The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, F.
Right arrow Articles by Aune, T. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, F.
Right arrow Articles by Aune, T. M.
The Journal of Immunology, 1998, 161: 6105-6112.
Copyright © 1998 by The American Association of Immunologists

Regulation of the Activity of IFN-{gamma} Promoter Elements During Th Cell Differentiation1

Feng Zhang*, Ding Zhe Wang{dagger}, Mark Boothby*,{dagger}, Laurie Penix{ddagger}, Richard A. Flavell and Thomas M. Aune2,*

Division of Rheumatology, Departments of * Medicine and {dagger} Microbiology and Immunology, Vanderbilt University School of Medicine, Nashville, TN 37232; and {ddagger} Department of Pediatrics and § Section of Immunobiology, Yale University School of Medicine, and Howard Hughes Medical Institute, New Haven, CT 06510


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Before they can deliver their effector functions, CD4+ Th cells must differentiate into Th1 or Th2 subsets. We have prepared reporter transgenic mice that express the luciferase gene under the control of proximal (prox.IFN-{gamma}) and distal (dist.IFN-{gamma}) regulatory elements from the IFN-{gamma} promoter to permit investigation of mechanisms that regulate IFN-{gamma} gene transcription during Th cell differentiation. Precursor Th cells (pTh) contain high levels of cAMP response element binding protein-activation transcription factor-1 (CREB-ATF1) proteins that bind these promoter elements from the IFN-{gamma} gene, and these cells fail to express promoter activity. Restimulated effector Th (eTh) cells have reduced levels of CREB-ATF1 proteins, their nuclear extracts exhibit reduced CREB-ATF1 binding and greater Jun and Jun-ATF2 binding to dist.IFN-{gamma}, and eTh cells express promoter activity. CREB directly competes with effector T cell nuclear proteins for dist.IFN-{gamma} binding, and overexpression of CREB inhibits both prox.IFN-{gamma}- and dist.IFN-{gamma}-directed transcription in Jurkat T cells. IL-12-stimulated Th1 differentiation increases dist.IFN-{gamma} activity in restimulated eTh1 cells; eTh1 nuclear extracts form increased levels of Jun-ATF2-dist.IFN-{gamma} complexes. Taken together, these data suggest that both de-repression and trans-activation contribute to the induction of IFN-{gamma} gene transcription during Th1 differentiation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Effector Th1 (eTh1)3 cells, which are producers of IFN-{gamma}, and effector Th2 (eTh2) cells, which are producers of IL-4, differentiate from precursor T cells (pTh), which are inefficient producers of these cytokines (1). Effector Th1 cells provide immunity to intracellular pathogens, and eTh2 cells provide immunity to extracellular pathogens (2). The development of these T cell subsets is controlled by the cytokine environment (IL-12 and IFN-{gamma} promote Th1 development; IL-4 promotes Th2 development) (3, 4, 5, 6, 7, 8, 9), the type and the concentration of Ag (10, 11), costimulatory pathways (12, 13), and non-MHC-linked background genes (14, 15, 16).

The transcriptional mechanisms by which these different signaling pathways converge to control T cell differentiation in the periphery is a question of intense interest. A number of transcription factors have been identified that participate in Th2 development and expression of the IL-4 gene. These include NF-IL-6 (17), NF-AT, AP-1 (18, 19, 20, 21, 22), STAT6 (23, 24), c-Maf (25), and GATA3 (26). Transcription factors that are required for Th1 development and IFN-{gamma} gene expression include AP-1 (27, 28), Stat4 (29, 30), and interferon regulatory factor 1 (31, 32). While these results show that distinct nuclear factors are required for selective gene expression in Th1 or Th2 cells, what is not clear is whether they act directly on the IFN-{gamma} gene or act on other genes required for selective Th1 or Th2 development. In addition, some of these transcription factors are found in both eTh1 and eTh2 subsets, while others appear to be unique to one or the other subset. Silencing mechanisms may also actively control gene expression in these different T cell subsets (33, 34).

Exactly how these and other nuclear factors interact during Th cell development to generate Th1 and Th2 subsets that express selective patterns of cytokine genes is poorly understood. To investigate this basic question, several laboratories have prepared lines of transgenic mice that express a reporter gene under the control of critical promoter regions of cytokine genes. These include transgenic lines that express the luciferase gene under the control of 1) the P1 element from the IL-4 promoter that contains both an NF-AT and an AP-1 binding site (18), 2) the P1 element with only the NF-AT binding site (19), 3) a composite NF-AT binding element from the IL-2 promoter (22), 4) an AP-1 binding element from the collagenase promoter (35), and 5) two elements from the IFN-{gamma} promoter (36, 37) that bind AP-1/CREB/ATF transcription factors (27, 28). These studies show that both P1NF-AT and P1NF-AT/AP1 from the IL-4 promoter are selectively active in eTh cells but not in pTh cells. The P1 element with both NF-AT and AP-1 binding sites shows greater selectivity, in that activity is expressed at much greater levels in eTh2 populations than in eTh1 populations. By contrast, the activity of the P1 element with only the NF-AT binding site is approximately equivalent in both eTh1 and eTh2 populations. Consistent with a possible contribution of AP-1 to P1 activity in eTh2 cells, the AP-1 binding element from the collagenase promoter does not bind NF-AT, yet activity of the AP-1 element is much greater in eTh2 populations than in eTh1 populations (20).

A similar strategy has been employed to address mechanisms of selective IFN-{gamma} gene regulation in eTh1 cells. Two promoter elements from the IFN-{gamma} gene, a proximal (-70 to -44 bp; prox.IFN-{gamma}) and a distal (-98 to -78; dist.IFN-{gamma}) element, are also inactive in pTh cells following stimulation with polyclonal mitogens, yet are activated following identical stimulation of resting memory T cells (36). Primary T cells can be stimulated in vitro to differentiate into eTh cells that express transcriptional activity under the control of prox.IFN-{gamma} and dist.IFN-{gamma} and produce IFN-{gamma}. This large shift in the activity of IFN-{gamma} promoter elements suggests that rather large changes must also occur in the transcriptional environment as T cells differentiate to acquire effector function. Therefore, we wanted to determine 1) whether lineage specificity of these transcriptional elements is also observed in a more physiologic TCR transgenic system in which pTh cells are more clearly defined; b) whether T cell differentiation causes changes in the pattern of nuclear factors that bind to these promoter elements; c) whether selective eTh1 differentiation stimulated by IL-12 would target either transcriptional element; and 4) if we can link changes in transcription factor binding to changes in transcriptional activity. We found that the proximal and distal elements of the IFN-{gamma} promoter are not active in pTh cells and are active in eTh cells following Ag stimulation in a single TCR transgenic system. Similarly, pTh cells produce very low levels of IFN-{gamma} following Ag stimulation, while, as expected, eTh cells produce large quantities of IFN-{gamma}. The results also show that there is a fundamental shift in the transcriptional environment during Th cell differentiation. CREB/ATF1 proteins are present at high levels in pTh cells, bind to prox.IFN-{gamma} and dist.IFN-{gamma}, and can inhibit transcription mediated by prox.IFN-{gamma} and dist.IFN-{gamma}. Following T cell differentiation, CREB/ATF1 levels fall, and stimulatory transcription factors bind to prox.IFN-{gamma} and dist.IFN-{gamma} and activate transcription. In addition, IL-12-stimulated Th1 differentiation results in increased binding of Jun-ATF2 heterodimers to dist.IFN-{gamma} and increased transcriptional activity at the dist.IFN-{gamma} element, but not the prox.IFN-{gamma} element.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Transgenic mice

The prox.IFN-{gamma}- and dist.IFN-{gamma}-luciferase transgenic mice were described in detail previously (36). Briefly, plasmids containing a head-to-tail (5' to 3') dimer of the IFN-{gamma} proximal element (-70 to -44 bp from the transcription start site) and tetramer of the IFN-{gamma} distal element (-98 to -78 bp) with the IFN-{gamma} minimal promoter were subcloned into the luc reporter plasmid (38). The 2.8-kb HpaI fragment isolated from these plasmids (prox.IFN-{gamma}-Luc and dist.IFN-{gamma}-Luc, respectively) was injected into fertilized C57BL/6 x CBA/N F2 eggs, and transgenic mice were generated as previously described (39).

The cytochrome c (Cyt c) TCR transgenic mice were provided by J. Kaye and S. M. Hedrick (40). Prox.IFN-{gamma}-Luc and dist.IFN-{gamma}-Luc mice were backcrossed to B10.BR for four generations before intercrossing with the Cyt c TCR mice, which are also B10.BR. Double transgenic littermates were identified by Southern blot analysis of tail DNA for the luciferase gene and by flow cytometry of peripheral blood using FITC-coupled {alpha}-CD4 and phycoerythrin-coupled {alpha}-Vß3. CD4 T cells from (Cyt c TCR x prox.IFN-{gamma}-luc)F1 or (Cyt c TCR x dist.IFN-{gamma}-luc)F1 double transgenic mice were employed to analyze changes in transcriptional activity following antigenic stimulation.

Cell preparation and culture

Spleen cells, lymph node cells, or pooled spleen and lymph node cells were harvested from wild-type or transgenic animals. RBCs were removed by hypotonic lysis. CD4+ T cells were purified by negative selection. Ia-expressing cells and NK cells were removed by incubation with an {alpha}-IE,IA mAb (m5/115, American Type Culture Collection, Manassas, VA) and an {alpha}-NK cell mAb (NK 1.1, American Type Culture Collection), respectively. An {alpha}-CD8 mAb (TIB 105, American Type Culture Collection) was used to deplete CD8 T cells. Cells were incubated for 30 min at 4°C, washed, and further incubated with goat {alpha}-mouse and {alpha}-rat IgG bound to magnetic beads (Collaborative Research, Waltham, MA) for 30 min at 4°C with rocking. Cells bound to beads were removed with a magnet. The average purity of CD4 cells was approximately 90–95% as determined by flow cytometry. RBC-depleted splenocytes from B10.BR mice were depleted of CD4+ and CD8+ T cells by negative selection with {alpha}-CD4 and {alpha}-CD8 mAb and were irradiated at 2000 rad from a cesium 137 source and used as APCs.

Reagents used to stimulate CD4 T cells were: Cyt c peptide, 0.05–50 µg/ml; {alpha}-CD3 (145-2C11 clone, American Type Culture Collection), 1 µg/ml; IL-2, 5 ng/ml; IL-12, 5 ng/ml; and IL-4, 30 ng/ml. Recombinant IL-2 and IL-4 were purchased from PharMingen (San Diego, CA); recombinant IL-12 was a gift from Genetics Institute (Cambridge, MA). Immobilized {alpha}-CD3 was prepared by adding 0.5–1 ml of 10 µg/ml of 2C11 mAb in 0.1 M sodium bicarbonate, pH 9.6, to a 24- or 48-well tissue culture plate for 3–6 h at 37°C or overnight at 0–4°C. Culture plates were washed thoroughly before use.

The IFN-{gamma} and IL-4 ELISAs were performed with Abs from PharMingen according to the manufacturer’s procedures. The sensitivity of the IFN-{gamma} ELISA was 0.02 ng/ml. The sp. act. of IFN-{gamma} was 107 U/mg protein (PharMingen). The sensitivity of the IL-4 ELISA was also 0.02 ng/ml.

Cells from various sources were cultured in complete RPMI 1640 medium with 10% FCS, 100 U/ml of penicillin, 100 U/ml of streptomycin, 2 mM L-glutamine, and 5 x 10-5 M 2-ME in 24- or 48-well tissue culture plates in volumes of 1 or 0.5 ml, respectively, at a density of 1 x 106/ml in the presence or the absence of various stimuli, as described in the text, at 37°C in 5% CO2 in air. Syngeneic irradiated APC were used at a density of 1 x 106/ml of culture fluid. The pTh cells were obtained 48–72 h after initial activation of purified CD4 T cells with Ag and APC. The eTh cells were obtained by stimulating purified CD4 T cells with Ag and APC for 5 days and restimulating these cultures with Ag and APC. The eTh1 and eTh2 cells were prepared as described for eTh cells, except that cultures received either 5 ng/ml of IL-12 or 30 ng/ml of IL-4 during the primary cultures, respectively.

Analysis of luciferase activity

After the periods of time indicated in the text, cultures were harvested, washed twice in PBS, and suspended in 50 µl of lysis buffer (luciferase assay, Promega, Madison, WI) for 30 min at 25°C. The supernatant fluid was harvested, and 20-µl aliquots were assayed for luciferase activity with 100 µl of luciferase reagent (Promega) in a luminometer (Turner TD20/20, Promega) for 15 s. Cultures were performed in duplicate. Duplicate analyses of two aliquots from each cell lysate were performed, and the results were averaged. Results are expressed as the average of these readings per 106 cells with the SE. The background measurement with luciferase reagent alone was subtracted from each reading. Results are expressed in relative light units. The absolute values obtained from individual readings ranged from 0.05 (unstimulated cell lysates = instrument background) to 20 light units (lysates from maximally stimulated cells). The Turner TD 20/20 luminometer differs from many luminometers used in biomedical research because its scale is significantly different. For comparison, 1 fg of luciferase yields a reading of approximately 1, and 10 fg yields a reading of approximately 10 in the Turner TD 20/20 luminometer.

Electrophoretic mobility shift assays (EMSAs)

Small scale nuclear extracts were prepared from 5 x 106 cells (41, 42) as previously described. Binding reactions were conducted essentially as previously described using 3–5 µg of nuclear proteins and 1.5 x 104 cpm of 32P end-labeled double-stranded oligonucleotides. Sequences of the oligonucleotides (sense strand) used for EMSA are as follows: prox.IFN-{gamma} (-70 to -44 bp), 5'-AAAACTTGTGAAAATACGTAATCCT; dist.IFN-{gamma} (-98 to -78 bp), TGCCTATCTGTCACCATCTCA; TRE, CGCTTGATGACTCAGCCGGAA; and CRE, GGCAACTGTGACGTCATCACAAGA. Consensus binding sites for AP-1 and CREB are underlined respectively. The Abs used for these studies include ATF1 (sc-4006, Santa Cruz Biotechnology), which recognizes CREB, ATF1, and ATF2; ATF2 (sc-6233); and pan-Jun (Upstate Biotechnology, Lake Placid, NY). Truncated CREB protein (amino acids 254–327) was also obtained from Santa Cruz Biotechnology. Abs (0.1–1 µg) were preincubated with nuclear extracts for 30–45 min at room temperature before addition of probes. Complexes were resolved on 5% native polyacrylamide gels in a tris-borate-EDTA (TBE) buffer.

Western blotting analysis

Nuclear proteins were fractionated by SDS-PAGE, transferred to nitrocellulose membranes, and incubated with specific primary Abs as outlined in the text. Membranes were washed and incubated with secondary horseradish peroxidase-conjugated anti-rabbit or anti-mouse Abs and developed with an enhanced chemiluminescent system (Amersham, Arlington Heights, IL) according to the vendor’s instructions.

Transient transfection

Jurkat cells, in log-phase growth, were harvested, washed once, suspended at 2.5 x 107 cells/ml, incubated with 10 µg of plasmid DNA for 10 min at 0–4°C, and transfected by electroporation at 270 V and 960 µF. Cells were suspended in RPMI 1640 medium with 10% FCS and cultured overnight before activation with plate-bound anti-CD3. CREB and c-Jun cDNAs were obtained from Drs. Darryl Granner and Ron Wisdom, respectively, and were ligated into the pCMV expression vector (Promega).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Changes in the activity of IFN-{gamma} regulatory elements during Th cell differentiation correlate with changes in the nuclear factors that bind these elements

Stimulation of pTh cells with Ag or polyclonal activators under neutral conditions resulted in IL-2 production, but only low levels of IFN-{gamma} production. This failure to produce IFN-{gamma} was reflected by a failure to express transcriptional activity under the control of critical regulatory elements from the IFN-{gamma} promoter. By contrast, T cells that were allowed to differentiate in vitro under neutral conditions (eTh) expressed high levels of prox.IFN-{gamma} and dist.IFN-{gamma} promoter activity following rechallenge with Ag (Fig. 1Go). Multiple founders were generated, and all showed similar qualitative properties, including the relative difference in prox.IFN-{gamma} and dist.IFN-{gamma} activities (36), indicating that the observed results are most likely not due to integration effects.



View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 1. Prox.IFN-{gamma}- and dist.IFN-{gamma}-directed transcriptional activities expressed by pTh and eTh cells. The pTh and eTh cells (derived from a 5-day culture of pTh cells, as outlined in Materials and Methods) were stimulated with peptide Ag (10 µg/ml) and APC. After 48 h (peak of response), cultures were harvested and analyzed for luciferase activity (prox.IFN-{gamma} and dist.IFN-{gamma} activities) and for cytokine levels (IFN-{gamma}, IL-4, and IL-2). Results are expressed as relative light units per 106 T cells or as nanograms per milliliter of IL-2, IFN-{gamma}, or IL-4. Results are derived from one prox.IFN-{gamma}-luc line and from one dist.IFN-{gamma}-luc line. Three founders expressing the prox.IFN-{gamma}-luc transgene and five founders expressing the dist.IFN-{gamma}-luc transgene were prepared and analyzed (36). Two separate prox.IFN-{gamma} lines and two separate dist.IFN-{gamma} lines were also intercrossed with the TCR transgenic mice. Similar qualitative results were obtained from lines derived from both groups of founders. T cells from both prox.IFN-{gamma}-luc lines expressed about 10-fold lower activity than the dist.IFN-{gamma}-luc lines in this assay system. The amount of luciferase activity observed in pTh cells is at the limit of detection by the luminometer. The limit of detection of cytokines by ELISA is 0.01–0.02 ng/ml.

 
Since these T cells are derived from B10.BR mice, they displayed preferential Th1 development and produced high levels of IFN-{gamma} and low levels of IL-4 under these experimental conditions. One possible explanation for why eTh, but not pTh, cells express prox.IFN-{gamma} and dist.IFN-{gamma} promoter activities after Ag stimulation was that different nuclear proteins bind to these two promoter elements in pTh and eTh subsets. To test this possibility, EMSA was performed with nuclear extracts derived from CD4+ T cells following either primary (pTh) or secondary (eTh) stimulation with Ag and APC (Fig. 2Go). For the purposes of the following experiments, primary T cells were allowed to differentiate under neutral conditions as outlined above and in Fig. 1Go. Nuclear extracts from primary T cells following their first cycle of Ag activation formed two major complexes with prox.IFN-{gamma}, whereas nuclear extracts from effector T cells (two cycles of Ag activation) formed three major complexes (Fig. 2Go). The lower complex, which represents a major complex formed with nuclear extracts from Ag-activated eTh cells, was present at very low levels in extracts from pTh cells following a single cycle of Ag stimulation. The upper two complexes formed with extracts from both T cell subsets were supershifted by an anti-CREB/ATF Ab.



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 2. Nuclear proteins from Ag-stimulated pTh and eTh cells form distinct complexes with prox.IFN-{gamma} and dist.IFN-{gamma}. Nuclear extracts were prepared from pTh cells and eTh cells after 24 h of stimulation with Cyt c peptide (10 µg/ml) and APC. Anti-ATF/CREB Ab (0.5 µg) was added to the binding reactions containing 10 µg of nuclear extract protein as indicated 30 min before addition of either end-labeled prox.IFN-{gamma} or dist.IFN-{gamma} as probe. The arrow indicates the ATF/CREB-DNA complexes supershifted by the anti-ATF/CREB Ab. The ATF/CREB Ab is cross-reactive with CREB, CREM, and ATF1 and is partially cross-reactive with ATF2 (50) (see Fig. 2Go). The asterisk indicates the novel eTh-protein-prox.IFN-{gamma} complex, which is not formed with extracts from pTh cells. Two amounts of anti-ATF/CREB Ab were used in the experiment illustrated in the eTh-prox.IFN-{gamma} panel (middle, 0.5 µg; right, 2 µg). The pTh and eTh extracts were derived from the same experiment, but the EMSAs were performed on separate days. This experiment has been performed a minimum of three times with identical results.

 
Nuclear extracts prepared from either pTh cells following a single cycle of Ag challenge or eTh cells after the second cycle of Ag challenge formed unique complexes with dist.IFN-{gamma}. The dist.IFN-{gamma}-pTh complexes were effectively supershifted by an anti-CREB/ATF Ab (Fig. 2Go), but not by an anti-Jun Ab (see below; Fig. 3Go). These complexes had almost identical mobilities to those formed with the prox.IFN-{gamma} element. Nuclear extracts from Ag-activated eTh cells formed complexes with dist.IFN-{gamma} with markedly different mobilities that were only partially supershifted by the anti-CREB-ATF Ab. These studies show that CREB/ATF proteins form the predominant complexes with both prox.IFN-{gamma} and dist.IFN-{gamma} following Ag stimulation of primary T cells but that different proteins also form complexes with these cis-acting elements following Ag stimulation of effector T cells.



View larger version (51K):
[in this window]
[in a new window]
  		FIGURE 3. Jun proteins form the predominant complexes with dist.IFN-{gamma} in Ag-stimulated eTh cells. Left panel, Nuclear extracts were prepared from pTh cells 24 h after Ag challenge and were preincubated with anti-Fos, anti-Jun, or anti-ATF/CREB Ab before addition of end-labeled dist.IFN-{gamma} as probe. Middle panel, Nuclear extracts were prepared 24 h after Ag activation of eTh cells and were preincubated with 1) TRE oligonucleotide (CGCTTGATGACTCAGCCGGAA (consensus AP-1 site is underlined); 20 ng (A) or 100 ng (B)), 2) CRE oligonucleotide (GGCAACTGTGACGTCATCACAAGA (consensus CREB site is underlined); 20 ng (A) or 100 ng (B)), 3) anti-CREB/ATF Ab (0.5 µg (A) or 2 µg (B)), or 4) anti-ATF2 Ab (0.5 µg (A) or 2 µg (B)) as described in Materials and Methods. Right panel, The eTh nuclear extracts were preincubated in the presence or the absence of an anti-pan-Jun antisera (0.5 µl; Upstate Biotechnology) for 30 min before addition of end-labeled dist.IFN-{gamma}. Note the major supershifted complex induced by the anti-Jun Ab. This experiment was performed a minimum of three times with different extracts from different cultures, and similar results were obtained each time.

 
Previous studies have identified imperfect CRE/TRE sites within the prox.IFN-{gamma} (T-ACGTAA) and dist.IFN-{gamma} (TGTCACCA) elements (bold-face type shows sequence matches between these elements and consensus sequences for AP-1 and CREB/ATF; 17 . These studies are consistent with the above demonstration that CREB-ATF factors from extracts from pTh cells form complexes with prox.IFN-{gamma} and dist.IFN-{gamma} However, certain complexes formed with nuclear extracts from eTh cells were inefficiently eliminated or supershifted by anti-ATF/CREB Ab (Fig. 2Go). Therefore, we wanted to investigate whether the complexes not supershifted by the anti-ATF/CREB Ab in eTh nuclear extracts may represent AP-1 complexes. Initial studies that employed TRE and CRE oligonucleotides as competitors of formation of dist.IFN-{gamma}-protein complexes indicated that the new complexes formed between dist.IFN-{gamma} and nuclear extracts from eTh cells were effectively competed by TRE oligonucleotides but not CRE oligonucleotides (Fig. 3Go, middle panel). In addition, the anti-CREB-ATF Ab was relatively ineffective at preventing formation of these new dist.IFN-{gamma}-protein complexes (Fig. 3Go, middle panel). By contrast, the anti-Jun Ab, which failed to compete or supershift pTh-dist.IFN-{gamma} complexes, effectively competed and supershifted the majority of eTh-dist.IFN-{gamma} complexes. In addition, a specific anti-ATF2 Ab, which failed to block formation of prox.IFN-{gamma}- or dist.IFN-{gamma}-complexes in pTh cells (not shown), blocked formation of the faint upper dist.IFN-{gamma}-protein complex in eTh cell extracts. Anti-Fos Abs neither blocked the formation of dist.IFN-{gamma}-protein complexes nor resulted in the formation of supershifted complexes (Fig. 3Go, left panel, and not shown). Taken together, these results indicate that ATF1 and CREB form the major protein-DNA complexes with prox.IFN-{gamma} and dist.IFN-{gamma} in pTh cell extracts and that Jun proteins form the major protein-DNA complexes with dist.IFN-{gamma} in eTh cells. In addition, the faint upper dist.IFN-{gamma}-protein complex appears to contain Jun-related proteins and ATF2 proteins, presumably as Jun-ATF2 dimers. At this point, we have not identified the protein(s) that makes up the new prox.IFN-{gamma} complexes in effector T cells with the faster mobility (asterisk in Fig. 2Go). Taken together, the above results indicate that marked changes occur following T cell differentiation that result in dramatic changes in the nuclear proteins that bind the prox.IFN-{gamma} and dist.IFN-{gamma} transcriptional elements. These changes in DNA binding may contribute to the marked changes in the activity of these regulatory elements in eTh cells following Ag stimulation.

T cell differentiation results in a marked decrease in the level of CREB-ATF1 proteins

The above data indicated that differentiation of pTh cells into eTh cells is accompanied by a transition from dominant CREB/ATF1 binding to the dist.IFN-{gamma} promoter element to dominant ATF2/Jun binding. This evolution could be due to changes in the levels of these transcription factors, changes in post-translational modifications, or both. To examine the first possibility, the levels of CREB-ATF1 proteins, ATF2, c-Jun, and Fos were measured by Western blotting of nuclear extracts from pTh and eTh cell populations. Extracts from unstimulated pTh cells contained undetectable levels of c-Jun, c-Fos, ATF2, CREB, and ATF1. Extracts from resting eTh cells (before secondary Ag stimulation) contained very low levels of these transcription factors (not shown). Extracts from pTh and eTh cells contained comparable levels of c-Jun, c-Fos, and ATF2 (Fig. 4Go). This indicates that each of these transcription factors is inducible in pTh and eTh cells by Ag stimulation. By contrast, levels of CREB-ATF1 proteins were not inducible in eTh cells following secondary Ag stimulation (Fig. 4Go).



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 4. Ag-stimulated eTh cells contain markedly less CREB/ATF1 transcription factors than Ag-stimulated pTh cells. Nuclear proteins from Ag-stimulated pTh and eTh cells were resolved by SDS-PAGE, transferred to nitrocellulose, and probed with anti-c-Jun, anti-c-Fos, anti-ATF2, or anti-CREB/ATF1 Ab. Filters were incubated with secondary Abs conjugated with horseradish peroxidase and developed with an enhanced chemiluminescence system. This experiment was performed a minimum of three times with different extracts from different cultures, and similar results were obtained each time.

 
CREB competes with eTh nuclear proteins for binding to dist.IFN-{gamma} and blocks the activity of prox IFN-{gamma} and dist.IFN-{gamma} transcriptional elements

The shift in the transcription factors that bind prox.IFN-{gamma} and dist.IFN-{gamma} and the shift in activity that accompanies T cell differentiation may result from a combination of loss of repressive mechanisms and gain of stimulatory mechanisms. Therefore, we wanted to determine whether CREB could directly compete with eTh nuclear extract proteins and inhibit formation of complexes between Jun/ATF2 and dist.IFN-{gamma} DNA. Addition of increasing amounts of unphosphorylated truncated CREB (amino acids 254–327) to eTh nuclear extracts inhibited formation of Jun and Jun-ATF2 complexes with the dist.IFN-{gamma} probe (Fig. 5Go), indicating that unphosphorylated truncated CREB can directly compete with Jun/ATF2 proteins from effector T cell extracts for binding to dist.IFN-{gamma}. Whether full-length phosphorylated or unphosphorylated CREB or ATF1 would compete more efficiently with Jun/ATF2 proteins for dist.IFN-{gamma} binding is not known. However, these data support the idea that CREB/ATF1 proteins in pTh cell nuclear extracts may compete with Jun/ATF2 proteins for binding to dist.IFN-{gamma}.



View larger version (58K):
[in this window]
[in a new window]
  		FIGURE 5. CREB competes with eTh nuclear extracts for binding to dist.IFN-{gamma}. Increasing amounts of truncated CREB (0, 1, 10, and 100 ng), as indicated, were added to a constant amount of eTh cell nuclear extracts (5 µg) before addition of the dist.IFN-{gamma} probe. The resulting DNA-protein complexes were resolved by native PAGE. The positions of the eTh nuclear protein-dist.IFN-{gamma} complexes and the truncated CREB-dist IFN-{gamma} complexes are indicated. Although free probe is not shown in this figure, addition of high levels of truncated CREB did not significantly deplete the level of free probe.

 
Direct competition between CREB and Jun/ATF2 for binding to dist.IFN-{gamma} raises the possibility that CREB may also block prox.IFN-{gamma}- and dist.IFN-{gamma}-directed transcriptional activities. To test this hypothesis, a CREB expression plasmid was transfected into Jurkat T cells along with prox.IFN-{gamma}-luciferase, dist.IFN-{gamma} -luciferase, or a -660 to +64 IFN-{gamma} promoter-luciferase reporter plasmid. After 24 h, Jurkat T cells were stimulated with plate-bound anti-human CD3 mAb. Cells were harvested 24 h later and analyzed for prox.IFN-{gamma}, dist.IFN-{gamma}, or IFN-{gamma} promoter activity. Overexpression of CREB in Jurkat cells caused marked inhibition of prox.IFN-{gamma}-, dist.IFN-{gamma}-, and IFN-{gamma} promoter-directed transcriptional activities (Fig. 6Go). In addition, overexpression of CREB inhibited the production of IFN-{gamma}. By contrast, overexpression of c-Jun did not inhibit promoter activity or IFN-{gamma} production (certain sublines of Jurkat cells produce low levels of IFN-{gamma} upon stimulation with PMA and ionomycin) (37). These data directly show that CREB can inhibit prox.IFN-{gamma}, dist.IFN-{gamma}, and IFN-{gamma} promoter activities and are consistent with the idea that high levels of CREB/ATF1 in Ag-stimulated pTh cells may contribute to their lack of expression of transcriptional activity directed by prox.IFN-{gamma} and dist.IFN-{gamma} regulatory elements. These data also confirm previous studies that showed that overexpression of CREB in Jurkat cells could block induction of prox.IFN-{gamma} or -538 to +64 bp IFN-{gamma} promoter activity by PMA and ionomycin (28).



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 6. Overexpression of CREB blocks prox.IFN-{gamma}-, dist.IFN-{gamma}-, and IFN-{gamma} promoter-directed transcriptional activities and IFN-{gamma} production by Jurkat T cells. CREB or c-Jun expression plasmids (10 µg of each) were transfected into Jurkat T cells along with the prox.IFN-{gamma}-luc, dist.IFN-{gamma}-luc, or IFN-{gamma} promoter-luc reporter plasmids (10 µg of each) by electroporation. Cells were rested for 24 h before stimulation with plate-bound anti-human CD3. After an additional 24 h of culture, cells were harvested and analyzed for induction of transcriptional activity, and supernatant fluids were harvested and analyzed for IFN-{gamma} levels by ELISA. Luciferase values are expressed as relative light units per culture (1 ml). Results are the average ± SEM from three separate experiments.

 
Selective Th1 differentiation induced by IL-12 results in enhanced dist.IFN-{gamma} activity in eTh1 cells

Activation of pTh cells with Ag and APC in the presence of IL-12 generates eTh1 cells which, upon restimulation with Ag and APC, produce high levels of IFN-{gamma} and low levels of IL-4. Therefore, we wanted to determine whether IL-12 priming of pTh cells would result in enhanced expression of prox.IFN-{gamma} or dist.IFN-{gamma} activity in eTh cells. IL-12 priming selectively enhanced expression of dist.IFN-{gamma} activity in eTh1 cells compared with that in eTh2 cells (IL-4 primed; Fig. 7GoA). By contrast, eTh1 and eTh2 cells expressed approximately equivalent amounts of prox.IFN-{gamma} activity following rechallenge with Ag and APC. IL-12 priming also resulted in changes in the composition of proteins that formed complexes with dist.IFN-{gamma}. The eTh1 cell nuclear extracts formed increased ATF2/Jun heterodimeric complexes bound to dist.IFN-{gamma} (Fig. 7GoB) than the eTh2 cell nuclear extracts. Both eTh1 and eTh2 cell nuclear extracts formed similar levels of Jun-dist.IFN-{gamma} complexes. Interestingly, nuclear extracts from both eTh1 cells and eTh2 cells did not form the lower Jun-dist.IFN-{gamma} complex seen with nuclear extracts from eTh cells that had not been primed with either IL-12 or IL-4. The reasons underlying this difference are not known. Levels of c-Jun were comparable in eTh1 and eTh2 nuclear extracts, while eTh1 extracts contained greater levels of ATF2 protein (Fig. 7GoC). Levels of ATF1/CREB were reproducibly lower in eTh2 cells than in eTh1 cells and were markedly lower than in pTh cells.



View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 7. Differential expression of dist.IFN-{gamma} activity in eTh1 and eTh2 cells. A, The eTh1 and eTh2 cells were prepared by culturing purified CD4 T cells with peptide Ag (5 µg/ml) and APC for 5 days in the presence of 5 ng/ml IL-12 or 30 ng/ml IL-4, respectively. Cultures were harvested and restimulated with peptide Ag and APC, and cells and culture fluids were harvested after 48 h and analyzed for expression of prox.IFN-{gamma} and dist.IFN-{gamma} activities by measuring luciferase and levels of IL-4 and IFN-{gamma} by ELISA. Results are the average ± SEM from triplicate cultures of one experiment; this experiment was performed at least three times with similar results. Identical cultures were used for EMSA analysis (B) and Western blotting (C). B, Nuclear extracts, prepared from eTh1 and eTh2 cells 24 h after secondary stimulation with Ag and APC were incubated with anti-ATF2 or anti-Jun Ab for 30 min before addition of 32P end-labeled dist.IFN-{gamma} probe. Complexes were resolved by native PAGE. C, Nuclear extracts from eTh1 and eTh2 cells were also analyzed for levels of c-Jun, ATF2, and CREB/ATF1 protein by Western blotting with anti-c-Jun, anti-ATF2, and anti-CREB/ATF1 as described in Materials and Methods.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Effector Th1 and Th2 subsets are defined by the cytokines they produce (43, 44, 45, 46). Both subsets differentiate from populations of precursor naive T cells or Th0 cells that are inefficient producers of these cytokines. To investigate mechanisms of IFN-{gamma} gene regulation during Th cell differentiation, we have prepared reporter transgenic mice that express the luciferase gene under the control of two critical promoter elements from the IFN-{gamma} gene: prox.IFN-{gamma} (-70 to -44 bp) and dist.IFN-{gamma} (-98 to -78 bp) (36). We previously showed that the regulation of these promoter elements in transgenic T cells recapitulates distinct aspects of regulated IFN-{gamma} gene expression during differentiation of Th cells from naive to effector status (36).

To uncover mechanistic differences that may explain changes in transcription during Th cell differentiation, we have intercrossed luc-reporter transgenic mice with transgenic mice that express a single MHC class II-restricted TCR specific for a Cyt c peptide. Because this transgene molds a T cell repertoire with >95% Cyt c-specific T cells and minimizes the representation of T cells with the memory phenotype, we could investigate the induction of IFN-{gamma} gene transcription starting from a precursor population in which virtually all activity derived from naive phenotype cells. The efficiency of this strategy can be assessed on the basis of cytokine production profiles after initial stimulation (Fig. 1Go). Thus, as observed by others, the production of effector cytokines (IFN-{gamma} and IL-4) was almost undetectable after primary stimulation using peptide and APCs. Accordingly, any contribution of pre-existing Ag-experienced, memory phenotype cells to luciferase activity would be modest and outweighed by the pTh cells. Consistent with this point, naive T cells (CD44low, CD45Rbhigh), purified by flow cytometry, do not express prox.IFN-{gamma} or dist.IFN-{gamma} activity following activation by anti-CD3, and memory T cells (CD44high, CD45Rblow) do express prox.IFN-{gamma} and dist.IFN-{gamma} activities following identical stimulation (36).

Our results show the following. 1) The pTh cells do not express promoter activity, while the eTh cells express promoter activity following identical Ag stimulation. 2) T cell differentiation results in profound shifts in the nuclear proteins that bind prox.IFN-{gamma} and dist.IFN-{gamma} promoter elements. 3) Shifts in nuclear protein binding and shifts in transcriptional activity result at least in part from the loss of CREB/ATF1 during eTh cell differentiation from pTh cells. 4) Selective eTh1 differentiation induced by IL-12 priming leads to enhanced dist.IFN-{gamma} activity, but not prox.IFN-{gamma} activity, following Ag rechallenge and leads to enhanced formation of Jun/ATF2 heterodimer-dist.IFN-{gamma} complexes. Thus, the loss of inhibitory mechanisms as well as the gain of stimulatory mechanisms contribute to changes in gene regulation during Th cell differentiation.

Differentiation of naive T cells into populations of eTh1 and eTh2 cells probably represents a multistep process that begins with the initial activation of naive T cells by Ag. Prox.IFN-{gamma} and dist.IFN-{gamma} activities reflect this differentiation process, since neither is expressed in pTh cells but both activities are expressed in eTh cells. This induction of transcriptional activity is accompanied by a shift in the proteins that bind these elements. In pTh cells, the predominant proteins that bind prox.IFN-{gamma} and dist.IFN-{gamma} are CREB-ATF1 proteins. In contrast, in eTh cells, Jun/ATF2 proteins are the predominant dist.IFN-{gamma} binding proteins; eTh nuclear extracts also form unique complexes with prox.IFN-{gamma}, reflected by a decrease in CREB/ATF1 binding and a marked increase in an unidentified complex. Transient transfection studies show that overexpression of CREB inhibits the activities of both prox.IFN-{gamma} and dist.IFN-{gamma} as well as IFN-{gamma} production. In addition, there is an absolute drop in CREB/ATF1 levels that accompanies T cell differentiation. Taken together, these studies suggest that high levels of CREB/ATF1 proteins inhibit prox.IFN-{gamma}, dist.IFN-{gamma}, and IFN-{gamma} transcriptional activity in Ag-activated pTh cells, and that the loss of CREB/ATF1 during eTh differentiation contributes to the absolute change in the activities of these regulatory elements and in IFN-{gamma} gene expression.

The above model is further supported by a comparison of these data with the binding and promoter activities of a TRE element (12-O-tetraphorbol 12-myristate 13-acetate response element) from the collagenase promoter (20, 35) in a similar experimental system. This TRE element binds AP-1 transcription factors but does not bind CREB-ATF1 transcription factors, and similar levels of AP-1 binding and transcriptional activity are observed in Ag-activated pTh cells and eTh1 cells. AP-1 binding sites have also been identified in the IL-2 and IL-4 promoters. However, only AP-1 binding sites from the IFN-{gamma} promoter also bind CREB/ATF1. Moreover, it has been shown that CREB can inhibit Jun-mediated transcription by competing for the same cis-acting elements (47). This suggests that the IFN-{gamma} gene employs transcriptional elements with overlapping stimulatory/inhibitory sites. This could permit blockade of IFN-{gamma} promoter activity in pTh cells (through CREB-ATF1 binding) and expression of AP-1 activity in, for example, the IL-2 promoter (which lacks CREB-ATF1 sites). The extent to which these regulatory features of transcriptional elements that bind both stimulatory and inhibitory transcription factors to control promoter activity are employed by other cytokine genes remains to be determined.

The data are also consistent with a second (and not mutually exclusive) possibility, which is that increased phosphorylation of Jun and ATF2 proteins, or other post-translational modifications, in effector populations may contribute to increased dist.IFN-{gamma} promoter activity. Indeed, predominant ATF-CREB complexes are formed between dist.IFN-{gamma} and nuclear extracts from unstimulated Jurkat cells, while predominant AP-1 complexes are formed between dist.IFN-{gamma} and nuclear extracts from Jurkat cells that are stimulated with PMA and ionomycin (27). These stimulation conditions also activate JNK, which, in turn, phosphorylates both c-Jun and JunD (48). However, eTh1 and pTh cells have similar levels of JNK activity, which are greater than that found in eTh2 cells (20). These observations suggest that increased JNK activity alone is not responsible for the shift in AP-1 binding activity and increased trans-activation of dist.IFN-{gamma} in effector Th1 populations. However, alterations in the activities of other protein kinases that phosphorylate Jun family members, such as p38, which is also selectively expressed in eTh1 rather than eTh2 cells (49), in the absence of changes in the levels of Jun proteins may contribute to the increased transcriptional activity directed by dist.IFN-{gamma} in eTh1 cell populations.

In addition, the activity of dist.IFN-{gamma} is significantly enhanced by stimulation of selective eTh1 development by IL-12 priming. IL-12 priming also results in an increase in the formation of Jun/ATF2-dist.IFN-{gamma} complexes by eTh1 cell nuclear extracts in gel mobility shift assays. Increased formation of Jun/ATF2-dist.IFN-{gamma} complexes and increased dist.IFN-{gamma} activity may result from changes in the level of ATF2 protein as well as from increased post-translational modification. The activities of certain p38 isoforms, enzymes known to phosphorylate ATF2, are greater in eTh1 cells than in eTh2 cells or pTh cells (49). Mechanistically, it is not entirely clear how addition of IL-12 to pTh cells results in these changes observed in eTh1 cells. However, by focusing on mechanisms that regulate dist.IFN-{gamma} activity and the formation of Jun/ATF2-dist.IFN-{gamma} complexes, it should be possible to link IL-12 priming of pTh cells to expression of eTh1 function.


   Footnotes
 
1 This work was supported by grants from the National Institute of Health (KO1AR02027 (to T.M.A.), 5P60DK20593 (to T.M.A.), RO1GM42550 (to M.R.B.), P30HD27757 (to L.A.P.), and RO1AI29902 (to R.A.F.)) and by the Howard Hughes Medical Institute (to R.A.F.). R.A.F. is an investigator with the Howard Hughes Medical Institute, and M.B. is a scholar with the Leukemia Society of America. Back

2 Address correspondence and reprint requests to Dr. Thomas M. Aune, MCN T3219, Vanderbilt University Medical Center, 21st and Garland, Nashville, TN 37232. E-mail address: Back

3 Abbreviations used in this paper: eTh, effector T helper cells; pTh, precursor T helper cells; AP-1, activating protein-1; CREB-ATF1, cyclic adenosine 3',5'-monophosphate response element binding protein-activation transcription factor-1; prox.IFN-{gamma}, proximal element (-70 to -44 base pairs) of the interferon-{gamma} promoter; dist.IFN-{gamma}, distal element (-98 to -78 base pairs) of the interferon-{gamma} promoter; Cyt c, cytochrome c; EMSA, electrophoretic mobility shift assay; CRE, cyclic adenosine 3',5'-monophosphate response element; TRE, TPA response element. Back

Received for publication May 14, 1998. Accepted for publication July 29, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
  2. Sher, A., R. L. Coffman. 1992. Regulation of immunity to parasites by T cells and T cell-derived cytokines. Annu. Rev. Immunol. 10:385.[Medline]
  3. Ehlers, S., K. A. Smith. 1991. Differentiation of T cell lymphokine gene expression: in vitro acquisition of T cell memory. J. Exp. Med. 173:25.[Abstract/Free Full Text]
  4. Hsieh, C.-S., A. B. Heimberger, J. S. Gold, A. O’Garra, K. M. Murphy. 1992. Differential regulation of T helper phenotype development by IL-4 and IL-10 in an {alpha}ß-T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. USA 89:6065.[Abstract/Free Full Text]
  5. Hsieh, C.-S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, K. M. Murphy. 1993. Development of TH1 CD4+ T cells through IL12 produced by Listeria-induced macrophages. Science 260:547.[Abstract/Free Full Text]
  6. Scott, P.. 1993. IL-12: Initiation cytokine for cell-mediated immunity. Science 260:496.[Free Full Text]
  7. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4 T cells. Annu. Rev. Immunol. 12:635.[Medline]
  8. Seder, R. A., R. Gazzinelli, A. Sher, W. E. Paul. 1993. Interleukin 12 acts directly on CD4+ T cells to enhance priming for interferon-{gamma} production and diminishes interleukin 4 inhibition of such priming. Proc. Natl. Acad. Sci. USA 90:10188.[Abstract/Free Full Text]
  9. Seder, R. A., W. E. Paul, M. M. Davis, B. Fazekas de St. Groth.. 1992. The presence of IL4 during priming determines the lymphokine-producing potential of CD4+ T cells from T cell receptor transgenic mice. J. Exp. Med. 176:1091.[Abstract/Free Full Text]
  10. Constant, S., C. Pfeiffer, A. Woodard, T. Pasqualini, K. Bottomly. 1995. Extent of T cell receptor ligation can determine the functional differentiation of naive CD4 T cells. J. Exp. Med. 182:1591.[Abstract/Free Full Text]
  11. Hosken, N. A., K. Shibuya, A. W. Heath, K. M. Murphy, A. O’Garra. 1995. The effect of antigen dose on CD4 T helper cell phenotype development in a T cell receptor-{alpha}ß-transgenic model. J. Exp. Med. 182:1579.[Abstract/Free Full Text]
  12. Seder, R. A., R. N. Germain, P. S. Linsley, W. E. Paul. 1994. CD28-mediated costimulation of interleukin 2 (IL-2) production plays a critical role in T cell priming for IL4 and interferon {gamma} production. J. Exp. Med. 179:299.[Abstract/Free Full Text]
  13. Thompson, C. B., T. Lindsten, J. A. Ledbetter, S. L. Kunkel, H. A. Young, S. G. Emerson, J. M. Leiden, C. H. June. 1989. CD28 activation pathway regulates the production of multiple T cell derived lymphokines/cytokines. Proc. Natl. Acad. Sci. USA 86:1333.[Abstract/Free Full Text]
  14. Guler, M. L., J. D. Gorham, C.-S. Hsieh, A. J. Mackey, R. G. Steen, W. F. Dietrich, K. M. Murphy. 1996. Genetic susceptibility to Leishmania: IL-12 responsiveness to Th1 cell development. Science 271:984.[Abstract]
  15. Hsieh, C.-S., S. E. Macatonia, A. O’Garra, K. M. Murphy. 1995. T cell genetic background determines default T helper phenotype development in vitro. J. Exp. Med. 181:713.[Abstract/Free Full Text]
  16. Scott, B., R. Liblau, S. Degermann, L. A. Marconi, L. Ogata, A. J. Caton, H. McDevitt, D. Lo. 1994. A role for non-MHC genetic polymorphism in susceptibility to spontaneous autoimmunity. Immunity 1:73.[Medline]
  17. Davydov, I. V., P. H. Krammer, M. Li-Weber. 1995. Nuclear factor-IL-6 activates the human IL-4 promoter in T cells. J. Immunol. 155:5273.[Abstract]
  18. Rincon, M., R. A. Flavell. 1997. Transcription mediated by NFAT is highly inducible in effector CD4 T helper 2 (Th2) cells but not in Th1 cells. Mol. Cell. Biol. 17:1522.[Abstract]
  19. Aune, T. M., R. A. Flavell. 1997. Differential expression of transcription directed by a discrete NF-AT binding element from the IL-4 promoter in naive and effector CD4 T cells. J. Immunol. 159:36.[Abstract]
  20. Rincon, M., B. Derijard, C.-W. Chow, R. J. Davis, R. A. Flavell. 1997. Reprogramming the signaling requirement for AP-1 (activator protein-1) activation during differentiation of precursor CD4 T-cells to effector Th1 and Th2 cells. Genes Function 1:51.[Medline]
  21. Rooney, J. W., T. Hoey, L. H. Glimcher. 1995. Coordinate and cooperative roles for NF-AT and AP-1 in the regulation of the murine IL4 gene. Immunity 2:473.[Medline]
  22. Wenner, C. A., S. J. Szabo, K. M. Murphy. 1997. Identification of IL-4 promoter elements conferring Th2-restricted expression during T helper cell subset development. J. Immunol. 158:765.[Abstract]
  23. Hou, J., U. Schindler, W. J. Henzel, T. C. Ho, M. Brasseur, S. L. McKnight. 1994. An interleukin-4-induced transcription factor: IL-4stat. Science 265:1701.[Abstract/Free Full Text]
  24. Kaplan, M. K., U. Schindler, S. T. Smiley, M. J. Grusby. 1996. Stat6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity 4:313.[Medline]
  25. Ho, I-C., M. R. Hodge, J. W. Rooney, L. H. Glimcher. 1996. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin 4. Cell 85:973.[Medline]
  26. Zheng, W.-P., R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for the Th2 cytokine gene expression in CD4 T cells. Cell 89:587.[Medline]
  27. Cippitelli, M., A. Sica, V. Viggiano, J. Ye, P. Ghosh, M. J. Birrer, H. A. Young. 1995. Negative transcriptional regulation of the interferon-{gamma} (IFN-{gamma}) promoter by glucocorticoids and dominant-negative mutants of c-Jun. J. Biol. Chem. 270:12548.[Abstract/Free Full Text]
  28. Penix, L. A., M. T. Sweetser, W. M. Weaver, J. P. Hoeffler, T. K. Kerppola, C. B. Wilson. 1996. The proximal regulatory element of the interferon-{gamma} promoter mediates selective expression in T cells. J. Biol. Chem. 271:31964.[Abstract/Free Full Text]
  29. Kaplan, M. K., Y. Sun, T. Hoey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382:174.[Medline]
  30. Thierfelder, W. E., J. M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, R. R. Carson, M. Y. Sangster, D. A. A. Vignali, P. C. Doeherty, G. C. Grosveld, et al 1996. Requirement for Stat4 in interleukin-12 mediated responses of natural killer and T cells. Nature 382:171.[Medline]
  31. Lohoff, M., D. Ferrick, H.-W. Mittrucker, G. S. Duncan, S. Bischoff, M. Rollinghoff, T. W. Mak. 1997. Interferon regulatory factor-1 is required for a T helper 1 immune response in vivo. Immunity 6:681.[Medline]
  32. Taki, S., T. Sato, K. Ogasawara, T. Fukuda, M. Sato, S. Hida, G. Suzuki, M. Mitsuyama, E.-H. Shin, S. Kojima, et al 1997. Multistage regulation of Th1-type immune responses by the transcription factor IRF-1. Immunity 6:673.[Medline]
  33. Kamogawa, Y., L. A. Minasi, S. R. Carding, K. Bottomly, R. A. Flavell. 1993. The relationship of IL-4- and IFN-{gamma}-producing T cells studied by lineage ablation of IL-4-producing cells. Cell 75:985.[Medline]
  34. Nakamura, T., Y. Kamogawa, K. Bottomly, R. A. Flavell. 1997. Polarization of IL-4 and IFN-{gamma}-producing CD4 T cells following activation of naive CD4 T cells. J. Immunol. 158:1085.[Abstract]
  35. Rincon, M., R. A. Flavell. 1994. AP-1 transcriptional activity requires both T-cell receptor-mediated and co-stimulatory signals in primary T lymphocytes. EMBO J. 13:4370.[Medline]
  36. Aune, T. M., L. A. Penix, M. R. Rincon, R. A. Flavell. 1996. Differential transcription directed by discrete IFN-{gamma} promoter elements in naive and memory (effector) CD4 T cells, and CD8 T cells. Mol. Cell. Biol. 17:199.[Abstract]
  37. Penix, L., W. M. Weaver, Y. Pang, H. A. Young, C. B. Wilson. 1993. Two essential regulatory elements in the human interferon {gamma} promoter confer activation specific expression in T cells. J. Exp. Med. 178:1483.[Abstract/Free Full Text]
  38. De Wet, J. R., K. V. Wood, M. DeLuca, D. R. Helinska, S. Subramani. 1987. Firefly luciferase gene: structure and expression in mammalian cells. Mol. Cell. Biol. 7:725.[Abstract/Free Full Text]
  39. Hogan, B., F. Costantini, L. Elizabeth. 1986. Manipulating the Mouse Embryo: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
  40. Kaye, J. M., M.-L. Hsu, M.-E. Sauron, S. C. Jameson, N. R. J. Gascoigne, S. M. Hedrick. 1989. Selective development of CD4+ T cells in transgenic mice expressing a class II MHC-restricted antigen receptor. Nature 341:746.[Medline]
  41. Schreiber, E. P., M. Muller Mathias, W. Sheffner. 1989. Rapid detection of octamer binding proteins with mini-extracts prepared from small numbers of cells. Nucleic Acids Res. 17:6419.[Free Full Text]
  42. Tugures, A., M. A. Alonso, F. Sanchez-Madrid, M. O. De Landazuri. 1992. Human T cell activation through the activation inducer molecule CD69 enhances the activity of transcription factor AP-1. J. Immunol. 148:2300.[Abstract]
  43. Swain, S. J., L. M. Bradley, M. Croft, S. Tonkonogy, G. Atkins, A. D. Weinberg, D. D. Duncan, S. M. Hedrick, R. W. Dutton, G. Huston. 1991. Helper T-cell subsets: phenotype, function and the role of lymphokines in regulating their development. Immunol. Rev. 123:115.[Medline]
  44. Mossman, T. R., R. L. Coffman. 1989. Th1 and Th2 cells: different pattern of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7:145.[Medline]
  45. Mosmann, T. R., S. Sad. 1996. The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol. Today 17:138.[Medline]
  46. Paul, W. E., R. A. Seder. 1994. Lymphocyte responses and cytokines. Cell 76:241.[Medline]
  47. Masquilier, D., P. Sassone-Corsi. 1992. Transcriptional cross-talk: nuclear factors CREM and CREB bind to AP-1 sites and inhibit activation by Jun. J. Biol. Chem. 267:22460.[Abstract/Free Full Text]
  48. Su, B., E. Jacinto, M. Hibi, T. Kallunki, M. Karin, Y. Ben-Neriah. 1994. JNK is involved in signal integration during costimulation of T lymphocytes. Cell 77:727.[Medline]
  49. Rincon, M., H. Enslen, J. Raingeaud, M. Recht, T. Zapton, M. S.-S. Su, L. A. Penix, R. J. Davis, R. A. Flavell. 1998. Interferon-{gamma} expression by Th1 effector T cells mediated by the p38 MAP kinase signaling pathway. EMBO J. 17:2817.[Medline]
  50. Wilson, B. E., E. Mochon, L. M. Boxer. 1996. Induction of bcl-2 expression by phosphorylated CREB proteins during B-cell activation and rescue from apoptosis. Mol. Cell. Biol. 16:5546.[Abstract]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
B. Samten, J. C. Townsend, S. E. Weis, A. Bhoumik, P. Klucar, H. Shams, and P. F. Barnes
CREB, ATF, and AP-1 Transcription Factors Regulate IFN-{gamma} Secretion by Human T Cells in Response to Mycobacterial Antigen
J. Immunol., August 1, 2008; 181(3): 2056 - 2064.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. M. Rosenberger, A. E. Clark, P. M. Treuting, C. D. Johnson, and A. Aderem
ATF3 regulates MCMV infection in mice by modulating IFN-{gamma} expression in natural killer cells
PNAS, February 19, 2008; 105(7): 2544 - 2549.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Samten, S. T. Howard, S. E. Weis, S. Wu, H. Shams, J. C. Townsend, H. Safi, and P. F. Barnes
Cyclic AMP Response Element-Binding Protein Positively Regulates Production of IFN-{gamma} by T Cells in Response to a Microbial Pathogen
J. Immunol., May 15, 2005; 174(10): 6357 - 6363.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
K.-Y. Chau, A. M. Keane-Myers, M. Fedele, Y. Ikeda, R. J. Creusot, L. Menozzi, D. J. Cousins, G. Manfioletti, L. Feigenbaum, A. Fusco, et al.
IFN-{gamma} gene expression is controlled by the architectural transcription factor HMGA1
Int. Immunol., March 1, 2005; 17(3): 297 - 306.