells, due to immune clearance of sensitized cells in the spleen; and 2) inhibition of lymphocyte homing into lymphoid tissues. L-selectin on lymphocytes recognizes a sialylated glycoprotein, GlyCAM-1, on high endothelial venules (45, 46) and mediates rolling of lymphocytes on the endothelial cell surface, an initial event in the process of lymphocyte homing (30). Thus, it is conceivable that L-selectin-specific autoantibodies can interfere with this process, resulting in abnormal polarization of CD4+ T cells to L-selectin-negative population in lymphoid tissues of aged (NZB x NZW)F1 mice.

Although autoantibodies specific for isoforms of CD45 were reported to be present in patients with SLE (18), we could not obtain hybridoma clones of this type of specificity from (NZB x NZW)F1 mice. In earlier studies, we obtained evidence that each naive CD4+ T cell, as defined by expression of the CD45RBhigh CD45RC+ phenotype, and memory CD4+ T cell, as defined by CD45RBlow CD45RC- phenotype, can be separated into two phenotypically distinct subsets, either positive or negative for expression of the Ag recognized by a monoclonal natural thymocytotoxic autoantibody, NTA260 (8), a mAb generated from an autoimmune NZB mouse (16). The biochemical nature of this antigenic structure remains to be characterized. However, the striking finding was that the four subsets of CD4+ T cells, CD45RC+ NTA260-, CD45RC+ NTA260+, CD45RC- NTA260+, and CD45RC- NTA260- were functionally distinct in terms of their pattern of cytokine production, and that with advancing age of (NZB x NZW)F1 mice, there was an age-associated polarization of CD4+ T cells to a subset that is negative for both CD45RC and NTA260 expressions in association with a marked decline in the cytokine production of Th1 and Th2 types (8). The present studies revealed that the CD45RC- NTA260- subset was similar to the subset with the H32- NTA260- phenotype, indicating that L-selectin is preferentially expressed on the CD45RC+ CD4+ T cell subset. Because NTA260-type autoantibodies are produced in high titers in NZB and (NZB x NZW)F1 mice (11, 12), in parallel with an age-associated decrease in the NTA-sensitive population of T cells (47), and because these autoantibodies also have potential to prevent the homing of lymphocytes (48), the age-associated polarization of CD4+ T cells to the CD45RC- NTA260- subset can be attributed to the concurrence of both H32-type and NTA260-type autoantibodies. Further characterization of the CD45RC- NTA260- CD4+ T cell subset is important, because this contains a functional subset responsible for the generation of high affinity, pathogenic IgG anti-DNA Abs in (NZB x NZW)F1 mice (49).

The pathologic role ascribed to lymphocyte autoantibodies in autoimmune diseases is controversial (50, 51). In genetic studies using (NZB x NZW)F1 x NZW backcross progeny, however, Yoshida et al. (52) showed that an accelerated onset and the highest incidence of lupus nephritis occurred in the progeny with coincidence of anti-dsDNA Abs and lymphocyte autoantibodies. In light of the present findings, the effects of lymphocyte autoantibodies, particularly those that react with specific functional molecules, should be given attention as a possible cause of immunologic abnormalities. While lymphocyte autoantibodies per se may be the effect rather than the primary cause of autoimmune disease, selection, expansion, and maturation of autoreactive B cell clones, which occur under genetic controls (53, 54), would in consequence facilitate, modify, and/or characterize autoimmune disease manifestations.


   Acknowledgments
 
We thank M. Ohara for critical comments and M. Morita for secretarial services.


   Footnotes
 
1 This work was supported by a grant from a Special Coordination Fund for Senescence Research, Japan; a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports, and Culture, Japan; and CREST (Core Research for Evolutional Science and Technology) of Japan Science and Technology Corporation. Back

2 Address correspondence and reprint requests to Dr. Toshikazu Shirai, Department of Pathology, Juntendo University School of Medicine, 2–1-1, Hongo Bunkyo-ku, Tokyo 113-8421, Japan. E-mail address: Back

3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; NZB, New Zealand Black; NZW, New Zealand White; NTA, natural thymocytotoxic autoantibodies; PE, phycoerythrin. Back

Received for publication July 22, 1997. Accepted for publication April 3, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Winfield, J. B.. 1987. Antilymphocyte antibodies: specificity, and relationship to abnormal cellular function. R. G. Lahita, ed. Systemic Lupus Erythematosus 305. John Wiley and Sons, New York.
  2. Shirai, T., S. Hirose, T. Okada, H. Nishimura. 1991. Immunology and immunopathology of the autoimmune disease of NZB and related mouse strains. B. Ríhová, and V. Vetvicka, eds. Immunological Disorders in Mice 95. CRC Press, Boston.
  3. Butler, W. T., J. T. Sharp, R. D. Rossen, M. D. Lidsky, K. K. Mittal, D. A. Gard. 1972. Relationship of the clinical course of systemic lupus erythematosus to the presence of circulating lymphocytotoxic antibodies. Arthritis Rheum. 15:231.
  4. Winfield, J. B., R. J. Winchester, H. G. Kunkel. 1975. Association of cold-reactive anti-lymphocyte antibodies with lymphopenia in systemic lupus erythematosus. Arthritis Rheum. 18:587.[Medline]
  5. Morimoto, C., E. L. Reinherz, J. A. Distaso, A. D. Steinberg, S. F. Schlossman. 1984. Relationship between systemic lupus erythematosus T cell subsets, anti-T cell antibodies, and T cell functions. J. Clin. Invest. 73:689.
  6. Dauphinée, M. J., S. B. Kipper, D. Wofsy, N. Talal. 1981. Interleukin 2 deficiency is a common feature of autoimmune mice. J. Immunol. 127:2483.[Abstract]
  7. Altman, A., A. N. Theofilopoulos, R. Weiner, D. H. Katz, F. J. Dixon. 1981. Analysis of T cell function in autoimmune murine strains: defects in production of and responsiveness to interleukin 2. J. Exp. Med. 154:791.[Abstract/Free Full Text]
  8. Nishimura, H., S. Hattori, G. Ueda, M. Abe, K. Yang, S. Nozawa, H. Okamoto, D. Zhang, H. Tsurui, S. Hirose, T. Shirai. 1995. Functional CD4+ T cell subsets defined by expression of CD45RC and NTA260 antigens and age-associated polarization in murine lupus. Int. Immunol. 7:1115.[Abstract/Free Full Text]
  9. Chu, E. B., D. N. Ernst, M. V. Hobbs, W. O. Weigle. 1994. Maturational changes in CD4+ cell subsets and lymphokine production in BXSB mice. J. Immunol. 152:4129.[Abstract]
  10. Nishimura, H., S. Hattori, M. Abe, G. Ueda, H. Okamoto, H. Tsurui, S. Hirose, T. Shirai. 1992. Differential expression of three CD45 alternative structures on murine T cells: exon 6-dependent epitope as a marker for functional heterogeneity of CD4+ T cells. Int. Immunol. 4:923.[Abstract/Free Full Text]
  11. Shirai, T., R. C. Mellors. 1971. Natural thymocytotoxic autoantibody and reactive antigen in New Zealand Black and other mice. Proc. Natl. Acad. Sci. USA 68:1412.[Abstract/Free Full Text]
  12. Shirai, T., R. C. Mellors. 1972. Natural cytotoxic autoantibody against thymocytes in NZB mice. Clin. Exp. Immunol. 12:133.[Medline]
  13. Auer, I. O., Jr T. B. Tomasi, F. Milgrom. 1974. Natural thymocytolytic autoantibodies in NZB and other strains of mice. Cell. Immunol. 10:404.[Medline]
  14. Bray, K. R., M. E. Gershwin, T. Chused, A. Ahmed. 1984. Characteristics of a spontaneous monoclonal thymocytotoxic antibody from New Zealand black mice: recognition of a specific NTA determinant. J. Immunol. 133:1318.[Abstract]
  15. Surh, C. D., M. E. Gershwin, A. Ahmed. 1987. A peripheral and central T cell antigen recognized by a monoclonal thymocytotoxic autoantibody from New Zealand Black mice. J. Immunol. 138:1421.[Abstract]
  16. Ohgaki, M., G. Ueda, J. Shiota, H. Nishimura, S. Hirose, H. Sato, T. Shirai. 1989. Two distinct monoclonal natural thymocytotoxic autoantibodies from New Zealand Black mouse. Clin. Immunol. Immunopathol. 53:475.[Medline]
  17. Shirai, T., K. Hayakawa, K. Okumura, T. Tada. 1978. Differential cytotoxic effect of natural thymocytotoxic autoantibody of NZB mice on functional subsets of T cells. J. Immunol. 120:1924.[Abstract/Free Full Text]
  18. Mimura, T., P. Fernsten, W. Jarjour, J. B. Winfield. 1990. Autoantibodies specific for different isoforms of CD45 in systemic lupus erythematosus. J. Exp. Med. 172:653.[Abstract/Free Full Text]
  19. Sanders, M. E., M. W. Makgoba, S. Shaw. 1988. Human naive and memory T cells: reinterpretation of helper-inducer and suppressor-inducer subsets. Immunol. Today 9:195.[Medline]
  20. Coffman, R. L.. 1982. Surface antigen expression and immunoglobulin gene rearrangement during mouse pre-B cell development. Immunol. Rev. 69:5.[Medline]
  21. Leo, O., M. Foo, D. H. Sachs, L. E. Samelson, J. A. Bluestone. 1987. Identification of a mAb specific for a murine T3 polypeptide. Proc. Natl. Acad. Sci. USA 84:1374.[Abstract/Free Full Text]
  22. Ceredig, R., J. W. Lowenthal, M. Nabholz, H. R. MacDonald. 1985. Expression of interleukin-2 receptors as a differentiation marker on intrathymic stem cells. Nature 314:98.[Medline]
  23. Ortega, R. G., R. J. Robb, E. M. Shevach, T. R. Malek. 1984. The murine IL-2 receptor. I Monoclonal antibodies that define distinct functional epitopes on activated T cells and react with activated B cells. J. Immunol. 133:1970.[Abstract]
  24. Ohara, J., W. E. Paul. 1985. Production of a mAb to and molecular characterization of B-cell stimulatory factor-1. Nature 315:333.[Medline]
  25. Oi, V. T., L. A. Herzenberg. 1980. Immunoglobulin-producing hybrid cell lines. B. B. Mishell, and S. M. Shiigi, eds. Selected Methods in Cellular Immunology 351. Freeman, San Francisco.
  26. Cherwinski, H. M., J. H. Schumacher, K. D. Brown, T. R. Mosmann. 1987. Two types of mouse helper T cell clone. III. Further differences in lymphokine synthesis between Th1 and Th2 clones revealed by RNA hybridization, functionally monospecific bioassays, and monoclonal antibodies. J. Exp. Med. 166:1229.[Abstract/Free Full Text]
  27. Mosmann, T. R., J. H. Schumacher, D. F. Fiorentino, J. Leverah, K. W. Moore, M. W. Bond. 1990. Isolation of monoclonal antibodies specific for IL-4, IL-5, IL-6, and a new Th-2-specific cytokine (IL-10), cytokine synthesis inhibitory factor, by using a solid phase radioimmunoadsorbent assay. J. Immunol. 145:2938.[Abstract]
  28. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Construction and analysis of cDNA libraries. In Molecular Cloning: A Laboratory Manual. 2nd Ed, Vol. 2. N. Irvin, N. Ford, C. Nolan, and M. Ferguson, eds. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, p. 8.3.
  29. Siegelman, M. H., M. van de Rijn, I. L. Weissman. 1989. Mouse lymph node homing receptor cDNA clone encodes a glycoprotein revealing tandem interaction domains. Science 243:1165.[Abstract/Free Full Text]
  30. Tamatani, T., K. Kuida, T. Watanabe, S. Koike, M. Miyasaka. 1993. Molecular mechanisms underlying lymphocyte recirculation. III Characterization of the LECAM-1 (L-selectin)-dependent adhesion pathway in rats. J. Immunol. 150:1735.[Abstract]
  31. Linsley, P. S., W. Brady, L. Grosmaire, A. Aruffo, N. K. Damle, J. A. Ledbetter. 1991. Binding of the B cell activation antigen B7 to CD28 costimulates T cell proliferation and interleukin 2 mRNA accumulation. J. Exp. Med. 173:721.[Abstract/Free Full Text]
  32. Laemmli, U. K.. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680.[Medline]
  33. Bainbridge, D. R., G. Gowland. 1966. Detection of homograft sensitivity in mice by the elimination of chromium-51 labeled lymph node cells. Ann. NY Acad. Sci. 129:257.
  34. Kishimoto, T. K., M. A. Jutila, E. L. Berg, E. C. Butcher. 1989. Neutrophil Mac-1 and Mel-14 adhesion proteins inversely regulated by chemotactic factors. Science 245:1238.[Abstract/Free Full Text]
  35. Gallatin, W. M., I. L. Weissman, E. C. Butcher. 1983. A cell-surface molecule involved in organ-specific homing of lymphocytes. Nature 304:30.[Medline]
  36. Croft, M., L. M. Bradley, S. L. Swain. 1994. Naive vs memory CD4 T cell response to antigen: memory cells are less dependent on accessory cell costimulation and can respond to many antigen-presenting cell types including resting B cells. J. Immunol. 152:2675.[Abstract]
  37. Lasky, L. A., M. S. Singer, T. A. Yednock, D. Dowbenko, C. Fennie, H. Rodriguez, T. Nguyen, S. Stachel, S. D. Rosen. 1989. Cloning of a lymphocyte homing receptor reveals a lectin domain. Cell 56:1045.[Medline]
