|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


*
Department of Immunology, Lerner Research Institute; and Departments of
Hematology-Oncology and
Anatomic Pathology, Cleveland Clinic Foundation, Cleveland, OH 44195
| Abstract |
|---|
|
|
|---|
-inducible chemokines IP-10 and Mig within the tumor tissue.
IP-10 and Mig have been shown to function as chemoattractants for
activated T lymphocytes. In animals treated with rabbit polyclonal Abs
specific for IP-10 and for Mig, the IL-12-induced regression of RENCA
tumors was partially abrogated. This effect was associated with a
dramatic inhibition of T cell infiltration. Thus, it appears that
IL-12-dependent, T cell-mediated antitumor activity requires the
intermediate expression of IP-10 and Mig to recruit antitumor effector
T cells to the tumor site. | Introduction |
|---|
|
|
|---|
(7, 10, 11). A recent
report from this laboratory demonstrated that the antitumor response
stimulated by IL-12 correlated strongly with the production of the
IFN-
-inducible chemokine IP-10 by cells within the tumor bed (6).
IP-10 is a member of the CXC family of chemokines but is missing the
ELR amino acid sequence motif that has been linked with neutrophil
chemotaxis. The absence of this function reflects the inability of
non-ELR CXC chemokines to bind with the IL-8R
(CXCR13 and CXCR2) (18, 19, 20).
Recently, a receptor exhibiting specificity for IP-10 and a related,
non-ELR CXC chemokine termed Mig (21, 22) has been identified (CXCR3)
whose expression is restricted to activated T cells (23). This finding
suggested the hypothesis that IL-12 induces expression of IP-10 and Mig
chemokines secondary to the production of IFN-
and thereby
stimulates enhanced recruitment of effector immune cells to the
tumor site. The goal of the present study was to test this hypothesis by examining the antitumor activity of IL-12 in animals given Abs to block the function of IP-10 and Mig. In BALB/c mice bearing established RENCA tumors, IL-12 treatment produces effective tumor regression (6, 7). Treatment with a mixture of rabbit polyclonal Abs that recognize IP-10 and Mig produced a significant abrogation of the IL-12-mediated antitumor function that was associated with a marked reduction in the infiltration of the tumor tissue with perforin-expressing CD8+ T cells.
| Materials and Methods |
|---|
|
|
|---|
Dulbeccos PBS was purchased from Mediatech (Washington DC). Agarose, SDS, guanidine isothiocyanate, cesium chloride, and phenol were purchased from Life Technologies (Gaithersburg, MD). Boehringer Mannheim (Indianapolis, IN) was the source of restriction endonucleases, proteinase K, nick translation kits, random primer kits, reverse transcriptase, RNase inhibitor, and Taq polymerase. [32P]dCTP was purchased from DuPont-New England Nuclear Research Products (Boston, MA). Reagents for SDS-PAGE and protein determination were obtained from Bio-Rad Laboratories (Richmond, CA). Recombinant murine IL-12 was provided by both Genetics Institute (Boston, MA) and Dr. Michael Brunda (Hoffmann-La Roche, Nutley, NJ). Vector Laboratories (Burlingame, CA) was the source of biotinylated goat anti-rat IgG. Peroxidase-labeled streptavidin, biotinylated anti-rat IgG, and chromogenic substrate for immunohistology were purchased from Ventana Medical Systems (Tuscon, AZ). Rat mAbs against mouse CD4 and CD8 were purchased from Becton Dickinson (Mountain View, CA), and a mAb against mouse CD31 was provided by Dr. Alberto Mantovani (Mario Negri Institute, Milan, Italy).
Animals
Male BALB/c mice, 6 to 8 wk old, were purchased from the National Institutes of Health (Bethesda, MD) and housed in a specific pathogen-free animal facility. Animals were maintained in microisolator cages with autoclaved food and bedding to minimize exposure to viral and microbial pathogens (24).
Tumors
RENCA is a spontaneously arising murine renal cell carcinoma and was isolated and maintained as described previously (25). Routinely, 4 x 105 tumor cells in 0.1 ml of PBS were inoculated s.c. Fourteen days following tumor inoculation, animals received 0.5 µg of recombinant murine IL-12 i.p. daily for the duration of the experiment, while control animals received vehicle alone. Tumor volumes were measured daily with a micrometer in two dimensions, and tumor size was estimated according to the formula: (smallest diameter)2 x (longest diameter). Tumor growth under different treatment conditions was statistically analyzed using the Wilcoxon rank sum test. The p values obtained represent the two-sided value.
Preparation of Abs
Rabbit polyclonal Abs to Mig and IP-10 were produced by Biosynthesis (Lewisville, TX) using synthetic peptides selected from the IP-10 and Mig protein sequences (CIHIDDGPVRMRAIGK and CISTSRGTIHYKSLKDLKQFAPS, respectively) coupled to carrier protein KLH.
Western blot analysis
RENCA cells in 100-mm diameter petri dishes were cultured in
serum- and protein-free hybridoma medium (Sigma, St. Louis, MO) with or
without stimulation by IFN-
for 24 h. Supernatant medium was
dialyzed overnight against 25 mM NaPO4, pH 7.4, and then mixed with a
40-µl (bed volume) aliquot of heparin-Sepharose beads for 16 h
at room temperature. The beads were washed in buffer and then boiled in
the presence of 2% SDS sample buffer (26), and the eluted samples were
separated by SDS-PAGE (15%). Proteins were then transferred to
Nitrobind transfer membranes (Micron Separations, Westborough, MA)
using a semidry transfer cell (Bio-Rad) for 45 min at 450 mA constant
current in transfer buffer (48 mM Tris, 39 mM glycine, and 20%
methanol, pH 9.2). Blots were blocked with 5% nonfat milk in TBST
(0.15 M NaCl, 0.1% Tween-20, and 50 mM Tris, pH 7.4) at 20°C for
2 h, then incubated overnight with rabbit polyclonal Abs against
IP-10 or Mig in 5% nonfat milk TBST solution (in some reactions,
peptide against which the Ab was initially raised was included as a
competitor at 1 µg/ml). After washing three times in TBST, filters
were incubated at room temperature for 1 h with goat
anti-rabbit IgG conjugated to horseradish peroxidase and then
washed again as described above. Ab binding was detected using the ECL
kit from Amersham (Arlington Heights, IL).
Immunohistologic analysis
Immunohistology was performed as previously described (6, 25, 27). Tissues were snap-frozen in isopentane precooled in liquid nitrogen until sectioned. Frozen tissue sections (6 µm) were prepared, air-dried, fixed in cold reagent grade acetone for 10 min, and air dried. Rat mAbs against mouse CD8 or CD31 were applied at concentrations optimally titrated against mouse thymus or mouse lung, respectively, and linked to streptavidin-peroxidase by biotinylated rabbit anti-rat IgG using the Ventana 320 automated immunostainer (Ventana, Tuscon, AZ). The chromogenic substrate aminocarbazole/H2O2 followed by hematoxylin counterstaining was used to visualize positive reactivity. To quantify T cell infiltration into tumor tissues, the number of cells showing anti-CD8 reactivity in a series of high power fields was counted in several tumors from each experiment. Because the tumor tissue exhibited variable degrees of necrosis and variable distribution of T cell infiltrates, only fields of nonnecrotic tumor containing the highest T cell numbers for each experimental condition were included in the analysis.
Plasmids
Plasmids with inserts encoding murine IP-10 and perforin were
previously described (6). A DNA fragment encoding a portion of the
murine Mig mRNA sequence was obtained by RT-PCR using primers flanking
the coding region and RNA derived from IFN-
-stimulated mouse
peritoneal macrophages. The PCR product was cloned into the plasmid
pGEM 4Z. The methods for plasmid DNA preparation were previously
described (6).
Analysis of mRNA expression in tumor tissue
Total cellular RNA was extracted from 0.3 to 0.5 g of whole tumor tissue by homogenization with a Polytron sonicator/homogenizer (Brinkmann Instruments, Westbury, NY) for 1 min in guanidine isothionate followed by ultracentrifugation through cesium chloride according to previously described methods (28, 29). Northern hybridization analysis was conducted as described previously (30, 31). Equal amounts of RNA (20 µg) were denatured, separated by electrophoresis in an agarose-formaldehyde gel, and blotted by capillary transfer onto nylon membranes. The blots were prehybridized 6 to 18 h at 42°C in 50% formamide, 1% SDS, 5x SSC, 1x Denhardts solution (0.02% Ficoll, 0.02% BSA, and 0.02% polyvinylpyrrolidine), 0.25 mg/ml denatured salmon sperm DNA, and 50 mM sodium phosphate buffer, pH 6.5. Hybridization was conducted at 42°C for 12 to 18 h with 107 cpm of denatured probe. The filters were washed twice for 15 min each time at 55°C in 0.1% SDS-0.5x SSC. The blots were then exposed using XAR-5 x-ray film (Eastman Kodak, Rochester, NY) with DuPont (Wilmington, DE) Cronex Lightening Plus intensifying screens at -70°C. Expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was used as an internal control and was applied in all experiments.
Semiquantitative RT-PCR analysis of perforin mRNA was conducted as reported previously (6, 25, 32). One microgram of total RNA was amplified using an oligo(dT) antisense primer and AMV reverse transcriptase at 42°C for 1 h. The RT reaction products were used undiluted or at a 1/10 dilution for PCR amplification using 20 mM sense and antisense primers (see below) and Taq polymerase. PCR reactions were conducted in a Perkin-Elmer/Cetus DNA Thermal Cycler for 15 cycles (denaturation, 1 min, 94°C; annealing, 1 min, 60°C; amplification, 2 min, 72°C). The primer sequences used were as follows: perforin antisense primer, GGTGGAGTGGAGGTTTTTGTACC; and perforin sense primer, CAGAATGCAAGCAGAAGCACAAG (perforin product size, 486 bp). These primers were chosen from separate exons to ensure that products derived from mRNA and contaminating genomic DNA could be distinguished. The PCR products were separated by agarose gel electrophoresis and visualized by Southern hybridization analysis using radiolabeled cDNA encoding a portion of the perforin gene sequence.
| Results |
|---|
|
|
|---|
-inducible chemokine mRNAs by
Northern hybridization (Fig. 1
|
(Fig. 2
-stimulated cells, the Ab to Mig showed specific recognition of
three IFN-
-inducible peptide species of approximately 14, 10, and 8
kDa. Specificity was further demonstrated by competition with peptides
used as immunogens (Fig. 2
|
0.005 for the group treated with IL-12
and nonimmune Ig vs that treated with IL-12 and anti-IP-10 and
anti-Mig Ig). Indeed, by day 15 of treatment, tumors from animals
receiving both anti-chemokine Abs were approximately fivefold
larger than tumors from animals treated with IL-12 alone or with
nonimmune Ig. While treatments with anti-IP-10 alone had no
detectable effect on IL-12-driven antitumor function, use of Ab to Mig
alone produced a small reduction of the response to IL-12, which was
not statistically significant. These results indicate that Mig and
IP-10 may be necessary for IL-12-mediated anti-tumor activity.
|
|
|
| Discussion |
|---|
|
|
|---|
and the presence of both CD4+ and
CD8+ T cells (7, 9, 10). The observation that IL-12
treatment induces high levels of IFN-
in tumor-bearing nude mice
without marked antitumor effects indicates that IFN-
is necessary,
but not sufficient, for IL-12-mediated antitumor function (7, 9, 10).
We hypothesize that the remarkable antitumor efficacy of IL-12 derives
from its ability both to enhance the T cell-mediated immune response to
the tumor and to promote the infiltration of the tumor by activated
effector T cells. Our results indicate that this latter objective is
achieved via the IFN-
-mediated production of the non-ELR-containing
CXC chemokines, IP-10 and Mig, and is supported by the following
observations. 1) Rabbit Abs to IP-10 and Mig, when provided in
combination, reduce the antitumor activity of IL-12 against established
RENCA tumors growing s.c. 2) The anti-chemokine Ab treatment
results in a marked reduction in the infiltration of tumors by
CD4+ and CD8+ T cells and reduced expression of
mRNA encoding the cytotoxic T cell effector molecule perforin. 3) There
was no detectable change in the tissue density of endothelial cells
within tumors receiving any of the experimental treatments. While the effect of Ab treatment on antitumor function is not complete, the results clearly indicate that both chemokine gene products are functionally important components of the IL-12 antitumor mechanism. Since both Mig and IP-10 bind CXCR3 and mediate T cell chemotaxis (23), it is not surprising that both Abs should be required to achieve neutralization of IL-12-mediated T cell infiltration and tumor growth inhibition. Although statistically significant effects were only observed when Abs to both Mig and IP-10 were administered, anti-Mig Ab alone appeared to produce a reduction in the action of IL-12 in several animals. In this regard Mig has also been shown to exhibit higher potency than IP-10 in T cell chemotaxis (22, 23).
The results presented here suggest that the effect of anti-chemokine Abs on IL-12-driven tumor regression is a direct consequence of their ability to block chemokine-mediated recruitment of activated T cells to the site. Such a scenario is consistent with an early report showing that IP-10 expression by tumor cells could promote a strong T cell-dependent antitumor effect (47). Both IP-10 and Mig have been shown to exhibit other nonchemotaxis-related activities that may be relevant to the antitumor effects of IL-12. Specifically, both chemokines have been reported to exhibit potent antiangiogenic activity in vitro and in vivo (38, 39, 40, 41). Interestingly, CXC chemokines that possess an ELR amino acid motif immediately preceding the CXC motif have been demonstrated to be angiogenic agents, while those that do not have the ELR sequence are angiogenesis inhibitors (41). Indeed, the balance of expression of ELR+ and ELR- CXC chemokines within a tumor has been proposed as an important determinant of progressive tumor growth and metastasis (41, 48). This hypothesis is supported by the finding that IP-10 expression by human lung tumors in SCID mice is associated with reduced tumor growth potential, while neutralization of IP-10 enhances growth (49). In our studies the density of endothelial cells within tumor tissue did not change in the presence of IL-12 treatment (and was not influenced by Abs to IP-10 or Mig). This result should not, however, be interpreted to mean that IL-12 did not produce an angiostatic effect in RENCA tumors. Because RENCA tumors are rapidly destroyed in immunocompetent mice treated with IL-12, the angiogenesis inhibitory action of IL-12 may be masked by its potent effect on the development of antitumor T cells. Thus, these experiments do not allow a direct determination of the antiangiogenic activity of IP-10 and Mig. In addition to effects on neovascularization, both IP-10 and Mig have also been reported to cause focal tumor necrosis when injected intratumorally or when expressed by tumor cells (50, 51). As discussed above with regard to angiogenesis inhibition, we cannot determine whether IP-10 and/or Mig are responsible for enhanced tumor necrosis because of the dominant role of T cell activity in this model.
There have been numerous reports attesting to the ability of CC and CXC
chemokines to promote antitumor activity when expressed as transgenes
by experimental tumors (39, 52, 53, 54, 55, 56, 57, 58). While there are examples where
chemokine expression alone appears to be sufficient to promote an
efficacious antitumor response, chemokines may function best in
cooperation with other cytokine agents. For example, tumor cells
transduced to express lymphotactin, a chemokine with specificity for T
cells, grew normally when injected alone, but were destroyed rapidly in
mice cotreated with IL-2 (59). The results of the present study support
the concept of cooperativity between chemokines and other cytokines in
antitumor strategies. IL-12 is able to promote chemokine expression
through the enhanced expression of IFN-
; this may not be sufficient,
however, and IL-12 also promotes expansion and activation of
tumor-specific T lymphocytes. The IFN-
-induced chemokines may
cooperate by recruiting such cells to the tumor site. One consequence
of increased T cell infiltration would be additional IFN-
production
and further enhancement of chemokine synthesis. It is also likely
that the nonchemotactic functions of Mig and IP-10, such as inhibition
of angiogenesis, can act cooperatively with the chemotactic functions
to promote more efficacious antitumor function.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Charles S. Tannenbaum, Department of Immunology, NN10, Cleveland Clinic Foundation, 9500 Euclid Ave., Cleveland, OH 44195. ![]()
3 Abbreviation used in this paper: CXCR, receptor for CXC chemokine. ![]()
Received for publication September 22, 1997. Accepted for publication March 11, 1998.
| References |
|---|
|
|
|---|
-interferon and
-interferon on a murine renal cancer (Renca) in vitro and in vivo. Cancer Res. 50:5414.
and
on two murine tumor cell lines. Int. J. Cancer 37:287.[Medline]
or
is influenced by tumor location. Int. J. Cancer 40:807.[Medline]
production. J. Immunol. 153:1697.[Abstract]
in mediating the antitumor efficacy of interleukin-12. J. Immunother. 17:71.
and interleukin-2. Am. J. Pathol. 4:747.
and IFN-ß independently stimulate the expression of lipopolysaccharide-inducible genes in murine peritoneal macrophages. J. Immunol. 142:2325.[Abstract]
, and tumor necrosis factor
are the key cytokines of the generalized Shwartzman reaction. J. Exp. Med. 180:907.
-inducible protein 10 (IP-10) is an angiostatic factor that inhibits human non-small cell lung cancer (NSCLC) tumorigenesis and spontaneous metastases. J. Exp. Med. 184:981.
, promotes tumor necrosis in vivo. Blood 89:2635.This article has been cited by other articles:
![]() |
A. K. Bauer and E. A. Rondini REVIEW PAPER: The Role of Inflammation in Mouse Pulmonary Neoplasia Vet. Pathol., May 1, 2009; 46(3): 369 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Keeley, B. Mehrad, and R. M. Strieter Chemokines as Mediators of Neovascularization Arterioscler. Thromb. Vasc. Biol., November 1, 2008; 28(11): 1928 - 1936. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ramirez-Montagut, A. Chow, A. A. Kochman, O. M. Smith, D. Suh, H. Sindhi, S. Lu, C. Borsotti, J. Grubin, N. Patel, et al. IFN-{gamma} and Fas Ligand Are Required for Graft-versus-Tumor Activity against Renal Cell Carcinoma in the Absence of Lethal Graft-versus-Host Disease J. Immunol., August 1, 2007; 179(3): 1669 - 1680. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhu, M. Waguespack, S. A. Barker, and S. Li Doxorubicin Directs the Accumulation of Interleukin-12 Induced IFN{gamma} into Tumors for Enhancing STAT1 Dependent Antitumor Effect Clin. Cancer Res., July 15, 2007; 13(14): 4252 - 4260. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Gorbachev, H. Kobayashi, D. Kudo, C. S. Tannenbaum, J. H. Finke, S. Shu, J. M. Farber, and R. L. Fairchild CXC Chemokine Ligand 9/Monokine Induced by IFN-{gamma} Production by Tumor Cells Is Critical for T Cell-Mediated Suppression of Cutaneous Tumors J. Immunol., February 15, 2007; 178(4): 2278 - 2286. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Hokeness, E. S. Deweerd, M. W. Munks, C. A. Lewis, R. P. Gladue, and T. P. Salazar-Mather CXCR3-Dependent Recruitment of Antigen-Specific T Lymphocytes to the Liver during Murine Cytomegalovirus Infection J. Virol., February 1, 2007; 81(3): 1241 - 1250. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Siddiqui, C.-Y. Li, S. M. LaRue, J. M. Poulson, P. R. Avery, A. F. Pruitt, X. Zhang, R. L. Ullrich, D. E. Thrall, M. W. Dewhirst, et al. A phase I trial of hyperthermia-induced interleukin-12 gene therapy in spontaneously arising feline soft tissue sarcomas Mol. Cancer Ther., January 1, 2007; 6(1): 380 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. N. Stiles, J. L. Hardison, C. S. Schaumburg, L. M. Whitman, and T. E. Lane T Cell Antiviral Effector Function Is Not Dependent on CXCL10 Following Murine Coronavirus Infection J. Immunol., December 15, 2006; 177(12): 8372 - 8380. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-c. Chen, R. Wang, X. Zhao, Y.-q. Wei, M. Hu, Y.-s. Wang, X.-w. Zhang, R. Zhang, L. Zhang, B. Yao, et al. Prophylaxis against carcinogenesis in three kinds of unestablished tumor models via IL12-gene-engineered MSCs Carcinogenesis, December 1, 2006; 27(12): 2434 - 2441. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Wald, I. D. Weiss, H. Wald, H. Shoham, Y. Bar-Shavit, K. Beider, E. Galun, L. Weiss, L. Flaishon, I. Shachar, et al. IFN-{gamma} Acts on T Cells to Induce NK Cell Mobilization and Accumulation in Target Organs. J. Immunol., April 15, 2006; 176(8): 4716 - 4729. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Khan, J. A. Hixon, J. K. Stauffer, E. Lincoln, T. C. Back, J. Brenner, S. Lockett, K. Nagashima, D. Powell, and J. M. Wigginton Therapeutic Modulation of Akt Activity and Antitumor Efficacy of Interleukin-12 Against Orthotopic Murine Neuroblastoma J Natl Cancer Inst, February 1, 2006; 98(3): 190 - 202. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pan, M. D. Burdick, J. A. Belperio, Y. Y. Xue, C. Gerard, S. Sharma, S. M. Dubinett, and R. M. Strieter CXCR3/CXCR3 Ligand Biological Axis Impairs RENCA Tumor Growth by a Mechanism of Immunoangiostasis J. Immunol., February 1, 2006; 176(3): 1456 - 1464. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Lopez, S. K. Adris, A. I. Bravo, Y. Chernajovsky, and O. L. Podhajcer IL-12 and IL-10 Expression Synergize to Induce the Immune-Mediated Eradication of Established Colon and Mammary Tumors and Lung Metastasis J. Immunol., November 1, 2005; 175(9): 5885 - 5894. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Ure, T. E. Lane, M. T. Liu, and M. Rodriguez Neutralization of chemokines RANTES and MIG increases virus antigen expression and spinal cord pathology during Theiler's virus infection Int. Immunol., May 1, 2005; 17(5): 569 - 579. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Saudemont, N. Jouy, D. Hetuin, and B. Quesnel NK cells that are activated by CXCL10 can kill dormant tumor cells that resist CTL-mediated lysis and can express B7-H1 that stimulates T cells Blood, March 15, 2005; 105(6): 2428 - 2435. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Croce, R. Meazza, A. M. Orengo, L. Radic', B. De Giovanni, C. Gambini, B. Carlini, V. Pistoia, L. Mortara, R. S. Accolla, et al. Sequential Immunogene Therapy with Interleukin-12- and Interleukin-15-Engineered Neuroblastoma Cells Cures Metastatic Disease in Syngeneic Mice Clin. Cancer Res., January 15, 2005; 11(2): 735 - 742. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Karmakar, R. Dhar, and C. Das Inhibition of Cytotrophoblastic (JEG-3) Cell Invasion by Interleukin 12 Involves an Interferon {gamma}-mediated Pathway J. Biol. Chem., December 31, 2004; 279(53): 55297 - 55307. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L Nagpal, Y. Chen, and T. Lin Effects of overexpression of CXCL10 (cytokine-responsive gene-2) on MA-10 mouse Leydig tumor cell steroidogenesis and proliferation J. Endocrinol., December 1, 2004; 183(3): 585 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nagata, T. Arai, Y. Soejima, H. Suzuki, H. Ishii, and T. Hibi Limited Capability of Regional Lymph Nodes to Eradicate Metastatic Cancer Cells Cancer Res., November 15, 2004; 64(22): 8239 - 8248. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. VALBUENA and D. H. WALKER EFFECT OF BLOCKING THE CXCL9/10-CXCR3 CHEMOKINE SYSTEM IN THE OUTCOME OF ENDOTHELIAL-TARGET RICKETTSIAL INFECTIONS Am J Trop Med Hyg, October 1, 2004; 71(4): 393 - 399. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Alatrash, T. E. Hutson, L. Molto, A. Richmond, C. Nemec, T. Mekhail, P. Elson, C. Tannenbaum, T. Olencki, J. Finke, et al. Clinical and Immunologic Effects of Subcutaneously Administered Interleukin-12 and Interferon Alfa-2b: Phase I Trial of Patients With Metastatic Renal Cell Carcinoma or Malignant Melanoma J. Clin. Oncol., July 15, 2004; 22(14): 2891 - 2900. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kawada, M. Sonoshita, H. Sakashita, A. Takabayashi, Y. Yamaoka, T. Manabe, K. Inaba, N. Minato, M. Oshima, and M. M. Taketo Pivotal Role of CXCR3 in Melanoma Cell Metastasis to Lymph Nodes Cancer Res., June 1, 2004; 64(11): 4010 - 4017. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-C. Yang, S. Hillinger, K. Riedl, L. Zhang, L. Zhu, M. Huang, K. Atianzar, B. Y. Kuo, B. Gardner, R. K. Batra, et al. Intratumoral Administration of Dendritic Cells Overexpressing CCL21 Generates Systemic Antitumor Responses and Confers Tumor Immunity Clin. Cancer Res., April 15, 2004; 10(8): 2891 - 2901. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Tsunoda, T. E Lane, J. Blackett, and R. S Fujinami Distinct roles for IP-10/C XC L10 in three animal models, Theiler's virus infection, EA E, and MHV infection, for multiple sclerosis: implication of differing roles for IP-10 Multiple Sclerosis, February 1, 2004; 10(1): 26 - 34. [Abstract] [PDF] |
||||
![]() |
E. Di Carlo, A. Comes, A. M. Orengo, O. Rosso, R. Meazza, P. Musiani, M. P. Colombo, and S. Ferrini IL-21 Induces Tumor Rejection by Specific CTL and IFN-{gamma}-Dependent CXC Chemokines in Syngeneic Mice J. Immunol., February 1, 2004; 172(3): 1540 - 1547. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Strasly, G. Doronzo, P. Capello, D. Valdembri, M. Arese, S. Mitola, P. Moore, G. Alessandri, M. Giovarelli, and F. Bussolino CCL16 activates an angiogenic program in vascular endothelial cells Blood, January 1, 2004; 103(1): 40 - 49. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hillinger, S.-C. Yang, L. Zhu, M. Huang, R. Duckett, K. Atianzar, R. K. Batra, R. M. Strieter, S. M. Dubinett, and S. Sharma EBV-Induced Molecule 1 Ligand Chemokine (ELC/CCL19) Promotes IFN-{gamma}-Dependent Antitumor Responses in a Lung Cancer Model J. Immunol., December 15, 2003; 171(12): 6457 - 6465. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Andrews and K. E. Sullivan Infections in Patients with Inherited Defects in Phagocytic Function Clin. Microbiol. Rev., October 1, 2003; 16(4): 597 - 621. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mitola, M. Strasly, M. Prato, P. Ghia, and F. Bussolino IL-12 Regulates an Endothelial Cell-Lymphocyte Network: Effect on Metalloproteinase-9 Production J. Immunol., October 1, 2003; 171(7): 3725 - 3733. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Q. Gao, Y. Tsuda, K. Katayama, T. Nakayama, Y. Hatanaka, Y. Tani, H. Mizuguchi, T. Hayakawa, O. Yoshie, Y. Tsutsumi, et al. Antitumor Effect by Interleukin-11 Receptor {alpha}-Locus Chemokine/CCL27, Introduced into Tumor Cells through a Recombinant Adenovirus Vector Cancer Res., August 1, 2003; 63(15): 4420 - 4425. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Blackwell and A. M. Krieg CpG-A-Induced Monocyte IFN-{gamma}-Inducible Protein-10 Production Is Regulated by Plasmacytoid Dendritic Cell-Derived IFN-{alpha} J. Immunol., April 15, 2003; 170(8): 4061 - 4068. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Hutson, L. Molto, T. Mekhail, P. Elson, J. Finke, C. Tannenbaum, E. Borden, R. Dreicer, T. Olencki, and R. M. Bukowski Phase I Trial of Consensus Interferon in Patients with Metastatic Renal Cell Carcinoma: Toxicity and Immunological Effects Clin. Cancer Res., April 1, 2003; 9(4): 1354 - 1360. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Bek, H. C. Reinhardt, K.-G. Fischer, J. R. Hirsch, C. Hupfer, E. Dayal, and H. Pavenstadt Up-Regulation of Early Growth Response Gene-1 Via the CXCR3 Receptor Induces Reactive Oxygen Species and Inhibits Na+/K+-ATPase Activity in an Immortalized Human Proximal Tubule Cell Line J. Immunol., January 15, 2003; 170(2): 931 - 940. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Shi, A. L. Rakhmilevich, C. P. Heise, K. Oshikawa, P. M. Sondel, N.-S. Yang, and D. M. Mahvi Intratumoral Injection of Interleukin-12 Plasmid DNA, Either Naked or in Complex with Cationic Lipid, Results in Similar Tumor Regression in a Murine Model Mol. Cancer Ther., September 1, 2002; 1(11): 949 - 957. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Segal, N. C. Lee, Y. L. Tsung, J. A. Norton, and K. Tsung The Role of IFN-{gamma} in Rejection of Established Tumors by IL-12 : Source of Production and Target Cancer Res., August 15, 2002; 62(16): 4696 - 4703. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Park, D. Amichay, P. Love, E. Wick, F. Liao, A. Grinberg, R. L. Rabin, H. H. Zhang, S. Gebeyehu, T. M. Wright, et al. The CXC Chemokine Murine Monokine Induced by IFN-{gamma} (CXC Chemokine Ligand 9) Is Made by APCs, Targets Lymphocytes Including Activated B Cells, and Supports Antibody Responses to a Bacterial Pathogen In Vivo J. Immunol., August 1, 2002; 169(3): 1433 - 1443. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Dorsey, N. Kundu, Q. Yang, C. S. Tannenbaum, H. Sun, T. A. Hamilton, and A. M. Fulton Immunotherapy with Interleukin-10 Depends on the CXC Chemokines Inducible Protein-10 and Monokine Induced by IFN-{gamma} Cancer Res., May 1, 2002; 62(9): 2606 - 2610. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Seki, A. D. Brooks, C. R. D. Carter, T. C. Back, E. M. Parsoneault, M. J. Smyth, R. H. Wiltrout, and T. J. Sayers Tumor-Specific CTL Kill Murine Renal Cancer Cells Using Both Perforin and Fas Ligand-Mediated Lysis In Vitro, But Cause Tumor Regression In Vivo in the Absence of Perforin J. Immunol., April 1, 2002; 168(7): 3484 - 3492. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lee, M. Zheng, S. Deshpande, S. K. Eo, T. A. Hamilton, and B. T. Rouse IL-12 suppresses the expression of ocular immunoinflammatory lesions by effects on angiogenesis J. Leukoc. Biol., March 1, 2002; 71(3): 469 - 476. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ganss, E. Ryschich, E. Klar, B. Arnold, and G. J. Hammerling Combination of T-Cell Therapy and Trigger of Inflammation Induces Remodeling of the Vasculature and Tumor Eradication Cancer Res., March 1, 2002; 62(5): 1462 - 1470. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Robertson Role of chemokines in the biology of natural killer cells J. Leukoc. Biol., February 1, 2002; 71(2): 173 - 183. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Ansell, T. E. Witzig, P. J. Kurtin, J. A. Sloan, D. F. Jelinek, K. G. Howell, S. N. Markovic, T. M. Habermann, G. G. Klee, P. J. Atherton, et al. Phase 1 study of interleukin-12 in combination with rituximab in patients with B-cell non-Hodgkin lymphoma Blood, January 1, 2002; 99(1): 67 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Liu, H. S. Keirstead, and T. E. Lane Neutralization of the Chemokine CXCL10 Reduces Inflammatory Cell Invasion and Demyelination and Improves Neurological Function in a Viral Model of Multiple Sclerosis J. Immunol., October 1, 2001; 167(7): 4091 - 4097. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sharma, M. Stolina, L. Zhu, Y. Lin, R. Batra, M. Huang, R. Strieter, and S. M. Dubinett Secondary Lymphoid Organ Chemokine Reduces Pulmonary Tumor Burden in Spontaneous Murine Bronchoalveolar Cell Carcinoma Cancer Res., September 1, 2001; 61(17): 6406 - 6412. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Gruys, T. C. Back, J. Subleski, T. A. Wiltrout, J.-K. Lee, L. Schmidt, M. Watanabe, R. Stanyon, J. M. Ward, J. M. Wigginton, et al. Induction of Transplantable Mouse Renal Cell Cancers by Streptozotocin: In Vivo Growth, Metastases, and Angiogenic Phenotype Cancer Res., August 1, 2001; 61(16): 6255 - 6263. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. V. Ramana, M. P. Gil, Y. Han, R. M. Ransohoff, R. D. Schreiber, and G. R. Stark Stat1-independent regulation of gene expression in response to IFN-gamma PNAS, June 5, 2001; 98(12): 6674 - 6679. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Pertl, A. D. Luster, N. M. Varki, D. Homann, G. Gaedicke, R. A. Reisfeld, and H. N. Lode IFN-{{gamma}}-Inducible Protein-10 Is Essential for the Generation of a Protective Tumor-Specific CD8 T Cell Response Induced by Single-Chain IL-12 Gene Therapy J. Immunol., June 1, 2001; 166(11): 6944 - 6951. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Qiu, K. A. Frait, F. Reich, E. Komuniecki, and S. W. Chensue Chemokine Expression Dynamics in Mycobacterial (Type-1) and Schistosomal (Type-2) Antigen-Elicited Pulmonary Granuloma Formation Am. J. Pathol., April 1, 2001; 158(4): 1503 - 1515. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-W. Park, M. E. Gruys, K. McCormick, J.-K. Lee, J. Subleski, J. M. Wigginton, R. G. Fenton, J.-M. Wang, and R. H. Wiltrout Primary Hepatocytes from Mice Treated with IL-2/IL-12 Produce T Cell Chemoattractant Activity that Is Dependent on Monokine Induced by IFN-{{gamma}} (Mig) and Chemokine Responsive to {{gamma}}-2 (Crg-2) J. Immunol., March 15, 2001; 166(6): 3763 - 3770. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Strasly, F. Cavallo, M. Geuna, S. Mitola, M. P. Colombo, G. Forni, and F. Bussolino IL-12 Inhibition of Endothelial Cell Functions and Angiogenesis Depends on Lymphocyte-Endothelial Cell Cross-Talk J. Immunol., March 15, 2001; 166(6): 3890 - 3899. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Kirk, D. Hartigan-OConnor, B. J. Nickoloff, J. S. Chamberlain, M. Giedlin, L. Aukerman, and J. J. Mulé T Cell-dependent Antitumor Immunity Mediated by Secondary Lymphoid Tissue Chemokine: Augmentation of Dendritic Cell-based Immunotherapy Cancer Res., March 1, 2001; 61(5): 2062 - 2070. [Abstract] [Full Text] |
||||
![]() |
M. T. Liu, D. Armstrong, T. A. Hamilton, and T. E. Lane Expression of Mig (Monokine Induced by Interferon-{{gamma}}) Is Important in T Lymphocyte Recruitment and Host Defense Following Viral Infection of the Central Nervous System J. Immunol., February 1, 2001; 166(3): 1790 - 1795. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Inngjerdingen, B. Damaj, and A. A. Maghazachi Expression and regulation of chemokine receptors in human natural killer cells Blood, January 15, 2001; 97(2): 367 - 375. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Liu, B. P. Chen, P. Oertel, M. J. Buchmeier, D. Armstrong, T. A. Hamilton, and T. E. Lane Cutting Edge: The T Cell Chemoattractant IFN-Inducible Protein 10 Is Essential in Host Defense Against Viral-Induced Neurologic Disease J. Immunol., September 1, 2000; 165(5): 2327 - 2330. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yao, S. E. Pike, J. Setsuda, J. Parekh, G. Gupta, M. Raffeld, E. S. Jaffe, and G. Tosato Effective targeting of tumor vasculature by the angiogenesis inhibitors vasostatin and interleukin-12 Blood, September 1, 2000; 96(5): 1900 - 1905. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. E. Carson, J. E. Dierksheide, S. Jabbour, M. Anghelina, P. Bouchard, G. Ku, H. Yu, H. Baumann, M. H. Shah, M. A. Cooper, et al. Coadministration of interleukin-18 and interleukin-12 induces a fatal inflammatory response in mice: critical role of natural killer cell interferon-gamma production and STAT-mediated signal transduction Blood, August 15, 2000; 96(4): 1465 - 1473. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. N. Lauw, A. J. H. Simpson, J. M. Prins, S. J. H. van Deventer, W. Chaowagul, N. J. White, and T. van der Poll The CXC Chemokines Gamma Interferon (IFN-gamma )-Inducible Protein 10 and Monokine Induced by IFN-gamma Are Released during Severe Melioidosis Infect. Immun., July 1, 2000; 68(7): 3888 - 3893. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takeda, Y. Hayakawa, M. Atsuta, S. Hong, L. Van Kaer, K. Kobayashi, M. Ito, H. Yagita, and K. Okumura Relative contribution of NK and NKT cells to the anti-metastatic activities of IL-12 Int. Immunol., June 1, 2000; 12(6): 909 - 914. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Frederick, Y. Henderson, X. Xu, M. T. Deavers, A. A. Sahin, H. Wu, D. E. Lewis, A. K. El-Naggar, and G. L. Clayman In Vivo Expression of the Novel CXC Chemokine BRAK in Normal and Cancerous Human Tissue Am. J. Pathol., June 1, 2000; 156(6): 1937 - 1950. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Watarai, S. Koga, D. R. Paolone, T. M. Engeman, C. Tannenbaum, T. A. Hamilton, and R. L. Fairchild Intraallograft Chemokine RNA and Protein During Rejection of MHC-Matched/Multiple Minor Histocompatibility-Disparate Skin Grafts J. Immunol., June 1, 2000; 164(11): 6027 - 6033. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Sleeman, J. K. Fraser, J. G. Murison, S. L. Kelly, R. L. Prestidge, D. J. Palmer, J. D. Watson, and K. D. Kumble B cell- and monocyte-activating chemokine (BMAC), a novel non-ELR {alpha}-chemokine Int. Immunol., May 1, 2000; 12(5): 677 - 689. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sharma, M. Stolina, J. Luo, R. M. Strieter, M. Burdick, L. X. Zhu, R. K. Batra, and S. M. Dubinett Secondary Lymphoid Tissue Chemokine Mediates T Cell-Dependent Antitumor Responses In Vivo J. Immunol., May 1, 2000; 164(9): 4558 - 4563. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Dunussi-Joannopoulos, K. Runyon, J. Erickson, R. G. Schaub, R. G. Hawley, and J. P. Leonard Vaccines With Interleukin-12-Transduced Acute Myeloid Leukemia Cells Elicit Very Potent Therapeutic and Long-Lasting Protective Immunity Blood, December 15, 1999; 94(12): 4263 - 4273. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Bukowski, P. Rayman, L. Molto, C. S. Tannenbaum, T. Olencki, D. Peereboom, R. Tubbs, D. McLain, G. T. Budd, T. Griffin, et al. Interferon-{{gamma}} and CXC Chemokine Induction by Interleukin 12 in Renal Cell Carcinoma Clin. Cancer Res., October 1, 1999; 5(10): 2780 - 2789. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Ha, C. H. Lee, S. B. Lee, C. M. Kim, K. L. Jang, H. S. Shin, and Y. C. Sung A Novel Function of IL-12p40 as a Chemotactic Molecule for Macrophages J. Immunol., September 1, 1999; 163(5): 2902 - 2908. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Pike, L. Yao, K. D. Jones, B. Cherney, E. Appella, K. Sakaguchi, H. Nakhasi, J. Teruya-Feldstein, P. Wirth, G. Gupta, et al. Vasostatin, a Calreticulin Fragment, Inhibits Angiogenesis and Suppresses Tumor Growth J. Exp. Med., December 21, 1998; 188(12): 2349 - 2356. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |