|
|
||||||||
Promoter Elements During Th Cell Differentiation1



Division of Rheumatology, Departments of
*
Medicine and
Microbiology and Immunology, Vanderbilt University School of Medicine, Nashville, TN 37232; and
Department of Pediatrics and
§
Section of Immunobiology, Yale University School of Medicine, and
¶
Howard Hughes Medical Institute, New Haven, CT 06510
| Abstract |
|---|
|
|
|---|
) and distal
(dist.IFN-
) regulatory elements from the IFN-
promoter to permit investigation of mechanisms that regulate IFN-
gene transcription during Th cell differentiation. Precursor Th cells
(pTh) contain high levels of cAMP response element binding
protein-activation transcription factor-1 (CREB-ATF1) proteins
that bind these promoter elements from the IFN-
gene, and these
cells fail to express promoter activity. Restimulated effector Th (eTh)
cells have reduced levels of CREB-ATF1 proteins, their nuclear extracts
exhibit reduced CREB-ATF1 binding and greater Jun and Jun-ATF2 binding
to dist.IFN-
, and eTh cells express promoter activity.
CREB directly competes with effector T cell nuclear proteins for
dist.IFN-
binding, and overexpression of CREB inhibits
both prox.IFN-
- and dist.IFN-
-directed
transcription in Jurkat T cells. IL-12-stimulated Th1 differentiation
increases dist.IFN-
activity in restimulated eTh1 cells;
eTh1 nuclear extracts form increased levels of
Jun-ATF2-dist.IFN-
complexes. Taken together, these data
suggest that both de-repression and trans-activation
contribute to the induction of IFN-
gene transcription during Th1
differentiation. | Introduction |
|---|
|
|
|---|
, and effector Th2 (eTh2) cells, which are
producers of IL-4, differentiate from precursor T cells (pTh), which
are inefficient producers of these cytokines (1). Effector Th1 cells
provide immunity to intracellular pathogens, and eTh2 cells provide
immunity to extracellular pathogens (2). The development of these T
cell subsets is controlled by the cytokine environment (IL-12 and
IFN-
promote Th1 development; IL-4 promotes Th2 development) (3, 4, 5, 6, 7, 8, 9),
the type and the concentration of Ag (10, 11), costimulatory pathways
(12, 13), and non-MHC-linked background genes (14, 15, 16).
The transcriptional mechanisms by which these different signaling
pathways converge to control T cell differentiation in the periphery is
a question of intense interest. A number of transcription factors have
been identified that participate in Th2 development and expression of
the IL-4 gene. These include NF-IL-6 (17), NF-AT, AP-1 (18, 19, 20, 21, 22), STAT6
(23, 24), c-Maf (25), and GATA3 (26). Transcription factors that
are required for Th1 development and IFN-
gene expression include
AP-1 (27, 28), Stat4 (29, 30), and interferon regulatory factor
1 (31, 32). While these results show that distinct nuclear
factors are required for selective gene expression in Th1 or Th2 cells,
what is not clear is whether they act directly on the IFN-
gene or
act on other genes required for selective Th1 or Th2 development. In
addition, some of these transcription factors are found in both eTh1
and eTh2 subsets, while others appear to be unique to one or the other
subset. Silencing mechanisms may also actively control gene expression
in these different T cell subsets (33, 34).
Exactly how these and other nuclear factors interact during Th
cell development to generate Th1 and Th2 subsets that express selective
patterns of cytokine genes is poorly understood. To investigate this
basic question, several laboratories have prepared lines of transgenic
mice that express a reporter gene under the control of critical
promoter regions of cytokine genes. These include transgenic lines that
express the luciferase gene under the control of 1) the P1 element from
the IL-4 promoter that contains both an NF-AT and an AP-1 binding site
(18), 2) the P1 element with only the NF-AT binding site (19), 3) a
composite NF-AT binding element from the IL-2 promoter (22), 4) an AP-1
binding element from the collagenase promoter (35), and 5) two elements
from the IFN-
promoter (36, 37) that bind AP-1/CREB/ATF
transcription factors (27, 28). These studies show that both
P1NF-AT and P1NF-AT/AP1 from the IL-4 promoter
are selectively active in eTh cells but not in pTh cells. The P1
element with both NF-AT and AP-1 binding sites shows greater
selectivity, in that activity is expressed at much greater levels in
eTh2 populations than in eTh1 populations. By contrast, the activity of
the P1 element with only the NF-AT binding site is approximately
equivalent in both eTh1 and eTh2 populations. Consistent with a
possible contribution of AP-1 to P1 activity in eTh2 cells, the AP-1
binding element from the collagenase promoter does not bind NF-AT, yet
activity of the AP-1 element is much greater in eTh2 populations than
in eTh1 populations (20).
A similar strategy has been employed to address mechanisms of selective
IFN-
gene regulation in eTh1 cells. Two promoter elements from the
IFN-
gene, a proximal (-70 to -44 bp;
prox.IFN-
) and a distal (-98 to -78;
dist.IFN-
) element, are also inactive in pTh cells
following stimulation with polyclonal mitogens, yet are activated
following identical stimulation of resting memory T cells (36). Primary
T cells can be stimulated in vitro to differentiate into eTh cells that
express transcriptional activity under the control of
prox.IFN-
and dist.IFN-
and produce
IFN-
. This large shift in the activity of IFN-
promoter elements
suggests that rather large changes must also occur in the
transcriptional environment as T cells differentiate to acquire
effector function. Therefore, we wanted to determine 1) whether lineage
specificity of these transcriptional elements is also observed in a
more physiologic TCR transgenic system in which pTh cells are more
clearly defined; b) whether T cell differentiation causes changes in
the pattern of nuclear factors that bind to these promoter elements; c)
whether selective eTh1 differentiation stimulated by IL-12 would target
either transcriptional element; and 4) if we can link changes in
transcription factor binding to changes in transcriptional activity. We
found that the proximal and distal elements of the IFN-
promoter are
not active in pTh cells and are active in eTh cells following Ag
stimulation in a single TCR transgenic system. Similarly, pTh cells
produce very low levels of IFN-
following Ag stimulation, while, as
expected, eTh cells produce large quantities of IFN-
. The results
also show that there is a fundamental shift in the transcriptional
environment during Th cell differentiation. CREB/ATF1 proteins are
present at high levels in pTh cells, bind to prox.IFN-
and dist.IFN-
, and can inhibit transcription mediated by
prox.IFN-
and dist.IFN-
. Following T cell
differentiation, CREB/ATF1 levels fall, and stimulatory transcription
factors bind to prox.IFN-
and dist.IFN-
and activate transcription. In addition, IL-12-stimulated Th1
differentiation results in increased binding of Jun-ATF2 heterodimers
to dist.IFN-
and increased transcriptional activity at
the dist.IFN-
element, but not the
prox.IFN-
element.
| Materials and Methods |
|---|
|
|
|---|
The prox.IFN-
- and
dist.IFN-
-luciferase transgenic mice were described in
detail previously (36). Briefly, plasmids containing a head-to-tail (5'
to 3') dimer of the IFN-
proximal element (-70 to -44 bp from the
transcription start site) and tetramer of the IFN-
distal element
(-98 to -78 bp) with the IFN-
minimal promoter were subcloned into
the luc reporter plasmid (38). The 2.8-kb HpaI fragment
isolated from these plasmids (prox.IFN-
-Luc and
dist.IFN-
-Luc, respectively) was injected into
fertilized C57BL/6 x CBA/N F2 eggs, and transgenic mice were
generated as previously described (39).
The cytochrome c (Cyt c) TCR transgenic mice were
provided by J. Kaye and S. M. Hedrick (40).
Prox.IFN-
-Luc and dist.IFN-
-Luc mice were
backcrossed to B10.BR for four generations before intercrossing with
the Cyt c TCR mice, which are also B10.BR. Double transgenic
littermates were identified by Southern blot analysis of tail DNA for
the luciferase gene and by flow cytometry of peripheral blood using
FITC-coupled
-CD4 and phycoerythrin-coupled
-Vß3. CD4 T cells
from (Cyt c TCR x
prox.IFN-
-luc)F1 or (Cyt c
TCR x dist.IFN-
-luc)F1 double
transgenic mice were employed to analyze changes in transcriptional
activity following antigenic stimulation.
Cell preparation and culture
Spleen cells, lymph node cells, or pooled spleen and lymph node
cells were harvested from wild-type or transgenic animals. RBCs were
removed by hypotonic lysis. CD4+ T cells were purified by
negative selection. Ia-expressing cells and NK cells were removed by
incubation with an
-IE,IA mAb (m5/115, American Type Culture
Collection, Manassas, VA) and an
-NK cell mAb (NK 1.1, American Type
Culture Collection), respectively. An
-CD8 mAb (TIB 105, American
Type Culture Collection) was used to deplete CD8 T cells. Cells were
incubated for 30 min at 4°C, washed, and further incubated with goat
-mouse and
-rat IgG bound to magnetic beads (Collaborative
Research, Waltham, MA) for 30 min at 4°C with rocking. Cells bound to
beads were removed with a magnet. The average purity of CD4 cells was
approximately 9095% as determined by flow cytometry. RBC-depleted
splenocytes from B10.BR mice were depleted of CD4+ and
CD8+ T cells by negative selection with
-CD4 and
-CD8
mAb and were irradiated at 2000 rad from a cesium 137 source and used
as APCs.
Reagents used to stimulate CD4 T cells were: Cyt c peptide,
0.0550 µg/ml;
-CD3 (145-2C11 clone, American Type Culture
Collection), 1 µg/ml; IL-2, 5 ng/ml; IL-12, 5 ng/ml; and IL-4, 30
ng/ml. Recombinant IL-2 and IL-4 were purchased from PharMingen (San
Diego, CA); recombinant IL-12 was a gift from Genetics Institute
(Cambridge, MA). Immobilized
-CD3 was prepared by adding 0.51 ml
of 10 µg/ml of 2C11 mAb in 0.1 M sodium bicarbonate, pH 9.6, to a 24-
or 48-well tissue culture plate for 36 h at 37°C or overnight at
04°C. Culture plates were washed thoroughly before use.
The IFN-
and IL-4 ELISAs were performed with Abs from PharMingen
according to the manufacturers procedures. The sensitivity of the
IFN-
ELISA was 0.02 ng/ml. The sp. act. of IFN-
was
107 U/mg protein (PharMingen). The sensitivity of the IL-4
ELISA was also 0.02 ng/ml.
Cells from various sources were cultured in complete RPMI 1640 medium with 10% FCS, 100 U/ml of penicillin, 100 U/ml of streptomycin, 2 mM L-glutamine, and 5 x 10-5 M 2-ME in 24- or 48-well tissue culture plates in volumes of 1 or 0.5 ml, respectively, at a density of 1 x 106/ml in the presence or the absence of various stimuli, as described in the text, at 37°C in 5% CO2 in air. Syngeneic irradiated APC were used at a density of 1 x 106/ml of culture fluid. The pTh cells were obtained 4872 h after initial activation of purified CD4 T cells with Ag and APC. The eTh cells were obtained by stimulating purified CD4 T cells with Ag and APC for 5 days and restimulating these cultures with Ag and APC. The eTh1 and eTh2 cells were prepared as described for eTh cells, except that cultures received either 5 ng/ml of IL-12 or 30 ng/ml of IL-4 during the primary cultures, respectively.
Analysis of luciferase activity
After the periods of time indicated in the text, cultures were harvested, washed twice in PBS, and suspended in 50 µl of lysis buffer (luciferase assay, Promega, Madison, WI) for 30 min at 25°C. The supernatant fluid was harvested, and 20-µl aliquots were assayed for luciferase activity with 100 µl of luciferase reagent (Promega) in a luminometer (Turner TD20/20, Promega) for 15 s. Cultures were performed in duplicate. Duplicate analyses of two aliquots from each cell lysate were performed, and the results were averaged. Results are expressed as the average of these readings per 106 cells with the SE. The background measurement with luciferase reagent alone was subtracted from each reading. Results are expressed in relative light units. The absolute values obtained from individual readings ranged from 0.05 (unstimulated cell lysates = instrument background) to 20 light units (lysates from maximally stimulated cells). The Turner TD 20/20 luminometer differs from many luminometers used in biomedical research because its scale is significantly different. For comparison, 1 fg of luciferase yields a reading of approximately 1, and 10 fg yields a reading of approximately 10 in the Turner TD 20/20 luminometer.
Electrophoretic mobility shift assays (EMSAs)
Small scale nuclear extracts were prepared from 5 x
106 cells (41, 42) as previously described. Binding
reactions were conducted essentially as previously described using 35
µg of nuclear proteins and 1.5 x 104 cpm of
32P end-labeled double-stranded oligonucleotides. Sequences
of the oligonucleotides (sense strand) used for EMSA are as follows:
prox.IFN-
(-70 to -44 bp),
5'-AAAACTTGTGAAAATACGTAATCCT; dist.IFN-
(-98 to -78
bp), TGCCTATCTGTCACCATCTCA; TRE, CGCTTGATGACTCAGCCGGAA;
and CRE, GGCAACTGTGACGTCATCACAAGA. Consensus
binding sites for AP-1 and CREB are underlined respectively. The Abs
used for these studies include ATF1 (sc-4006, Santa Cruz
Biotechnology), which recognizes CREB, ATF1, and ATF2; ATF2 (sc-6233);
and pan-Jun (Upstate Biotechnology, Lake Placid, NY). Truncated CREB
protein (amino acids 254327) was also obtained from Santa Cruz
Biotechnology. Abs (0.11 µg) were preincubated with nuclear
extracts for 3045 min at room temperature before addition of probes.
Complexes were resolved on 5% native polyacrylamide gels in a
tris-borate-EDTA (TBE) buffer.
Western blotting analysis
Nuclear proteins were fractionated by SDS-PAGE, transferred to nitrocellulose membranes, and incubated with specific primary Abs as outlined in the text. Membranes were washed and incubated with secondary horseradish peroxidase-conjugated anti-rabbit or anti-mouse Abs and developed with an enhanced chemiluminescent system (Amersham, Arlington Heights, IL) according to the vendors instructions.
Transient transfection
Jurkat cells, in log-phase growth, were harvested, washed once, suspended at 2.5 x 107 cells/ml, incubated with 10 µg of plasmid DNA for 10 min at 04°C, and transfected by electroporation at 270 V and 960 µF. Cells were suspended in RPMI 1640 medium with 10% FCS and cultured overnight before activation with plate-bound anti-CD3. CREB and c-Jun cDNAs were obtained from Drs. Darryl Granner and Ron Wisdom, respectively, and were ligated into the pCMV expression vector (Promega).
| Results |
|---|
|
|
|---|
regulatory elements during Th
cell differentiation correlate with changes in the nuclear factors that
bind these elements
Stimulation of pTh cells with Ag or polyclonal activators under
neutral conditions resulted in IL-2 production, but only low levels of
IFN-
production. This failure to produce IFN-
was reflected by a
failure to express transcriptional activity under the control of
critical regulatory elements from the IFN-
promoter. By contrast, T
cells that were allowed to differentiate in vitro under neutral
conditions (eTh) expressed high levels of prox.IFN-
and
dist.IFN-
promoter activity following rechallenge with
Ag (Fig. 1
). Multiple founders were
generated, and all showed similar qualitative properties, including the
relative difference in prox.IFN-
and
dist.IFN-
activities (36), indicating that the observed
results are most likely not due to integration effects.
|
and
low levels of IL-4 under these experimental conditions. One possible
explanation for why eTh, but not pTh, cells express
prox.IFN-
and dist.IFN-
promoter
activities after Ag stimulation was that different nuclear proteins
bind to these two promoter elements in pTh and eTh subsets. To test
this possibility, EMSA was performed with nuclear extracts derived from
CD4+ T cells following either primary (pTh) or secondary
(eTh) stimulation with Ag and APC (Fig. 2
, whereas
nuclear extracts from effector T cells (two cycles of Ag activation)
formed three major complexes (Fig. 2
|
. The
dist.IFN-
-pTh complexes were effectively
supershifted by an anti-CREB/ATF Ab (Fig. 2
element. Nuclear extracts from
Ag-activated eTh cells formed complexes with dist.IFN-
with markedly different mobilities that were only partially
supershifted by the anti-CREB-ATF Ab. These studies show that
CREB/ATF proteins form the predominant complexes with both
prox.IFN-
and dist.IFN-
following Ag
stimulation of primary T cells but that different proteins also form
complexes with these cis-acting elements following Ag
stimulation of effector T cells.
|
(T-ACGTAA) and
dist.IFN-
(TGTCACCA)
elements (bold-face type shows sequence matches between these elements
and consensus sequences for AP-1 and CREB/ATF; 17 . These studies
are consistent with the above demonstration that CREB-ATF factors from
extracts from pTh cells form complexes with prox.IFN-
and dist.IFN-
However, certain complexes formed with
nuclear extracts from eTh cells were inefficiently eliminated or
supershifted by anti-ATF/CREB Ab (Fig. 2
-protein complexes indicated that the
new complexes formed between dist.IFN-
and nuclear
extracts from eTh cells were effectively competed by TRE
oligonucleotides but not CRE oligonucleotides (Fig. 3
-protein complexes (Fig. 3
complexes, effectively
competed and supershifted the majority of eTh-dist.IFN-
complexes. In addition, a specific anti-ATF2 Ab, which failed to
block formation of prox.IFN-
- or
dist.IFN-
-complexes in pTh cells (not shown), blocked
formation of the faint upper dist.IFN-
-protein complex
in eTh cell extracts. Anti-Fos Abs neither blocked the formation of
dist.IFN-
-protein complexes nor resulted in the
formation of supershifted complexes (Fig. 3
and
dist.IFN-
in pTh cell extracts and that Jun proteins
form the major protein-DNA complexes with dist.IFN-
in eTh cells. In addition, the faint upper
dist.IFN-
-protein complex appears to contain Jun-related
proteins and ATF2 proteins, presumably as Jun-ATF2 dimers. At this
point, we have not identified the protein(s) that makes up the new
prox.IFN-
complexes in effector T cells with the faster
mobility (asterisk in Fig. 2
and dist.IFN-
transcriptional elements. These changes in DNA binding may contribute
to the marked changes in the activity of these regulatory elements in
eTh cells following Ag stimulation. T cell differentiation results in a marked decrease in the level of CREB-ATF1 proteins
The above data indicated that differentiation of pTh cells into
eTh cells is accompanied by a transition from dominant CREB/ATF1
binding to the dist.IFN-
promoter element to dominant
ATF2/Jun binding. This evolution could be due to changes in the levels
of these transcription factors, changes in post-translational
modifications, or both. To examine the first possibility, the levels of
CREB-ATF1 proteins, ATF2, c-Jun, and Fos were measured by Western
blotting of nuclear extracts from pTh and eTh cell populations.
Extracts from unstimulated pTh cells contained undetectable levels of
c-Jun, c-Fos, ATF2, CREB, and ATF1. Extracts from resting eTh cells
(before secondary Ag stimulation) contained very low levels of these
transcription factors (not shown). Extracts from pTh and eTh cells
contained comparable levels of c-Jun, c-Fos, and ATF2 (Fig. 4
). This indicates that each of these
transcription factors is inducible in pTh and eTh cells by Ag
stimulation. By contrast, levels of CREB-ATF1 proteins were not
inducible in eTh cells following secondary Ag stimulation (Fig. 4
).
|
and blocks the activity of prox
IFN-
and dist.IFN-
transcriptional
elements
The shift in the transcription factors that bind
prox.IFN-
and dist.IFN-
and the
shift in activity that accompanies T cell differentiation may result
from a combination of loss of repressive mechanisms and gain of
stimulatory mechanisms. Therefore, we wanted to determine whether CREB
could directly compete with eTh nuclear extract proteins and inhibit
formation of complexes between Jun/ATF2 and dist.IFN-
DNA. Addition of increasing amounts of unphosphorylated truncated CREB
(amino acids 254327) to eTh nuclear extracts inhibited formation of
Jun and Jun-ATF2 complexes with the dist.IFN-
probe
(Fig. 5
), indicating that
unphosphorylated truncated CREB can directly compete with Jun/ATF2
proteins from effector T cell extracts for binding to
dist.IFN-
. Whether full-length phosphorylated or
unphosphorylated CREB or ATF1 would compete more efficiently with
Jun/ATF2 proteins for dist.IFN-
binding is not known.
However, these data support the idea that CREB/ATF1 proteins in pTh
cell nuclear extracts may compete with Jun/ATF2 proteins for binding to
dist.IFN-
.
|
raises the possibility that CREB may also
block prox.IFN-
- and
dist.IFN-
-directed transcriptional activities. To test
this hypothesis, a CREB expression plasmid was transfected into Jurkat
T cells along with prox.IFN-
-luciferase,
dist.IFN-
-luciferase, or a -660 to +64 IFN-
promoter-luciferase reporter plasmid. After 24 h, Jurkat T cells
were stimulated with plate-bound anti-human CD3 mAb. Cells were
harvested 24 h later and analyzed for prox.IFN-
,
dist.IFN-
, or IFN-
promoter activity. Overexpression
of CREB in Jurkat cells caused marked inhibition of
prox.IFN-
-, dist.IFN-
-, and IFN-
promoter-directed transcriptional activities (Fig. 6
. By contrast, overexpression of
c-Jun did not inhibit promoter activity or IFN-
production (certain
sublines of Jurkat cells produce low levels of IFN-
upon stimulation
with PMA and ionomycin) (37). These data directly show that CREB can
inhibit prox.IFN-
, dist.IFN-
, and IFN-
promoter activities and are consistent with the idea that high levels
of CREB/ATF1 in Ag-stimulated pTh cells may contribute to their lack of
expression of transcriptional activity directed by
prox.IFN-
and dist.IFN-
regulatory
elements. These data also confirm previous studies that showed that
overexpression of CREB in Jurkat cells could block induction of
prox.IFN-
or -538 to +64 bp IFN-
promoter activity
by PMA and ionomycin (28).
|
activity in eTh1 cells
Activation of pTh cells with Ag and APC in the presence of IL-12
generates eTh1 cells which, upon restimulation with Ag and APC, produce
high levels of IFN-
and low levels of IL-4. Therefore, we wanted to
determine whether IL-12 priming of pTh cells would result in enhanced
expression of prox.IFN-
or dist.IFN-
activity in eTh cells. IL-12 priming selectively enhanced expression of
dist.IFN-
activity in eTh1 cells compared with
that in eTh2 cells (IL-4 primed; Fig. 7
A). By contrast, eTh1 and
eTh2 cells expressed approximately equivalent amounts of
prox.IFN-
activity following rechallenge with Ag and
APC. IL-12 priming also resulted in changes in the composition of
proteins that formed complexes with dist.IFN-
. The eTh1
cell nuclear extracts formed increased ATF2/Jun heterodimeric complexes
bound to dist.IFN-
(Fig. 7
B) than the eTh2
cell nuclear extracts. Both eTh1 and eTh2 cell nuclear extracts formed
similar levels of Jun-dist.IFN-
complexes.
Interestingly, nuclear extracts from both eTh1 cells and eTh2 cells did
not form the lower Jun-dist.IFN-
complex seen with
nuclear extracts from eTh cells that had not been primed with either
IL-12 or IL-4. The reasons underlying this difference are not known.
Levels of c-Jun were comparable in eTh1 and eTh2 nuclear extracts,
while eTh1 extracts contained greater levels of ATF2 protein (Fig. 7
C). Levels of ATF1/CREB were reproducibly lower in eTh2
cells than in eTh1 cells and were markedly lower than in pTh cells.
|
| Discussion |
|---|
|
|
|---|
gene regulation
during Th cell differentiation, we have prepared reporter transgenic
mice that express the luciferase gene under the control of two critical
promoter elements from the IFN-
gene: prox.IFN-
(-70
to -44 bp) and dist.IFN-
(-98 to -78 bp) (36). We
previously showed that the regulation of these promoter elements in
transgenic T cells recapitulates distinct aspects of regulated IFN-
gene expression during differentiation of Th cells from naive to
effector status (36).
To uncover mechanistic differences that may explain changes in
transcription during Th cell differentiation, we have intercrossed
luc-reporter transgenic mice with transgenic mice that express a single
MHC class II-restricted TCR specific for a Cyt c peptide.
Because this transgene molds a T cell repertoire with >95% Cyt
c-specific T cells and minimizes the representation of T
cells with the memory phenotype, we could investigate the induction of
IFN-
gene transcription starting from a precursor population in
which virtually all activity derived from naive phenotype cells. The
efficiency of this strategy can be assessed on the basis of cytokine
production profiles after initial stimulation (Fig. 1
). Thus, as
observed by others, the production of effector cytokines (IFN-
and
IL-4) was almost undetectable after primary stimulation using peptide
and APCs. Accordingly, any contribution of pre-existing Ag-experienced,
memory phenotype cells to luciferase activity would be modest and
outweighed by the pTh cells. Consistent with this point, naive T cells
(CD44low, CD45Rbhigh), purified by flow
cytometry, do not express prox.IFN-
or
dist.IFN-
activity following activation by anti-CD3,
and memory T cells (CD44high, CD45Rblow) do
express prox.IFN-
and dist.IFN-
activities following identical stimulation (36).
Our results show the following. 1) The pTh cells do not express
promoter activity, while the eTh cells express promoter activity
following identical Ag stimulation. 2) T cell differentiation results
in profound shifts in the nuclear proteins that bind
prox.IFN-
and dist.IFN-
promoter
elements. 3) Shifts in nuclear protein binding and shifts in
transcriptional activity result at least in part from the loss of
CREB/ATF1 during eTh cell differentiation from pTh cells. 4) Selective
eTh1 differentiation induced by IL-12 priming leads to enhanced
dist.IFN-
activity, but not prox.IFN-
activity, following Ag rechallenge and leads to enhanced formation of
Jun/ATF2 heterodimer-dist.IFN-
complexes. Thus, the loss
of inhibitory mechanisms as well as the gain of stimulatory mechanisms
contribute to changes in gene regulation during Th cell
differentiation.
Differentiation of naive T cells into populations of eTh1 and eTh2
cells probably represents a multistep process that begins with the
initial activation of naive T cells by Ag. Prox.IFN-
and
dist.IFN-
activities reflect this differentiation
process, since neither is expressed in pTh cells but both activities
are expressed in eTh cells. This induction of transcriptional activity
is accompanied by a shift in the proteins that bind these elements. In
pTh cells, the predominant proteins that bind prox.IFN-
and dist.IFN-
are CREB-ATF1 proteins. In contrast, in
eTh cells, Jun/ATF2 proteins are the predominant
dist.IFN-
binding proteins; eTh nuclear extracts also
form unique complexes with prox.IFN-
, reflected by a
decrease in CREB/ATF1 binding and a marked increase in an unidentified
complex. Transient transfection studies show that overexpression of
CREB inhibits the activities of both prox.IFN-
and
dist.IFN-
as well as IFN-
production. In addition,
there is an absolute drop in CREB/ATF1 levels that accompanies T cell
differentiation. Taken together, these studies suggest that high levels
of CREB/ATF1 proteins inhibit prox.IFN-
,
dist.IFN-
, and IFN-
transcriptional activity in
Ag-activated pTh cells, and that the loss of CREB/ATF1 during eTh
differentiation contributes to the absolute change in the activities of
these regulatory elements and in IFN-
gene expression.
The above model is further supported by a comparison of these data with
the binding and promoter activities of a TRE element
(12-O-tetraphorbol 12-myristate 13-acetate response
element) from the collagenase promoter (20, 35) in a similar
experimental system. This TRE element binds AP-1 transcription factors
but does not bind CREB-ATF1 transcription factors, and similar levels
of AP-1 binding and transcriptional activity are observed in
Ag-activated pTh cells and eTh1 cells. AP-1 binding sites have also
been identified in the IL-2 and IL-4 promoters. However, only AP-1
binding sites from the IFN-
promoter also bind CREB/ATF1. Moreover,
it has been shown that CREB can inhibit Jun-mediated transcription by
competing for the same cis-acting elements (47). This
suggests that the IFN-
gene employs transcriptional elements with
overlapping stimulatory/inhibitory sites. This could permit blockade of
IFN-
promoter activity in pTh cells (through CREB-ATF1 binding) and
expression of AP-1 activity in, for example, the IL-2 promoter (which
lacks CREB-ATF1 sites). The extent to which these regulatory features
of transcriptional elements that bind both stimulatory and inhibitory
transcription factors to control promoter activity are employed by
other cytokine genes remains to be determined.
The data are also consistent with a second (and not mutually exclusive)
possibility, which is that increased phosphorylation of Jun and ATF2
proteins, or other post-translational modifications, in effector
populations may contribute to increased dist.IFN-
promoter activity. Indeed, predominant ATF-CREB complexes are formed
between dist.IFN-
and nuclear extracts from unstimulated
Jurkat cells, while predominant AP-1 complexes are formed between
dist.IFN-
and nuclear extracts from Jurkat cells that
are stimulated with PMA and ionomycin (27). These stimulation
conditions also activate JNK, which, in turn, phosphorylates both c-Jun
and JunD (48). However, eTh1 and pTh cells have similar levels of JNK
activity, which are greater than that found in eTh2 cells (20). These
observations suggest that increased JNK activity alone is not
responsible for the shift in AP-1 binding activity and increased
trans-activation of dist.IFN-
in effector Th1
populations. However, alterations in the activities of other protein
kinases that phosphorylate Jun family members, such as p38, which is
also selectively expressed in eTh1 rather than eTh2 cells (49), in the
absence of changes in the levels of Jun proteins may contribute to the
increased transcriptional activity directed by dist.IFN-
in eTh1 cell populations.
In addition, the activity of dist.IFN-
is significantly
enhanced by stimulation of selective eTh1 development by IL-12 priming.
IL-12 priming also results in an increase in the formation of
Jun/ATF2-dist.IFN-
complexes by eTh1 cell nuclear
extracts in gel mobility shift assays. Increased formation of
Jun/ATF2-dist.IFN-
complexes and increased
dist.IFN-
activity may result from changes in the level
of ATF2 protein as well as from increased post-translational
modification. The activities of certain p38 isoforms, enzymes known to
phosphorylate ATF2, are greater in eTh1 cells than in eTh2 cells or pTh
cells (49). Mechanistically, it is not entirely clear how addition of
IL-12 to pTh cells results in these changes observed in eTh1 cells.
However, by focusing on mechanisms that regulate
dist.IFN-
activity and the formation of
Jun/ATF2-dist.IFN-
complexes, it should be possible to
link IL-12 priming of pTh cells to expression of eTh1 function.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Thomas M. Aune, MCN T3219, Vanderbilt University Medical Center, 21st and Garland, Nashville, TN 37232. E-mail address: ![]()
3 Abbreviations used in this paper: eTh, effector T helper cells; pTh, precursor T helper cells; AP-1, activating protein-1; CREB-ATF1, cyclic adenosine 3',5'-monophosphate response element binding protein-activation transcription factor-1; prox.IFN-
, proximal element (-70 to -44 base pairs) of the interferon-
promoter; dist.IFN-
, distal element (-98 to -78 base pairs) of the interferon-
promoter; Cyt c, cytochrome c; EMSA, electrophoretic mobility shift assay; CRE, cyclic adenosine 3',5'-monophosphate response element; TRE, TPA response element. ![]()
Received for publication May 14, 1998. Accepted for publication July 29, 1998.
| References |
|---|
|
|
|---|
ß-T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. USA 89:6065.
production and diminishes interleukin 4 inhibition of such priming. Proc. Natl. Acad. Sci. USA 90:10188.
ß-transgenic model. J. Exp. Med. 182:1579.
production. J. Exp. Med. 179:299.
(IFN-
) promoter by glucocorticoids and dominant-negative mutants of c-Jun. J. Biol. Chem. 270:12548.
promoter mediates selective expression in T cells. J. Biol. Chem. 271:31964.
-producing T cells studied by lineage ablation of IL-4-producing cells. Cell 75:985.[Medline]
-producing CD4 T cells following activation of naive CD4 T cells. J. Immunol. 158:1085.[Abstract]
promoter elements in naive and memory (effector) CD4 T cells, and CD8 T cells. Mol. Cell. Biol. 17:199.[Abstract]
promoter confer activation specific expression in T cells. J. Exp. Med. 178:1483.
expression by Th1 effector T cells mediated by the p38 MAP kinase signaling pathway. EMBO J. 17:2817.[Medline]
This article has been cited by other articles:
![]() |
X. Wang, P. F. Barnes, K. M. Dobos-Elder, J. C. Townsend, Y.-t. Chung, H. Shams, S. E. Weis, and B. Samten ESAT-6 Inhibits Production of IFN-{gamma} by Mycobacterium tuberculosis-Responsive Human T Cells J. Immunol., March 15, 2009; 182(6): 3668 - 3677. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Samten, J. C. Townsend, S. E. Weis, A. Bhoumik, P. Klucar, H. Shams, and P. F. Barnes CREB, ATF, and AP-1 Transcription Factors Regulate IFN-{gamma} Secretion by Human T Cells in Response to Mycobacterial Antigen J. Immunol., August 1, 2008; 181(3): 2056 - 2064. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Rosenberger, A. E. Clark, P. M. Treuting, C. D. Johnson, and A. Aderem ATF3 regulates MCMV infection in mice by modulating IFN-{gamma} expression in natural killer cells PNAS, February 19, 2008; 105(7): 2544 - 2549. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Samten, S. T. Howard, S. E. Weis, S. Wu, H. Shams, J. C. Townsend, H. Safi, and P. F. Barnes Cyclic AMP Response Element-Binding Protein Positively Regulates Production of IFN-{gamma} by T Cells in Response to a Microbial Pathogen J. Immunol., May 15, 2005; 174(10): 6357 - 6363. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-Y. Chau, A. M. Keane-Myers, M. Fedele, Y. Ikeda, R. J. Creusot, L. Menozzi, D. J. Cousins, G. Manfioletti, L. Feigenbaum, A. Fusco, et al. IFN-{gamma} gene expression is controlled by the architectural transcription factor HMGA1 Int. Immunol., March 1, 2005; 17(3): 297 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Bream, D. L. Hodge, R. Gonsky, R. Spolski, W. J. Leonard, S. Krebs, S. Targan, A. Morinobu, J. J. O'Shea, and H. A. Young A Distal Region in the Interferon-{gamma} Gene Is a Site of Epigenetic Remodeling and Transcriptional Regulation by Interleukin-2 J. Biol. Chem., September 24, 2004; 279(39): 41249 - 41257. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Cunard, Y. Eto, J. T. Muljadi, C. K. Glass, C. J. Kelly, and M. Ricote Repression of IFN-{gamma} Expression by Peroxisome Proliferator-Activated Receptor {gamma} J. Immunol., June 15, 2004; 172(12): 7530 - 7536. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, R. A. Barke, R. Charboneau, H. H. Loh, and S. Roy Morphine Negatively Regulates Interferon-{gamma} Promoter Activity in Activated Murine T Cells through Two Distinct Cyclic AMP-dependent Pathways J. Biol. Chem., September 26, 2003; 278(39): 37622 - 37631. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Samten, B. Wizel, H. Shams, S. E. Weis, P. Klucar, S. Wu, R. Vankayalapati, E. K. Thomas, S. Okada, A. M. Krensky, et al. CD40 Ligand Trimer Enhances the Response of CD8+ T Cells to Mycobacterium tuberculosis J. Immunol., March 15, 2003; 170(6): 3180 - 3186. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Soutto, F. Zhang, B. Enerson, Y. Tong, M. Boothby, and T. M. Aune A Minimal IFN-{gamma} Promoter Confers Th1 Selective Expression J. Immunol., October 15, 2002; 169(8): 4205 - 4212. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Samten, P. Ghosh, A.-K. Yi, S. E. Weis, D. L. Lakey, R. Gonsky, U. Pendurthi, B. Wizel, Y. Zhang, M. Zhang, et al. Reduced Expression of Nuclear Cyclic Adenosine 5'-Monophospate Response Element-Binding Proteins and IFN-{gamma} Promoter Function in Disease Due to an Intracellular Pathogen J. Immunol., April 1, 2002; 168(7): 3520 - 3526. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Gudmundsdottir and L. A. Turka A Closer Look at Homeostatic Proliferation of CD4+ T Cells: Costimulatory Requirements and Role in Memory Formation J. Immunol., October 1, 2001; 167(7): 3699 - 3707. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kanda and S. Watanabe Gangliosides GD1b, GT1b, and GQ1b Enhance IL-2 and IFN-{{gamma}} Production and Suppress IL-4 and IL-5 Production in Phytohemagglutinin-Stimulated Human T Cells J. Immunol., January 1, 2001; 166(1): 72 - 80. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-T. Yu, H.-m. Shih, and M.-Z. Lai Multiple Signals Required for Cyclic AMP-Responsive Element Binding Protein (CREB) Binding Protein Interaction Induced by CD3/CD28 Costimulation J. Immunol., January 1, 2001; 166(1): 284 - 292. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goodbourn, L. Didcock, and R. E. Randall Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures J. Gen. Virol., October 1, 2000; 81(10): 2341 - 2364. [Full Text] |
||||
![]() |
F. Zhang, M. Rincon, R. A. Flavell, and T. M. Aune Defective Th Function Induced by a Dominant-Negative cAMP Response Element Binding Protein Mutation Is Reversed by Bcl-2 J. Immunol., August 15, 2000; 165(4): 1762 - 1770. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Kalina, D. Kauschat, N. Koyama, H. Nuernberger, K. Ballas, S. Koschmieder, G. Bug, W.-K. Hofmann, D. Hoelzer, and O. G. Ottmann IL-18 Activates STAT3 in the Natural Killer Cell Line 92, Augments Cytotoxic Activity, and Mediates IFN-{gamma} Production by the Stress Kinase p38 and by the Extracellular Regulated Kinases p44erk-1 and p42erk-21 J. Immunol., August 1, 2000; 165(3): 1307 - 1313. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. Glimcher and K. M. Murphy Lineage commitment in the immune system: the T helper lymphocyte grows up Genes & Dev., July 15, 2000; 14(14): 1693 - 1711. [Full Text] |
||||
![]() |
F. Zhang, T. Nakamura, and T. M. Aune TCR and IL-12 Receptor Signals Cooperate to Activate an Individual Response Element in the IFN-{gamma} Promoter in Effector Th Cells J. Immunol., July 15, 1999; 163(2): 728 - 735. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Aune, A. L. Mora, S. Kim, M. Boothby, and A. H. Lichtman Costimulation Reverses the Defect in IL-2 But Not Effector Cytokine Production by T Cells with Impaired I{kappa}B{alpha} Degradation J. Immunol., May 15, 1999; 162(10): 5805 - 5812. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.A. FLAVELL, B. LI, C. DONG, H.-T. LU, D. D. YANG, H. ENSLEN, C. TOURNIER, A. WHITMARSH, M. WYSK, D. CONZE, et al. Molecular Basis of T-cell Differentiation Cold Spring Harb Symp Quant Biol, January 1, 1999; 64(0): 563 - 572. [Abstract] [PDF] |
||||
![]() |
I.-C. HO, J.I. KIM, S.J. SZABO, and L.H. GLIMCHER Tissue-specific Regulation of Cytokine Gene Expression Cold Spring Harb Symp Quant Biol, January 1, 1999; 64(0): 573 - 584. [Abstract] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |