| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
3 (AML2) Is Induced by TGF-ß1 to Bind and Activate the Mouse Germline Ig Promoter1
Department of Molecular Genetics and Microbiology, Graduate Program in Immunology and Virology, University of Massachusetts Medical School, Worcester, MA 01655
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
transcripts. The promoter segment between -130 and +46,
relative to the first initiation site for mouse GL transcripts, is
sufficient for expression and TGF-ß1 inducibility of a reporter gene
in B cell lines. Within this segment resides a TGF-ß1-responsive
element (TßRE) that is required for induction of the promoter by
TGF-ß1 and, when multimerized, is sufficient to transfer TGF-ß1
inducibility to another promoter. In this report we show that a
TGF-ß1-inducible complex binds the TßRE and contains the
transcription factor core-binding factor (CBF; also known as acute
myeloid leukemia, AML). Although all three CBF family members
activate the GL promoter, only CBF3 (AML-2) is induced by
TGF-ß1 in splenic B and I.29µ cells. The TßRE contains two CBF
binding sites. Mutation of both sites reduces but does not eliminate
induction of the GL promoter by TGF-ß1 or by overexpression of
CBF, possibly due to the presence of an additional CBF site in the
promoter. In addition, the TßRE contains two copies of another
sequence motif. Mutation of these motifs eliminates TGF-ß1 induction
of the GL promoter. Together the data indicate that TGF-ß1
induction of the promoter involves induction of CBF3, which
binds to the TßRE of the promoter along with one or more
proteins. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
TGF-ß1 induces GL transcripts and directs class switching to IgA
in mouse splenic B cells activated by polyclonal activators, such as
LPS (6, 7). Similarly, TGF-ß1 increases GL transcripts, and in
the presence of LPS induces switching to IgA in the surface
IgM+ (sIgM+) I.29µ B lymphoma cell line (8, 9). The induction of GL transcripts by TGF-ß1 in I.29µ cells is
due to regulation at the transcriptional level (8). Previous work
showed that the promoter segment containing nucleotides from -128 to
+46, relative to the first initiation site for GL transcripts, is
sufficient for expression and TGF-ß1 inducibility of a reporter gene
in two different B cell lines (10). Within the -128/+46 segment, a
novel element (called TßRE) was shown to be required for TGF-ß1
inducibility of a reporter gene and, when multimerized, to be
sufficient to transfer the inducibility to a minimal c-fos
promoter (10). The TßRE is also present in the human GL 1 and 2
promoters and has been shown to be responsive to TGF-ß1 in the human
GL 1 promoter (11, 12). Despite the importance of the TßRE for GL
transcription, no protein that binds the TßRE and regulates the
GL promoter has been identified.
The core-binding factor (CBF) family of transcription factors plays a
key role in hematopoiesis and bone ossification. The family consists of
three (CBF) and one ß (CBFß) subunits (reviewed in Refs. 13
and 14). CBF binds to DNA as a heterodimer of the and ß subunits.
All the subunits contain a highly conserved runt domain that is
responsible for both DNA binding and dimerization with the CBFß
subunit (15, 16, 17, 18, 19, 20), which by itself cannot bind DNA but increases the
affinity of CBF protein for DNA about fivefold (16, 17, 18). CBF is
also known as acute myeloid leukemia (AML) or polyomavirus enhancer
core-binding protein-2 (PEBP2). Thus, CBF1 is also known as
AML3 or PEBP2A, CBF2 as AML1 or PEBP2B, and CBF3 as AML2 or
PEBP2C. CBFß is also known as PEBP2ß.
CBF specifically recognizes the consensus sequence ACCPuCA (13). This
sequence motif has been identified in both viral and cellular promoters
and/or enhancers of a number of genes including polyomavirus and murine
leukemia virus and some hematopoietic-specific genes, such as in the Ig
µ intron enhancer (21), and the genes for the TCR (TCR -, ß-,
-, and 
-chains), CD3
, cytokines (IL-3 and
granulocyte-macrophage CSF), the CSF receptor, and the myeloid-specific
genes myeloperoxidase and neutrophil elastase (reviewed in 13 .
The binding site has also been found in bone-specific genes (22, 23).
Although all the subunits bind and activate transcription via the
same sequence motif (16, 19, 24, 25, 26, 27), the expression levels of
different CBF proteins differ among different tissues. CBF1
(AML3) is most abundant in osteoblasts and is also present in
thymocytes and T cell lines (16, 27, 28, 29). CBF2 (AML1) is abundant in
T and myeloid cells and also in B cells and some B cell lines (15, 26, 28, 30, 31). CBF3 (AML2) is most abundant in B and myeloid cell
lines (26). CBFß is ubiquitously expressed (17, 18, 28). Thus, at
least one explanation for the different functions of the three CBF
proteins in vivo must be their different patterns of expression. A
knockout of the CBF1 gene in the mouse completely blocks bone
ossification. Such mice die just after birth due to inability to
breathe (32). A knockout of the CBF2 gene in the mouse results in
death on days 12–14 of fetal development owing to hemorrhaging in the
central nervous system and blockage of fetal liver hematopoiesis (33, 34). The targeted deletion experiments indicate that the function of
CBFß is similar to that of CBF2, as it is also essential for
definitive hematopoiesis of all lineages and its deletion leads to
death at midgestation (35, 36, 37). Furthermore, the CBF2/CBFß
transcription factor complex represents one of the most important
targets of chromosomal translocations found in human leukemias, hence
the alternative name AML (13, 14, 38).
In this report, we demonstrate that CBF (AML) proteins bind to the
TßRE present within the GL promoter for GL transcripts and
that CBF3 (AML2) and TßRE binding activities are up-regulated by
TGF-ß1. We also demonstrate that CBF activates the GL promoter.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Three mouse B lymphoma cell lines were used in this study: I.29µ (22D subclone) and CH12.LX, two sIgM+ B cell lines that can be induced to undergo class switch recombination to IgA (39, 40, 41, 42), and A20.3, a sIgG2a+ B cell line that has not been demonstrated to undergo class switching (43, 44).
Cell culture
A20.3 and CH12.LX cells were cultured at 37°C in an atmosphere of 5% CO2 in RPMI 1640 medium supplemented with 10% FBS, 50 µM 2-ME, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.1 mg/ml kanamycin sulfate (the last six reagents were from Life Technologies Laboratories, Grand Island, NY). I.29µ cells were cultured similarly to A20.3 cells, except in 8% CO2, and the medium was supplemented with 0.1 U/ml regular purified pork insulin (Squibb and Sons, Princeton, NJ), and the FBS concentration was 20%. In transfection experiments, human TGF-ß1 (R & D System, Minneapolis, MN) was added right after transfection at 1–2 ng/ml. The amount of TGF-ß1 used was determined to be in the optimal range (data not shown).
Splenic B cells were purified by depletion of T cells, using mAbs for
Ty1.2 (HO13.4), Thy1 (Jij.10), CD4 (GK1.5), and CD8 (3.168) followed by
addition of anti-rat 
-chain mAb (MAR 18.5) and guinea pig
complement. Dead cells were removed by centrifugation on Ficoll-Hypaque
gradients. Purified splenic B cells were cultured as were A20.3 cells,
with addition of LPS (50 µg/ml) for 18 h and TGF-ß1 (2 ng/ml)
for 14 h.
Oligonucleotides
The sequences of the top strand of the double-stranded
oligonucleotides used in EMSAs are given below. Lower case letters
indicate nucleotides not present in the promoter that were added
for cloning. Underlines indicate consensus motifs for the transcription
factor binding sites. Bold nucleotides indicate mutations: CBF
consensus, CGTATTAACCACAATACTCG; TßRE(-130/-104),
CACCACAGCCAGACCACAGGCCAGACA;
m1-TßRE,
gaTCCACCACAGAACTACCACAGGAACTACA;
m2-TßRE,
gaTCCGTGACAGACAGACCTGCAGCCAGACA;
C(-104/-69), ATGACGTGGAGGCAAGCGGCCACAACGTGGAGGTGG;
C(-94/-55),
GGCAAGCGGCCACAACGTGGAGGTGGAACAGGAAGTGGGT;
C(-95/-78), AGGCAAGCGGCCACAACG; Ets(C -71/-55),
TGGAACAGGAAGTGGGT; and reverse PCR primer (+14/-7),
cgcggatccTGGATGGGTCAGACTGAGCGC. Single-stranded oligonucleotides were
obtained from Operon Technologies (Alameda, CA).
Plasmid constructs
Wild-type or mutated GL promoter -130/+14 segments were
created by PCR using oligonucleotides containing wild-type or mutated
TßREs as primers. Some of the segments with mutations were obtained
using an overlap extension technique (45). PCR-amplified fragments were
then cloned into SmaI/BglII sites upstream of the
luciferase reporter gene in the pXP2 vector (46). Each construct was
sequenced to verify that only the desired mutations had been
introduced. DNA sequencing was performed using the dideoxy chain
termination method with Sequenase version 2.0 kits (U.S. Biochemical
Corp. Cleveland, OH).
Expression plasmids
Expression plasmids containing cDNAs for mouse CBF1 (AML3),
human CBF2 (AML1B), the trans-activating form of AML1
(25), and human CBF3 (AML2) (26) were obtained from S. Hiebert, St.
Jude Children’s Research Hospital (Memphis, TN). Expression plasmids
containing cDNAs for mouse CBF2 and CBFß were obtained from N.
Speck, Dartmouth Medical School (Hanover, NH). These expression
plasmids (30 µg) were cotransfected with the luciferase reporter
plasmids driven by the mouse GL promoter -130/+14. At the amino
acid level, human and mouse CBF3 are identical (47), whereas human
and mouse CBF2 share about 90% identity (25, 48). We compared the
activities of human and mouse CBF2 expression plasmids and found no
difference (data not shown). Since the CBF cDNAs were cloned into
different expression vectors, we first tested whether the different
empty expression vectors have different effects on the promoter
activity. We cotransfected the empty expression vectors pCMV-2, pCMV-5,
and pcDNA I into A20.3 cells and found that all have similar luciferase
activities. Therefore, we used pCMV-2 as the vector control for all CBF
expression plasmids.
Transfection, luciferase, chloramphenicol acetyltransferase (CAT), and ß-galactosidase (ß-gal) assays
For each transfection, 50 x 106 cells were resuspended in 1 ml of RPMI 1640 containing 50 µg of luciferase reporter plasmid DNA for I.29µ and 30 µg for A20.3 cells along with 10 µg of control plasmid DNA before imposing an electric shock at 1250 µF and 750 V/cm using Cell ZapII (Anderson Electronics, Brookline, MA). To control for variation in transfection efficiency, the plasmid pSV2CAT, which expresses the CAT gene under control of the SV40 enhancer/promoter, was cotransfected in all experiments in I.29µ cells, and the plasmid pPGKß-gal, which expresses the ß-gal gene under control of the PGK enhancer/promoter, was used in all experiments in A20.3 cells. After transfection, cells were rested at room temperature for 10 min and then pipetted into complete FBS/RPMI medium at approximately 1.7 x 106 cells/ml. Cells were incubated for 24 h at 37°C and then assayed for luciferase, CAT (49), and ß-gal (50) activities. CAT activity was measured by a liquid scintillation counter after 20-h incubation at 37°C.
Oligonucleotide probes for EMSAs
Double-stranded (ds) oligonucleotides were prepared and labeled as previously described (51).
Preparation of cytoplasmic and nuclear extracts
Cells were pelleted and resuspended in fresh medium at 106 cells/ml before adding stimuli. After incubation, cells were harvested, and cytoplasmic and nuclear extracts were prepared using a modification of the small scale method of Schreiber et al. (49, 52). Protein concentrations of the cytoplasmic and nuclear extracts were determined using the Bradford assay (Bio-Rad, Richmond, CA).
EMSA
DNA binding reactions were performed in 15-µl reaction volumes
containing 0.1–1 ng (15,000–30,000 cpm) of end-labeled dsDNA probe,
1–5 µg of nuclear extracts, and 2–4 µg of poly(dI-dC) (Pharmacia,
Piscataway, NJ). The final concentration of NaCl in each reaction
mixture was adjusted to 80 mM by adding buffer C (52). The reaction
mixtures were incubated at room temperature for 30 min and then loaded
onto 4–6% native polyacrylamide gels. All gels were electrophoresed
in recirculating 0.5x TBE buffer at 100–150 V for 2–4 h. For
supershift experiments, Ab (or antiserum; 1 µl) and nuclear extracts
were added to the entire mixture before the probe. Polyclonal Abs
against human CBF1 (AML3), CBF2 (AML1B), CBF3 (AML2), and
CBFß used in both EMSAs and Western blot analyses were obtained from
S. Hiebert, St. Jude Children’s Research Hospital. mAb against mouse
CBFß from N. Speck, Dartmouth Medical School, was also used in
Western blot analyses.
Western blot analyses
Western blot analyses were performed by standard procedures. Briefly, nuclear extracts (10 µg/lane) were resolved by 12% SDS-PAGE and electroblotted onto Millipore Immobilon-P transfer membrane. Membranes were incubated overnight at 4°C in PBS containing 5% milk and 0.1% Tween-20 and Abs. After a brief wash with the same solution without Ab, the membrane was incubated with the secondary Ab for 2–3 h at room temperature, followed by chemiluminescent detection using SuperSignal ULTRA Chemiluminescent Substrate (Pierce, Rockford, IL) according to the manufacturer’s specifications. Membranes were exposed for 10 s to 5 min to Kodak XAR film (Eastman Kodak, Rochester, NY) for detection of signals.
Densitometry quantitation
Quantitation of DNA binding activity and protein expression were performed by densitometry using a Molecular Dynamics Personal Densitometry SI (Sunnyvale, CA), and the results were analyzed using Bio-Rad MultiAnalyst.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Tß RE of the GL promoter
Previous studies identified a novel TßRE at –128/-105 relative
to the first RNA initiation site in the mouse GL promoter that is
required for induction of the GL promoter by TGF-ß1. When the
TßRE was used as a probe in EMSAs, complexes were formed using
nuclear extracts from I.29µ cells (10). To examine whether complexes
binding the TßRE could be induced by TGF-ß1, we performed EMSAs
using the TßRE (-130/-104) as a probe and nuclear extracts from
I.29µ cells treated with TGF-ß1 for varying times. As shown in Fig. 1
A, two major complexes were
formed with the TßRE, one of which was induced fourfold by TGF-ß1
treatment for 12 h, but not for 6 h. Induction of the complex
slightly decreased after treatment for 18 h.
|
B). These data indicate that TGF-ß1
induces a complex in I.29µ extracts that binds the Ig TßRE of
the GL promoter and that induction of the complex requires de novo
protein synthesis. The TGF-ß1-inducible complex binds to two CBF consensus elements in the TßRE
The TßRE contains two copies of a sequence (underlined in
Fig. 2), and deletion of one of these two
repeats reduces the TGF-ß1 inducibility by 50% (10). To identify the
binding site(s) in the TßRE for the inducible complex, we made two
different sets of mutations in the direct repeats of the TßRE (m1 and
m2) and tested the effects of these mutations in EMSAs. Figure 2A demonstrates that binding of the TGF-ß1-inducible
complex in I.29µ nuclear extracts to the wild-type TßRE probe is
competed well by a 100-fold excess of unlabeled wild-type TßRE and
competed nearly as well by a 100-fold excess of an oligonucleotide with
the m1 mutation, but not by an oligonucleotide with the m2-TßRE
mutation. These results indicate that the binding of the
TGF-ß1-inducible complex requires nucleotides that are mutated in the
m2-TßRE mutant, the wild-type sequence of which matches the consensus
CBF binding site ACCACA. This was confirmed by EMSAs using an
oligonucleotide containing a consensus CBF binding site as a competitor
(Fig. 2A). Since CBF proteins preferentially bind a site
containing the nucleotide A just upstream of the core motif ACCACA
(13), the CBF oligonucleotide competes better than the TßRE (Fig. 2A). These data demonstrate that the TGF-ß1-inducible
complex binds to the two CBF binding sites within the TßRE (Fig. 2).
|
B) or CBF recombinant
protein (Fig. 2C). The results show that the m1 mutation
greatly reduces binding of the TGF-ß1-inducible complex compared with
that formed with the wild-type probe (Fig. 2B). No
corresponding complex was formed with the m2-TßRE probe (data not
shown). By contrast, recombinant CBF2 runt domain (which is
conserved among the CBF subunits) binds equally well to the
wild-type and m1-TßRE probes (Fig. 2C). The equivalent
binding to the wild-type or m1 probe is not surprising, since CBF
proteins do not preferentially bind to a site with a G (as in the
wild-type TßRE) instead of a T (as in m1) upstream of the ACCACA
consensus motif (13). These data suggest that the nucleotides mutated
in the m1 probe interact with another protein(s) that increases the
binding of CBF to the TßRE in the wild-type promoter.
CBF3 (AML2) is the predominant CBF protein in the
TGF-ß1-induced complex
To identify the specific CBF proteins binding to the GL
TßRE, we tested Abs against all known members of the family in
supershift EMSAs. As shown in Fig. 3, Ab
against CBF3 (AML2) partially supershifted the major complex. Abs
against CBF1 (AML3), CBF2 (AML1), and CBFß weakly supershifted
the complex. While the Ab against CBF2 weakly cross-reacted with
1 and 3 on Western blots, the Abs against CBF1 and 3 were
specific (26). These data suggest that CBF3 (AML2) is the
predominant subunit in I.29µ B cells treated by TGF-ß1, but
that the other CBF subunits and CBFß may also be present and bind
the TßRE.
|
3 (AML2) is induced by TGF-ß1 in I.29µ nuclear extracts
To directly examine the expression and regulation of CBF in
I.29µ cells, we performed Western analyses using cytoplasmic and
nuclear extracts from cells untreated or treated with TGF-ß1 for
14 h. CBF1 was not detected by Western analyses (data not
shown), consistent with previous reports that CBF1 (AML3) is not in
pre-B and sIg+ B cell lines (21, 26), although it is
present in a plasmacytoma line (21). The weak supershift observed using
anti-CBF1 Ab in EMSAs may be due to the greater sensitivity of
the EMSA.
As shown in Fig. 4A, two isoforms
of CBF2 are detected in cytoplasmic extracts, but only the smaller
form is detected in nuclear extracts. The size of CBF2 in I.29µ
nuclear extracts agrees with the 48.6-kDa form identified in a mouse B
lymphoma cell line by Bae et al. (30). Treatment with TGF-ß1 had
almost no effect on the level of CBF2 in the cytoplasm but very
slightly reduced its expression in nuclear extracts. The detection of
CBF2 cannot be due to cross-reaction with CBF1, since CBF1 was
undetectable, nor was it due to cross-reaction with CBF3, since
CBF3 was highly inducible by TGF-ß1 (see below).
|
3 in nuclei (Fig. 4B). Expression of
CBF3 in the cytoplasm was barely detectable. The approximately
50-kDa forms were the expected size for CBF3 (20, 31, 47). CBFß
was constitutively expressed in both cytoplasm and nuclei of I.29µ
cells, and the 28-kDa form was reproducibly induced by TGF-ß1 in
I.29µ cells (Figs. 4C and 5B).
Thus, the induction of the TßRE-binding activity observed in EMSAs is
consistent with the induction of CBF3 (AML2) by TGF-ß1 as detected
by Western analysis. The induction of binding activity is low, however,
relative to the large induction of CBF3 protein. This may be due to
constitutive expression of CBF2, as it binds the identical sequence
element and has a similar m.w.
CBF3 is also induced in splenic B cells and other B cell lines
I.29µ cells constitutively express GL transcripts, which can
be further induced by treatment with TGF-ß1. We asked whether the
ability of other B cells and B cell lines to express GL transcripts
correlates with the expression of CBF and its induction by TGF-ß1.
The expression and regulation of CBF3 and CBFß were examined in
splenic B cells and in two additional B lymphoma cell lines: the
sIgM+ line, CH12.LX, and the sIgG2a+ line,
A20.3. CH12.LX cells constitutively express GL transcripts, which
can be further increased by treatment with TGF-ß1, and the cells can
be induced to undergo class switch recombination to IgA (41, 42).
A20.3 cells do not express GL transcripts and have not been
found to undergo class switching (10) (our laboratory
observations).
Western blot analyses of nuclear extracts from these B cells indicated
that the constitutive expression of CBF3 was highest in CH12.LX
cells, lower in I.29 µ cells, and barely detectable in A20.3 or
splenic B cells (Fig. 5A).
TGF-ß1 treatment induced expression of CBF3 in splenic B and in
I.29 µ cells and marginally induced CBF3 (1.7-fold) in CH12.LX
cells, but not in A20.3 cells. Thus, CBF3 can be induced in two B
cell lines and in a B cell population that can be induced to express GL
transcripts and to switch to IgA, but not in a B cell line that
cannot be induced by TGF-ß1 to express GL transcripts. In
contrast with the expression of CBF3, the levels of CBFß in
nuclear extracts from different B cells were similar (Fig. 5B).
|
3 are detected in these various B cells.
CBF mRNA always occurs in multiple, alternatively spliced forms, the
sizes of which may be cell type-specific (15, 17, 18, 26, 28, 30, 31).
The TßRE binding activities of nuclear extracts from the various
cells were examined by EMSA. As shown in Fig. 5C, the
activity was highest in CH12.LX and I.29µ cells, lower in splenic B
cells, and lowest in A20.3 cells. Furthermore, binding activity was not
induced by TGF-ß1 in A20.3 and splenic B cells, but was induced in
both I.29µ (2.5-fold) and CH12.LX (1.3-fold) cells. Although
induction by TGF-ß1 was lower in CH12.LX than in I.29µ cells, there
was a greater constitutive binding activity in CH12.LX extracts. Lack
of induction of TßRE binding activity in splenic B cells may be due
to constitutive expression of CBF2 (28) and to the low level of
CBF3 induced. In conclusion, the ability of the B cells to express
GL transcripts correlates with the levels of CBF3 induced by
TGF-ß1 and the TßRE binding activities.
Effects of mutations in the TßRE on expression of the GL
promoter in I.29µ cells
To assess the function of CBF binding to the GL promoter, we
examined the effects of mutations in the TßRE on reporter gene
activity. The GL promoter -130/+14 or -132/+14 segments
containing the wild-type or mutated TßRE (m1 and m2) were cloned
upstream of the luciferase reporter gene in the promoterless pXP2
plasmid and were transiently transfected into I.29µ B cells.
Consistent with previous data (10), TGF-ß1 treatment increased
luciferase activity of the plasmid driven by the wild-type GL
promoter by 3.5-fold (Fig. 6). This is in
accord with the finding that TGF-ß1 increases transcription of
endogenous GL RNA in I.29µ cells by 5-fold in a nuclear run-on
assay (8) and also correlates with the 4-fold induction of the TßRE
binding activity by TGF-ß1 in I.29µ cells (Fig. 1).
|
). Both
mutations reduce the transcriptional activity of the promoter in the
presence of TGF-ß1.
These transfection data indicate that CBF contributes to both basal
activity and to TGF-ß1 induction of the GL promoter. Failure of
the m2-TßRE to eliminate TGF-ß1 induction of the promoter may be
due to the presence of additional CBF sites in the GL promoter, as
demonstrated below. In addition, elimination of TGF-ß1 induction of
the promoter by the m1 mutation suggests that a protein(s) binding the
nucleotides mutated in the m1-TßRE is required for TGF-ß1 induction
of the promoter. Consistent with this hypothesis are the EMSA data,
which indicate that sequence elements mutated in the m1-TßRE are
required for optimal binding of the TGF-ß1-inducible complex to the
TßRE (Fig. 2). Together the data suggest that CBF interacts with
another protein(s) that binds the sites defined by the m1 mutation to
cause TGF-ß1 induction of the GL promoter.
Overexpression of CBF proteins activates the GL promoter
To directly examine the ability of CBF proteins to activate
transcription from the GL promoter, we cotransfected expression
plasmids for CBF proteins and the reporter plasmid driven by the GL
promoter -130/+14 segment into A20.3 cells. We chose A20.3, since
these cells express only low levels of CBF and TßRE binding
activity, which are not further induced by TGF-ß1 (Fig. 5). Although
only CBF3 is induced in I.29µ cells, we tested the effects of
overexpression of all three subunits on the promoter activity, as
it has been shown that all subunits can trans-activate
the TCR ß or murine leukemia virus enhancers in vivo (16, 19, 24, 25, 26, 53).
Overexpression of CBF proteins in A20.3 cells increased the GL
promoter activity by 3- to 7-fold in the absence of TGF-ß1 (Fig. 7A). The response to CBF was
increased to 5- to 12-fold in the presence of TGF-ß1. The increased
response to CBF in the presence of TGF-ß1 could be due to
post-translational modification of the overexpressed CBF proteins
and/or to interaction of CBF with another TGF-ß1-inducible protein(s)
in A20.3 cells.
|
proteins and increases their affinity for DNA (16, 17, 18, 25). To
determine whether overexpression of CBFß together with CBF protein
activates the promoter better than CBF alone, an expression plasmid
containing mouse CBFß cDNA alone or together with a plasmid
containing CBF2 or CBF3 cDNA was cotransfected into A20.3 cells.
Overexpression of CBFß alone or together with CBF2 or CBF3
resulted in luciferase activity marginally greater than that of the
pcDNA I vector, CBF2, or CBF3 alone, respectively (data not
shown). These results indicate that CBFß is not limiting, consistent
with a previous report (15).
Effects of mutations in the GL promoter on the CBF response
of the promoter
The results presented above demonstrate that all CBF subunits
activate the GL promoter. To determine whether the CBF proteins are
acting on the TßRE of the GL promoter, we tested the effects of
TßRE mutations m1 and m2 on activation of the GL promoter by
overexpressed CBF. Since only CBF3 is induced by TGF-ß1 in I.29
µ cells, we only present the effect of overexpression of CBF3.
Overexpression of CBF2 produced similar results (data not shown).
Cotransfection of an expression plasmid for CBF3 in A20.3 cells
increased activity of the GL promoter by 5.2-fold, and this
activity was reduced about 35% by the m2 mutation in the TßRE (Fig. 7B), similar to the effect of this mutation on induction by
TGF-ß1 in I.29µ cells (Fig. 6). The response to CBF was reduced,
but again was not eliminated, by the m1 mutation in the TßRE (Fig. 7B), although this mutation eliminated the response to
TGF-ß1 (Fig. 6). This indicates that the protein(s) binding to the
nucleotides mutated in m1 cannot interact with CBF except in cells
treated with TGF-ß1. Finally, a DNA segment (-98/+14) that lacked
the entire TßRE and adjacent ATF/CRE site (10) had a reduced basal
activity but responded well to the overexpression of CBF3 (only a
20% reduction with respect to the fold induction). These data suggest
that other sequence elements in the promoter must be involved in
its activation by CBF.
Identification of multiple CBF-binding sites in the GL promoter
Failure of the m2 mutation to eliminate TGF-ß1 induction of the
GL promoter in I.29µ cells or the response to CBF3 in A20.3
cells may result from additional CBF binding sites in the GL
promoter. Visual inspection of the sequence within the -130/+14 region
revealed an incomplete CBF binding site CCACA at -85/-81 (Fig. 8). We examined the binding activity and
TGF-ß1 inducibility of complexes formed with a probe ( -95/-78)
that contains this element. As shown in Fig. 8A, two
complexes bound this element, one of which was inducible by TGF-ß1
(indicated by an arrow), although the binding activity of this probe
was much less than that of the TßRE. Competition analyses indicated
that the TGF-ß1-inducible complex could be competed by a CBF binding
site and to a lesser extent by the TßRE and the unlabeled probe
itself (Fig. 8B). Similarly, complexes formed with the
TßRE could be inhibited by DNA segments including the -85/-81 CCACA
element, but were poorly inhibited by one that does not (-71/+14; Fig. 8C). Thus, there appears to be another CBF binding site in
the GL promoter in addition to the two sites within the TßRE.
This may explain why the m2-TßRE mutation cannot completely eliminate
the CBF-response in A20.3 cells.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this report we identify two CBF binding sites within the TßRE of
the promoter for GL RNA. We demonstrate that CBF binds to the
TßRE and that CBF3 (AML2) is induced by TGF-ß1 in splenic B
cells and in two B cell lines, I.29µ and CH12.LX. All three CBF
subunits can activate the GL promoter, and mutation of the CBF
binding sites in the TßRE has similar effects on activation of the
promoter by CBF2 or CBF3. Although the mechanism of
transcriptional activation by CBF is unknown, it has recently been
demonstrated that CBF2 (AML-1B) colocalizes with active RNA
polymerase II at the nuclear matrix (61).
Despite their similar trans-activation abilities, the
transcriptional targets of the three CBF proteins in vivo differ due
to their variable expression among different tissues and cell lines.
Not surprisingly, CBF genes are regulated by different factors.
CBF1 is induced in fibroblasts by treatment with bone morphogenic
protein-7, a member of the TGF-ß superfamily. Subsequent to induction
of CBF1, the fibroblasts undergo osteoblast differentiation (29).
The trans-activating form of CBF2 (AML1B) is up-regulated
in the embryonic carcinoma cell line F9 cells by retinoic acid (62) and
is also increased following denervation of rat skeletal muscle (63). In
the present study we demonstrate for the first time that a CBF protein
is induced by TGF-ß1.
In addition to being induced by TGF-ß1, we found that the
constitutive levels of CBF3 appear to correlate with the propensity
of the B cells to switch to IgA. Abundant CBF3 is present in the two
B cell lines capable of expressing endogenous GL transcripts and
switching to IgA. In contrast, CBF3 cannot be induced by TGF-ß1
treatment of the sIgG2a+ A20.3 B cell line, which also
cannot be induced to express endogenous GL transcripts. The lack of
induction of CBF3 is not due to an inability of A20.3 cells to
respond to TGF-ß1, as the activity of the GL promoter is
increased in cells treated by TGF-ß1 (Fig. 7A) (10).
It is possible that the constitutive expression of CBF3 may be due
to the autocrine TGF-ß1 that is produced by I.29µ cells. It is
unknown whether CH12.LX cells secrete TGF-ß1. Although CBF3 is not
detectable in splenic B cells in the absence of TGF-ß1, it is
inducible by treatment with LPS and TGF-ß1. Splenic B cells have the
ability to switch to all Ig classes depending on the cytokine and
activation signal received. B cells are believed to become committed to
switch to IgA in Peyer’s patches, where intestinal Ags are presented
to B and T cells. Furthermore, GL transcripts are induced in
Peyer’s patches during the initiation of an immune response (64). It
is possible that CBF3 may be induced in B cells in Peyer’s patches
in the presence of activation signals and that this contributes to
initiation of transcription of GL RNA.
Regulation of a promoter requires binding of multiple factors. Previous
studies of the human GL 1 and mouse GL promoters indicate that
the TßRE, ATF, and Ets sites are all important for induction of these
promoters by TGF-ß1 (10, 12) (M.-J. Shi, unpublished observations).
In this study we provide data indicating that CBF along with another
unidentified transcription factor bind to the TßRE and that binding
of both factors is required for TGF-ß1 induction. Since the m1
mutation eliminates the response of the GL promoter to TGF-ß1,
but not that to overexpressed CBF, it is possible that the putative
protein(s) binding the sites mutated in m1 is activated by TGF-ß1.
CBF has been shown to interact with Ets proteins and to
synergistically activate promoters binding both proteins (21, 53, 65, 66). Consistent with this, we found that simultaneous mutation of the
CBF sites in the TßRE and of the Ets site in the GL promoter
greatly reduces the activity of the promoter (90%) and the response to
overexpressed CBF (50%). Mutation of either the CBF or Ets site alone
has much less of an effect on the response to CBF (data not shown).
These results suggest that Ets and CBF may cooperate to activate the GL
promoter.
Members of a recently identified family of proteins, the Smads, serve
both as signal transducers and transcriptional activators for signaling
by the TGF-ß superfamily (reviewed in Refs. 67 and 68). Upon TGF-ß1
binding to its receptors, Smad2 and Smad3 are rapidly phosphorylated
and form a complex with Smad4 (DPC4). This complex is translocated into
the nucleus and binds DNA. Although natural binding sites in promoters
that respond to Smads are not well characterized, optimal binding sites
for Smad3 and Smad4 were recently identified (69). They closely
resemble the repeated sequence elements mutated in the m1 mutation. It
will be interesting to investigate the relationship between activation
of Smads and induction of CBF3 proteins by TGF-ß1 and to determine
whether Smad proteins are involved in the regulation of GL
transcription in B cells.
|
Acknowledgments |
|---|
1, -2, and -3 and
CBFß Abs and CBF expression plasmids. We thank Dr. N.
Speck (Dartmouth Medical School, Hanover, NH) for helpful suggestions
and for CBF2 and CBFß expression plasmids, recombinant CBF2
(Runt domain), and CBFß Ab. We are also grateful to our colleagues
Drs. C. Schrader and F. He and Mr. C. H. Shen for their
helpful comments on the manuscript. |
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Janet Stavnezer, Department of Molecular Genetics and Microbiology, Graduate Program in Immunology and Virology, University of Massachusetts Medical School, Worcester, MA 01655-0122. E-mail address:
3 Abbreviations used in this paper: CH, heavy chain constant region; GL, germline; sIg, surface immunoglobulin; TßRE, transforming growth factor-ß1-responsive element; CBF, core-binding factor; AML, acute myeloid leukemia protein; PEBP2, polyomavirus enhancer core-binding protein; EMSA, electrophoretic mobility shift assays; CAT, chloramphenicol acetyltransferase; ß-gal, ß-galactosidase; PGK, phosphoglycerate kinase.
Received for publication June 25, 1998. Accepted for publication August 31, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2b promoter and exon. EMBO J. 12:3529.[Medline]
germline transcripts in the B lymphoma I.29µ: transforming growth factor-ß activates transcription of the unrearranged C gene. J. Immunol. 147:4374.[Abstract]
and C genes: implications for commitment to an isotype switch. Int. Immunol. 4:1145. constant region gene by an ATF element and by novel transforming growth factor-ß1-responsive elements. J. Immunol. 149:2914.[Abstract]
1 and I2 germline promoter elements: proximal positive and distal negative elements may regulate the tissue specific expression of C1 and C2 germline transcripts. Int. Immunol. 5:271.1 region contains a TGF-ß1 responsive enhancer and a putative recombination hotspot. Int. Immunol. 7:1191.. Virology 194:314.[Medline]
B/mouse AML1 consists of multiple isoforms that possess differential transactivation potentials. Mol. Cell. Biol. 14:3242.C, a third gene encoding the mammalian runt domain. Gene 159:245.[Medline]
(AML1) and ß subunits on murine leukemia virus enhancer cores. J. Virol. 68:2898. genes in T cells during thymic development. Mol. Cell. Biol. 15:1662.[Abstract]
B cDNA representing the mouse homolog of human acute myeloid leukemia gene, AML1. Oncogene 8:809.[Medline]
1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89:755.[Medline]
2 (AML1) function in vivo. Cell 87:697.[Medline]
1 RNA: analysis of the promoter/enhancer. EMBO J. 11:145.[Medline]
B cDNA representing the mouse homolog of human acute myeloid leukemia gene, AML1. Oncogene 8:809.
B/Rel by CD40 engagement induces the mouse germline immunoglobulin C1 promoter. Mol. Cell. Biol. 16:4591.[Abstract]
2(I) collagen (COL1A2) promoter activity by transforming growth factor-beta. J. Biol. Chem. 271:3272. regulatory factors to nuclear matrix-associated transcriptional domains. Proc. Natl. Acad. Sci. USA 95:1585. enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions. Genes Dev. 9:995.This article has been cited by other articles:
|
|
 |
|
  D. M. Piscopo, E. B. Johansen, and R. Derynck Identification of the GATA Factor TRPS1 as a Repressor of the Osteocalcin Promoter J. Biol. Chem., November 13, 2009; 284(46): 31690 - 31703. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. M. Wildey and P. H. Howe Runx1 Is a Co-activator with FOXO3 to Mediate Transforming Growth Factor {beta} (TGF{beta})-induced Bim Transcription in Hepatic Cells J. Biol. Chem., July 24, 2009; 284(30): 20227 - 20239. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Brady, H. J. Whiteman, L. C. Spender, and P. J. Farrell Downregulation of RUNX1 by RUNX3 Requires the RUNX3 VWRPY Sequence and Is Essential for Epstein-Barr Virus-Driven B-Cell Proliferation J. Virol., July 1, 2009; 83(13): 6909 - 6916. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G.-Y. Seo, J. Youn, and P.-H. Kim IL-21 ensures TGF-{beta}1-induced IgA isotype expression in mouse Peyer's patches J. Leukoc. Biol., May 1, 2009; 85(5): 744 - 750. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Stavnezer and J. Kang The Surprising Discovery That TGF{beta} Specifically Induces the IgA Class Switch J. Immunol., January 1, 2009; 182(1): 5 - 7. [Full Text] [PDF]
|
|
|
|
 |
|
 J.-R. Landry, S. Kinston, K. Knezevic, M. F.T.R. de Bruijn, N. Wilson, W. T. Nottingham, M. Peitz, F. Edenhofer, J. E. Pimanda, K. Ottersbach, et al. Runx genes are direct targets of Scl/Tal1 in the yolk sac and fetal liver Blood, March 15, 2008; 111(6): 3005 - 3014. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Puig-Kroger, A. Dominguez-Soto, L. Martinez-Munoz, D. Serrano-Gomez, M. Lopez-Bravo, E. Sierra-Filardi, E. Fernandez-Ruiz, N. Ruiz-Velasco, C. Ardavin, Y. Groner, et al. RUNX3 Negatively Regulates CD36 Expression in Myeloid Cell Lines J. Immunol., August 15, 2006; 177(4): 2107 - 2114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E.-J. Jeon, K.-Y. Lee, N.-S. Choi, M.-H. Lee, H.-N. Kim, Y.-H. Jin, H.-M. Ryoo, J.-Y. Choi, M. Yoshida, N. Nishino, et al. Bone Morphogenetic Protein-2 Stimulates Runx2 Acetylation J. Biol. Chem., June 16, 2006; 281(24): 16502 - 16511. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Yamamura, W. L. Lee, K.-i. Inoue, H. Ida, and Y. Ito RUNX3 Cooperates with FoxO3a to Induce Apoptosis in Gastric Cancer Cells J. Biol. Chem., February 24, 2006; 281(8): 5267 - 5276. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Grueter, M. Petter, T. Egawa, K. Laule-Kilian, C. J. Aldrian, A. Wuerch, Y. Ludwig, H. Fukuyama, H. Wardemann, R. Waldschuetz, et al. Runx3 Regulates Integrin {alpha}E/CD103 and CD4 Expression during Development of CD4-/CD8+ T Cells J. Immunol., August 1, 2005; 175(3): 1694 - 1705. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Brenner, D. Levanon, V. Negreanu, O. Golubkov, O. Fainaru, E. Woolf, and Y. Groner Loss of Runx3 function in leukocytes is associated with spontaneously developed colitis and gastric mucosal hyperplasia PNAS, November 9, 2004; 101(45): 16016 - 16021. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Borsutzky, B. B. Cazac, J. Roes, and C. A. Guzman TGF-{beta} Receptor Signaling Is Critical for Mucosal IgA Responses J. Immunol., September 1, 2004; 173(5): 3305 - 3309. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Li, J Kleeff, A Guweidhi, I Esposito, P O Berberat, T Giese, M W Buchler, and H Friess RUNX3 expression in primary and metastatic pancreatic cancer J. Clin. Pathol., March 1, 2004; 57(3): 294 - 299. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ehlers, K. Laule-Kilian, M. Petter, C. J. Aldrian, B. Grueter, A. Wurch, N. Yoshida, T. Watanabe, M. Satake, and V. Steimle Morpholino Antisense Oligonucleotide-Mediated Gene Knockdown During Thymocyte Development Reveals Role for Runx3 Transcription Factor in CD4 Silencing During Development of CD4-/CD8+ Thymocytes J. Immunol., October 1, 2003; 171(7): 3594 - 3604. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Austin, K. M. Haas, S. M. Naugler, A. A. Bajer, D. Garcia-Tapia, and D. M. Estes Identification and Characterization of a Novel Regulatory Factor: IgA-Inducing Protein J. Immunol., August 1, 2003; 171(3): 1336 - 1342. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Woolf, C. Xiao, O. Fainaru, J. Lotem, D. Rosen, V. Negreanu, Y. Bernstein, D. Goldenberg, O. Brenner, G. Berke, et al. Runx3 and Runx1 are required for CD8 T cell development during thymopoiesis PNAS, June 24, 2003; 100(13): 7731 - 7736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Zhang Accessibility control and machinery of immunoglobulin class switch recombination J. Leukoc. Biol., March 1, 2003; 73(3): 323 - 332. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. C. Spender, G. H. Cornish, A. Sullivan, and P. J. Farrell Expression of Transcription Factor AML-2 (RUNX3, CBF{alpha}-3) Is Induced by Epstein-Barr Virus EBNA-2 and Correlates with the B-Cell Activation Phenotype J. Virol., April 16, 2002; 76(10): 4919 - 4927. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Spieker-Polet, P.-C. Yam, and K. L. Knight Functional Analysis of I{alpha} Promoter Regions of Multiple IgA Heavy Chain Genes J. Immunol., April 1, 2002; 168(7): 3360 - 3368. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Nam, Y.-H. Jin, Q.-L. Li, K.-Y. Lee, G.-B. Jeong, Y. Ito, J. Lee, and S.-C. Bae Expression Pattern, Regulation, and Biological Role of Runt Domain Transcription Factor, run, in Caenorhabditis elegans Mol. Cell. Biol., January 15, 2002; 22(2): 547 - 554. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. D. Ortiz, F. Harrow, D. Cado, B. Santoso, and A. Winoto Function and Factor Interactions of a Locus Control Region Element in the Mouse T Cell Receptor-{alpha}/Dad1 Gene Locus J. Immunol., October 1, 2001; 167(7): 3836 - 3845. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-J. Shi, S.-R. Park, P.-H. Kim, and J. Stavnezer Roles of Ets proteins, NF-{{kappa}}B and nocodazole in regulating induction of transcription of mouse germline Ig {{alpha}} RNA by transforming growth factor-{beta}1 Int. Immunol., June 1, 2001; 13(6): 733 - 746. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Javed, G. L. Barnes, B. O. Jasanya, J. L. Stein, L. Gerstenfeld, J. B. Lian, and G. S. Stein runt Homology Domain Transcription Factors (Runx, Cbfa, and AML) Mediate Repression of the Bone Sialoprotein Promoter: Evidence for Promoter Context-Dependent Activity of Cbfa Proteins Mol. Cell. Biol., April 15, 2001; 21(8): 2891 - 2905. [Abstract] [Full Text]
|
|
|
|
 |
|
 S.-C. Bae, K.-S. Lee, Y.-W. Zhang, and Y. Ito Intimate Relationship Between TGF-{beta}/BMP Signaling and Runt Domain Transcription Factor, PEBP2/CBF J. Bone Joint Surg. Am., April 1, 2001; 83(90010): S48 - 55. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-C. Bae, K.-S. Lee, Y.-W. Zhang, and Y. Ito Intimate Relationship Between TGF-{beta}/BMP Signaling and Runt Domain Transcription Factor, PEBP2/CBF J. Bone Joint Surg. Am., March 1, 2001; 83(1_suppl_1): S48 - S55. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-S. Lee, H.-J. Kim, Q.-L. Li, X.-Z. Chi, C. Ueta, T. Komori, J. M. Wozney, E.-G. Kim, J.-Y. Choi, H.-M. Ryoo, et al. Runx2 Is a Common Target of Transforming Growth Factor beta 1 and Bone Morphogenetic Protein 2, and Cooperation between Runx2 and Smad5 Induces Osteoblast-Specific Gene Expression in the Pluripotent Mesenchymal Precursor Cell Line C2C12 Mol. Cell. Biol., December 1, 2000; 20(23): 8783 - 8792. [Abstract] [Full Text]
|
|
|
|
|
|
E. Pardali, X.-Q. Xie, P. Tsapogas, S. Itoh, K. Arvanitidis, C.-H. Heldin, P. ten Dijke, T. Grundstrom, and P. Sideras Smad and AML Proteins Synergistically Confer Transforming Growth Factor beta 1 Responsiveness to Human Germ-line IgA Genes J. Biol. Chem., February 4, 2000; 275(5): 3552 - 3560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A Javed, B Guo, S Hiebert, J. Choi, J Green, S. Zhao, M. Osborne, S Stifani, J. Stein, J. Lian, et al. Groucho/TLE/R-esp proteins associate with the nuclear matrix and repress RUNX (CBF(alpha)/AML/PEBP2(alpha)) dependent activation of tissue-specific gene transcription J. Cell Sci., January 6, 2000; 113(12): 2221 - 2231. [Abstract] [PDF]
|
|
|
|
|
|
K Miyazono Positive and negative regulation of TGF-beta signaling J. Cell Sci., January 4, 2000; 113(7): 1101 - 1109. [Abstract] [PDF]
|
|
|
|
|
|
J.-i. Hanai, L. F. Chen, T. Kanno, N. Ohtani-Fujita, W. Y. Kim, W.-H. Guo, T. Imamura, Y. Ishidou, M. Fukuchi, M.-J. Shi, et al. Interaction and Functional Cooperation of PEBP2/CBF with Smads. SYNERGISTIC INDUCTION OF THE IMMUNOGLOBULIN GERMLINE Calpha PROMOTER J. Biol. Chem., October 29, 1999; 274(44): 31577 - 31582. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Jakubowiak, C. Pouponnot, F. Berguido, R. Frank, S. Mao, J. Massague, and S. D. Nimer Inhibition of the Transforming Growth Factor beta 1 Signaling Pathway by the AML1/ETO Leukemia-associated Fusion Protein J. Biol. Chem., December 15, 2000; 275(51): 40282 - 40287. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zhang and R. Derynck Transcriptional Regulation of the Transforming Growth Factor-beta -inducible Mouse Germ Line Ig alpha Constant Region Gene by Functional Cooperation of Smad, CREB, and AML Family Members J. Biol. Chem., May 26, 2000; 275(22): 16979 - 16985. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Thirunavukkarasu, R. R. Miles, D. L. Halladay, X. Yang, R. J. S. Galvin, S. Chandrasekhar, T. J. Martin, and J. E. Onyia Stimulation of Osteoprotegerin (OPG) Gene Expression by Transforming Growth Factor-beta (TGF-beta ). MAPPING OF THE OPG PROMOTER REGION THAT MEDIATES TGF-beta EFFECTS J. Biol. Chem., September 21, 2001; 276(39): 36241 - 36250. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
