HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Norian, L. A. Articles by Koretzky, G. A. Search for Related Content PubMed PubMed Citation Articles by Norian, L. A. Articles by Koretzky, G. A.

Cutting Edge: A Newly Identified Response Element in the CD95 Ligand Promoter Contributes to Optimal Inducibility in Activated T Lymphocytes¹

Lyse A. Norian^2,*, Kevin M. Latinis^2,* and Gary A. Koretzky^3,*,,

^* Interdisciplinary Graduate Program in Immunology and Departments of Internal Medicine and Physiology and Biophysics, University of Iowa, Iowa City, IA 52242

	Abstract

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Inducible expression of CD95 ligand on activated T lymphocytes contributes to both cytotoxic effector mechanisms and peripheral T cell homeostasis. To understand better the transcriptional events that regulate this expression, we have examined the CD95 ligand promoter to determine which regions are required for its induced activity following T cell stimulation. We report here the identification of a new response element within the promoter that is required for its optimal function in activated Jurkat T cells. This region is bound by proteins contained in nuclear extracts of activated, but not resting, T cells. Multimerization of this sequence independently drives transcription in response to T cell activation, while mutation of it substantially decreases inducible promoter activity. Finally, we provide evidence that T cell activation-induced transcription of the CD95 ligand gene is regulated coordinately by this response element together with two previously defined sites for nuclear factor of activated T cells (NFAT).

	Introduction

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Tcell Ag receptor (TCR) ligation results in the expression of cytokine genes, such as IL-2, that influence the activation, differentiation, and clonal expansion of T cells (1, 2). Following these initial events, activated T cells undergo a process of activation-induced cell death as a means of terminating the specific immune response (3, 4, 5, 6). Activation-induced cell death is mediated at least in part by the interaction of CD95 ligand (CD95L)⁴ and CD95, both of which are expressed on the surface of activated T cells (7, 8). This interaction results in the death of the CD95-bearing cell by apoptosis (9).

Unlike the intracellular events that regulate IL-2 production, relatively little is known about the events that control TCR-induced expression of CD95L. Previous studies indicated that CD95L mRNA levels are increased rapidly upon TCR ligation (4, 5, 6). However, expression of CD95L is inhibited by pretreatment of T cells with cyclosporin A (10, 11), an immunosuppressive drug which interferes with the activity of the phosphatase calcineurin. One function of calcineurin is to modulate the activity of the cytoplasmic nuclear factor of activated T cells (NFAT). Dephosphorylation of NFAT allows this transcription factor to translocate to the nucleus and associate with a nuclear component to form an active binding complex (12, 13, 14). These results therefore suggested a role for NFAT in mediating the inducible expression of CD95L in activated T cells.

We have pursued further the role of NFAT in CD95L transcriptional regulation. Using a luciferase reporter gene driven by 486 bp of the CD95L promoter sequence, we found that overexpression of the NFATc isoform substantially augments the activity of the reporter in TCR-stimulated Jurkat T cells (15). As expected, addition of cyclosporin A inhibits reporter activity in activated cells (15). We also demonstrated that NFAT proteins bind specifically to two regions of the CD95L promoter (16). While both sites appear to contribute to promoter function, mutation of the distal NFAT site produces a pronounced decrease in the ability of the promoter to trans-activate gene expression, whereas mutation of the proximal NFAT site produces only a slight decrease in promoter activity (16). In agreement with our findings, Holtz-Heppelmann et al. have also recently described a role for NFAT in regulating CD95L expression (17). These studies indicate that transcription of the CD95L gene is regulated at least in part by an interaction of NFAT proteins with the CD95L promoter.

However, mutation of both NFAT sites does not totally eliminate inducible activity in our reporter system. We therefore continued our examination of the CD95L promoter to identify additional RE required for its optimal activity. We report here the identification of a new CD95L response element, designated RE 3 (for response element 3), which is centered around bases -214 to -207 upstream of the translational start site in the human CD95L promoter sequence. This region is bound by proteins found in nuclear extracts of stimulated T cells and is required for maximal CD95L promoter function in our reporter system. We also demonstrate that this response element cooperates with the previously described NFAT binding sites to regulate CD95L gene transcription in activated T lymphocytes.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Cell culture and transient transfections

The Jurkat T leukemic cell line was maintained in RPMI 1640 supplemented with 10% FCS, penicillin (1000 U/ml), streptomycin (1000 U/ml), and glutamine (20 mM). The murine TM4 Sertoli line was maintained in DMEM supplemented with 10% FCS, and penicillin, streptomycin, and glutamine as above. Jurkat cells (15 x 10⁶) or 5 x 10⁷ Sertoli cells were transfected with 40 µg of reporter construct DNA. Cells were resuspended in 400 µl of cytomix intracellular buffer (18) before electroporation at 250 V/960 µF with a GenePulser (Bio-Rad Laboratories, Hercules, CA). Cells were cotransfected with 5 µg of a CMV-ß-gal reporter construct, which was used to standardize transfection efficiencies, and ß-galactosidase activity was quantified with the use of a Galacto-Light assay kit (Tropix, Bedford, MA).

CD95L reporter constructs

The CD95L 486 luciferase reporter construct and the double NFAT mutant reporter construct have been described previously (15, 16). The truncated CD95L reporter constructs were generated by cloning a BamHI/HindIII- flanked PCR product derived from the CD95L 486 construct into the Luc Link plasmid (19). The reverse primer was the same as for the 486 bp product, while the following forward primers were used: CD95L 258, 5'-CAGGGATCCCAGCAACTGAGGCCTTGAAGGC-3'; CD95L 132, 5'-CATGGATCCCTCTATAAGAGAGATCCAGCTTGC-3'. The CD95L RE 3 mut construct was generated using overlap extension PCR and the indicated primers to introduce a mutation at the RE 3 site: forward 5'-AAGTGAGTAGATCTTTCTTT-3', reverse 5'-AAAGAAAGATCTACTCACTT-3'. The triple mut reporter construct was created by inserting the same mutation into the RE 3 site of the double NFAT mut reporter by overlap extension PCR, using the same primers listed above. The triplicated RE 3 wt and mutant constructs were generated by cloning a double-stranded oligonucleotide, with XhoI-compatible overhanging ends, into the XhoI site of the minimal IL-2 promoter luciferase construct (20). The following oligonucleotides were used: 3x RE 3 wt forward 5'-TCGAGAAGTGAGTGGGTGTTTCTTTAAGTGAGTGGGTGTTTCTTTAAGTGAGTGGGTGTTTCTTTC-3'; reverse 5'-TCGACAAAGAAACACCCACTCACTTAAAGAAACACCCACTCACTTAAAGAAACACCCACTCACTTC-3'; 3x RE 3 mut forward 5'-TCGACAAAGAAAGATCTACTCACTTAAAGAAAGATCTACTCACTTAAAGAAAGATCTACTCACTTC3'; and reverse 5'-TCGAGAAGTGAGTAGATCTTTCTTTAAGTGAGTAGATCTTTCTTTAAGTGAGTAGATCTTTCTTTG-3'. The sequence of all PCR-derived products was confirmed by fluorescent automated sequencing (University of Iowa DNA Facility, Iowa City, IA).

Cell stimulation and luciferase assays

Transfected Jurkat cells were stimulated for 16 h with either immobilized anti-Jurkat clonotypic TCR ß-chain mAb (10 µg/ml C305 ascites in PBS on plastic tissue culture dishes at 37°C for 1.5 h), or a combination of PMA (Sigma, St. Louis, MO) at 50ng/ml, and ionomycin (Sigma) at 1 µM. The cells were then lysed in 100 µl of lysis buffer (100 mM KPO₄, pH 7.8, 5.0 mM DTT, 1% Triton X-100). Lysates were mixed with an additional 100 µl of assay buffer (200 mM KPO₄, pH 7.8, 10 mM ATP, 20 mM MgCl₂), followed by 100 µl of 1.0 mM sodium-D-luciferin (Sigma). Luciferase activity was determined using a Monolight 2010 Luminometer (Analytical Luminescence Laboratory, San Diego, CA) and is expressed in arbitrary light units, as the mean ± SD of triplicate samples. Fold increases were calculated by dividing the stimulated luciferase count with the unstimulated luciferase count from the same reporter construct.

Electrophoretic mobility shift assay

EMSA were performed as described previously (20). Briefly, Jurkat nuclear extracts were prepared from 50 x 10⁶ cells, either left unstimulated or stimulated with plate-bound C305 mAb, or 50 ng/ml PMA, 1 µM ionomycin, or PMA plus ionomycin with or without 50 ng/ml cyclosporin A (Sigma) for various times as indicated. Human PBMC were collected by veinipuncture, and nuclear extracts were prepared from 50 x 10⁶ cells, either left unstimulated or stimulated with plate-bound OKT3 Ab for 4 h in the presence or absence of cyclosporin A as above. Binding reactions were performed with 5 µg of protein and 1 µg of poly(dI-dC) in 50 mM KCl, 10 mM Tris (pH 7.5), 10 mM HEPES, 1.25 mM DTT, 1.1 mM EDTA, and 15% (v/v) glycerol in a volume of 20 µl. Binding reactions were incubated at room temperature for 30 min with 20,000 cpm (0.1–0.5 ng) of double stranded oligonucleotide end-labeled with [-³²P]ATP using T4 polynucleotide kinase. Unlabeled specific or nonspecific competitor oligonucleotides were used where indicated at a 1000-fold excess. Protein/DNA complexes and unbound DNA probe were then resolved on 5% or 6% nondenaturing polyacrylamide gels and visualized by autoradiography. DNA probe sequences were used as follows: wt RE 3 forward 5'-TGCAAGTGAGTGGGTGTCTC-3', and mutant RE 3 forward 5'-TGCAAGTGAGTAGATCTCTC-3'.

	Results and Discussion

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Multiple regions of the CD95L promoter are required for optimal promoter function

To define those regions of the human CD95L promoter that contribute specifically to its TCR inducibility, we created a series of 5' truncation mutations in the promoter sequence relative to our previously defined functional 486-bp promoter construct. Utilizing the CD95L 486-bp reporter construct as a control for maximal promoter function, we assessed the ability of each of the truncated reporter constructs to induce luciferase expression after TCR stimulation of transiently transfected Jurkat T cells. We studied a variety of mutants, the most revealing of which are shown in Figure 1. We find that sequential removal of CD95L promoter sequences results in a stepwise decrease in luciferase reporter activity. As predicted, deletion of the region that contains the previously defined distal NFAT site, located between bases -275 and -271, produces a substantial diminution in the inducible activity of the CD95L promoter, as compared with the full length 486-bp reporter construct, and reduces the fold activity from 26 to 17. Another substantial decrease in promoter activity is observed when the region between bases -258 and -132 is also deleted, further reducing the fold increase from 17 to 5. These data are supportive of a model in which multiple regions of the CD95L promoter contain RE that contribute to optimal activation-induced expression of the CD95L gene.

View larger version (17K): [in this window] [in a new window]   FIGURE 1. Truncations of the CD95L promoter sequence reduce inducible transcriptional activity. Jurkat cells were transfected transiently with reporter constructs containing 486 bp of CD95L promoter sequence (CD95L 486), 258 bp of sequence (CD95L 258), or 132 bp of sequence (CD95L 132). Transfectants were left unstimulated or stimulated for 16 h with immobilized anti-TCR mAb. Luciferase light units, standardized to ß-galactosidase activity, are expressed as the mean ± SD of triplicate samples. The fold increase of stimulated over unstimulated baselines for each reporter are presented as numerical values above the bars. These data are representative of five independent experiments.

We next began to examine the region between bases -258 and -132, focusing on those sequences that were conserved between the human and murine promoters. Although the previously identified proximal NFAT site is located within this area, its contribution to promoter activity appears to be minimal (16). Using EMSA, we identified a 20-bp sequence within this region that specifically binds proteins from activated, but not resting, T cells. This sequence contains a core site, located between bases -214 and -207, that consists of a GGGTGT sequence that is conserved completely between the human and murine promoter sequences (21).

EMSA analysis of this 20-bp sequence (Fig. 2B) demonstrates that stimulation of Jurkat cells with either TCR cross-linking or PMA plus ionomycin results in the formation of one specific protein/DNA complex (lanes 2–5), while no complex is observed without stimulation (lane 1). Interestingly, stimulation with PMA alone, but not ionomycin alone, also results in specific complex formation (data not shown). The specificity of the reaction is illustrated by the competitive inhibition of complex formation upon the addition of an excess of specific unlabeled probe (lanes 4 and 7), but not upon the addition of an excess of an unrelated DNA sequence (lanes 5 and 8). The inducible formation of this complex is, however, not affected by the addition of cyclosporin A (lanes 6–8). As a control to ensure that the cyclosporin A treatment was effective, nuclear extracts from the same cells were used in a binding reaction with a previously described CD95L NFAT response element DNA probe (16). In these samples, complex formation is inhibited by the addition of cyclosporin A (data not shown).

View larger version (38K): [in this window] [in a new window]   FIGURE 2. The RE 3 site binds nuclear proteins from activated T cells. A, A schematic diagram of the DNA probe sequences used with the core RE 3 site underlined. B, An EMSA was performed with nuclear extracts from Jurkat cells left unstimulated (un), stimulated with immobilized anti-TCR mAb (TCR), stimulated with PMA plus ionomycin (PMA/Ion), or PMA plus ionomycin with cyclosporin A (PMA/Ion/CsA) for 4 h. A radiolabeled 20-bp DNA probe, corresponding to the wt RE 3 site plus flanking sequences, was used. Binding reactions were conducted in the presence of no DNA competitor (0), an excess of unlabeled specific competitor (S), or unlabeled nonspecific competitor (NS). Complexes were resolved on a 5% acrylamide gel. Data are representative of three independent experiments. C, EMSA performed as in B using nuclear extracts from Jurkat cells stimulated for varying amounts of time as indicated. As above, the RE 3 probe was used. Complexes were resolved on a 6% acrylamide gel. D, EMSA performed as in B using Jurkat nuclear extracts stimulated for varying amounts of time as indicated. A probe corresponding to the CD95L distal NFAT site (16) was used. Complexes were resolved on a 6% acrylamide gel. E, EMSA performed as in B using a second 20-bp radiolabeled DNA probe that corresponds to the mutated RE 3 site. Complexes were resolved on a 6% acrylamide gel. Data are representative of three independent experiments.

The specificity of the protein binding reaction was demonstrated by the introduction of a 3-bp substitution mutation into the core GGGTGT sequence of our DNA probe, creating an AGATCT sequence. As shown in Figure 2E, use of this mutated DNA probe completely abolishes inducible protein/DNA complex formation (lanes 4–6 vs lanes 10–12). This suggests that it is the core sequence that participates in inducible protein binding to the 20-bp probe. Thus, the core site, designated RE 3, is specifically bound by nuclear proteins present in activated T cells.

RE 3 independently activates transcription of a reporter gene and is required for optimal CD95L promoter function

Next, we asked if the RE 3 sequence has an important role in the transcriptional activation of the CD95L gene. Our first approach was to generate reporter constructs driven by triplicated copies of both the wt and mutated DNA sequences used to demonstrate inducible protein binding by EMSA. Transient transfection of Jurkat cells with the triplicated wt reporter, designated 3x RE 3 wt, shows inducible activity following stimulation with PMA plus ionomycin, or TCR ligation, but not with either PMA or ionomycin alone (Fig. 3A). Additionally, reporter activity is blocked by pretreatment of cells with cyclosporin A, resulting in a loss of approximately 90% of the induced activity (data not shown). The triplicated mutant reporter, 3x RE 3 mut, fails to activate reporter gene transcription above baseline regardless of the type of stimulation used. This indicates that the transcriptional activity associated with the 3x RE 3 wt reporter requires the presence of the core GGGTGT site.

View larger version (15K): [in this window] [in a new window]   FIGURE 3. The RE 3 site is involved in CD95L promoter activity. A, Jurkat cells were transiently transfected with reporter constructs driven by the triplicated wt RE 3 sequence (3x RE 3 wt) or the triplicated mutant RE 3 sequence (3x RE 3 mut). Cells were left unstimulated or stimulated for 16 h as indicated. Luciferase light units, standardized to ß-galactosidase activity, are reported as the mean ± SD of triplicate samples. The fold increase of stimulated over unstimulated baselines for each reporter are presented as numerical values above the bars. Data are representative of three independent experiments. B, Transient transfections and stimulations were performed as above, with the exception that either the CD95L 486-bp reporter was used (CD95L 486) or a reporter containing the mutated RE 3 site in the context of the 486-bp sequence (CD95L 486 RE 3 mut). Data are representative of seven independent experiments.

RE 3 and the NFAT RE contribute to CD95L promoter activity

To investigate further the nature of the residual promoter activity associated with the CD95L 486 RE 3 mut reporter, we utilized two additional reporter constructs. One contains mutations in both of the previously described NFAT RE in the context of the full-length CD95L 486-bp reporter (referred to as CD95L 486 Dbl mut). The second contains mutations in all three defined RE in the context of the full-length reporter (referred to as CD95L 486 Triple mut). Transient transfections of these reporters were performed in conjunction with the wt CD95L 486 reporter (Fig. 4). All four reporters demonstrate little activity in unstimulated Jurkat cells. TCR stimulation produces a substantial augmentation of the CD95L 486 reporter activity, increasing 21-fold over unstimulated, as shown previously. Again, the introduction of a mutation in the RE 3 site results in a loss of approximately 60% of reporter activity following TCR stimulation and a decline in fold induction from 21 to 14. The mutation of both NFAT RE produces an approximately 80% inhibition of promoter function following TCR stimulation and decreases the fold induction to 7. This may indicate that the integrity of the NFAT sites, or at least that of the distal NFAT site, is more critical for CD95L promoter function than is the RE 3 site. The loss of all three sites further decreases inducible reporter activity, as indicated by the CD95L 486 Triple mut reporter, which is able to generate only a fourfold increase in stimulated activity. Similar results are observed with PMA plus ionomycin stimulation (data not shown).

View larger version (16K): [in this window] [in a new window]   FIGURE 4. Coordinate regulation of CD95L promoter activity by the RE 3 and NFAT RE. Jurkat cells were transiently transfected with the CD95L 486 reporter, the reporter containing the mutated RE 3 site (CD95L 486 RE 3 mut), a reporter containing mutations in both NFAT sites in the context of the 486-bp sequence (CD95L 486 Dbl mut), or a reporter containing mutations in all three RE (CD95L 486 Triple mut). Cells were left unstimulated or stimulated for 16 h with immobilized anti-TCR mAb. Luciferase light units, standardized to ß-galactosidase activity, are reported as the mean ± SD of triplicate samples. The fold increases of stimulated over unstimulated baselines for each reporter are presented as numerical values above the bars. Data are representative of six independent experiments.

To test this model, and to elucidate the specific ways in which the RE 3-binding protein and NFAT cooperate to regulate CD95L transcription, the identity of this protein must be determined. Searches of transcription factor recognition sequences (utilizing the TESS: Transcription Element Search Software on the world wide web) have generated several candidate proteins that are currently being investigated. One family of proteins indicated as a potential match are the CACCC-binding factors, which could recognize the reverse complement ACACCC sequence of our core GGGTGT site. One member of this family has been shown to regulate the expression of the TCR Vß 8.1 gene (22). Another member, LKLF, has been recently implicated as a regulator of T cell quiescence, which suppresses, either directly or indirectly, CD95L gene expression (23). However, this protein is rapidly degraded upon T cell activation, and we have found no evidence that it is the protein that binds inducibly to the CD95L RE 3 site in activated T cells.

	Acknowledgments

 
We thank Drs. Erik Peterson and Nancy Boerth for their critical review of the manuscript.

	Footnotes

 
¹ This work was supported in part by a grant from the Arthritis Foundation. G.A.K. is an Established Investigator with the American Heart Association. L.A.N. is supported by an institutional National Research Service Award (NRSA) (National Institutes of Health Grant HL-07638). K.M.L. is supported by the University of Iowa Medical Scientist Training Program (National Institutes of Health Grant T326 M07337).

² These two authors contributed equally to this work.

³ Address correspondence and reprint requests to Dr. Gary A. Koretzky, Department of Internal Medicine, 540 Eckstein Medical Research Building, University of Iowa, Iowa City, IA 52242. E-mail address:

⁴ Abbreviations used in this paper: CD95L, CD95 ligand; NFAT, nuclear factor of activated T cells; RE, response element; wt, wild-type; EMSA, electrophoretic mobility shift assay.

Received for publication March 17, 1998. Accepted for publication June 2, 1998.

	References

Top Abstract Introduction Materials and Methods Results and Discussion References

 

1. Musci, M. A., K. M. Latinis, G. A. Koretzky. 1997. Signaling events in T lymphocytes leading to cellular activation or programmed cell death. Clin. Immunol. Immunopathol. 83:205.[Medline]
2. Weiss, A., D. R. Littman. 1994. Signal transduction by lymphocyte antigen receptors. Cell 76:263.[Medline]
3. Alderson, M. R., T. W. Tough, T. Davis-Smith, S. Braddy, B. Falk, K. A. Schooley, R. G. Goodwin, C. A. Smith, F. Ramsdell, D. H. Lynch. 1995. Fas ligand mediates activation-induced cell death in human T lymphocytes. J. Exp. Med. 181:71.[Abstract/Free Full Text]
4. Brunner, T., R. J. Mogil, D. LaFace, N. J. Yoo, A. Mahboubi, F. Echeverri, S. J. Martin, W. R. Force, D. H. Lynch, C. F. Ware, D. R. Green. 1995. Cell-autonomous Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature 373:441.[Medline]
5. Dhein, J., H. Walczak, C. Baumler, K. M. Debatin, P. H. Krammer. 1995. Autocrine T-cell suicide mediated by APO-1/(Fas/CD95). Nature 373:438.[Medline]
6. Ju, S. T., D. J. Panka, H. Cui, R. Ettinger, M. el-Khatib, D. H. Sherr, B. Z. Stanger, A. Marshak-Rothstein. 1995. Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature N 73:444.
7. Lynch, D. H., F. Ramsdell, M. R. Alderson. 1995. Fas and FasL in the homeostatic regulation of immune responses. Immunol. Today 16:569.[Medline]
8. van Parijs, L., A. K. Abbas. 1996. Role of Fas-mediated cell death in the regulation of immune responses. Curr. Opin. Immunol. 8:355.[Medline]
9. Nagata, S.. 1997. Apoptosis by death factor. Cell 88:355.[Medline]
10. Anel, A., M. Buferne, C. Boyer, A. M. Schmitt-Verhulst, P. Golstein. 1994. TCR-induced Fas ligand expression in cytotoxic T lymphocyte clones is blocked by protein tyrosine kinase inhibitors and cyclosporin A. Eur. J. Immunol. 24:2469.[Medline]
11. Brunner, T., J. Y. Nam, D. LaFace, C. F. Ware, D. R. Green. 1996. Activation-induced cell death in murine T cell hybridomas: differential regulation of Fas (CD95) vs Fas ligand expression by cyclosporin A and FK506. Int. Immunol. 8:1017.[Abstract/Free Full Text]
12. Schreiber, S. L., G. R. Crabtree. 1992. The mechanism of action of cyclosporin A and FK506. Immunol. Today N 3:136.
13. McCaffrey, P. G., C. Luo, T. K. Kerppola, J. Jain, T. M. Badalian, A. M. Ho, E. Burgeon, W. S. Lane, J. N. Lambert, T. Curran, G. L. Verdine, A. Rao, P. G. Hogan. 1993. Isolation of the cyclosporin-sensitive T cell transcription factor NFATp. Science N 62:750.
14. Rao, A., C. Luo, P. G. Hogan. 1997. Transcription factors of the NFAT family. Annu. Rev. Immunol. 15:707.[Medline]
15. Latinis, K. M., L. L. Carr, E. J. Peterson, L. A. Norian, S. L. Eliason, G. A. Koretzky. 1997. Regulation of CD95 (Fas) ligand expression by TCR-mediated signaling events. J. Immunol. 158:4602.[Abstract]
16. Latinis, K. M., L. A. Norian, S. L. Eliason, G. A. Koretzky. 1997. Two NFAT transcription factor binding sites participate in the regulation of CD95 (Fas) ligand expression in activated human T cells. J. Biol. Chem. 272:31427.[Abstract/Free Full Text]
17. Holtz-Heppelmann, C. J., A. Algeciras, A. D. Badley, C.V. Paya. 1998. Transcriptional regulation of the human FasL promoter-enhancer region. J. Biol. Chem. 273:4416.[Abstract/Free Full Text]
18. van den Hoff, M. J., A. F. Moorman, W. H. Lamers. 1992. Electroporation in "intracellular" buffer increases cell survival. Nucleic Acids Res. 20:2902.[Free Full Text]
19. de Wet, J. R., K. V. Wood, M. DeLuca, D. R. Helinski, S. Subramani. 1987. Firefly luciferase gene: structure and expression in mammalian cells. Mol. Cell. Biol. 7:725.[Abstract/Free Full Text]
20. Thompson, C. B., C. Y. Wang, I. C. Ho, P. R. Bohjanen, B. Petryniak, C. H. June, S. Miesfeldt, L. Zhang, G. J. Nabel, B. Karpinski, J.M. Leiden. 1992. cis-Acting sequences required for inducible interleukin-2 enhancer function bind a novel Ets-related protein, Elf-1. Mol. Cell. Biol. 12:1043.[Abstract/Free Full Text]
21. Takahashi, T., M. Tanaka, J. Inazawa, T. Abe, T. Suda, S. Nagata. 1994. Human Fas ligand: gene structure, chromosomal location and species specificity. Int. Immunol. 6:1567.[Abstract/Free Full Text]
22. Wang, Y., J. A. Kobori, L. Hood. 1993. The ht ß gene encodes a novel CACCC box-binding protein that regulates T-cell receptor gene expression. Mol. Cell. Biol. 13:5691.[Abstract/Free Full Text]
23. Kuo, C. T., M. L. Veselits, J. M. Leiden. 1997. LKLF: a transcriptional regulator of single-positive T cell quiescence and survival. Science 277:1986.[Abstract/Free Full Text]

This article has been cited by other articles:

				P. Contini, M. Ghio, A. Merlo, A. Poggi, F. Indiveri, and F. Puppo Apoptosis of Antigen-Specific T Lymphocytes upon the Engagement of CD8 by Soluble HLA Class I Molecules Is Fas Ligand/Fas Mediated: Evidence for the Involvement of p56lck, Calcium Calmodulin Kinase II, and Calcium-Independent Protein Kinase C Signaling Pathways and for NF-{kappa}B and NF-AT Nuclear Translocation J. Immunol., December 1, 2005; 175(11): 7244 - 7254. [Abstract] [Full Text] [PDF]

				M. Cippitelli, C. Fionda, D. Di Bona, M. Piccoli, L. Frati, and A. Santoni Hyperthermia Enhances CD95-Ligand Gene Expression in T Lymphocytes J. Immunol., January 1, 2005; 174(1): 223 - 232. [Abstract] [Full Text] [PDF]

				K. J. Erb, T. Twardzik, A. Palmetshofer, G. Wohlleben, U. Tatsch, and E. Serfling Mice Deficient in Nuclear Factor of Activated T-Cell Transcription Factor c2 Mount Increased Th2 Responses after Infection with Nippostrongylus brasiliensis and Decreased Th1 Responses after Mycobacterial Infection Infect. Immun., November 1, 2003; 71(11): 6641 - 6647. [Abstract] [Full Text] [PDF]

				S. A. Crist, T. S. Griffith, and T. L. Ratliff Structure/Function Analysis of the Murine CD95L Promoter Reveals the Identification of a Novel Transcriptional Repressor and Functional CD28 Response Element J. Biol. Chem., September 19, 2003; 278(38): 35950 - 35958. [Abstract] [Full Text] [PDF]

				M. Cippitelli, C. Fionda, D. Di Bona, A. Lupo, M. Piccoli, L. Frati, and A. Santoni The Cyclopentenone-Type Prostaglandin 15-Deoxy-{Delta}12,14-Prostaglandin J2 Inhibits CD95 Ligand Gene Expression in T Lymphocytes: Interference with Promoter Activation Via Peroxisome Proliferator-Activated Receptor-{gamma}-Independent Mechanisms J. Immunol., May 1, 2003; 170(9): 4578 - 4592. [Abstract] [Full Text] [PDF]

				Y.-J. Chwae, M. J. Chang, S. M. Park, H. Yoon, H.-J. Park, S. J. Kim, and J. Kim Molecular Mechanism of the Activation-Induced Cell Death Inhibition Mediated by a p70 Inhibitory Killer Cell Ig-Like Receptor in Jurkat T Cells J. Immunol., October 1, 2002; 169(7): 3726 - 3735. [Abstract] [Full Text] [PDF]

				L. Li, X. Qi, M. Williams, Y. Shi, and A. D. Keegan Overexpression of Insulin Receptor Substrate-1, But Not Insulin Receptor Substrate-2, Protects a T Cell Hybridoma from Activation-Induced Cell Death J. Immunol., June 15, 2002; 168(12): 6215 - 6223. [Abstract] [Full Text] [PDF]

				M. Cippitelli, C. Fionda, D. Di Bona, F. Di Rosa, A. Lupo, M. Piccoli, L. Frati, and A. Santoni Negative Regulation of CD95 Ligand Gene Expression by Vitamin D3 in T Lymphocytes J. Immunol., February 1, 2002; 168(3): 1154 - 1166. [Abstract] [Full Text] [PDF]

				S. Kirchhoff, T. Sebens, S. Baumann, A. Krueger, R. Zawatzky, M. Li-Weber, E. Meinl, F. Neipel, B. Fleckenstein, and P. H. Krammer Viral IFN-Regulatory Factors Inhibit Activation-Induced Cell Death Via Two Positive Regulatory IFN-Regulatory Factor 1-Dependent Domains in the CD95 Ligand Promoter J. Immunol., February 1, 2002; 168(3): 1226 - 1234. [Abstract] [Full Text] [PDF]

				R. Dzialo-Hatton, J. Milbrandt, R. D. Hockett Jr., and C. T. Weaver Differential Expression of Fas Ligand in Th1 and Th2 Cells Is Regulated by Early Growth Response Gene and NF-AT Family Members J. Immunol., April 1, 2001; 166(7): 4534 - 4542. [Abstract] [Full Text] [PDF]

				S. T. Eichhorst, M. Müller, M. Li-Weber, H. Schulze-Bergkamen, P. Angel, and P. H. Krammer A Novel AP-1 Element in the CD95 Ligand Promoter Is Required for Induction of Apoptosis in Hepatocellular Carcinoma Cells upon Treatment with Anticancer Drugs Mol. Cell. Biol., October 15, 2000; 20(20): 7826 - 7837. [Abstract] [Full Text]

				X. R. Li, A. S.-F. Chong, J. Wu, K. A. Roebuck, A. Kumar, J. E. Parrillo, U. R. Rapp, R. P. Kimberly, J. W. Williams, and X. Xu Transcriptional Regulation of Fas Gene Expression by GA-binding Protein and AP-1 in T Cell Antigen Receptor{middle dot}CD3 Complex-stimulated T Cells J. Biol. Chem., December 3, 1999; 274(49): 35203 - 35210. [Abstract] [Full Text] [PDF]

				M. Villalba, S. Kasibhatla, L. Genestier, A. Mahboubi, D. R. Green, and A. Altman Protein Kinase C{theta} Cooperates with Calcineurin to Induce Fas Ligand Expression During Activation-Induced T Cell Death J. Immunol., December 1, 1999; 163(11): 5813 - 5819. [Abstract] [Full Text] [PDF]

				S.-C. Hsu, M. A. Gavrilin, M.-H. Tsai, J. Han, and M.-Z. Lai p38 Mitogen-activated Protein Kinase Is Involved in Fas Ligand Expression J. Biol. Chem., September 3, 1999; 274(36): 25769 - 25776. [Abstract] [Full Text] [PDF]

				J. C. Pratt, M. R. M. van den Brink, V. E. Igras, S. F. Walk, K. S. Ravichandran, and S. J. Burakoff Requirement for Shc in TCR-Mediated Activation of a T Cell Hybridoma J. Immunol., September 1, 1999; 163(5): 2586 - 2591. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Norian, L. A. Articles by Koretzky, G. A. Search for Related Content PubMed PubMed Citation Articles by Norian, L. A. Articles by Koretzky, G. A.