| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
B Nuclear Binding and Is Inhibited by Adenovirus-Mediated Expression of Inhibitor of B
1
*
Department of Infectious Diseases, Imperial College School of Medicine (Hammersmith Campus), and
Pediatric Infectious Diseases Unit, St. George’s Hospital Medical School, London, United Kingdom; and
Environmental Protection Agency, Chapel Hill, NC 27514
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B translocation to
the nucleus and binding to the RANTES-specific B-binding sequences
within 2 h, with levels peaking at 24 h. Supershift assays
indicated that binding was due to p50/p65 heterodimers. BEAS-2B cells
were transfected with a replication-deficient adenoviral vector,
expressing a mutated, nondegradable form of IB
. IB
overexpression specifically blocked NF-B translocation and inhibited
mRNA accumulation and secretion of RANTES induced by RSV or TNF-
plus IFN-
. Adenoviral transfection did not interfere with RSV
replication or significantly induce apoptosis. Further, a control
adenovirus, expressing the ß-galactosidase gene, did not alter
cellular functions. Thus, NF-B nuclear translocation is a critical
step in RSV induction of RANTES secretion. Elucidating the mechanisms
of cellular activation by RSV and targeting specific areas may lead to
novel therapeutic approaches in the treatment of RSV. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Chemokines are chemoattractant cytokines that appear critical in cellular recruitment to sites of RSV infection. The chemokine family is divided, on structural criteria, into two main groups (15, 16). The C-X-C chemokines, typified by IL-8, are mainly neutrophil and T cell chemoattractants, while C-C chemokines are involved in recruitment of monocytes, T lymphocytes, and eosinophils to areas of infection and inflammation (17, 18, 19). Human alveolar macrophages (20) and neutrophils (21) may secrete IL-8 following in vitro RSV infection. However, the respiratory epithelium is the primary target for viral infection, and epithelial cells have a pivotal role in initiation of cellular recruitment. RSV infection of human respiratory epithelial cell lines is known to induce transcription-dependent secretion of the C-X-C chemokine IL-8 (22, 23) and of the C-C chemokine RANTES, but not that of other C-C chemokines, monocyte chemotactic protein-1 or -3 or macrophage inflammatory protein-1ß (24). RANTES is a potent chemoattractant for CD4+ T cells of the memory phenotype, monocytes, basophils, and eosinophils (25, 26, 27). RANTES, but not IL-8, was detected in RSV-infected cultures of primary human respiratory epithelial cells (28), although both chemokines have been detected in clinical samples (24, 29). The mechanisms regulating the secretion of this chemokine in response to RSV are not well understood.
NF-B is an important family of rel-related transcription
factors that is necessary, although not sufficient, for transcription
of many chemokine and other proinflammatory genes. NF-B is retained
in an inactive form in the cytoplasm through its association with the
inhibitory protein IB (30). Following cellular stimulation,
phosphorylation, then ubiquitination and subsequent proteolysis of
IB, frees NF-B to translocate to the nucleus, where it
regulates transcription of responsive genes by interacting with B
binding sites (31, 32). There is a consensus binding site for NF-B
in the RANTES promoter at position -30 relative to the transcriptional
start site (33). It has been shown that TNF and IL-1ß may up-regulate
RANTES gene expression in respiratory epithelial cells (34, 35), and
both these cytokines are known to activate NF-B (36). There are
currently no specific data concerning the mechanisms by which RSV is
able to regulate RANTES gene expression in epithelial cells.
The purpose of this study, therefore, was to determine whether RSV
activates RANTES secretion by up-regulating its transcription in
respiratory epithelial cells. Further, we have specifically examined
the involvement of the transcription factor NF-B in RSV-induced
RANTES expression. We found that active virus was required for RANTES
gene expression and that this was preceded by specific translocation of
the p65/p50 NF-B heterodimer to the nucleus in both respiratory
epithelial cell lines and primary cells. To demonstrate that such
NF-B activity was critical in the regulation of RANTES secretion,
cells were transfected with an adenovirus that constitutively expresses
a stable form of the inhibitory protein IB. The adenoviral
IB vector did not significantly affect RSV replication, but did
abolish RSV-induced nuclear translocation of NF-B and consequent
RANTES gene expression and secretion. Thus, RSV infection of human
respiratory epithelial cells causes NF-B trans-activation
of the RANTES gene.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Keratinocyte growth medium and bronchial epithelial growth
medium (BEGM) for cell culture were purchased from Clonetics (San
Diego, CA), while medium 199-Eagle’s MEM was supplied by Life
Technologies (Grand Island, NY). Trypsin (0.05%) with 0.02% EDTA was
purchased from Biosciences (Lenexa, KS). The cytokines TNF- and
IFN- were both purchased from R&D Systems (Minneapolis, MN). The
protease inhibitors leupeptin, E64, chymostatin, pepstatin, antipain,
bestatin, and Pefabloc were purchased from Boehringer Mannheim
(Indianapolis, IN). Santa Cruz Biotechnology (Santa Cruz, CA) supplied
rabbit polyclonal Abs to IB, p50, p65, c-Rel, and C/EBP-ß.
FITC-labeled donkey anti-rabbit Ab was obtained from Jackson
Laboratories (Beverly, MA). The reagents for RT-PCR were obtained as
follows: Moloney murine leukemia virus reverse transcriptase was from
Life Technologies (Gaithersburg, MD), dNTP was from Pharmacia (Pleasant
Hill, CA), RNasin was from Promega (Madison, WI), and Taq
polymerase was from Boehringer Mannheim. All other chemical reagents
were purchased from Sigma (St. Louis, MO).
Cell culture
The human bronchial epithelial cell line BEAS-2B (37) was cultured in serum-free keratinocyte growth medium. The human alveolar epithelial cell line A549 (38) was maintained in RPMI containing 10% endotoxin-free FBS and 20 µg/ml gentamicin. Normal human tracheobronchial epithelial cells (NHBE) were obtained by brush biopsy during bronchoscopy of healthy volunteers. Briefly, a bronchoscopy cytologic brush (Bard, Tewksbury, MA) was inserted through the bronchoscope, and epithelial cells were removed by gentle brushing in the tracheobronchial region. The cells were removed from the brush by vigorous pipetting and were disaggregated in BEGM containing 3 mM DTT for 15 min. After washing in BEGM, cells were plated onto collagen-coated 16-mm diameter culture wells and grown to confluence. NHBE cells were used in the assays at passages 3 and 4. All cells were routinely cultured in 100-mm petri dishes. For experiments, the cells were detached using 0.05% trypsin with 0.02% EDTA and seeded at 2 x 105 cells/24-mm well in 12-well culture plates or at 3 x 106 cells/100-mm culture dish.
Preparation of RSV
Long strain RSV (American Type Culture Collection, Rockville, MD) was propagated in HEp-2 cell cultures according to methods described (39). Supernatants from these cells were harvested, and virus was precipitated with 50% polyethylene glycol. This precipitate was then dissolved in 50 mM Tris-HCl plus 1 mM EDTA and overlaid onto a discontinuous sucrose gradient of 60, 45, and 30% in Eagle’s MEM. After centrifugation for 90 min at 85,000 x g, virus was collected from the 30 to 45% interface, aliquoted, and stored at -80°C. Virus titer was measured by placing 10-fold dilutions of virus preparations onto 70% confluent layers of HEp-2 cells in 48-well plates. After 1 h, the virus-containing medium was replaced with 2 ml of overlay medium consisting of 1.2% methylcellulose and 2% FBS in DMEM. The plates were incubated for 4 days at 37°C, then fixed and stained with cresyl violet, and plaques were counted under a light microscope. The virus titer, expressed as plaque-forming units (PFU) per milliliter, was determined as the reciprocal of the dilution of virus causing one plaque per well. RSV preparations used for experiments contained 1.4 x 107 PFU/ml. For experiments examining the effects of noninfectious RSV (UV-RSV), virus preparations were UV-inactivated with 1800 mJ of UV light in a UV Stratalinker (Stratagene, La Jolla, CA).
RSV infection of epithelial cells
Cultures of BEAS-2B, A549, and NHBE were infected with RSV at a multiplicity of infection (MOI) of 0.3 PFU/cell. The virus was added to cells in the appropriate serum-free medium and allowed to adsorb for 1 h, after which the supernatant was removed and replaced with fresh medium. The cells were then incubated for up to 72 h. At specific time points, cell-free supernatants were collected for cytokine detection. The cells were either harvested into 4 M guanidine isothiocyanate for RNA isolation or lysed for cellular protein detection. Samples were stored at -80°C until further analysis.
Transfection of cells with adenoviral vectors
Recombinant replication-deficient adenovirus 5 (Ad5) containing
mutated IB was constructed using the methods of Graham et al.
(40) in the laboratory of Dr. D. Brenner (University of North Carolina,
Chapel Hill) and provided through the Gene Therapy Core facility at
University of North Carolina. In brief, plasmid pRc/CMV-IB S32A/S36A
(provided by Dr. J. Dinato, University of San Diego, San Diego), which
contains a hemagglutinin-tagged human super-repressor of NF-B, was
subcloned into the XbaI site of the pACCMV.PLPASR(+) plasmid
to construct the plasmid pACCMV/IÍB, in which IB is driven by
the CMV promoter/enhancer. The plasmid DNA was prepared by the alkaline
lysis method and purified by CsCl-ethidium bromide density
centrifugation. The recombinant Ad5-IB was then constructed by
cotransfection of the 293 embryonic kidney cell line with the
pACCMV/IÍB plasmid plus the purified fragment of
ClaI-digested DNA from E1-deleted Ad5. The presence of
mutant IB sequence packaged into recombinant Ad5 was confirmed by
PCR and Western blotting. The IB gene was constructed such that
the translated protein was mutated at positions 32 and 36 to replace
serine in each case, thus preventing the normal sites for
phosphorylation that signal subsequent degradation of IB (41).
Ad5-IB was grown in 293 cells and purified by banding twice on
CsCl gradients. Viral titer was determined by optical densitometry
(particles per milliliter) and by plaque assay. Recombinant virus was
then stored in 10% (v/v) glycerol at -20°C. Ad5-LacZ, which
contains Escherichia coli, ß-galactosidase gene, was also
grown and purified as described above and used as the control virus.
The adenoviruses were added to epithelial cells at an MOI of 100 virus
particles/cell and incubated for 1 h at 37°C. For experiments
involving study of RSV infection, both the RSV and adenovirus vector
were added to cell cultures simultaneously. In other experiments, the
transfection medium was first removed and replaced with fresh medium.
Cells were then stimulated with either TNF- (10 ng/ml), IFN- (10
ng/ml), or TNF- and IFN- together at the same concentrations.
Western blotting and SDS-PAGE electrophoresis
Expression of adenoviral vector proteins over 96 h was
confirmed by Western blotting. For detection of IB, cells were
lysed with ice-cold PBS containing 0.1% SDS, 0.1% Nonidet P-40, 0.5%
deoxycholate, 10 mM NaF, 1 mM VaSO4, 170 µg/ml PMSF,
and a mixture of protease inhibitors (leupeptin, E64, chymostatin,
pepstatin, antipain, bestatin, and Pefabloc; all at 1 µg/ml). Lysates
were harvested and centrifuged at 800 x g for 5 min at
4°C to pellet debris. Supernatant was removed, and an equal volume of
loading buffer (containing 50 mM HEPES (pH 6.8), 10% glycerol, 5%
ß-ME, 2% SDS, and bromophenol blue) was added. The samples were
boiled for 5 min and then immediately frozen at -80°C. Protein were
separated by SDS-PAGE, and transferred by electroblotting to a
nitrocellulose membrane (0.45-µm pore size; Bio-Rad, Hercules, CA).
Western blots were blocked with PBS containing 0.05% Tween-20 and 3%
milk protein before being incubated at 4°C overnight with 1 µg/ml
rabbit anti-human IB. After washing with PBS containing
0.05% Tween-20, the blot was incubated with peroxidase-conjugated goat
anti-rabbit IgG, and bands were detected using enhanced
chemiluminescence reagents and film according to the manufacturer’s
instructions (Amersham, Arlington Heights, IL; DuPont-New England
Nuclear, Wilmington, DE). Unstimulated HeLa cell extracts (New England
BioLabs, Beverly, MA) were used as a positive control for wild-type
IB.
Assessment of ß-galactosidase activity
In cells exposed to Ad5-LacZ, transfection was assessed by staining for ß-galactosidase activity. The cell monolayers were fixed in 5% glutaraldehyde, then incubated for 30 min at room temperature with X-Gal (5-bromo-4-chloro-3-indolyl ß-D-galactoside) (1 mg/ml) in PBS plus 5 mM KFe3(CN)6, 5 mM KFe4(CN)6, and 1 mM MgCl2. The monolayers were then washed, and the proportion of cells stained blue was determined by assessing the percent area positive for staining in 20 fields/well.
Assessment of cell viability and apoptosis
The effect of adenovirus transfection on cell viability was assessed by trypan blue exclusion of trypsinized cells. Numbers of viable cells from wells that had been transfected with adenovirus or left untreated for 48 h were stained with 0.4% trypan blue and counted in triplicate. For apoptosis measurements, cells were fixed with 4% paraformaldehyde for 10 min, then stained with Hoescht 33258 (1 µg/ml in PBS plus 0.1% Triton X-100). Cells were then viewed by fluorescence microscopy. Cells with large, round nuclei were designated healthy, while those with pyknotic nuclei and chromosomal fragmentation were counted as apoptotic.
Isolation of nuclear extracts and electromobility shift assays (EMSAs)
BEAS-2B and NHBE cells were plated into petri dishes and
inoculated with 0.3 MOI of RSV. Dishes were processed after 0, 2, 8,
24, or 48 h. At each time point, nuclear extracts were prepared
using a modified version of the protocol of Durand et al. (42), and
protein levels were quantified spectrophotometrically at 590 nm using
the Bradford assay system (43). Two micrograms of nuclear extract was
added to 0.3 ng of 32P end-labeled double-stranded DNA
probe in a binding buffer containing 10 mM Tris-HCl (pH 7.9), 50 mM
NaCl, 0.25 mM EDTA, 1 mM DTT, 0.25 mg/ml BSA, 5 µg/ml poly(dI-dC),
and 4% Ficoll. The probes used were those specific for the RANTES
NF-B site, (5'-TAGGGGATGCCCCTC-3') (33) and the consensus binding
region for the Sp1 transcription factor (5'-ATTCGATCGGGGCGGGGCGAG-3';
Promega). Bound and free probes were separated by PAGE and visualized
using the PhosphorImager system (Molecular Dynamics, Sunnyvale, CA).
Competition assays were conducted by adding a 10-fold excess of
unlabeled probe to the reaction or an unrelated probe specific for the
binding region of the transcription factor activating protein-1 (AP-1;
5'-CGCTTGATGAGTCAGCCGGAA-3'; Promega). For supershift assays 1 µg of
Abs to the NF-B subunits p50, p65, and c-Rel or to the unrelated
factor C/EBP-ß was added to the binding mix and incubated for 15 min
at room temperature before running on an SDS-PAGE gel.
Fluorescence cell staining
BEAS-2B cell monolayers grown on glass coverslips in 12-well
plates were treated with adenovirus vectors and stimulated with RSV
(0.3 MOI) for 24 h. The cells were then fixed with 70% ice-cold
acetone/30% methanol for 10 min. After rinsing with physiologic saline
containing 20% human serum albumin (Sa-HSA), rabbit Abs to NF-B p65
(2 µg/ml) and IB (1 µg/ml) in Sa-HSA were added for 60 min at
room temperature. The wells were rinsed five times with Sa-HSA, and
then FITC-donkey anti-rabbit Ab was added for 30 min. Coverslips
were rinsed and mounted, and the image of fluorescently labeled cells
was captured by a Zeiss CCD camera system (New York, NY).
RNA isolation and RT-PCR
RNA was harvested from cells using 4 M guanidine isothiocyanate, then purified as described previously (44, 45). cDNA was then generated by reverse transcribing 0.1 µg of RNA with 10 U/µl reverse transcriptase, 0.5 mM dNTP, 1 U/µl, 0.5 mM spermidine, and 5 mM random hexamers in a reaction buffer consisting of 10 mM Tris-HCl (pH 9.3), 50 mM KCl, 3 mM MgCl2, and 0.1 mg/ml BSA. PCR amplification was performed on 2 ml of cDNA using 0.025 U/µl Taq polymerase, 0.05 mM dNTP, and 0.1 to 0.2 pM RANTES primer pairs (sense, GCTGTCATCCTCATTGCTAC; antisense, TCCATCCTAGCTCATCTCCA) in the reaction buffer. The PCR was initiated by a single cycle of 1 min at 94°C, 1.5 min at 56°C, and 2 min at 72°C, followed by cycles in which the denaturation step was reduced to 30 s. The identity of PCR sequences was confirmed by sequencing and Northern blotting with a probe for an internal DNA sequence. Standardization of cDNA was achieved using primer pairs for GAPDH in the reaction. Ten microliters of PCR product from cycles 28 and 31 to 34 was run out on 2% agarose, and the gels were stained with ethidium bromide (5 µg/ml). DNA was visualized under UV light and photographed with type 55 positive/negative film (Polaroid, Cambridge, MA).
Cytokine assay
RANTES concentrations in supernatants were measured by specific ELISAs. ELISA kits for RANTES were obtained from R&D Systems, and the manufacturer’s instructions were followed. The lower limit of sensitivity of the assay was 8 to 15 pg/ml.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BEAS-2B cells were infected with 0.3 MOI RSV, UV-inactivated RSV,
or control medium and incubated for 72 h at 37°C. Tissue culture
supernatants and RNA extracts were harvested at specific time points.
RANTES protein was detectable in supernatants of RSV-infected cells
after 24 h, and concentrations continued to increase up to 72
h in these cells (Fig. 1
A). RT-PCR analysis of
cellular mRNA demonstrated that message for RANTES was just detectable
at 8 h, was clearly expressed by 24 h, and increased up to
72 h (Fig. 1B). No RANTES expression or
secretion was observed in cells stimulated by medium alone or by
UV-inactivated virus, which confirmed our previous observation that
activation of this chemokine is dependent upon active virus replication
within cells (24). In view of findings that MIP-1 plays a key role
in the inflammatory response to influenza in mice (46), we also
measured secreted MIP-1 levels; however, RSV caused only small
amounts (<100 pg/ml) to be released (data not shown). Further, we did
not detect any mRNA or protein for eotaxin, another potent eosinophil
attractant of the ß-chemokine family with homology to RANTES (data
not shown).
|
B in RSV-infected cells
To further elucidate the mechanisms underlying RSV-induced RANTES
gene activation, the binding of NF-B to the RANTES NF-B sequence
following epithelial cell stimulation by RSV was examined. Nuclear
proteins were extracted from BEAS-2B and NHBE cells at 0, 2, 8, 24, and
48 h post-RSV or UV-RSV infection before performing EMSAs (Fig. 2). Extracts from both BEAS-2B (Fig. 2A) and NHBE (Fig. 2B) showed clear
NF-B binding, which was detectable after 2 h, peaked at 24
h, and was still apparent after 48 h. This time course of
activation is temporally coincident with the gene expression and
secretion of RANTES from RSV-infected cells. Addition of an excess of
cold probe specific for the RANTES NF-B site blocked binding to the
labeled probe, whereas excess cold oligonucleotide specific for the
AP-1 binding site had no effect, thus verifying the specificity of the
binding reaction. BEAS-2B extracts were also run on EMSA and probed
with an oligonucleotide specific for the binding sequence for Sp-1 to
demonstrate extract loading, since it has been found that RSV does not
up-regulate Sp-1 binding, nor is Sp-1 is present in the RANTES promoter
(33). As predicted, no change in the binding patterns was observed
following exposure to RSV or control stimuli (Fig. 2C). Supershift assays on extracts taken 24 h
after RSV infection revealed that the NF-B binding activity involved
both the p50 and p65 subunits, but not c-Rel (Fig. 3). In addition, the irrelevant Ab
C/EBP-ß did not affect NF-B binding. Identical shifting patterns
were observed in the BEAS-2B cell line and in primary NHBE cells,
indicating that both cell types exhibit similar responses to
RSV.
|
|
To determine the importance of NF-B translocation to the
nucleus in RSV-induced RANTES production, replication-deficient Ad5
vectors were used to introduce the gene and overexpress the protein for
IB. BEAS-2B cells transfected with the adenoviruses were cultured
for up to 96 h to investigate the kinetics of IB protein
synthesis and the stability of transfections. Cell lysates were
obtained from Ad5-IB-transfected cells, and equal amounts of
cellular protein run in Western blots to detect IB (Fig. 4A). Substantial levels
of the adenoviral IB were present 24 h after introduction of
the virus, and levels diminished slightly but nonetheless persisted
throughout the 96-h period examined. Levels of endogenous IB did
increase over the time period examined; however, expression of the
adenoviral IB markedly exceeded that of the endogenous protein
present in either untreated or transfected cells. In parallel to these
experiments cells transfected with Ad5-LacZ were fixed at each time
point and stained for ß-galactosidase activity using the substrate
X-Gal. Again, protein production was evident at 24 h and was
maintained through 96 h (Fig. 4B). No staining
was observed in untreated cells. All future experiments with the
adenoviruses were performed at either the 24 or 48 h points, when
transfection was both effective and stable, and endogenous IB
activation was minimal.
|
It was a concern that although the adenoviruses themselves were
unable to replicate, they might interfere with the infection and
replication of RSV within epithelial cells, a prerequisite for RANTES
secretion. Further IB overexpression itself had the potential to
alter viral replication. The effects of Ad5-IB and Ad5-LacZ on
RSV replication were therefore investigated by measuring virus titer in
supernatants collected 48 h after simultaneous RSV infection and
adenovirus transfection of BEAS-2B cells. Supernatants were placed onto
HEp-2 cell layers and overlaid with methylcellulose, and the number of
plaque-forming units was assessed after 4 days. There was a slight, but
insignificant, decrease in infectious RSV titer in samples from
adenovirus-treated cells (Fig. 5). There
was no difference in viral titers obtained from Ad5-IB vs
Ad5-LacZ cell supernatants (Ad5-IB titer = 0.52 ±
0.10 x 106; Ad5-LacZ titer = 0.59 ±
0.17 x 106). These data show that RSV replication is
NF-B independent.
|
To ensure that adenovirus transfection was in no way toxic to
cells, transfected BEAS-2B cells were assessed alongside control cells
for viability and apoptosis (see Table I).
These experiments showed that although adenovirus transfection itself
caused a slight decrease in the viability of BEAS-2B cells, there was
no appreciable difference between those cells transfected with
Ad5-IB and those transfected with Ad5-LacZ. Similarly, apoptosis
was slightly increased in transfected cells vs controls, but no
difference was seen between Ad5-IB- and Ad5-LacZ-transfected
cells. Further, these experiments, which were performed 48 h
post-transfection, showed that under any of these conditions, <10% of
BEAS-2B cells exhibited signs of apoptosis. Further, these experiments
showed that <3% of NHBE cells became apoptotic under any condition
(data not shown). Thus, Ad5-IB does not appear to have any
significant effect on cell viability or apoptosis; therefore, apoptosis
cannot account for changes in cell responses due to IB.
|
B overexpression on NF-B activity
Having established the efficacy of adenoviral transfection for
these studies, the functional effect of IB overexpression on
NF-B translocation was then confirmed by both EMSA and fluorescent
cell staining. For EMSAs, nuclear proteins were harvested from BEAS-2B
cells exposed to adenovirus and infected with RSV. Extracts were
obtained 24 and 48 h following RSV addition. RSV induced NF-B
binding activity at both 24 and 48 h in nontransfected cells, and
this was essentially unchanged in cells infected with Ad5-LacZ, but was
totally absent in cells transfected with Ad5- IB (Fig. 6). Using direct immunofluorescence, it
was confirmed that Ad5-IB prevented translocation of NF-B from
the cytoplasm to the nucleus (Fig. 7). In
unstimulated, Ad5-LacZ-transfected cells there was even cytoplasmic
distribution of NF-B which, after RSV infection, was redistributed
to and around the nucleus. Cells that were transfected with
Ad5-IB displayed intense staining for IB throughout the
cytoplasm. However, NF-B initially localized to the cytoplasm in
these cells did not translocate to the nucleus following RSV infection.
Thus, the vector-expressed IB functions in an identical manner to
endogenously synthesized protein. Further, the lack of effect of
Ad5-LacZ indicates that the addition of adenovirus vectors per se does
not activate the cells.
|
|
B overexpression on RANTES gene expression and
secretion
To assess the effect of transfection with Ad5-IB on RANTES
gene expression and secretion, BEAS-2B and NHBE cells, transfected with
either Ad5-IB or Ad5-LacZ, were infected with RSV or stimulated
with TNF- plus IFN- (10 ng/ml each). Cells were then cultured for
48 h before supernatants and RNA were harvested. Similar
experiments were performed using the A549 cell line, which is alveolar
in origin and frequently used in experimental models of RSV infection.
The Ad5 vectors themselves did not cause any cell type to secrete
appreciable levels of RANTES into tissue culture medium (Fig. 8, A–C, lefthand
bars). The vectors also did not stimulate any IL-8
secretion (data not shown). However, RSV-induced RANTES protein
production was drastically decreased by overexpression of IB. It
was not significantly affected in cells containing Ad5-LacZ. These
results were consistently found in experiments using BEAS-2B cells
(Fig. 8A), NHBE cells (Fig. 8B), or
A549 cells (Fig. 8C). Similarly, RANTES secretion in
response to stimulation of epithelial cells with TNF- plus IFN-
was ablated by Ad5-IB, but not Ad5-LacZ, in all cell types.
Interestingly, neither TNF- nor IFN- alone was able to induce
epithelial cells to secrete RANTES. This specific inhibitory effect of
Ad5-IB was also seen on RANTES mRNA levels in BEAS-2B, NHBE, and
A549 cells (Fig. 9), indicating that
inhibition of NF-B by overexpression of IB activity directly
decreases transcription of this chemokine gene in RSV-infected human
airway epithelial cells.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B nuclear binding. Such gene expression was abolished by
overexpression of IB following transfection with an adenoviral
vector. Trans-activation of NF-B did not occur in
respiratory epithelial cells exposed to UV-inactivated RSV. NF-B
translocation to the nucleus was necessary for the large induction of
RANTES gene activity in both primary cells and the BEAS-2B cell line.
In RSV infection, RANTES secretion begins by approximately 24 h
and increases over the next 48 h, a time course consistent with
both the delayed onset of proinflammatory symptoms in infants (47) and
the presence of RANTES in clinical specimens (24). Such a delay may
indicate that transcription factors in addition to NF-B may be
involved in activation of the RANTES gene. The levels of RANTES
measured within supernatants in this study are broadly similar to those
found in a comparable study of human epithelial cells by Saito et
al. (30).
NF-B is a family of rel-related transcription factors,
comprising dimers of at least five different subunits in various
combinations, that have varied stimulatory and inhibitory effects on
the promoter regions of different genes (48). Thus, binding of specific
family members is an additional mechanism giving specificity to
proinflammatory gene activation. Supershift assays performed in the
present study have demonstrated that the binding of BEAS and NHBE
nuclear extracts to the B-binding site in the RANTES promoter was
attributable to both p50 and p65 (RelA) subunits. This is similar to
the pattern seen in RANTES production from an activated T cell line in
which both p50/p65 heterodimers and p50/p50 homodimers are reported to
bind B sequences (49). In addition, heterodimers of p50 and p65 as
well as homodimers of p50 have been reported to be
trans-activated following IL-1ß stimulation of RANTES in
human bronchial epithelial cells (50). RelA binding was also shown to
be involved in RSV-induced IL-8 secretion from A549 cells (51).
c-rel which, in association with p65, is important in
switching on several inducible proinflammatory genes, such as that of
granulocyte-macrophage CSF (52), was not supershifted in our
experiments.
The data we obtained with cells overexpressing a nondegradable
mutant of IB provides evidence for the central role of NF-B in
the regulation of RANTES secretion in RSV-infected respiratory
epithelial cells. These studies also demonstrate that NF-B itself is
not necessary for RSV replication within epithelial cells. Under
resting physiologic conditions, cytosolic NF-B is prevented from
entering the nucleus because it is bound to endogenous IB in the
cytoplasm (53, 54). Appropriate stimuli cause site-specific
phosphorylation of IB and subsequently its proteolysis, thereby
freeing NF-B to translocate to the nucleus. However, the gene for
the protein expressed by Ad5-IB has been specifically mutated to
replace serines 32 and 36, thus preventing the normal phosphorylation
of IB (41). The high levels of the adenoviral protein expressed
ensured that NF-B remained bound in the cytoplasm (Fig. 7
).
Ad5-IB vectors, whose use as transfection agents has only
previously been reported in studies of endothelial cell activation
(55), have a number of advantages over other approaches in the
investigation of NF-B function. Pharmacologic inhibitors of NF-B
activity (56), such as antioxidants like pyrrolidine dithiocarbamate,
are relatively nonspecific, exhibiting actions on other transcription
factors (57), and do not directly block NF-B activation.
Oligonucleotides have also been used to compete with endogenous B
sites for NF-B binding, but large concentrations were required to
achieve this (58). Transfections via electroporation have also been
employed to overexpress IB (59), but these have a much lower
transfection efficiency than that using adenoviruses, with which
transfection routinely occurs in approximately 70% of all cells in our
experiments. In addition, it has been shown that neither Ad5-LacZ nor
wild-type Ad5 cause any IL-6 or IL-8 secretion from human epithelial
cells (60), and we, too, found no induction of IL-8 or RANTES by the
vectors themselves. Although NF-B has been found to inhibit
apoptosis in some cells (61, 62), we found no significant increases in
apoptotic activity or cell death with Ad5-IB transfection vs
Ad5-LacZ or controls. Thus, these vectors represent an excellent
mechanism by which specific intracellular pathways may be
manipulated.
Transfection of epithelial cells with the Ad5-IB vector
caused RSV-induced RANTES gene expression and secretion to be markedly
reduced. This effect was observed in NHBE cells as well as in both
BEAS-2B and A549 cell lines, suggesting that it is of fundamental
importance in the immune response of respiratory epithelial cells to
RSV. Similar data were obtained when epithelial cells were stimulated
with TNF- and IFN- together, but TNF- alone was not able to
induce RANTES secretion. Since TNF- alone is a potent inducer of
NF-B (63, 64), this is evidence that NF-B is necessary, but not
sufficient, for RANTES gene activation, and that other, as yet
unidentified, factors also play roles. The fact that Ad5-IB
vector transfection did not completely abolish RSV-dependent RANTES
secretion is supportive of additional transcription factors being
involved in the regulation of this chemokine gene by RSV. Indeed the
regulation of RANTES expression is known to be complex and tissue
specific. For example, distinct transcription factors differentially
regulate early and late RANTES expression in T lymphocytes (65). There
are also multiple binding sites for other transcription factors,
including AP-1, AP-3, and Common Factor-1 (CF-1), in the RANTES
promoter (33). In addition, it is apparent from studies in T
lymphocytes that not only may distinct binding sites for
transcriptional regulators be important, but also that novel regulatory
proteins may bind to known B-like sequences (49, 65). Further, it is
evident that direct interactions between transcription factors may
provide an additional level of gene regulation. We are therefore
currently investigating the roles of other transcription factors in
RANTES-specific gene activation.
In contrast to our findings with RANTES, NF-B-dependent activation
of the IL-8 gene has been demonstrated upon stimulation of airway
epithelial cells with both live and UV-inactivated RSV, suggesting
differential regulation of the two chemokines (22, 51, 66). In A549
cells, IL-8 gene activation appeared to occur in a biphasic manner. A
rapid, but transient, burst of IL-8 production, which is independent of
viral replication (67), is followed by a more delayed,
replication-dependent phase of IL-8 secretion (68). Also, in vivo
studies have detected an early peak of IL-8 secretion in nasal lavage
samples, followed by a gradual increase in both IL-8 and RANTES protein
in RSV-infected adults (69). mRNA for RANTES, but not for IL-8, was
increased in epithelial cells taken at this later time point,
indicating that the epithelium is probably not the main source of the
late phase IL-8 in this infection (T. L. Noah, F. W. Henderson, I.
A. Wortman, J. Carson and S. Becker, unpublished observations).
Further, NF-IL-6 appears to be critical in the early activation of the
respiratory epithelial cell IL-8 gene in response to RSV (66, 67), but
there are no data indicating that binding of this transcription factor
to the RANTES promoter region is necessary for gene expression,
supporting the idea that RANTES and IL-8 are in part regulated by
distinct mechanisms.
The fact that inhibition of NF-B translocation by Ad5-IB was
so effective at blocking the accumulation of RANTES mRNA and secretion
of protein by RSV not only demonstrates that NF-B is critical for
the activation of RANTES by RSV, but opens up possible novel
therapeutic approaches. Given the problems associated with the
development of a suitable vaccine against RSV, alternative effective
treatments are certainly needed for RSV infections, which can cause
severe illness in both infants and immunocompromised individuals.
Although NF-B itself, which influences a wide range of cellular
functions, does not seem to be a suitable target, more specific
inhibitors of C-C chemokine activation, delivered locally to the site
of excessive inflammation in patients with RSV, have the potential to
dampen down-recruitment of inflammatory cells to areas of infection.
For more specific target sites to be found, a greater understanding of
the mechanisms by which the different transcription factors
specifically interact to control activation of the RANTES promoter in
RSV infection is required.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. J. S. Friedland, Department of Infectious Diseases, Imperial College School of Medicine (Hammersmith Campus), Du Cane Rd., London, United Kingdom W12 0NN. E-mail address:
3 Abbreviations used in this paper: RSV, respiratory syncytial virus; IB, inhibitor of B; BEGM, bronchial epithelial growth medium; NHBE, normal human tracheobronchial epithelial; PFU, plaque-forming units; MOI, multiplicity of infection; Ad5, adenovirus type 5; EMSA, electrophoretic mobility shift assay; AP-1, activating protein-1; Sa-HSA, physiologic saline containing 20% human serum albumin; GAPDH, glyceraldehyde-6-phosphate dehydrogenase; X-Gal, 5-bromo-4-chloro-3-indolyl ß-D galactoside.
Received for publication October 22, 1997. Accepted for publication March 24, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) release and respiratory burst activity in human granulocytes. Immunology 82:184.[Medline]
B-like activity. Cell 65:1281.[Medline]
B- is necessary for activation of transcription factor NF-B. Nature 365:182.[Medline]
B- proteolysis by site-specific, signal induced phosphorylation. Science 267:1485.B: ten years after. Cell 87:13.[Medline]
B on serines 32 and 36 controls IB proteolysis and NF-B activation in response to diverse stimuli. EMBO J. 14:2876.[Medline]
for an inflammatory response to viral infection. Science 269:1583.B in the immune system. Annu. Rev. Immunol. 12:141.[Medline]
B binding activity. Biochem. Biophys. Res. Commun. 220:120.[Medline]
B-like sites that specifically bind c-Rel-p65 heterodimers. J. Biol. Chem. 269:823.
B: a specific inhibitor of the NF-B transcription factor. Science 242:540.B interacts with the nuclear localization sequences of the subunits of NF-B: a mechanism for cytoplasmic retention. Genes Dev. 6:1899.B, an inhibitor of the transcription factor NF, a mechanism for cytoplasmic retention. J. Exp. Med. 183:1013.B transcription factor and HIV-1. EMBO J. 10:2247.[Medline]
B and AP-1 in intact cells: AP-1 as a secondary antioxidant responsive factor. EMBO J. 12:2005.[Medline]
B/MAD3, and inhibitor of NF-B. EMBO J. 13:861.[Medline]
B or die?. Curr. Biol. 7:R94.[Medline]
-induced apoptosis by NF-B. Science 274:787. and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor B. Proc. Natl. Acad. Sci. USA 86:2336. and ß bind to the same two types of tumour necrosis factor receptors and maximally activate the transcription factor NF-B at low receptor occupancy and within minutes after receptor binding. J. Biol. Chem. 265:15183.B and NF-IL6. J. Infect. Dis. 174:262.[Medline]
B activation and interleukin-8 gene expression in A549 cells. Virol. 70:9079.
This article has been cited by other articles:
|
|
 |
|
  T. Okabayashi, S.-i. Yokota, Y. Yoto, H. Tsutsumi, and N. Fujii Fosfomycin Suppresses Chemokine Induction in Airway Epithelial Cells Infected with Respiratory Syncytial Virus Clin. Vaccine Immunol., June 1, 2009; 16(6): 859 - 865. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. P. Y. Hui, S. M. Y. Lee, C.-y. Cheung, I. H. Y. Ng, L. L. M. Poon, Y. Guan, N. Y. Y. Ip, A. S. Y. Lau, and J. S. M. Peiris Induction of Proinflammatory Cytokines in Primary Human Macrophages by Influenza A Virus (H5N1) Is Selectively Regulated by IFN Regulatory Factor 3 and p38 MAPK J. Immunol., January 15, 2009; 182(2): 1088 - 1098. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. S. Mohapatra and S. Boyapalle Epidemiologic, Experimental, and Clinical Links between Respiratory Syncytial Virus Infection and Asthma Clin. Microbiol. Rev., July 1, 2008; 21(3): 495 - 504. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. J. Culley, A. M. J. Pennycook, J. S. Tregoning, J. S. Dodd, G. Walzl, T. N. Wells, T. Hussell, and P. J. M. Openshaw Role of CCL5 (RANTES) in Viral Lung Disease. J. Virol., August 1, 2006; 80(16): 8151 - 8157. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Miller, C. Gerard, M. Schaller, A. D. Gruber, A. A. Humbles, and N. W. Lukacs Deletion of CCR1 Attenuates Pathophysiologic Responses during Respiratory Syncytial Virus Infection J. Immunol., February 15, 2006; 176(4): 2562 - 2567. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Jamaluddin, S. Choudhary, S. Wang, A. Casola, R. Huda, R. P. Garofalo, S. Ray, and A. R. Brasier Respiratory Syncytial Virus-Inducible BCL-3 Expression Antagonizes the STAT/IRF and NF-{kappa}B Signaling Pathways by Inducing Histone Deacetylase 1 Recruitment to the Interleukin-8 Promoter J. Virol., December 15, 2005; 79(24): 15302 - 15313. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Rajala, R. V. S. Rajala, R. A. Astley, A. L. Butt, and J. Chodosh Corneal Cell Survival in Adenovirus Type 19 Infection Requires Phosphoinositide 3-Kinase/Akt Activation J. Virol., October 1, 2005; 79(19): 12332 - 12341. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Imaizumi, M. Kumagai, K. Taima, T. Fujita, H. Yoshida, and K. Satoh Involvement of retinoic acid-inducible gene-I in the IFN-{gamma}/STAT1 signalling pathway in BEAS-2B cells Eur. Respir. J., June 1, 2005; 25(6): 1077 - 1083. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-C. T. Huang, Z. Li, L. E. Brighton, J. L. Carson, S. Becker, and J. M. Soukup 3-Nitrotyrosine attenuates respiratory syncytial virus infection in human bronchial epithelial cell line Am J Physiol Lung Cell Mol Physiol, May 1, 2005; 288(5): L988 - L996. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Tian, D. E. Nowak, M. Jamaluddin, S. Wang, and A. R. Brasier Identification of Direct Genomic Targets Downstream of the Nuclear Factor-{kappa}B Transcription Factor Mediating Tumor Necrosis Factor Signaling J. Biol. Chem., April 29, 2005; 280(17): 17435 - 17448. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. I. Wickremasinghe, L. H. Thomas, C. M. O'Kane, J. Uddin, and J. S. Friedland Transcriptional Mechanisms Regulating Alveolar Epithelial Cell-specific CCL5 Secretion in Pulmonary Tuberculosis J. Biol. Chem., June 25, 2004; 279(26): 27199 - 27210. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Weiss, I. Shalit, H. Blau, S. Werber, D. Halperin, A. Levitov, and I. Fabian Anti-Inflammatory Effects of Moxifloxacin on Activated Human Monocytic Cells: Inhibition of NF-{kappa}B and Mitogen-Activated Protein Kinase Activation and of Synthesis of Proinflammatory Cytokines Antimicrob. Agents Chemother., June 1, 2004; 48(6): 1974 - 1982. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. A. Haeberle, A. Casola, Z. Gatalica, S. Petronella, H.-J. Dieterich, P. B. Ernst, A. R. Brasier, and R. P. Garofalo I{kappa}B Kinase Is a Critical Regulator of Chemokine Expression and Lung Inflammation in Respiratory Syncytial Virus Infection J. Virol., March 1, 2004; 78(5): 2232 - 2241. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Melchjorsen, L. N. Sorensen, and S. R. Paludan Expression and function of chemokines during viral infections: from molecular mechanisms to in vivo function J. Leukoc. Biol., September 1, 2003; 74(3): 331 - 343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Page, J. Li, L. Zhou, S. Iasvoyskaia, K. C. Corbit, J.-W. Soh, I. B. Weinstein, A. R. Brasier, A. Lin, and M. B. Hershenson Regulation of Airway Epithelial Cell NF-{kappa}B-Dependent Gene Expression by Protein Kinase C{delta} J. Immunol., June 1, 2003; 170(11): 5681 - 5689. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zhang, M. Jamaluddin, S. Wang, B. Tian, R. P. Garofalo, A. Casola, and A. R. Brasier Ribavirin Treatment Up-Regulates Antiviral Gene Expression via the Interferon-Stimulated Response Element in Respiratory Syncytial Virus-Infected Epithelial Cells J. Virol., May 15, 2003; 77(10): 5933 - 5947. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Escotte, O. Tabary, D. Dusser, C. Majer-Teboul, E. Puchelle, and J. Jacquot Fluticasone reduces IL-6 and IL-8 production of cystic fibrosis bronchial epithelial cells via IKK-{beta} kinase pathway Eur. Respir. J., April 1, 2003; 21(4): 574 - 581. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Tian and A. R. Brasier Identification of a Nuclear Factor Kappa B-dependent Gene Network Recent Prog. Horm. Res., January 1, 2003; 58(1): 95 - 130. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Tabary, C. Muselet, S. Escotte, F. Antonicelli, D. Hubert, D. Dusser, and J. Jacquot Interleukin-10 Inhibits Elevated Chemokine Interleukin-8 and Regulated on Activation Normal T Cell Expressed and Secreted Production in Cystic Fibrosis Bronchial Epithelial Cells by Targeting the IkB Kinase {alpha}/{beta} Complex Am. J. Pathol., January 1, 2003; 162(1): 293 - 302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Casola, A. Henderson, T. Liu, R. P. Garofalo, and A. R. Brasier Regulation of RANTES promoter activation in alveolar epithelial cells after cytokine stimulation Am J Physiol Lung Cell Mol Physiol, December 1, 2002; 283(6): L1280 - L1290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Wolf, C. Schulz, G.A.J. Riegger, and M. Pfeifer Tumour necrosis factor-{alpha} induced CD70 and interleukin-7R mRNA expression in BEAS-2B cells Eur. Respir. J., August 1, 2002; 20(2): 369 - 375. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-M. Huang and D. J. McCance Down Regulation of the Interleukin-8 Promoter by Human Papillomavirus Type 16 E6 and E7 through Effects on CREB Binding Protein/p300 and P/CAF J. Virol., July 29, 2002; 76(17): 8710 - 8721. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Tian, Y. Zhang, B. A. Luxon, R. P. Garofalo, A. Casola, M. Sinha, and A. R. Brasier Identification of NF-{kappa}B-Dependent Gene Networks in Respiratory Syncytial Virus-Infected Cells J. Virol., June 5, 2002; 76(13): 6800 - 6814. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. A. Haeberle, F. Nesti, H.-J. Dieterich, Z. Gatalica, and R. P. Garofalo Perflubron Reduces Lung Inflammation in Respiratory Syncytial Virus Infection by Inhibiting Chemokine Expression and Nuclear Factor-{kappa}B Activation Am. J. Respir. Crit. Care Med., May 15, 2002; 165(10): 1433 - 1438. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. W. Thomas, M. M. Monick, J. M. Staber, T. Yarovinsky, A. B. Carter, and G. W. Hunninghake Respiratory Syncytial Virus Inhibits Apoptosis and Induces NF-kappa B Activity through a Phosphatidylinositol 3-Kinase-dependent Pathway J. Biol. Chem., January 4, 2002; 277(1): 492 - 501. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. J. Holtzman, J. D. Morton, L. P. Shornick, J. W. Tyner, M. P. O'Sullivan, A. Antao, M. Lo, M. Castro, and M. J. Walter Immunity, Inflammation, and Remodeling in the Airway Epithelial Barrier: Epithelial-Viral-Allergic Paradigm Physiol Rev, January 1, 2002; 82(1): 19 - 46. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. I. Lebovic, V. A. Chao, J.-F. Martini, and R. N. Taylor IL-1{beta} Induction of RANTES (Regulated upon Activation, Normal T Cell Expressed and Secreted) Chemokine Gene Expression in Endometriotic Stromal Cells Depends on a Nuclear Factor-{kappa}B Site in the Proximal Promoter J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 4759 - 4764. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Friedland, D. Constantin, T. C. Shaw, and E. Stylianou Regulation of interleukin-8 gene expression after phagocytosis of zymosan by human monocytic cells J. Leukoc. Biol., September 1, 2001; 70(3): 447 - 454. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. G. Leidal, K. L. Munson, and G. M. Denning Small Molecular Weight Secretory Factors from Pseudomonas aeruginosa Have Opposite Effects on IL-8 and RANTES Expression by Human Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., August 1, 2001; 25(2): 186 - 195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Casola, R. P. Garofalo, H. Haeberle, T. F. Elliott, R. Lin, M. Jamaluddin, and A. R. Brasier Multiple cis Regulatory Elements Control RANTES Promoter Activity in Alveolar Epithelial Cells Infected with Respiratory Syncytial Virus J. Virol., July 15, 2001; 75(14): 6428 - 6439. [Abstract] [Full Text]
|
|
|
|
|
|
M. Cecilia Berin, L. Eckmann, D. H. Broide, and M. F. Kagnoff Regulated Production of the T Helper 2-Type T-Cell Chemoattractant TARC by Human Bronchial Epithelial Cells In Vitro and in Human Lung Xenografts Am. J. Respir. Cell Mol. Biol., April 1, 2001; 24(4): 382 - 389. [Abstract] [Full Text]
|
|
|
|
|
|
L. H. Thomas, M. I. Y. Wickremasinghe, M. Sharland, and J. S. Friedland Synergistic Upregulation of Interleukin-8 Secretion from Pulmonary Epithelial Cells by Direct and Monocyte-Dependent Effects of Respiratory Syncytial Virus Infection J. Virol., September 15, 2000; 74(18): 8425 - 8433. [Abstract] [Full Text]
|
|
|
|
 |
|
 J. W. Christman, R. T. Sadikot, and T. S. Blackwell The Role of Nuclear Factor-{kappa} B in Pulmonary Diseases Chest, May 1, 2000; 117(5): 1482 - 1487. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Jaspers, J. M. Samet, and W. Reed Arsenite Exposure of Cultured Airway Epithelial Cells Activates kappa B-dependent Interleukin-8 Gene Expression in the Absence of Nuclear Factor-kappa B Nuclear Translocation J. Biol. Chem., October 22, 1999; 274(43): 31025 - 31033. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Hilliard, E. B. Samoilova, T.-S. T. Liu, A. Rostami, and Y. Chen Experimental Autoimmune Encephalomyelitis in NF-{kappa}B- Deficient Mice: Roles of NF-{kappa}B in the Activation and Differentiation of Autoreactive T Cells J. Immunol., September 1, 1999; 163(5): 2937 - 2943. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Setsuda, J. Teruya-Feldstein, N. L. Harris, J. A. Ferry, L. Sorbara, G. Gupta, E. S. Jaffe, and G. Tosato Interleukin-18, Interferon-{gamma}, IP-10, and Mig Expression in Epstein-Barr Virus-Induced Infectious Mononucleosis and Posttransplant Lymphoproliferative Disease Am. J. Pathol., July 1, 1999; 155(1): 257 - 265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Fiedler and K. Wernke-Dollries Incomplete Regulation of NF-kappa B by Ikappa Balpha during Respiratory Syncytial Virus Infection in A549 Cells J. Virol., May 1, 1999; 73(5): 4502 - 4507. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