  38. Bowen, B. R., C. Fennie, L. A. Lasky. 1990. The Mel-14 antibody binds to the lectin domain of the murine peripheral lymph node homing receptor. J. Cell Biol. 110:147.[Abstract/Free Full Text]
  39. Bradley, L. M., G. G. Atkins, S. L. Swain. 1992. Long-term CD4+ memory T cells from the spleen lack Mel-14, the lymph node homing receptor. J. Immunol. 148:324.[Abstract]
  40. Shortman, K., A. Wilson, W. Van Ewijk, R. Scollay. 1987. Phenotype and localization of thymocytes expressing the homing receptor-associated antigen MEL-14: arguments for the view that most mature thymocytes are located in the medulla. J. Immunol. 138:342.[Abstract]
  41. Mosmann, T. R., K. W. Moore. 1991. The role of IL-10 in crossregulation of TH1 and TH2 responses. Immunol. Today 12:A49.[Medline]
  42. Croft, M., D. D. Duncan, S. L. Swain. 1992. Response of naive antigen-specific CD4+ T cells in vitro: characteristics and antigen-presenting cell requirements. J. Exp. Med. 176:1431.[Abstract/Free Full Text]
  43. Croft, M.. 1994. Activation of native, memory and effector T cells. Curr. Opin. Immunol. 6:431.[Medline]
  44. Andris, F., M. Van Mechelen, F. De Mattia, E. Baus, J. Urbain, O. Leo. 1996. Induction of T cell unresponsiveness by anti-CD3 antibodies occurs independently of co-stimulatory functions. Eur. J. Immunol. 26:1187.[Medline]
  45. Imai, Y., M. S. Singer, C. Fennie, L. A. Lasky, S. D. Rosen. 1991. Identification of a carbohydrate-based endothelial ligand for a lymphocyte homing receptor. J. Cell Biol. 113:1213.[Abstract/Free Full Text]
  46. Lasky, L. A., M. S. Singer, D. Dowbenko, Y. Imai, W. J. Henzel, C. Grimley, C. Fennie, N. Gillett, S. R. Watson, S. D. Rosen. 1992. An endothelial ligand for L-selectin is a novel mucin-like molecule. Cell 69:927.[Medline]
  47. Shirai, T., T. Yoshiki, R. C. Mellors. 1972. Age-decrease of cells sensitive to an autoantibody-specific for thymocytes and thymus-dependent lymphocytes in NZB mice. Clin. Exp. Immunol. 12:455.[Medline]
  48. Shirai, T., T. Yoshiki, R. C. Mellors. 1973. Effects of natural thymocytotoxic autoantibody of NZB mice and of specifically prepared antilymphocyte serum on the tissue distribution of 51Cr-labeled lymphocytes. J. Immunol. 110:517.[Abstract/Free Full Text]
  49. Sekigawa, I., T. Okada, K. Noguchi, G. Ueda, S. Hirose, H. Sato, T. Shirai. 1987. Class-specific regulation of anti-DNA antibody synthesis and the age-associated changes in (NZB x NZW)F1 hybrid mice. J. Immunol. 138:2890.[Abstract]
  50. Bocchieri, M. H., A. Cooke, J. B. Smith, M. Weigert, R. J. Riblet. 1982. Independent segregation of NZB immune abnormalities in NZB x C58 recombinant inbred mice. Eur. J. Immunol. 12:349.[Medline]
  51. Lehuen, A., A. Bendelac, J.-F. Bach, C. Carnaud. 1990. The nonobese diabetic mouse model. Independent expression of humoral and cell-mediated autoimmune features. J. Immunol. 144:2147.[Abstract]
  52. Yoshida, H., A. Kohno, K. Ohta, S. Hirose, N. Maruyama, T. Shirai. 1981. Genetic studies of autoimmunity in New Zealand mice. III. Association among anti-DNA antibodies, NTA, and renal disease in (NZB x NZW)F1 x NZW backcross mice. J. Immunol. 127:433.[Medline]
  53. Hirose, S., H. Tsurui, H. Nishimura, Y. Jiang, T. Shirai. 1994. Mapping of a gene for hypergammaglobulinemia to the distal region on chromosome 4 in NZB mice and its contribution to systemic lupus erythematosus in (NZB x NZW)F1 mice. Int. Immunol. 6:1857.[Abstract/Free Full Text]
  54. Jiang, Y., S. Hirose, Y. Hamano, S. Kodera, H. Tsurui, M. Abe, K. Terashima, S. Ishikawa, T. Shirai. 1997. Mapping of a gene for the increased susceptibility of B1 cells to Mott cell formation in murine autoimmune disease. J. Immunol. 158:992.[Abstract]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hattori, S.
Right arrow Articles by Shirai, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hattori, S.
Right arrow Articles by Shirai, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS