| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1
*
Department of Microbiology and Immunology, University of Adelaide, North Terrace, Adelaide, South Australia, Australia; and
Centre de Recherche en Rhumatologie et Immunologie, Centre de Recherche du Centre Hospitalier de l’Université Laval (CHUL), Ste-Foy, Quebec, Canada;
Pfizer Central Research, Groton, CT 06340; and
§
Biomedical Research Center, University of British Columbia, Vancouver, British Columbia, Canada
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and
the chemokines macrophage inflammatory protein-2 (MIP-2), MIP-1, and
JE in the pouch exudate. In addition, pretreatment of mice with
Abs raised against ICAM-1, TNF-, MIP-2, MIP-1, KC, or
JE inhibited leukocyte accumulation induced by SEA. These data
demonstrate that bacterial superantigens may promote inflammation at
extravascular sites in vivo, and that this response is secondary to the
generation of inflammatory mediators, including
chemokines. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IL-1ß.
ICAM-1, an Ig superfamily member, is involved in the third step of
leukocyte extravasation (1, 2). ICAM-1 is broadly expressed in response
to proinflammatory cytokines such as IL-1ß, TNF-, and IFN-
(5).
By binding to its counter-receptors, LFA-1 and Mac-1, ICAM-1 has been
shown to mediate adhesion of leukocytes to endothelial cells (1, 2).
While ICAM-1 expression cannot be detected at significant levels in
normal tissue, increased expression has been correlated with
accumulation of leukocytes at extravascular sites under pathologic
conditions. For instance, ICAM-1 has been observed in synovial tissues
from patients suffering from rheumatoid arthritis (6) as well as in
delayed hypersensitivity reactions (7) and on vascular endothelium
during graft rejection (8).
Bacterial enterotoxins secreted by certain Gram-positive bacteria show pathogenic effects in humans and animals (9). To date, several toxins secreted by Staphylococcus aureus (SEA,3 B, C1, C2, C3, D, and E) have been identified (10). They induce vomiting and diarrhea when ingested at submicrogram levels as well as toxic shock, a systemic response to infectious agents (9). Another toxin produced by some isolates of S. aureus, toxic shock syndrome toxin-1, also causes systemic toxic shock (10). These proteins are also referred to as superantigens because of their ability to stimulate the proliferation of large numbers of T lymphocytes (9, 10). They bind to both MHC class II molecules and specific Vß segments of the TCR, leading to the activation of both APCs and T lymphocytes (9, 10). This activation is associated with the release of cytokines such as IL-6 and IL-8 as well as with the stimulation of adhesion through activation of integrins (11).
Recent studies have suggested a role for the proinflammatory cytokine
TNF- and the adhesion molecule ICAM-1 in toxic shock syndrome
induced by superantigens. Passive immunization of mice with Abs raised
against TNF- results in a diminution of the severity of the toxic
shock (12). A second study using ICAM-1-deficient mice demonstrated
that ICAM-1 expression was necessary for toxic shock to occur (13).
Finally, prior work has shown that superantigens induce chemokine gene
expression in synovial fibroblasts in vitro (14). Since ICAM-1,
TNF-, and chemokines are critically involved in leukocyte
extravasation in acute inflammatory responses, we have investigated the
ability of superantigens derived from S. aureus to induce a
localized inflammatory reaction in vivo using the s.c. air pouch model
in the mouse. Our results indicate for the first time that the
superantigens SEA and SEB induce leukocyte accumulation at
extravascular sites in vivo and that this response is dependent at
least in part on the expression of TNF-, ICAM-1, and chemokines.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Six- to eight-week-old male BALB/c mice were obtained from the
Central Animal House at the University of Adelaide (Adelaide,
Australia). Air pouches were raised on the dorsum by s.c. injections of
2.5 ml of sterile air on days 0 and 3 as previously described (15). All
experiments were conducted on day 6 as previously described (16, 17).
Recombinant murine (mu) TNF- was obtained from R&D Systems
(Minneapolis, MN). SEA and SEB were obtained from three separate
sources. They were affinity purified from recombinant protein produced
in Escherichia coli as previously described (18), they were
produced in E. coli using the pTrc-histidine tag system and
purified according to the manufacturer’s protocol (Invitrogen, San
Diego, CA), or they were purchased from Toxin Technology (Madison, WI)
or Sigma (St. Louis, MO) as purified protein from S. aureus.
SE preparations contained <0.001% (wt/wt) endotoxin as determined by
the COATEST endotoxin assay (Kabi Pharmacia Diagnostics, Piscataway,
NJ). The hybridoma RB6-8C5, secreting an anti-neutrophil Ab) was a
gift from Dr. P. Hodgkin (Division of Cell Biology, The John Curtin
School of Medical Research, Canberra, Australia). Rat monoclonal
anti-mTNF- Abs and a rabbit polyclonal Ab raised against
muTNF- were gifts from Dr. Janet Ruby (Division of Cell Biology, The
John Curtin School of Medical Research). The hybridomas P3X63Ag8 (19)
(TIB 3), GK1-5 (20) (TIB 207, anti-CD4), 53-6.7 (21) (TIB 105,
anti-CD8), F4/80 (22) (HB 198, anti-monocyte), and YN1/1.7.4
(23) (CRL 1878, anti-muICAM-1) were obtained from the American Type
Culture Collection (Rockville, MD). All other reagents were obtained
from the Sigma-Aldrich (Castle Hill, Australia). The anti-chemokine
Abs used in this study were either purchased or raised in rabbits using
N-terminus peptides. The resultant polyclonal antisera were tested for
cross-reactivity against other chemokines (JE, MIP-2, KC,
MIP-1, MIP-1ß, RANTES, C10, TCA-3, and lymphotactin) in direct
ELISA and Western blot. No cross-reactivity was observed. Full-length
synthetic murine chemokines were chemically synthesized as previously
described (24).
Superantigen-induced leukocyte migration
On day 6, air pouches were injected with increasing
concentrations of SEA and SEB dissolved in 1 ml of PBS. At given times,
the mice were euthanized by asphyxiation using CO2, the air
pouches were washed once with 1 ml of PBS, then twice with 2 ml of PBS,
and the cells were centrifuged at 100 x g for 10 min
at room temperature. The supernatants were removed, and the pelleted
cells were resuspended in PBS, stained in Turk’s solution, and
counted. Two hundred thousand cells were centrifuged on microscope
slides at 500 rpm for 5 min using a cytospin centrifuge. The slides
were air-dried, then stained with Diff-Quik (Sigma, St. Louis,
MO) to allow quantitation of the granulocyte and mononuclear leukocyte
subpopulations. In selected experiments, mice were injected i.p. on day
5 with 1 ml of a solution containing 100 µg/ml of purified mAbs
against either ICAM-1 or TNF-, or 200 µg of IgG-purified
polyclonal Ab against TNF-, JE, MIP-2, MIP-1 or KC. On day 6, air
pouches were injected with 1 ml of either PBS or 10 µg/ml of SEA, the
exudates were collected, and the number of cells present were
quantified 6 h after injection as described above.
Immunohistochemistry
Pouch lining tissue was collected and processed for immunohistochemical assessment of ICAM-1 in the tissue. Identification of ICAM-1-positive cells was achieved by indirect immunoperoxidase staining using the hybridoma YN1/1.7.4. Briefly, the tissues were placed in OCT compound and snap-frozen using isopentane. Five-micron sections were cut using a Bright cryostat (Bright, Huntingdon, U.K.). The tissue sections were isolated using a water repellent solution (PAP pen, Zymed, San Francisco, CA) and fixed in ice-cold 96% ethanol for 10 min. This was followed by washing four times in PBS (2 min each wash). Sections were dipped in PBS containing 1% BSA to block nonspecific binding and to help prevent excessive drying out of the section. Primary Ab (30 µl with 10% normal mouse serum) was then added and incubated for 1 h at 4°C. Sections were then washed three times with PBS as described above, and after a second dip in BSA, secondary Ab (30 µl, 1/200 dilution of sheep anti-rat biotin with 10% normal mouse serum) was added and incubated for 1 h at 4°C. Sections were washed three times with PBS and again dipped in PBS containing 1% BSA. Thirty microliters of streptavidin-HRP conjugate was added and incubated at 4°C for 1 h. This was followed by three washes in PBS and incubation for 10 min with filtered solution of diaminobenzidine (5 mg in 10 ml of 0.05 M Tris) plus 200 µl of 1% H2O2. The slides were then washed three times in PBS before counterstaining.
TNF- ELISA
On day 6, 1 ml of a solution of 10 µg/ml of SEA diluted in PBS
or 1 ml of PBS was injected into the air pouches. At given times, the
air pouches was washed once with 1 ml of PBS, then twice with 2 ml of
PBS. The exudates were centrifuged at 100 x g for 10
min to remove migrating leukocytes. A TNF- ELISA was performed on
the supernatants as specified by the manufacturer (Endogen, Cambridge,
MA). The sensitivity limit of the assay was 35 pg/ml.
Chemokine ELISAs
The levels of MIP-2 and MIP-1 in pouch supernatants were
quantified by an in-house sandwich ELISA as follows. Microtiter plate
wells were coated with 0.1 µg/well of commercially available goat
anti-mouse MIP-2 or MIP-1 (R&D Systems) in carbonate buffer (pH
9.5) overnight at 4°C or for 6 h at 37°C. The wells were
washed three times (PBS/Tween) and blocked by incubation with a
solution of PBS containing 3% BSA for 1 h at 37°C. The wells
were again washed three times, and standards (0.019–2.5 ng/ml) or
pouch supernatants were then added and incubated for 90 min at 37°C.
The wells were washed three times, and secondary Abs (rabbit
anti-mouse MIP-2 or MIP-1) were added at final dilutions of
1/3000 and 1/1000, respectively, and incubated for 1 h at 37°C.
The wells were then washed three times in PBS/Tween, and a biotinylated
sheep anti-rabbit IgG was added (1/10,000 final dilution/well) and
incubated for 45 min at room temperature. The wells were washed an
additional three times, and 100 µl/well of a 1/1000 dilution of
streptavidin peroxidase conjugate was added and incubated at room
temperature for 30 min. The wells were then washed three times, and
substrate was added. The reactions were stopped after 5 min by the
addition of 50 µl of 3 M HCl, and the absorbance was read at 490 nm.
Standard curves were generated, and values were extrapolated from
the standard curve using the curve-fitting function on Prism (GraphPad
Software, San Diego, CA). The secondary Abs used in these ELISAs were
made by immunizing rabbits with full-length synthetic muMIP-2 or
muMIP-1. No cross-reactivity for either Ab in ELISA was observed
with any other chemokine tested, including KC, MGSA, murine or human
RANTES, murine eotaxin, muMIP-2, or mMIP-1, murine or human MCP-1,
IL-8, or human MIP-1ß. Levels of JE were determined as previously
described (25).
Passive immunization with Abs
Passive immunization was achieved by injecting 200 µg/ml of
IgG-purified rabbit anti-TNF-, rabbit anti-MIP-2, rabbit
anti-MIP-1, rabbit anti-JE, or rabbit anti-KC or the
equivalent amount of Ig purified from the serum of a naive rabbit into
the peritoneal cavity of mice the evening before injection of the
superantigens into the air pouch. Passive immunization with mAbs was
achieved by injecting 100 µg/ml of IgG-purified rat anti-TNF-,
rat anti-ICAM-1, or rat anti-P3X63Ag8 the evening before
injection of the superantigens into the air pouch.
Assessment of chemokine expression by comparative PCR
Total RNA from exudate cells or pouch lining tissues collected at different times after injection of SEA were purified essentially as previously described (26, 27, 28). Briefly, tissue samples were homogenized using a tissue grinder in 2 ml of RNAzol B before addition of 200 µl of chloroform. The mixture was vortexed for 1 min and placed at 4°C for 5 min before being centrifuged at 13,000 x g for 15 min at 4°C. The aqueous layer was then mixed with an equal volume of isopropanol and incubated at 4°C for 15 min before being centrifuged at 13,000 x g for 15 min at 4°C. The supernatant was discarded, and the RNA pellet was dried, then solubilized in diethylpyrocarbonate-treated H2O. Equal amounts of RNA, as determined spectrophotometrically and confirmed by dot blot assay, were reverse transcribed to cDNA, which was used as a template for PCR reactions as previously described (29). Briefly, 10 µg of total RNA diluted in 45 µl of a solution of 1% diethylpyrocarbonate in ddH2O was heated at 65°C for 10 min. The RT reaction was then performed for 90 min at 37°C in 80 µl of a solution of 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 15 mM MgCl2, 0.01 M DTT, 0.66 µM random hexamer primers, 0.66 µM oligo(dT)12–18 primers, 1 mM deoxyribonucleotides, 0.35 U/µl RNAsin, and 1 U/µl Moloney murine leukemia virus reverse transcriptase. The reaction was stopped by heating the mixture at 95°C for 5 min.
The comparative PCR assays were performed as previously described (29).
Briefly, 5 µl of reverse transcribed RNA was added to a solution to
obtain a final concentration of 50 mM KCl, 10 mM Tris-HCl (pH 9.0),
0.1% Triton X-100, 0.2 mM deoxyribonucleotides, 0.5 mM
MgCl2, 0.05 U/ml of Taq polymerase, and 1 pmol/µl each of
sense and antisense specific primers. The primer sequences are as
follows: MIP-2f, ccgctgttgtggccagtgaactgcg; MIP-2r,
ttagccttgcctttgttcagtat; KCf, ccgcgcctatcgccaatgagctgcgc; KCr,
cttggggacaccttttagcatcttttgg; JEf, cccagccagatgcagtta-acgccccact;
JEr, ttcactgtcacactggtcactc; MIP-1f, caccctctgtcacctgctcaacatc;
MIP-1r, ggttcctcgctgcctccaagactct; GAPDHf, tccttggaggccatgtaggccat;
and GAPDHr, tgatgacatcaag-aaggtggtgaag. The sequence of PCR
amplification was one cycle of denaturation at 95°C for 2 min,
followed by annealing at 56°C for 30 s and extension at 72°C
for 1 min. This cycle was followed by 30 s at 95°C, 30 s at
56°C, and 1 min at 72°C, repeated 38 times. The PCR reaction was
sampled every five cycles from cycles 25 to 40 inclusively. The samples
were migrated on a 2% agarose gel, stained with ethidium bromide, and
compared for intensity.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Air pouches were raised on the backs of mice as described in
Materials and Methods, injected with 1 ml of either
SEA or SEB (both at 10 µg/ml final concentration), or their diluent
(PBS), and the exudate cells were collected at different periods (Fig. 1
A). This concentration of the
superantigens was chosen from the results of previous in vitro studies
(14). Few cells were found in the pouch exudate when PBS was injected
alone. However, both SEA and SEB induced an accumulation of leukocytes,
which was first detectable within 3 h following injection and was
at maximal levels at 6 h postinjection. The number of cells in the
pouch fluid decreased after 6 h, although the effect of the
superantigens was still apparent after 24 h. The response to SEA
was consistently greater than that to SEB, as demonstrated by
dose-response experiments (Fig. 1B). Over a series of five
separate experiments, SEA and SEB consistently induced an accumulation
of leukocytes in the pouch exudate that was significantly greater than
control levels (Fig. 1C).
|
A), with a small
percentage of eosinophils. Upon stimulation with SEA, the relative
percentages of the three cell populations altered. The percentage of
neutrophils increased significantly compared with the control value,
whereas the percentage on mononuclear phagocytes and eosinophils
decreased significantly. When the total number of each of these cell
populations was calculated, it was apparent that SEA induced a
significant increase in the levels of all three leukocyte populations
(Fig. 2B). No lymphocytes were detected at any given time
point in either the pouch tissue or the exudate cells as determined by
immunohistochemistry on pouch tissue or flow cytometry on pouch exudate
cells using anti-CD4 and anti-CD8 Abs (not shown).
|
in leukocyte recruitment to the air pouch in
response to superantigens
To examine the potential role of TNF- in leukocyte accumulation
induced by superantigens, pouch exudates were analyzed for the presence
of TNF-. Injection of SEA induced a rapid, transient accumulation of
TNF- in the air pouch, with a maximal level of 500 pg/ml detected 15
min after injection (Fig. 3). TNF-
levels in air pouches decreased after 30 min, returning to undetectable
levels 1 h after injection of SEA. These levels remained
undetectable for up to 48 h postinjection (data not shown). To
further characterize the role of TNF- in superantigen-induced
leukocyte accumulation, mice were injected i.p. with 100 µg of
purified anti-muTNF- monoclonal or 200 µg of purified
polyclonal or control Abs 24 h before experimentation. Air pouches
were then injected with either 1 ml of PBS or 1 ml of 10 µg/ml SEA
for 6 h, the pouch exudate was collected, and the number of cells
present was determined. Pretreatment with the anti-TNF- Abs had
no significant effect on the background level of leukocytes in the
pouch exudate (Fig. 4). In contrast,
leukocyte accumulation induced by SEA was inhibited by >70% by
pretreatment with either Ab.
|
|
Since ICAM-1 has been shown to contribute to almost 90% of the
adhesion of neutrophils to endothelial cells (30) and its expression
can be stimulated by TNF- (1, 2), we examined the potential
involvement of ICAM-1 in SEA-induced leukocyte migration. ICAM-1
expression was weak in unstimulated pouch lining tissue as well as on
blood vessels in the tissue surrounding the pouch (data not shown).
However, injection of SEA resulted in a detectable increase in ICAM-1
surface expression on the cells lining the pouch and on endothelial
cells in the tissue surrounding the air pouch (data not shown). To
evaluate the role of ICAM-1 in leukocyte migration, mice were injected
i.p. with 100 µg of purified anti-muICAM-1 or control mAb 24
h before the injection of either PBS or SEA. Six hours following the
injection of the agonists, the pouch exudate was collected, and the
number of cells present was determined (Fig. 5). No significant difference in the
accumulation of cells in response to PBS was observed between mice
injected with the Ab directed against ICAM-1 or an isotype-matched
control. In contrast, pretreatment of mice with the anti-ICAM-1 Ab
resulted in an inhibition of >65% of leukocyte accumulation in
response to SEA. In addition, prior treatment of the mice with the
anti-ICAM-1 Ab significantly inhibited leukocyte accumulation in
the pouch exudate in response to TNF-.
|
generation in response to
SEA
To further define the role of the mediators involved in leukocyte
recruitment in response to SEA, mice were pretreated with
anti-ICAM-1 Abs, SEA was injected in to the air pouches for either
30 min or 6 h, the number of leukocytes accumulating was assessed,
and the exudate fluid was analyzed for TNF- content. As shown in
Figure 5
, anti-ICAM-1 treatment significantly inhibited the
recruitment of leukocytes at 6 h postinjection of SEA. No TNF-
was detected in any of the exudates at this time point (data not
shown). While no leukocytes were detected in the exudate at 30 min
poststimulation (see Fig. 1A), SEA induced the accumulation
of immunoreactive TNF- at this point (Figs. 3 and 6). However, anti-ICAM-1 pretreatment
had no effect on the level of TNF- accumulating in the pouch exudate
in response to SEA (Fig. 6).
|
Leukocyte recruitment to extravascular sites of inflammation also
involves the actions of chemotactic factors such as chemokines.
Therefore, another series of experiments was performed to determine
whether chemokines are involved in the induction of acute inflammation
by SEA. The levels of MIP-2 (known to be chemotactic for neutrophils)
(31) and MIP-1 and JE (known to be chemotactic for mononuclear
cells) (32, 33) in the pouch exudate fluid were determined by specific
ELISA. Air pouches were injected with PBS or 10 µg of SEA, and the
exudates were collected at different time points. Injection of PBS did
not increase the level of any of the three chemokines (Fig. 7). In contrast, injection of SEA
resulted in a time-dependent increase in the levels of all three
chemokines. The expressions of MIP-2 and MIP-1 were rapid and
transient. JE expression was of a greater magnitude and lasted longer
than that for either MIP-2 or MIP-1. The level of immunoreactive KC
(also known to be chemotactic for neutrophils (34)) was not assessed
due to lack of reagents suitable for the ELISA.
|
, and JE. Expression of mRNA for MIP-2
and MIP-1 in the pouch lining tissue was clearly increased following
injection of SEA (Fig. 8). JE and KC mRNA
were also increased to a minor extent. To ensure equal amounts of
starting material, the housekeeping gene GAPDH was subjected to PCR. No
difference was observed between PBS- and SEA-stimulated pouch lining
tissue with respect to GAPDH expression.
|
, or JE or with Igs purified from preimmune serum on
the evening before induction of inflammation with SEA (Fig. 9). The exudate cells were collected
6 h postinjection and counted. The response to SEA was
significantly inhibited by each of the anti-chemokine Abs, whereas
the control Igs had no detectable effect on the ability of SEA to
induce leukocyte recruitment. The inhibition of leukocyte recruitment
was observed equally at the levels of neutrophil, eosinophil, and
mononuclear phagocyte recruitment (data not shown). The results of
these experiments clearly show that injection of SEA induces the
expression of these chemokines in vivo, and that their expression is
required for leukocyte recruitment to occur in response to SEA.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and the chemokines MIP-2, KC, MIP-1,
and JE. Of further interest was the observation that T cells, which are
believed to be a major target of superantigens, were not detected in
either tissue surrounding the air pouch or in the pouch exudate. In a
separate study (35a), using a range of T cell-deficient mice, we have
determined that T cells are not required for this s.c. inflammatory
response.
In the present study we investigated the molecular mechanism by which
SEA induces inflammation at this extravascular site. Numerous studies
in our laboratory and others have failed to show a direct effect of
superantigens on neutrophils (data not shown) (35). Moreover, the time
course for the recruitment of neutrophils following injection of the
superantigens was relatively slow compared with that of direct
injection of TNF- or zymosan, in which case maximum recruitment was
observed within 2 and 3 h of injection, respectively (data not
shown). Taken together, these observations suggested that the
inflammatory effect observed in response to superantigens was probably
indirect. Since TNF- is an important effector molecule in acute
inflammation, and its expression has been linked to
superantigen-induced toxic shock syndrome (36), we examined the
hypothesis that SEA could be inducing TNF- gene expression, which,
in turn, leads to leukocyte recruitment. The results of our experiments
showed clearly that administration of superantigens into the air pouch
led to a rapid, transient accumulation of immunoreactive TNF-.
Finally, prior treatment of mice with neutralizing Abs against TNF-
effectively inhibited leukocyte recruitment to the air pouch. These
observations are consistent with a role for TNF- as a secondary
mediator of superantigen-induced leukocyte accumulation in vivo.
However, the fact that leukocyte accumulation was not completely
inhibited by the Abs against TNF- suggests that other
proinflammatory mediators are likely to be involved in the inflammatory
response induced by SEA. Two good candidates as secondary mediators are
IL-1ß and IL-6, which, like TNF-, are induced by SEA in vitro (11, 14).
Expression of TNF- mRNA, as determined by RT-PCR, was also observed
in both the tissue surrounding the air pouch and in the pouch exudate
cell population (data not shown), although the kinetics of this
response suggest that the immunoreactive TNF- observed is
presynthesized and released from resident cells. This is further
supported by the results of our experiments, which indicated that
anti-ICAM-1 Abs did not inhibit the rapid accumulation of TNF-,
suggesting that accumulation of leukocytes is not required for the
production of TNF-.
To gain access to inflammatory sites, leukocytes must adhere to and
migrate through the endothelium. This process involves, among other
things, expression of adhesion proteins on the surface of both
leukocytes and endothelial cells (1, 2). One of the best characterized
proteins involved in this process, particularly with respect to
neutrophil extravasation, is ICAM-1 (1, 2). This adhesion molecule is
expressed by a wide variety of cells, including fibroblasts and
endothelial cells stimulated by TNF-, IL-1ß, IFN-, or LPS (19).
The results of the present study provide clear evidence for an
important role for ICAM-1 in the recruitment of leukocytes in response
to superantigens. ICAM-1 expression, as determined by
immunohistochemistry on pouch lining tissue and by RT-PCR (data not
shown), was increased following injection of superantigens into the air
pouch, and prior treatment of the animals with a neutralizing mAb
against ICAM-1 significantly reduced the extent of leukocyte
recruitment into the air pouch. However, as observed with TNF-,
pretreatment of mice with the anti-ICAM-1 Ab failed to completely
inhibit leukocyte migration induced by SEA, suggesting the involvement
of other adhesion molecules in the neutrophil and monocyte migratory
processes. VCAM-1 or PECAM-1, which have been shown to
be involved in neutrophil and monocyte adhesion to endothelial cells
are possible candidates for this role (37, 38). In the present study,
increased VCAM-1 and PECAM-1 gene expression, as determined by
RT-PCR was observed in air pouch tissues (P. A. Tessier and
S. R. McColl, unpublished observations), confirming a recent
report that SEB induced an increase in the expression of VCAM-1 and
P-selectin, in addition to ICAM-1, in lung tissue (39). Another
possible explanation for the lack of complete inhibition is that the Ab
used in this study failed to inhibit the interaction between ICAM-1 and
either LFA-1 or Mac-1. Since human ICAM-1 is known to bind to its two
counter-receptors (LFA-1 and Mac-1) via two distinct binding sites
(40), it is possible that the Ab used in this study failed to inhibit
the interaction of one of the two ICAM-1 counter-receptors to the
ICAM-1 molecule.
The abilities of anti-MIP-2 and anti-KC Abs to inhibit
neutrophil recruitment in response to SEA are in keeping with the
results of previous work demonstrating that injection of these
chemokines or their human homologues into either skin or the peritoneal
cavity results in neutrophil accumulation (31, 34, 41), and are
consistent with results obtained from mice deficient in the mIL-8R
homologue (a receptor for KC and MIP-2), in which recruitment of
neutrophils into the peritoneal cavity in response to inflammatory
stimulation was significantly impaired (42). In addition, recent data
indicate that mice expressing KC in a tissue-specific manner exhibit
increased accumulation of neutrophils in those tissues (43). The
ability of anti-MIP-1 and anti-JE Abs to inhibit neutrophil
recruitment in response to SEA demonstrates that both MIP-1 and JE,
two C-C chemokines, are involved in neutrophil recruitment in the air
pouch in response to SEA. The results of previous studies using
neutralizing antisera against MIP-1 indicate that endogenous
MIP-1 is involved in neutrophil recruitment to the lung in a murine
model of endotoxemia (44); however, to date, there is no evidence, in
vitro or in vivo, to suggest that JE is a chemotactic factor for
neutrophils. Indeed, while leukocyte recruitment into the air pouch is
observed in response to MIP-2 and KC, neither MIP-1 nor JE induces
detectable accumulation of leukocytes into the air pouch even at
concentrations as high at 10 µg/ml (17). These results suggest that
C-C chemokines are necessary, but not sufficient, to induce neutrophil
recruitment in vivo. Further examination of the involvement of MIP-1
and JE in neutrophil recruitment in the air pouch was undertaken by
assessing the abilities of the different Abs used in the present study
to inhibit MIP-2-induced neutrophil recruitment. Pretreatment of mice
with anti-JE Abs inhibited the recruitment of neutrophils into s.c.
air pouches in response to MIP-2 to the same extent as did
anti-MIP-2 Abs (data not shown). In contrast, under the same
circumstances, neither anti-KC, anti-MIP-1, nor
anti-RANTES Abs affected neutrophil recruitment in response to
MIP-2 (data not shown). KC and MIP-2 share 67.1% identity at the amino
acid level compared with 20.5% for MIP-2 and JE (ClustalW analysis).
It is therefore unlikely that the ability of anti-JE Abs to inhibit
MIP-2-induced neutrophil recruitment is due to cross-reactivity.
Moreover, no evidence of cross-reactivity between MIP-2 and anti-JE
(or other chemokines or anti-chemokines) was observed in either
Western blot or direct ELISA, indicating that MIP-2 does not bind to
anti-JE Abs (data not shown). Finally, recent studies have shown
that pretreatment with anti-JE Abs inhibits neutrophil accumulation
in the s.c. air pouch in response to TNF- (17) and in the peritoneal
cavity in response to LPS and zymosan (45). In the former study, the
same anti-JE Abs as those employed in the present study were used,
whereas in the latter, a commercial Ab was used. Taken together, these
observations suggest that the CC chemokines MIP-1 and JE contribute
indirectly to neutrophil recruitment, albeit through different
mechanisms. Of relevance is the previous observation that human MCP-1
can amplify the production of IL-1ß and TNF- by
monocyte/macrophages (46).
It is generally considered that superantigens are molecules of bacterial and viral origins that may subvert the immune system to their own ends by skewing the T cell repertoire. However, the results in the present manuscript demonstrate that the S. aureus-derived superantigens SEA and SEB elicit an acute inflammatory response in tissue. Taking the view that inflammation is beneficial in fighting infection, the results of this study suggest that not all pharmacologic effects of these superantigens are necessarily of detriment to the host. Future studies in the air pouch system should further delineate the mechanism(s) involved in leukocyte recruitment as well as the overall biologic significance of this inflammatory response in the context of superantigen-mediated pathology.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Shaun R. McColl, Molecular Inflammation, Department of Microbiology and Immunology, University of Adelaide, Adelaide, South Australia 5005, Australia.
3 Abbreviations used in this paper: SEA, staphylococcal enterotoxin A; SEB, staphylococcal enterotoxin B; mu, murine; MIP, macrophage inflammatory protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PECAM, platalet endothelial cell adhesion molecule 1.
Received for publication May 9, 1997. Accepted for publication April 1, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
: tissue distribution, biochemistry and function of a natural adherence molecule (ICAM-1). J. Immunol. 137:245.[Abstract]
. J. Exp. Med. 176:593. (MIP-1) and MIP-1ß chemokines attract distinct populations of lymphocytes. J. Exp. Med. 177:1821. mediates lung leukocyte recruitment, lung capillary leak, and early mortality in murine endotoxemia. J. Immunol. 155:1515.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  O. Dauwalder, D. Thomas, T. Ferry, A.-L. Debard, C. Badiou, F. Vandenesch, J. Etienne, G. Lina, and G. Monneret Comparative inflammatory properties of staphylococcal superantigenic enterotoxins SEA and SEG: implications for septic shock J. Leukoc. Biol., October 1, 2006; 80(4): 753 - 758. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. P. Gladue, S. H. Cole, M. L. Roach, L. A. Tylaska, R. T. Nelson, R. M. Shepard, J. D. McNeish, K. T. Ogborne, and K. S. Neote The Human Specific CCR1 Antagonist CP-481,715 Inhibits Cell Infiltration and Inflammatory Responses in Human CCR1 Transgenic Mice. J. Immunol., March 1, 2006; 176(5): 3141 - 3148. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. R. Teixeira, M. J. Teixeira, R. B. B. Gomes, C. S. Santos, B. B. Andrade, I. Raffaele-Netto, J. S. Silva, A. Guglielmotti, J. C. Miranda, A. Barral, et al. Saliva from Lutzomyia longipalpis Induces CC Chemokine Ligand 2/Monocyte Chemoattractant Protein-1 Expression and Macrophage Recruitment J. Immunol., December 15, 2005; 175(12): 8346 - 8353. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. D. L. Ramos, C. Canetti, J. T. Souto, J. S. Silva, C. M. Hogaboam, S. H. Ferreira, and F. Q. Cunha MIP-1{alpha}[CCL3] acting on the CCR1 receptor mediates neutrophil migration in immune inflammation via sequential release of TNF-{alpha} and LTB4 J. Leukoc. Biol., July 1, 2005; 78(1): 167 - 177. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. F. Franco-Penteado, I. A. De Souza, E. A. Camargo, S. A. Teixeira, M. N. Muscara, G. De Nucci, and E. Antunes Mechanisms Involved in the Enhancement of Allergic Airways Neutrophil Influx by Permanent C-Fiber Degeneration in Rats J. Pharmacol. Exp. Ther., April 1, 2005; 313(1): 440 - 448. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Pelletier, A. Bouchard, and D. Girard In Vivo and In Vitro Roles of IL-21 in Inflammation J. Immunol., December 15, 2004; 173(12): 7521 - 7530. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Singer and P. J. Sansonetti IL-8 Is a Key Chemokine Regulating Neutrophil Recruitment in a New Mouse Model of Shigella-Induced Colitis J. Immunol., September 15, 2004; 173(6): 4197 - 4206. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kuroishi, K.-i. Komine, K.-i. Asai, J. Kobayashi, K. Watanabe, T. Yamaguchi, S.-i. Kamata, and K. Kumagai Inflammatory Responses of Bovine Polymorphonuclear Neutrophils Induced by Staphylococcal Enterotoxin C via Stimulation of Mononuclear Cells Clin. Vaccine Immunol., November 1, 2003; 10(6): 1011 - 1018. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Clare, R. Goldin, C. Hale, R. Aspinall, C. Simmons, P. Mastroeni, and G. Dougan Intracellular Adhesion Molecule 1 Plays a Key Role in Acquired Immunity to Salmonellosis Infect. Immun., October 1, 2003; 71(10): 5881 - 5891. [Abstract] [Full Text] [PDF]
|
|
