The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, M.-J.
Right arrow Articles by Stavnezer, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, M.-J.
Right arrow Articles by Stavnezer, J.
The Journal of Immunology, 1998, 161: 6751-6760.
Copyright © 1998 by The American Association of Immunologists

CBF{alpha}3 (AML2) Is Induced by TGF-ß1 to Bind and Activate the Mouse Germline Ig {alpha} Promoter1

Meng-Jiao Shi and Janet Stavnezer2

Department of Molecular Genetics and Microbiology, Graduate Program in Immunology and Virology, University of Massachusetts Medical School, Worcester, MA 01655


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TGF-ß1 directs class switching to IgA by splenic B cells and by the surface IgM+ B cell line, I.29µ, by inducing germline (GL) Ig {alpha} transcripts. The promoter segment between -130 and +46, relative to the first initiation site for mouse GL {alpha} transcripts, is sufficient for expression and TGF-ß1 inducibility of a reporter gene in B cell lines. Within this segment resides a TGF-ß1-responsive element (TßRE) that is required for induction of the promoter by TGF-ß1 and, when multimerized, is sufficient to transfer TGF-ß1 inducibility to another promoter. In this report we show that a TGF-ß1-inducible complex binds the TßRE and contains the transcription factor core-binding factor (CBF; also known as acute myeloid leukemia, AML). Although all three CBF{alpha} family members activate the GL {alpha} promoter, only CBF{alpha}3 (AML-2) is induced by TGF-ß1 in splenic B and I.29µ cells. The TßRE contains two CBF binding sites. Mutation of both sites reduces but does not eliminate induction of the GL {alpha} promoter by TGF-ß1 or by overexpression of CBF, possibly due to the presence of an additional CBF site in the promoter. In addition, the TßRE contains two copies of another sequence motif. Mutation of these motifs eliminates TGF-ß1 induction of the GL {alpha} promoter. Together the data indicate that TGF-ß1 induction of the {alpha} promoter involves induction of CBF{alpha}3, which binds to the TßRE of the promoter along with one or more proteins.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Upon antigenic or mitogenic stimulation, B lymphocytes proliferate and differentiate toward Ab secretion. As they proliferate, some of the progeny switch from expression of IgM to expression of other Ig classes. Ig class switching allows the recombined variable (VDJ) region gene of the heavy chain to be expressed with a new downstream constant region (CH)3 gene, resulting in a change in the effector function of the Ab. Class switching is effected by a deletional recombination that occurs between switch regions located upstream of each CH gene. Class switch recombination is directed to particular CH genes by cytokines that induce transcription of germline (GL) transcripts from unrearranged CH genes before switch recombination (1). Although the functions of GL transcripts are unknown, transcription of unrearranged CH genes is important for regulation of class switch recombination. Two types of evidence support this statement. First, there is a good correlation between the specificity of GL transcription and the specificity of isotype switching events. Second, deletion of a DNA segment containing the promoter and first exon (I or GL exon) of the GL transcript by knockout technology abrogates switching to that CH gene (2, 3, 4, 5).

TGF-ß1 induces GL {alpha} transcripts and directs class switching to IgA in mouse splenic B cells activated by polyclonal activators, such as LPS (6, 7). Similarly, TGF-ß1 increases GL {alpha} transcripts, and in the presence of LPS induces switching to IgA in the surface IgM+ (sIgM+) I.29µ B lymphoma cell line (8, 9). The induction of GL {alpha} transcripts by TGF-ß1 in I.29µ cells is due to regulation at the transcriptional level (8). Previous work showed that the promoter segment containing nucleotides from -128 to +46, relative to the first initiation site for GL {alpha} transcripts, is sufficient for expression and TGF-ß1 inducibility of a reporter gene in two different B cell lines (10). Within the -128/+46 segment, a novel element (called TßRE) was shown to be required for TGF-ß1 inducibility of a reporter gene and, when multimerized, to be sufficient to transfer the inducibility to a minimal c-fos promoter (10). The TßRE is also present in the human GL {alpha}1 and {alpha}2 promoters and has been shown to be responsive to TGF-ß1 in the human GL {alpha}1 promoter (11, 12). Despite the importance of the TßRE for GL {alpha} transcription, no protein that binds the TßRE and regulates the GL {alpha} promoter has been identified.

The core-binding factor (CBF) family of transcription factors plays a key role in hematopoiesis and bone ossification. The family consists of three {alpha} (CBF{alpha}) and one ß (CBFß) subunits (reviewed in Refs. 13 and 14). CBF binds to DNA as a heterodimer of the {alpha} and ß subunits. All the {alpha} subunits contain a highly conserved runt domain that is responsible for both DNA binding and dimerization with the CBFß subunit (15, 16, 17, 18, 19, 20), which by itself cannot bind DNA but increases the affinity of CBF{alpha} protein for DNA about fivefold (16, 17, 18). CBF{alpha} is also known as acute myeloid leukemia (AML) or polyomavirus enhancer core-binding protein-2{alpha} (PEBP2{alpha}). Thus, CBF{alpha}1 is also known as AML3 or PEBP2{alpha}A, CBF{alpha}2 as AML1 or PEBP2{alpha}B, and CBF{alpha}3 as AML2 or PEBP2{alpha}C. CBFß is also known as PEBP2ß.

CBF specifically recognizes the consensus sequence ACCPuCA (13). This sequence motif has been identified in both viral and cellular promoters and/or enhancers of a number of genes including polyomavirus and murine leukemia virus and some hematopoietic-specific genes, such as in the Ig µ intron enhancer (21), and the genes for the TCR (TCR {alpha}-, ß-, {delta}-, and {gamma}-chains), CD3{epsilon}, cytokines (IL-3 and granulocyte-macrophage CSF), the CSF receptor, and the myeloid-specific genes myeloperoxidase and neutrophil elastase (reviewed in 13 . The binding site has also been found in bone-specific genes (22, 23).

Although all the {alpha} subunits bind and activate transcription via the same sequence motif (16, 19, 24, 25, 26, 27), the expression levels of different CBF{alpha} proteins differ among different tissues. CBF{alpha}1 (AML3) is most abundant in osteoblasts and is also present in thymocytes and T cell lines (16, 27, 28, 29). CBF{alpha}2 (AML1) is abundant in T and myeloid cells and also in B cells and some B cell lines (15, 26, 28, 30, 31). CBF{alpha}3 (AML2) is most abundant in B and myeloid cell lines (26). CBFß is ubiquitously expressed (17, 18, 28). Thus, at least one explanation for the different functions of the three CBF{alpha} proteins in vivo must be their different patterns of expression. A knockout of the CBF{alpha}1 gene in the mouse completely blocks bone ossification. Such mice die just after birth due to inability to breathe (32). A knockout of the CBF{alpha}2 gene in the mouse results in death on days 12–14 of fetal development owing to hemorrhaging in the central nervous system and blockage of fetal liver hematopoiesis (33, 34). The targeted deletion experiments indicate that the function of CBFß is similar to that of CBF{alpha}2, as it is also essential for definitive hematopoiesis of all lineages and its deletion leads to death at midgestation (35, 36, 37). Furthermore, the CBF{alpha}2/CBFß transcription factor complex represents one of the most important targets of chromosomal translocations found in human leukemias, hence the alternative name AML (13, 14, 38).

In this report, we demonstrate that CBF (AML) proteins bind to the TßRE present within the GL {alpha} promoter for GL {alpha} transcripts and that CBF{alpha}3 (AML2) and TßRE binding activities are up-regulated by TGF-ß1. We also demonstrate that CBF activates the GL {alpha} promoter.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell lines

Three mouse B lymphoma cell lines were used in this study: I.29µ (22D subclone) and CH12.LX, two sIgM+ B cell lines that can be induced to undergo class switch recombination to IgA (39, 40, 41, 42), and A20.3, a sIgG2a+ B cell line that has not been demonstrated to undergo class switching (43, 44).

Cell culture

A20.3 and CH12.LX cells were cultured at 37°C in an atmosphere of 5% CO2 in RPMI 1640 medium supplemented with 10% FBS, 50 µM 2-ME, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.1 mg/ml kanamycin sulfate (the last six reagents were from Life Technologies Laboratories, Grand Island, NY). I.29µ cells were cultured similarly to A20.3 cells, except in 8% CO2, and the medium was supplemented with 0.1 U/ml regular purified pork insulin (Squibb and Sons, Princeton, NJ), and the FBS concentration was 20%. In transfection experiments, human TGF-ß1 (R & D System, Minneapolis, MN) was added right after transfection at 1–2 ng/ml. The amount of TGF-ß1 used was determined to be in the optimal range (data not shown).

Splenic B cells were purified by depletion of T cells, using mAbs for Ty1.2 (HO13.4), Thy1 (Jij.10), CD4 (GK1.5), and CD8 (3.168) followed by addition of anti-rat {kappa}-chain mAb (MAR 18.5) and guinea pig complement. Dead cells were removed by centrifugation on Ficoll-Hypaque gradients. Purified splenic B cells were cultured as were A20.3 cells, with addition of LPS (50 µg/ml) for 18 h and TGF-ß1 (2 ng/ml) for 14 h.

Oligonucleotides

The sequences of the top strand of the double-stranded oligonucleotides used in EMSAs are given below. Lower case letters indicate nucleotides not present in the {alpha} promoter that were added for cloning. Underlines indicate consensus motifs for the transcription factor binding sites. Bold nucleotides indicate mutations: CBF consensus, CGTATTAACCACAATACTCG; TßRE(-130/-104), CACCACAGCCAGACCACAGGCCAGACA; m1-TßRE, gaTCCACCACAGAACTACCACAGGAACTACA; m2-TßRE, gaTCCGTGACAGACAGACCTGCAGCCAGACA; C{alpha}(-104/-69), ATGACGTGGAGGCAAGCGGCCACAACGTGGAGGTGG; C{alpha}(-94/-55), GGCAAGCGGCCACAACGTGGAGGTGGAACAGGAAGTGGGT; C{alpha}(-95/-78), AGGCAAGCGGCCACAACG; Ets(C{alpha} -71/-55), TGGAACAGGAAGTGGGT; and reverse PCR primer (+14/-7), cgcggatccTGGATGGGTCAGACTGAGCGC. Single-stranded oligonucleotides were obtained from Operon Technologies (Alameda, CA).

Plasmid constructs

Wild-type or mutated GL {alpha} promoter -130/+14 segments were created by PCR using oligonucleotides containing wild-type or mutated TßREs as primers. Some of the segments with mutations were obtained using an overlap extension technique (45). PCR-amplified fragments were then cloned into SmaI/BglII sites upstream of the luciferase reporter gene in the pXP2 vector (46). Each construct was sequenced to verify that only the desired mutations had been introduced. DNA sequencing was performed using the dideoxy chain termination method with Sequenase version 2.0 kits (U.S. Biochemical Corp. Cleveland, OH).

Expression plasmids

Expression plasmids containing cDNAs for mouse CBF{alpha}1 (AML3), human CBF{alpha}2 (AML1B), the trans-activating form of AML1 (25), and human CBF{alpha}3 (AML2) (26) were obtained from S. Hiebert, St. Jude Children’s Research Hospital (Memphis, TN). Expression plasmids containing cDNAs for mouse CBF{alpha}2 and CBFß were obtained from N. Speck, Dartmouth Medical School (Hanover, NH). These expression plasmids (30 µg) were cotransfected with the luciferase reporter plasmids driven by the mouse GL {alpha} promoter -130/+14. At the amino acid level, human and mouse CBF{alpha}3 are identical (47), whereas human and mouse CBF{alpha}2 share about 90% identity (25, 48). We compared the activities of human and mouse CBF{alpha}2 expression plasmids and found no difference (data not shown). Since the CBF cDNAs were cloned into different expression vectors, we first tested whether the different empty expression vectors have different effects on the {alpha} promoter activity. We cotransfected the empty expression vectors pCMV-2, pCMV-5, and pcDNA I into A20.3 cells and found that all have similar luciferase activities. Therefore, we used pCMV-2 as the vector control for all CBF expression plasmids.

Transfection, luciferase, chloramphenicol acetyltransferase (CAT), and ß-galactosidase (ß-gal) assays

For each transfection, 50 x 106 cells were resuspended in 1 ml of RPMI 1640 containing 50 µg of luciferase reporter plasmid DNA for I.29µ and 30 µg for A20.3 cells along with 10 µg of control plasmid DNA before imposing an electric shock at 1250 µF and 750 V/cm using Cell ZapII (Anderson Electronics, Brookline, MA). To control for variation in transfection efficiency, the plasmid pSV2CAT, which expresses the CAT gene under control of the SV40 enhancer/promoter, was cotransfected in all experiments in I.29µ cells, and the plasmid pPGKß-gal, which expresses the ß-gal gene under control of the PGK enhancer/promoter, was used in all experiments in A20.3 cells. After transfection, cells were rested at room temperature for 10 min and then pipetted into complete FBS/RPMI medium at approximately 1.7 x 106 cells/ml. Cells were incubated for 24 h at 37°C and then assayed for luciferase, CAT (49), and ß-gal (50) activities. CAT activity was measured by a liquid scintillation counter after 20-h incubation at 37°C.

Oligonucleotide probes for EMSAs

Double-stranded (ds) oligonucleotides were prepared and labeled as previously described (51).

Preparation of cytoplasmic and nuclear extracts

Cells were pelleted and resuspended in fresh medium at 106 cells/ml before adding stimuli. After incubation, cells were harvested, and cytoplasmic and nuclear extracts were prepared using a modification of the small scale method of Schreiber et al. (49, 52). Protein concentrations of the cytoplasmic and nuclear extracts were determined using the Bradford assay (Bio-Rad, Richmond, CA).

EMSA

DNA binding reactions were performed in 15-µl reaction volumes containing 0.1–1 ng (15,000–30,000 cpm) of end-labeled dsDNA probe, 1–5 µg of nuclear extracts, and 2–4 µg of poly(dI-dC) (Pharmacia, Piscataway, NJ). The final concentration of NaCl in each reaction mixture was adjusted to 80 mM by adding buffer C (52). The reaction mixtures were incubated at room temperature for 30 min and then loaded onto 4–6% native polyacrylamide gels. All gels were electrophoresed in recirculating 0.5x TBE buffer at 100–150 V for 2–4 h. For supershift experiments, Ab (or antiserum; 1 µl) and nuclear extracts were added to the entire mixture before the probe. Polyclonal Abs against human CBF{alpha}1 (AML3), CBF{alpha}2 (AML1B), CBF{alpha}3 (AML2), and CBFß used in both EMSAs and Western blot analyses were obtained from S. Hiebert, St. Jude Children’s Research Hospital. mAb against mouse CBFß from N. Speck, Dartmouth Medical School, was also used in Western blot analyses.

Western blot analyses

Western blot analyses were performed by standard procedures. Briefly, nuclear extracts (10 µg/lane) were resolved by 12% SDS-PAGE and electroblotted onto Millipore Immobilon-P transfer membrane. Membranes were incubated overnight at 4°C in PBS containing 5% milk and 0.1% Tween-20 and Abs. After a brief wash with the same solution without Ab, the membrane was incubated with the secondary Ab for 2–3 h at room temperature, followed by chemiluminescent detection using SuperSignal ULTRA Chemiluminescent Substrate (Pierce, Rockford, IL) according to the manufacturer’s specifications. Membranes were exposed for 10 s to 5 min to Kodak XAR film (Eastman Kodak, Rochester, NY) for detection of signals.

Densitometry quantitation

Quantitation of DNA binding activity and protein expression were performed by densitometry using a Molecular Dynamics Personal Densitometry SI (Sunnyvale, CA), and the results were analyzed using Bio-Rad MultiAnalyst.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
TGF-ß1 induces a complex in I.29µ nuclear extracts that binds the Ig {alpha} Tß RE of the GL {alpha} promoter

Previous studies identified a novel TßRE at –128/-105 relative to the first RNA initiation site in the mouse GL {alpha} promoter that is required for induction of the GL {alpha} promoter by TGF-ß1. When the TßRE was used as a probe in EMSAs, complexes were formed using nuclear extracts from I.29µ cells (10). To examine whether complexes binding the TßRE could be induced by TGF-ß1, we performed EMSAs using the TßRE (-130/-104) as a probe and nuclear extracts from I.29µ cells treated with TGF-ß1 for varying times. As shown in Fig. 1GoA, two major complexes were formed with the TßRE, one of which was induced fourfold by TGF-ß1 treatment for 12 h, but not for 6 h. Induction of the complex slightly decreased after treatment for 18 h.



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 1. EMSAs demonstrate that TGF-ß1 increases binding of a protein complex to the TßRE in the GL {alpha} promoter in I.29µ nuclear extracts. A, Three micrograms of nuclear extracts (NEs) from cells untreated (-) or treated (+) with TGF-ß1 (2 ng/ml) for the indicated times were incubated with the end-labeled GL {alpha} -130/-104 segment named TßRE. The arrow indicates the TGF-ß1-inducible complex. B, NEs (3.5 µg) from cells untreated (-) or treated (+) with TGF-ß1 (2 ng/ml) in the absence or the presence of cycloheximide (CHX; 5 µg/ml) for 10 h were incubated with the end-labeled TßRE probe. The left-most lane in both A and B contains probe alone.

 
Since results from the kinetics experiment demonstrate a slow induction of binding activity by TGF-ß1, we reasoned that induction of the TßRE binding complex may require de novo protein synthesis. To test this, we performed EMSAs using nuclear extracts from I.29µ cells treated with TGF-ß1 in the presence or the absence of the protein synthesis inhibitor cycloheximide. As expected, treatment with cycloheximide completely prevented the induction of complexes binding to the TßRE (Fig. 1GoB). These data indicate that TGF-ß1 induces a complex in I.29µ extracts that binds the Ig {alpha} TßRE of the GL {alpha} promoter and that induction of the complex requires de novo protein synthesis.

The TGF-ß1-inducible complex binds to two CBF consensus elements in the TßRE

The {alpha} TßRE contains two copies of a sequence (underlined in Fig. 2Go), and deletion of one of these two repeats reduces the TGF-ß1 inducibility by 50% (10). To identify the binding site(s) in the TßRE for the inducible complex, we made two different sets of mutations in the direct repeats of the TßRE (m1 and m2) and tested the effects of these mutations in EMSAs. Figure 2GoA demonstrates that binding of the TGF-ß1-inducible complex in I.29µ nuclear extracts to the wild-type TßRE probe is competed well by a 100-fold excess of unlabeled wild-type TßRE and competed nearly as well by a 100-fold excess of an oligonucleotide with the m1 mutation, but not by an oligonucleotide with the m2-TßRE mutation. These results indicate that the binding of the TGF-ß1-inducible complex requires nucleotides that are mutated in the m2-TßRE mutant, the wild-type sequence of which matches the consensus CBF binding site ACCACA. This was confirmed by EMSAs using an oligonucleotide containing a consensus CBF binding site as a competitor (Fig. 2GoA). Since CBF proteins preferentially bind a site containing the nucleotide A just upstream of the core motif ACCACA (13), the CBF oligonucleotide competes better than the TßRE (Fig. 2GoA). These data demonstrate that the TGF-ß1-inducible complex binds to the two CBF binding sites within the TßRE (Fig. 2Go).



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 2. EMSAs demonstrate that the TGF-ß1-inducible complex in I.29 µ nuclear extracts (NEs) contains CBF. A, Competition of the complexes formed with the wild-type TßRE probe by a 10- or 100-fold excess of unlabeled wild-type or mutated (m1 and m2) TßRE oligonucleotides or with an oligonucleotide containing the CBF consensus site. The wild-type and mutated TßRE sequences and the CBF consensus sequence are shown below, with the CBF sequence motifs boxed and repeats of another sequence underlined. Mutated nucleotides are indicated by bold type. NEs (2 µg) in the competition assay are from I.29µ cells treated with TGF-ß1 for 18 h. B, EMSAs performed with wild-type or m1-TßRE as probes (PWT or Pm1, respectively). Both the wild-type and m1 probes have extra GATC sequences 5' of the TßRE. NEs (1.5 µg) from I.29µ cells untreated (-) or treated (+) with TGF-ß1 for 14 h were used. C, EMSAs performed with 0.3 nM recombinant CBF{alpha}2 runt domain and wild-type or mutated (m1 and m2) TßRE probes. The reason for the different mobilities of the complexes is probably due to the different lengths of the wild-type and m1 probes (27 and 31 nucleotides, respectively). Due to the small size of the recombinant runt domain, its migration is influenced by the probe length.

 
Results from the competition experiment indicate that the CBF sites (mutated in m2) in the TßRE are essential for binding of the TGF-ß1-inducible complex, whereas the nucleotides mutated in the m1 mutation might not be required. To further examine the importance of the nucleotides mutated in mutant m1, we used the m1-TßRE oligonucleotide as a probe in EMSAs incubated with either nuclear extracts from I.29µ cells (Fig. 2GoB) or CBF recombinant protein (Fig. 2GoC). The results show that the m1 mutation greatly reduces binding of the TGF-ß1-inducible complex compared with that formed with the wild-type probe (Fig. 2GoB). No corresponding complex was formed with the m2-TßRE probe (data not shown). By contrast, recombinant CBF{alpha}2 runt domain (which is conserved among the CBF{alpha} subunits) binds equally well to the wild-type and m1-TßRE probes (Fig. 2GoC). The equivalent binding to the wild-type or m1 probe is not surprising, since CBF{alpha} proteins do not preferentially bind to a site with a G (as in the wild-type TßRE) instead of a T (as in m1) upstream of the ACCACA consensus motif (13). These data suggest that the nucleotides mutated in the m1 probe interact with another protein(s) that increases the binding of CBF to the TßRE in the wild-type promoter.

CBF{alpha}3 (AML2) is the predominant CBF{alpha} protein in the TGF-ß1-induced complex

To identify the specific CBF proteins binding to the GL {alpha} TßRE, we tested Abs against all known members of the family in supershift EMSAs. As shown in Fig. 3Go, Ab against CBF{alpha}3 (AML2) partially supershifted the major complex. Abs against CBF{alpha}1 (AML3), CBF{alpha}2 (AML1), and CBFß weakly supershifted the complex. While the Ab against CBF{alpha}2 weakly cross-reacted with {alpha}1 and {alpha}3 on Western blots, the Abs against CBF{alpha}1 and {alpha}3 were specific (26). These data suggest that CBF{alpha}3 (AML2) is the predominant {alpha} subunit in I.29µ B cells treated by TGF-ß1, but that the other CBF {alpha} subunits and CBFß may also be present and bind the TßRE.



View larger version (70K):
[in this window]
[in a new window]
  		FIGURE 3. Supershift EMSAs demonstrate that CBF{alpha}3 is the main binding component of the CBF family in the TGF-ß1-inducible complex in I.29µ nuclear extracts (NEs). NEs (2.3 µg) from I.29µ cells treated with TGF-ß1 for 14 h were incubated with the TßRE probe in the presence or the absence of the indicated Ab (1 µl). Lane 1 contains probe alone.

 
CBF{alpha}3 (AML2) is induced by TGF-ß1 in I.29µ nuclear extracts

To directly examine the expression and regulation of CBF in I.29µ cells, we performed Western analyses using cytoplasmic and nuclear extracts from cells untreated or treated with TGF-ß1 for 14 h. CBF{alpha}1 was not detected by Western analyses (data not shown), consistent with previous reports that CBF{alpha}1 (AML3) is not in pre-B and sIg+ B cell lines (21, 26), although it is present in a plasmacytoma line (21). The weak supershift observed using anti-CBF{alpha}1 Ab in EMSAs may be due to the greater sensitivity of the EMSA.

As shown in Fig. 4GoA, two isoforms of CBF{alpha}2 are detected in cytoplasmic extracts, but only the smaller form is detected in nuclear extracts. The size of CBF{alpha}2 in I.29µ nuclear extracts agrees with the 48.6-kDa form identified in a mouse B lymphoma cell line by Bae et al. (30). Treatment with TGF-ß1 had almost no effect on the level of CBF{alpha}2 in the cytoplasm but very slightly reduced its expression in nuclear extracts. The detection of CBF{alpha}2 cannot be due to cross-reaction with CBF{alpha}1, since CBF{alpha}1 was undetectable, nor was it due to cross-reaction with CBF{alpha}3, since CBF{alpha}3 was highly inducible by TGF-ß1 (see below).



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 4. Western blot analyses demonstrate that expression of CBF{alpha}3 and CBFß in nuclei of I.29µ cells are induced by TGF-ß1. Ten micrograms of cytoplasmic or nuclear extracts (Cyto or Nucl) untreated (-) or treated (+) with TGF-ß1 (2 ng/ml) for 14 h were loaded in each lane. The blot was incubated with the indicated Abs from S. Hiebert (Memphis, TN). Both forms of CBFß detected were longer than those previous reported, ranging from 17–22 kDa (13). However, the 28-kDa form in the present study was also detected by the mAb from N. Speck (Hanover, NH). The positions of m.w. markers are indicated on the left.

 
Interestingly, TGF-ß1 induced expression by about 18-fold of two isoforms of CBF{alpha}3 in nuclei (Fig. 4GoB). Expression of CBF{alpha}3 in the cytoplasm was barely detectable. The approximately 50-kDa forms were the expected size for CBF{alpha}3 (20, 31, 47). CBFß was constitutively expressed in both cytoplasm and nuclei of I.29µ cells, and the 28-kDa form was reproducibly induced by TGF-ß1 in I.29µ cells (Figs. 4GoC and 5B).

Thus, the induction of the TßRE-binding activity observed in EMSAs is consistent with the induction of CBF{alpha}3 (AML2) by TGF-ß1 as detected by Western analysis. The induction of binding activity is low, however, relative to the large induction of CBF{alpha}3 protein. This may be due to constitutive expression of CBF{alpha}2, as it binds the identical sequence element and has a similar m.w.

CBF{alpha}3 is also induced in splenic B cells and other B cell lines

I.29µ cells constitutively express GL {alpha} transcripts, which can be further induced by treatment with TGF-ß1. We asked whether the ability of other B cells and B cell lines to express GL {alpha} transcripts correlates with the expression of CBF and its induction by TGF-ß1. The expression and regulation of CBF{alpha}3 and CBFß were examined in splenic B cells and in two additional B lymphoma cell lines: the sIgM+ line, CH12.LX, and the sIgG2a+ line, A20.3. CH12.LX cells constitutively express GL {alpha} transcripts, which can be further increased by treatment with TGF-ß1, and the cells can be induced to undergo class switch recombination to IgA (41, 42). A20.3 cells do not express GL {alpha} transcripts and have not been found to undergo class switching (10) (our laboratory observations).

Western blot analyses of nuclear extracts from these B cells indicated that the constitutive expression of CBF{alpha}3 was highest in CH12.LX cells, lower in I.29 µ cells, and barely detectable in A20.3 or splenic B cells (Fig. 5GoA). TGF-ß1 treatment induced expression of CBF{alpha}3 in splenic B and in I.29 µ cells and marginally induced CBF{alpha}3 (1.7-fold) in CH12.LX cells, but not in A20.3 cells. Thus, CBF{alpha}3 can be induced in two B cell lines and in a B cell population that can be induced to express GL {alpha} transcripts and to switch to IgA, but not in a B cell line that cannot be induced by TGF-ß1 to express GL {alpha} transcripts. In contrast with the expression of CBF{alpha}3, the levels of CBFß in nuclear extracts from different B cells were similar (Fig. 5GoB).



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 5. Expression levels of CBF subunits differ among B cells and B cell lines. A and B, Western blot analyses with the Ab indicated below. Nuclear extracts (NEs; 10 µg) were loaded in each lane. The m.w. markers are shown on the left for each panel. The same blot was probed in A and B. C, EMSAs in which the TßRE probe was incubated with 2 µg of NEs from splenic B (Spl B), I.29µ, A20.3, or CH12. LX (CH12) cells were untreated (-) or treated (+) with TGF-ß1 for 14 h (plus LPS for Spl B for 18 h). Lane 1 contains probe alone.

 
Several isoforms of CBF{alpha}3 are detected in these various B cells. CBF{alpha} mRNA always occurs in multiple, alternatively spliced forms, the sizes of which may be cell type-specific (15, 17, 18, 26, 28, 30, 31).

The TßRE binding activities of nuclear extracts from the various cells were examined by EMSA. As shown in Fig. 5GoC, the activity was highest in CH12.LX and I.29µ cells, lower in splenic B cells, and lowest in A20.3 cells. Furthermore, binding activity was not induced by TGF-ß1 in A20.3 and splenic B cells, but was induced in both I.29µ (2.5-fold) and CH12.LX (1.3-fold) cells. Although induction by TGF-ß1 was lower in CH12.LX than in I.29µ cells, there was a greater constitutive binding activity in CH12.LX extracts. Lack of induction of TßRE binding activity in splenic B cells may be due to constitutive expression of CBF{alpha}2 (28) and to the low level of CBF{alpha}3 induced. In conclusion, the ability of the B cells to express GL {alpha} transcripts correlates with the levels of CBF{alpha}3 induced by TGF-ß1 and the TßRE binding activities.

Effects of mutations in the TßRE on expression of the GL {alpha} promoter in I.29µ cells

To assess the function of CBF binding to the GL {alpha} promoter, we examined the effects of mutations in the TßRE on reporter gene activity. The GL {alpha} promoter -130/+14 or -132/+14 segments containing the wild-type or mutated TßRE (m1 and m2) were cloned upstream of the luciferase reporter gene in the promoterless pXP2 plasmid and were transiently transfected into I.29µ B cells. Consistent with previous data (10), TGF-ß1 treatment increased luciferase activity of the plasmid driven by the wild-type GL {alpha} promoter by 3.5-fold (Fig. 6Go). This is in accord with the finding that TGF-ß1 increases transcription of endogenous GL {alpha} RNA in I.29µ cells by 5-fold in a nuclear run-on assay (8) and also correlates with the 4-fold induction of the TßRE binding activity by TGF-ß1 in I.29µ cells (Fig. 1Go).



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 6. Effects of mutations in the {alpha} TßRE on luciferase reporter gene expression in I.29µ cells. The wild-type (-130/+14) and mutated (-132/+14) segments of the GL {alpha} promoter (except m1- or m2-TßRE, which have an additional A or GA sequence upstream of -132, respectively) were inserted upstream of the luciferase reporter gene in the enhancerless, promoterless pXP2 plasmid. Luciferase activities of reporter plasmids transiently transfected into I.29µ cells are shown. TGF-ß1 was added immediately after transfection and again 7 h after transfection at 1 ng/ml each time. Luciferase activity was assayed 24 h after transfection. The mean ± SE from at least three independent experiments are reported after subtraction of background (no cell extract) of 200–300 light units. Variation in transfection efficiency among different plasmids was corrected by the activity of pSV2CAT, which was cotransfected with the luciferase plasmids.

 
The two mutations of the TßRE have different effects on promoter activity. The m1 mutation eliminates TGF-ß1 induction and has almost no effect on basal activity. The m2 mutation, which eliminates CBF binding to the TßRE, only reduces TGF-ß1 induction by about 30%, but also reduces basal promoter activity by about 50% (Fig. 6Go). Both mutations reduce the transcriptional activity of the promoter in the presence of TGF-ß1.

These transfection data indicate that CBF contributes to both basal activity and to TGF-ß1 induction of the GL {alpha} promoter. Failure of the m2-TßRE to eliminate TGF-ß1 induction of the promoter may be due to the presence of additional CBF sites in the GL {alpha} promoter, as demonstrated below. In addition, elimination of TGF-ß1 induction of the promoter by the m1 mutation suggests that a protein(s) binding the nucleotides mutated in the m1-TßRE is required for TGF-ß1 induction of the promoter. Consistent with this hypothesis are the EMSA data, which indicate that sequence elements mutated in the m1-TßRE are required for optimal binding of the TGF-ß1-inducible complex to the TßRE (Fig. 2Go). Together the data suggest that CBF interacts with another protein(s) that binds the sites defined by the m1 mutation to cause TGF-ß1 induction of the GL {alpha} promoter.

Overexpression of CBF proteins activates the GL {alpha} promoter

To directly examine the ability of CBF proteins to activate transcription from the GL {alpha} promoter, we cotransfected expression plasmids for CBF proteins and the reporter plasmid driven by the GL {alpha} promoter -130/+14 segment into A20.3 cells. We chose A20.3, since these cells express only low levels of CBF{alpha} and TßRE binding activity, which are not further induced by TGF-ß1 (Fig. 5Go). Although only CBF{alpha}3 is induced in I.29µ cells, we tested the effects of overexpression of all three {alpha} subunits on the promoter activity, as it has been shown that all {alpha} subunits can trans-activate the TCR ß or murine leukemia virus enhancers in vivo (16, 19, 24, 25, 26, 53).

Overexpression of CBF{alpha} proteins in A20.3 cells increased the GL {alpha} promoter activity by 3- to 7-fold in the absence of TGF-ß1 (Fig. 7GoA). The response to CBF was increased to 5- to 12-fold in the presence of TGF-ß1. The increased response to CBF in the presence of TGF-ß1 could be due to post-translational modification of the overexpressed CBF{alpha} proteins and/or to interaction of CBF with another TGF-ß1-inducible protein(s) in A20.3 cells.



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 7. Effects of overexpression of CBF proteins on the GL {alpha} promoter activity in A20.3 cells. A, Luciferase reporter plasmids containing the wild-type -130/+14 segment of the {alpha} promoter were transiently transfected into A20.3 cells together with expression plasmids containing cDNAs for CBF{alpha}1, -2, and -3 or the empty vector pCMV-2. The pPGKß-gal plasmid was cotransfected as an internal control for variation in transfection efficiency among different plasmids in A and B. TGF-ß1 was added immediately after transfection at 1–2 ng/ml. Luciferase and ß-gal activities were assayed 24 h after transfection. The mean ± SE from three independent experiments are reported after subtraction of background (no cell extract) of 200–300 light units. The twofold induction of the GL {alpha} promoter by TGF-ß1 in the absence of overexpressed CBF is low compared with the eightfold induction previously observed in A20.3 cells (10) (data not shown). This may be related to the unusually high basal activity observed in these experiments. The promoterless pXP2 had an activity below 500 light units, and its activity was not increased by cotransfection of the CBF plasmids. B, Effects of mutations in the GL {alpha} promoter on activation by CBF{alpha}3 in the absence of TGF-ß1. The wild-type (WT) and mutated luciferase reporter plasmids were transiently transfected into A20.3 cells together with an expression plasmid for CBF{alpha}3 or with the empty vector pCMV-2. The plasmid -98/+14 has an additional GATC sequence upstream of the GL {alpha} -98/+14 segment. Luciferase and ß-gal activities were assayed 24 h after transfection. The mean ± SE from three independent experiments are reported for pXP2, WT, and m2 plasmids, whereas the mean ± range from two independent experiments are reported for other plasmids (after subtraction of background (no cell extract) of 200–300 light units). The fold induction of the promoter activity by overexpressing CBF{alpha}3 is indicated on the top of the bars for each plasmid.

 
Although CBFß cannot bind DNA, it heterodimerizes with CBF{alpha} proteins and increases their affinity for DNA (16, 17, 18, 25). To determine whether overexpression of CBFß together with CBF{alpha} protein activates the promoter better than CBF{alpha} alone, an expression plasmid containing mouse CBFß cDNA alone or together with a plasmid containing CBF{alpha}2 or CBF{alpha}3 cDNA was cotransfected into A20.3 cells. Overexpression of CBFß alone or together with CBF{alpha}2 or CBF{alpha}3 resulted in luciferase activity marginally greater than that of the pcDNA I vector, CBF{alpha}2, or CBF{alpha}3 alone, respectively (data not shown). These results indicate that CBFß is not limiting, consistent with a previous report (15).

Effects of mutations in the GL {alpha} promoter on the CBF{alpha} response of the promoter

The results presented above demonstrate that all CBF{alpha} subunits activate the GL {alpha} promoter. To determine whether the CBF proteins are acting on the TßRE of the GL {alpha} promoter, we tested the effects of TßRE mutations m1 and m2 on activation of the GL {alpha} promoter by overexpressed CBF. Since only CBF{alpha}3 is induced by TGF-ß1 in I.29 µ cells, we only present the effect of overexpression of CBF{alpha}3. Overexpression of CBF{alpha}2 produced similar results (data not shown).

Cotransfection of an expression plasmid for CBF{alpha}3 in A20.3 cells increased activity of the GL {alpha} promoter by 5.2-fold, and this activity was reduced about 35% by the m2 mutation in the TßRE (Fig. 7GoB), similar to the effect of this mutation on induction by TGF-ß1 in I.29µ cells (Fig. 6Go). The response to CBF was reduced, but again was not eliminated, by the m1 mutation in the TßRE (Fig. 7GoB), although this mutation eliminated the response to TGF-ß1 (Fig. 6Go). This indicates that the protein(s) binding to the nucleotides mutated in m1 cannot interact with CBF except in cells treated with TGF-ß1. Finally, a DNA segment (-98/+14) that lacked the entire TßRE and adjacent ATF/CRE site (10) had a reduced basal activity but responded well to the overexpression of CBF{alpha}3 (only a 20% reduction with respect to the fold induction). These data suggest that other sequence elements in the {alpha} promoter must be involved in its activation by CBF.

Identification of multiple CBF-binding sites in the GL {alpha} promoter

Failure of the m2 mutation to eliminate TGF-ß1 induction of the GL {alpha} promoter in I.29µ cells or the response to CBF{alpha}3 in A20.3 cells may result from additional CBF binding sites in the GL {alpha} promoter. Visual inspection of the sequence within the -130/+14 region revealed an incomplete CBF binding site CCACA at -85/-81 (Fig. 8Go). We examined the binding activity and TGF-ß1 inducibility of complexes formed with a probe ({alpha} -95/-78) that contains this element. As shown in Fig. 8GoA, two complexes bound this element, one of which was inducible by TGF-ß1 (indicated by an arrow), although the binding activity of this probe was much less than that of the TßRE. Competition analyses indicated that the TGF-ß1-inducible complex could be competed by a CBF binding site and to a lesser extent by the TßRE and the unlabeled probe itself (Fig. 8GoB). Similarly, complexes formed with the TßRE could be inhibited by DNA segments including the -85/-81 CCACA element, but were poorly inhibited by one that does not (-71/+14; Fig. 8GoC). Thus, there appears to be another CBF binding site in the GL {alpha} promoter in addition to the two sites within the TßRE. This may explain why the m2-TßRE mutation cannot completely eliminate the CBF-response in A20.3 cells.



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 8. EMSAs identify an additional CBF binding site in the GL {alpha} promoter. A, Two micrograms of nuclear extracts (NEs) from I.29µ cells untreated (-) or treated (+) with TGF-ß1 for 14 h were incubated with the TßRE probe (-130/-104) or with a labeled oligonucleotide corresponding to the -95/-78 segment (P-95/-78). The sequences of the probes are shown below. B, Competition of complexes formed with P-95/-78 and NEs from TGF-ß1-treated cells by a 100-fold excess of unlabeled oligonucleotides corresponding to the GL {alpha} -95/-78, the TßRE or the Ets (-71/-57) binding site, or a consensus binding site for CBF. C, Competition of the complex formed with PTßRE probe and NEs from TGF-ß1-treated cells by a 300-fold excess of unlabeled oligonucleotides corresponding to the GL {alpha} TßRE, or the indicated wild-type GL {alpha} segments or the -132/+14 segment containing mutations in the CBF binding sites in the TßRE, m2(-132/+14). The relative positions of the CBF binding sites and other consensus transcription factor binding sites in the GL {alpha} promoter are shown at the bottom. Lane 1 in each panel and lane 4 in A contain probe alone.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
TGF-ß1 is a pleiotropic cytokine, with suppressive effects on growth and both inhibitory and stimulatory effects on the differentiation of a variety of cell types, including B cells. Several DNA sequence elements responsive to TGF-ß1 have been identified in a number of genes. These elements include several known transcription factor binding sites, e.g., AP-1, NF-1, USF, and Sp1 sites (54, 55, 56, 57, 58, 59, 60).

In this report we identify two CBF binding sites within the TßRE of the promoter for GL {alpha} RNA. We demonstrate that CBF binds to the TßRE and that CBF{alpha}3 (AML2) is induced by TGF-ß1 in splenic B cells and in two B cell lines, I.29µ and CH12.LX. All three CBF{alpha} subunits can activate the GL {alpha} promoter, and mutation of the CBF binding sites in the TßRE has similar effects on activation of the promoter by CBF{alpha}2 or CBF{alpha}3. Although the mechanism of transcriptional activation by CBF is unknown, it has recently been demonstrated that CBF{alpha}2 (AML-1B) colocalizes with active RNA polymerase II at the nuclear matrix (61).

Despite their similar trans-activation abilities, the transcriptional targets of the three CBF{alpha} proteins in vivo differ due to their variable expression among different tissues and cell lines. Not surprisingly, CBF{alpha} genes are regulated by different factors. CBF{alpha}1 is induced in fibroblasts by treatment with bone morphogenic protein-7, a member of the TGF-ß superfamily. Subsequent to induction of CBF{alpha}1, the fibroblasts undergo osteoblast differentiation (29). The trans-activating form of CBF{alpha}2 (AML1B) is up-regulated in the embryonic carcinoma cell line F9 cells by retinoic acid (62) and is also increased following denervation of rat skeletal muscle (63). In the present study we demonstrate for the first time that a CBF protein is induced by TGF-ß1.

In addition to being induced by TGF-ß1, we found that the constitutive levels of CBF{alpha}3 appear to correlate with the propensity of the B cells to switch to IgA. Abundant CBF{alpha}3 is present in the two B cell lines capable of expressing endogenous GL {alpha} transcripts and switching to IgA. In contrast, CBF{alpha}3 cannot be induced by TGF-ß1 treatment of the sIgG2a+ A20.3 B cell line, which also cannot be induced to express endogenous GL{alpha} transcripts. The lack of induction of CBF{alpha}3 is not due to an inability of A20.3 cells to respond to TGF-ß1, as the activity of the GL {alpha} promoter is increased in cells treated by TGF-ß1 (Fig. 7GoA) (10).

It is possible that the constitutive expression of CBF{alpha}3 may be due to the autocrine TGF-ß1 that is produced by I.29µ cells. It is unknown whether CH12.LX cells secrete TGF-ß1. Although CBF{alpha}3 is not detectable in splenic B cells in the absence of TGF-ß1, it is inducible by treatment with LPS and TGF-ß1. Splenic B cells have the ability to switch to all Ig classes depending on the cytokine and activation signal received. B cells are believed to become committed to switch to IgA in Peyer’s patches, where intestinal Ags are presented to B and T cells. Furthermore, GL {alpha} transcripts are induced in Peyer’s patches during the initiation of an immune response (64). It is possible that CBF{alpha}3 may be induced in B cells in Peyer’s patches in the presence of activation signals and that this contributes to initiation of transcription of GL {alpha} RNA.

Regulation of a promoter requires binding of multiple factors. Previous studies of the human GL {alpha}1 and mouse GL {alpha} promoters indicate that the TßRE, ATF, and Ets sites are all important for induction of these promoters by TGF-ß1 (10, 12) (M.-J. Shi, unpublished observations). In this study we provide data indicating that CBF along with another unidentified transcription factor bind to the TßRE and that binding of both factors is required for TGF-ß1 induction. Since the m1 mutation eliminates the response of the GL {alpha} promoter to TGF-ß1, but not that to overexpressed CBF, it is possible that the putative protein(s) binding the sites mutated in m1 is activated by TGF-ß1.

CBF{alpha} has been shown to interact with Ets proteins and to synergistically activate promoters binding both proteins (21, 53, 65, 66). Consistent with this, we found that simultaneous mutation of the CBF sites in the TßRE and of the Ets site in the GL {alpha} promoter greatly reduces the activity of the promoter (90%) and the response to overexpressed CBF (50%). Mutation of either the CBF or Ets site alone has much less of an effect on the response to CBF (data not shown). These results suggest that Ets and CBF may cooperate to activate the GL {alpha} promoter.

Members of a recently identified family of proteins, the Smads, serve both as signal transducers and transcriptional activators for signaling by the TGF-ß superfamily (reviewed in Refs. 67 and 68). Upon TGF-ß1 binding to its receptors, Smad2 and Smad3 are rapidly phosphorylated and form a complex with Smad4 (DPC4). This complex is translocated into the nucleus and binds DNA. Although natural binding sites in promoters that respond to Smads are not well characterized, optimal binding sites for Smad3 and Smad4 were recently identified (69). They closely resemble the repeated sequence elements mutated in the m1 mutation. It will be interesting to investigate the relationship between activation of Smads and induction of CBF{alpha}3 proteins by TGF-ß1 and to determine whether Smad proteins are involved in the regulation of GL {alpha} transcription in B cells.


   Acknowledgments
 
We are especially grateful to Dr. J. Stein (University of Massachusetts Medical School, Worcester, MA) for pointing out the similarity between the CBF binding site and the TßRE. We also thank Drs. J. Stein and C. Banerjee for their generosity with Abs and for helpful suggestions. We thank Dr. S. Hiebert (National Cancer Institute, Frederick, MD) for CBF{alpha}1, -2, and -3 and CBFß Abs and CBF{alpha} expression plasmids. We thank Dr. N. Speck (Dartmouth Medical School, Hanover, NH) for helpful suggestions and for CBF{alpha}2 and CBFß expression plasmids, recombinant CBF{alpha}2 (Runt domain), and CBFß Ab. We are also grateful to our colleagues Drs. C. Schrader and F. He and Mr. C. H. Shen for their helpful comments on the manuscript.


   Footnotes
 
1 This work was supported by Grant R01AI23283 from the National Institutes of Health. Back

2 Address correspondence and reprint requests to Dr. Janet Stavnezer, Department of Molecular Genetics and Microbiology, Graduate Program in Immunology and Virology, University of Massachusetts Medical School, Worcester, MA 01655-0122. E-mail address: Back

3 Abbreviations used in this paper: CH, heavy chain constant region; GL, germline; sIg, surface immunoglobulin; TßRE, transforming growth factor-ß1-responsive element; CBF, core-binding factor; AML, acute myeloid leukemia protein; PEBP2, polyomavirus enhancer core-binding protein; EMSA, electrophoretic mobility shift assays; CAT, chloramphenicol acetyltransferase; ß-gal, ß-galactosidase; PGK, phosphoglycerate kinase. Back

Received for publication June 25, 1998. Accepted for publication August 31, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Stavnezer, J.. 1996. Antibody class switching. Adv. Immunol. 61:79.[Medline]
  2. Jung, S., K. Rajewsky, A. Radbruch. 1993. Shutdown of class switch recombination by deletion of a switch region control element. Science 259:984.[Abstract]
  3. Zhang, J., A. Bottaro, S. Li, V. Stewart, F. W. Alt. 1993. A selective defect in IgG2b switching as a result of targeted mutation of the I{gamma}2b promoter and exon. EMBO J. 12:3529.[Medline]
  4. Bottaro, A., R. Lansford, L. Xu, J. Zhang, P. Rothman, F. Alt. 1994. S region transcription (per se) promotes basal IgE class switch recombination but additional factors regulate the efficiency of the process. EMBO J. 13:665.[Medline]
  5. Lorenz, M., S. Jung, A. Radbruch. 1995. Switch transcripts in immunoglobulin class switching. Science 267:1825.[Abstract/Free Full Text]
  6. Lebman, D. A., F. D. Lee, R. L. Coffman. 1990. Mechanism for transforming growth factor ß and IL-2 enhancement of IgA expression in lipopolysaccharide-stimulated B cell cultures. J. Immunol. 144:952.[Abstract]
  7. Lebman, D. A., D. Y. Nomura, R. L. Coffman, F. D. Lee. 1990. Molecular characterization of germ-line immunoglobulin A transcripts produced during transforming growth factor type ß-induced isotype switching. Proc. Natl. Acad. Sci. USA 87:3962.[Abstract/Free Full Text]
  8. Shockett, P., J. Stavnezer. 1991. Effect of cytokines on switching to IgA and {alpha} germline transcripts in the B lymphoma I.29µ: transforming growth factor-ß activates transcription of the unrearranged C{alpha} gene. J. Immunol. 147:4374.[Abstract]
  9. Gaff, C., R. J. Grumont, S. Gerondakis. 1992. Transcriptional regulation of the germline immunoglobulin C{alpha} and C{epsilon} genes: implications for commitment to an isotype switch. Int. Immunol. 4:1145.[Abstract/Free Full Text]
  10. Lin, Y.-C. A., J. Stavnezer. 1992. Regulation of transcription of the germline Ig{alpha} constant region gene by an ATF element and by novel transforming growth factor-ß1-responsive elements. J. Immunol. 149:2914.[Abstract]
  11. Nilsson, L., S. Paschalis. 1993. The human I{alpha}1 and I{alpha}2 germline promoter elements: proximal positive and distal negative elements may regulate the tissue specific expression of C{alpha}1 and C{alpha}2 germline transcripts. Int. Immunol. 5:271.[Abstract/Free Full Text]
  12. Nilsson, L., P. Grant, I. Larsson, S. Pettersson, P. Sideras. 1995. The human I{alpha}1 region contains a TGF-ß1 responsive enhancer and a putative recombination hotspot. Int. Immunol. 7:1191.[Abstract/Free Full Text]
  13. Speck, N. A., S. Terryl. 1995. A new transcription factor family associated with human leukemias. Crit. Rev. Eukaryot. Gene Expr. 5:337.[Medline]
  14. Meyers, S., S. W. Hiebert. 1995. Indirect and direct disruption of transcriptional regulation in cancer: E2F and AML-1. Crit. Rev. Eukaryot. Gene Expr. 5:365.[Medline]
  15. Meyers, S., J. R. Downing, S. W. Hiebert. 1993. Identification of AML-1 and the (8;21) translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: the runt homology domain is required for DNA binding and protein-protein interactions. Mol. Cell. Biol. 13:6336.[Abstract/Free Full Text]
  16. Ogawa, E., M. Maruyama, H. Kagoshima, M. Inuzuka, J. Lu, M. Satake, K. Shigesada, Y. Ito. 1993. PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene. Proc. Natl. Acad. Sci. USA 90:6859.[Abstract/Free Full Text]
  17. Ogawa, E., M. Inuzuka, M. Maruyama, M. Satake, M. Naito-Fujimoto, Y. Ito, K. Shigesada. 1993. Molecular cloning and characterization of PEBP2ß, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2{alpha}. Virology 194:314.[Medline]
  18. Wang, S., Q. Wang, B. E. Rute, I. N. Melnikova, S. R. Keller, N. A. Speck. 1993. Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor. Mol. Cell. Biol. 13:3324.[Abstract/Free Full Text]
  19. Bae, S. C., E. Ogawa, M. Maruyama, H. Oka, M. Satake, K. Shigesada, N. A. Jenkins, D. J. Gilbert, N. G. Copeland, Y. Ito. 1994. PEBP2{alpha}B/mouse AML1 consists of multiple isoforms that possess differential transactivation potentials. Mol. Cell. Biol. 14:3242.[Abstract/Free Full Text]
  20. Bae, S. C., E. Takahashi, Y. W. Zhang, E. Ogawa, K. Shigesada, Y. Namba, M. Satake, Y. Ito. 1995. Cloning, mapping and expression of PEBP2{alpha}C, a third gene encoding the mammalian runt domain. Gene 159:245.[Medline]
  21. Erman, B., M. Cortes, B. Nikolajczyk, N. Speck, R. Sen. 1998. ETS-core binding factor: a common composite motif in antigen receptor gene enhancers. Mol. Cell. Biol. 18:1322.[Abstract/Free Full Text]
  22. Merriman, H. L., A. J. v. Wijnen, S. Hiebert, J. P. Bidwell, E. Fey, J. Lian, J. Stein, G. S. Stein. 1995. The tissue-specific nuclear matrix protein, NMP-2, is a member of the AML/CBF/PEBP2/runt domain transcription factor family: interactions with the osteocalcin gene promoter. Biochemistry 34:13125.[Medline]
  23. Banerjee, C., S. W. Hiebert, J. L. Stein, J. B. Lian, G. S. Stein. 1996. An AML-1 consensus sequence binds an osteoblast-specific complex and transcriptionally activates the osteocalcin gene. Proc. Natl. Acad. Sci. USA 93:4968.[Abstract/Free Full Text]
  24. Zaiman, A. L., A. F. Lewis, B. E. Crute, N. A. Speck, J. Lenz. 1995. Transcriptional activity of core-binding factor {alpha} (AML1) and ß subunits on murine leukemia virus enhancer cores. J. Virol. 68:2898.[Abstract/Free Full Text]
  25. Meyers, S., N. Lenny, S. W. Hiebert. 1995. The t(8;21) fusion protein interferes with AML-1B-dependent transcriptional activation. Mol. Cell. Biol. 15:1974.[Abstract]
  26. Meyers, S., N. Lenny, W. Sun, S. W. Hiebert. 1996. AML-2 is a potential target for transcriptional regulation by the t(8;21) and t(12;21) fusion proteins in acute leukemia. Oncogene 13:303.[Medline]
  27. Banerjee, C., L. R. McCabe, J.-Y. Choi, S. W. Hiebert, J. L. Stein, G. S. Stein, J. B. Lian. 1997. Runt homology domain protein in osteoblast differentiation: AML3/CBFA1 is a major component of a bone-specific complex. J. Cell. Biochem. 66:1.[Medline]
  28. Satake, M., S. Nomura, Y. Yamaguchi-Iwai, Y. Takahama, Y. Hashimoto, M. Niki, Y. Kitamura, Y. Ito. 1995. Expression of the runt domain-encoding PEBP2{alpha} genes in T cells during thymic development. Mol. Cell. Biol. 15:1662.[Abstract]
  29. Ducy, P., R. Zhang, V. Geoffroy, A. Ridall, G. Karsenty. 1997. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 89:747.[Medline]
  30. Bae, S. C., Y. Yamaguchi-Iwai, E. Ogawa, M. Maruyama, M. Inuzuka, H. Kagoshima, K. Shigesada, M. Satake, Y. Ito. 1993. Isolation of PEBP2{alpha}B cDNA representing the mouse homolog of human acute myeloid leukemia gene, AML1. Oncogene 8:809.[Medline]
  31. Levanon, D., V. Negreanu, Y. Bernstein, I. Bar-Am, L. Avivi, Y. Groner. 1994. AML1, AML2, and AML3, the human members of the runt domain gene-family: cDNA structure, expression, and chromosomal localization. Genomics 23:425.[Medline]
  32. Komori, T., H. Yagi, S. Nomura, A. Yamaguchi, K. Sasaki, K. Deguchi, Y. Shimizu, R. T. Bronson, Y. H. Gao, M. Inada, et al 1997. Targeted disruption of Cbf{alpha}1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89:755.[Medline]
  33. Okuda, T., J. van Deursen, S. W. Hiebert, G. Grosveld, J. R. Downing. 1996. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84:321.[Medline]
  34. Wang, Q., T. Stacy, M. Binder, M. Marin-Padilla, A. H. Sharpe, N. A. Speck. 1996. Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc. Natl. Acad. Sci. USA 93:3444.[Abstract/Free Full Text]
  35. Sasaki, K., H. Yagi, R. T. Bronson, K. Tominaga, T. Matsunashi, K. Deguchi, Y. Tani, T. Kishimoto, T. Komori. 1996. Absence of fetal liver hematopoiesis in mice deficient in transcriptional coactivator core binding factor ß. Proc. Natl. Acad. Sci. USA 93:12359.[Abstract/Free Full Text]
  36. Niki, M., H. Okada, H. Takano, J. Kuno, K. Tani, H. Hibino, S. Asano, Y. Ito, M. Satake, T. Noda. 1997. Hematopoiesis in the fetal liver is impaired by targeted mutagenesis of a gene encoding a non-DNA binding subunit of the transcription factor, polyomavirus enhancer binding protein 2/core binding factor. Proc. Natl. Acad. Sci. USA 94:5697.[Abstract/Free Full Text]
  37. Wang, Q., T. Stacy, J. D. Miller, A. F. Lewis, T. L. Gu, X. Huang, J. H. Bushweller, J. C. Bories, F. W. Alt, G. Ryan, et al 1996. The CBFß subunit is essential for CBF{alpha}2 (AML1) function in vivo. Cell 87:697.[Medline]
  38. Miyoshi, H., K. Shimizu, T. Kozu, N. Maseki, Y. Kaneko, M. Ohki. 1991. t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1. Proc. Natl. Acad. Sci. USA 88:10431.[Abstract/Free Full Text]
  39. Stavnezer, J., S. Sirlin, J. Abbott. 1985. Induction of immunoglobulin isotype switching in cultured I. 29 µ B lymphoma cells: characterization of the accompanying rearrangements of heavy chain genes. J. Exp. Med. 161:577.[Abstract/Free Full Text]
  40. Alberini, C., R. Biassoni, S. DeAmbrosis, D. Vismara, R. Sitia. 1987. Differentiation in the murine B cell lymphoma I.29: individual µ+ clones may be induced by lipopolysaccharide to both IgM secretion and isotype switching. Eur. J. Immunol. 17:555.[Medline]
  41. Kunimoto, D. Y., G. R. Harriman, W. Strober. 1988. Regulation of IgA differentiation in CH12LX cells by lymphokines: IL-4 induces membrane IgM-positive CH12LX cells to express membrane IgA and IL-5 induces membrane IgA-positive CH12LX cells to secrete IgA. J. Immunol. 141:713.[Abstract]
  42. Wakatsuki, Y., W. Strober. 1993. Effect of downregulation of germline transcripts on immunoglobulin A isotype differentiation. J. Exp. Med. 178:129.[Abstract/Free Full Text]
  43. Kim, K., C. Kanellopoulous-Langevin, R. Merwin, D. Sachs, R. Asofsky. 1979. Establishment and characterization of BALB/c lymphoma lines with B cell properties. J. Immunol. 122:549.[Abstract/Free Full Text]
  44. Xu, M., J. Stavnezer. 1992. Regulation of transcription of immunoglobulin germ-line {gamma}1 RNA: analysis of the promoter/enhancer. EMBO J. 11:145.[Medline]
  45. Ho, N. S., H. D. Hunt, R. M. Horton, J. K. Pullen, L. R. Pease. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51.[Medline]
  46. Nordeen, S. K.. 1988. Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques