The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahn, H.-J.
Right arrow Articles by Fujiwara, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahn, H.-J.
Right arrow Articles by Fujiwara, H.
The Journal of Immunology, 1998, 161: 5893-5900.
Copyright © 1998 by The American Association of Immunologists

Requirement for Distinct Janus Kinases and STAT Proteins in T Cell Proliferation Versus IFN-{gamma} Production Following IL-12 Stimulation1

Hyun-Jong Ahn, Michio Tomura, Wen-Gong Yu, Masayuki Iwasaki, Woong-Ryeon Park, Toshiyuki Hamaoka and Hiromi Fujiwara2

Biomedical Research Center, Osaka University Medical School, Yamada-oka, Suita, Osaka, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
While IL-12 is known to activate JAK2 and TYK2 and induce the phosphorylation of STAT4 and STAT3, little is known regarding how the activation of these signaling molecules is related to the biologic effects of IL-12. Using an IL-12-responsive T cell clone (2D6), we investigated their requirements for proliferation and IFN-{gamma} production of 2D6 cells. 2D6 cells could be maintained with either IL-12 or IL-2. 2D6 lines maintained with IL-12 (2D6IL-12) or IL-2 (2D6IL-2) exhibited comparable levels of proliferation, but produced large or only small amounts of IFN-{gamma}, respectively, when restimulated with IL-12 after starvation of either cytokine. 2D6IL-12 induced TYK2 and STAT4 phosphorylation. In contrast, their phosphorylation was marginally induced in 2D6IL-2. The reduced STAT4 phosphorylation was due to a progressive decrease in the amount of STAT4 protein along with the passages in IL-2-containing medium. 2D6IL-12 and 2D6IL-2 similarly proliferating in response to IL-12 induced comparable levels of JAK2 activation and STAT5 phosphorylation. JAK2 was associated with STAT5, and IL-12-induced STAT5 phosphorylation was elicited in the absence of JAK3 activation. These results indicate that IL-12 has the capacity to induce/maintain STAT4 and STAT5 proteins, and that TYK2 and JAK2 activation correlate with STAT4 phosphorylation/IFN-{gamma} induction and STAT5 phosphorylation/cellular proliferation, respectively.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-12 plays a central role in the initiation and regulation of cell-mediated immune responses through exerting a number of effects on T and NK cells (1, 2). For example, IL-12 induces the production of a representative inflammatory cytokine, IFN-{gamma}, by T cells and NK cells (3, 4), and supports the growth (5, 6) and enhances the cytolytic activity of both cell types (3, 7). Together with the effect on the differentiation of naive CD4+ T cells toward the Th1 phenotype (8, 9), IL-12 promotes induction of cell-mediated immunity.

Despite the importance of IL-12 functions, the molecular mechanisms through which this cytokine exerts its biologic effects are poorly understood. Recent studies have revealed that a functional IL-12R complex is composed of two ß-type cytokine receptor subunits (10). Cytokine receptors lacking intrinsic tyrosine kinase activity induce rapid tyrosine phosphorylation of signaling proteins through association with members of the Janus (JAK)3 family of protein tyrosine kinases (11, 12). Like other cytokine receptors, the stimulation of IL-12R with IL-12 was shown to result in the activation of two JAK family members, JAK2 and TYK2 (13). Activation of JAKs leads to the tyrosine phosphorylation of a family of STATs that are important in the regulation of gene expression by cytokine receptors (14, 15). Accordingly, IL-12 was found to induce the tyrosine phosphorylation of two STAT family members, STAT3 and STAT4, defining the components of the JAK-STAT signaling pathway activated through IL-12R (16, 17). Both TYK2 and JAK2 have been shown to be involved in the signal transduction via other cytokine receptors, including the IFN (18, 19), IL-6 (20), and IL-3/granulocyte-macrophage CSF (21, 22) cytokine families. While simultaneous activation of TYK2 and JAK2 is induced in IL-12R signaling, the relative requirements for these two JAKs in the phosphorylation of STATs and the expression of various IL-12 bioactivities remain to be investigated.

In the present study, we investigated, using an IL-12-responsive T cell clone (2D6), the requirements for the components of the JAK-STAT signaling pathway in the two IL-12 bioactivities, T cell proliferation and IFN-{gamma} production. 2D6 could be maintained with either IL-12 (2D6IL-12) or IL-2 (2D6IL-2). 2D6IL-12 and 2D6IL-2 lines exhibited comparable levels of proliferation, but high and low levels of IFN-{gamma} production, respectively, in response to IL-12. In contrast to phosphorylation of TYK2 and STAT4 in 2D6IL-12, the phosphorylation levels were only marginal in 2D6IL-2. The reduced STAT4 activation was due largely to a decrease in the amount of STAT4 protein. The two 2D6 lines capable of proliferating in response to IL-12 exhibited comparable levels of JAK2 activation and STAT5 phosphorylation. The phosphorylation of STAT5 associated with JAK2 was found to be induced in the absence of JAK3 activation. These results indicate that IL-12 has the capacity to induce/maintain STAT4 and STAT5, and that TYK2 activation is associated with STAT4 phosphorylation leading to IFN-{gamma} induction, while JAK2 activation correlates with STAT5 phosphorylation and cellular proliferation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell line

The IL-12-responsive T cell clone, 2D6, was established by maintaining alloreactive 4-86 Th cells in the presence of rIL-12 alone without stimulation with allogeneic APCs (23). 2D6 exhibited high levels of proliferation in response to as little as 1 pg/ml of rIL-12. 2D6 cells maintained with rIL-12 (250 pg/ml) were used after intensive washing, as the standard IL-12-dependent 2D6. In some experiments, 2D6, which were maintained with rIL-2 (50 U/ml) instead of rIL-12 for 1–20 passages, were used as an IL-2-supported subline. This subline was designated 2D6IL-2, and the standard line was designated 2D6IL-12 for distinction.

Reagents

Murine rIL-12 and rIL-2 were kindly provided by Genetics Institute (Cambridge, MA) and Shionogi (Osaka, Japan), respectively. The following polyclonal rabbit antisera and mAb were purchased: polyclonal anti-JAK2, anti-TYK2, anti-STAT3, anti-STAT4, and anti-STAT5 antisera (both anti-STAT5a/b and anti-STAT5a) were from Santa Cruz Biotechnology (Santa Cruz, CA); polyclonal rabbit anti-JAK1 and anti-JAK3 antisera were from Upstate Biotechnology (Lake Placid, NY); and anti-phosphotyrosine mAb (PY20) was from Transduction Laboratories (Lexington, KY).

Immunoprecipitation and immunoblotting

Stimulated cells were washed before being lysed in buffer containing 1% Triton X-100 and 0.5% Nonidet P-40. Lysates were immunoprecipitated with anti-JAK1, anti-JAK2, anti-TYK2, anti-JAK3, anti-STAT3, anti-STAT4, or anti-STAT5 antisera conjugated to protein A-coupled Sepharose beads. The immunoprecipitates were resolved on 7.5% SDS-polyacrylamide gels and transferred to Immobilon (Millipore, Bedford, MA).

For immunoblotting with anti-phosphotyrosine mAb, membranes were blocked in Tris-buffered saline (TBS) containing 1% fish gelatin, 5% BSA, and 0.1% Tween-20, and sequentially incubated with anti-phosphotyrosine mAb and horseradish peroxidase-conjugated sheep anti-mouse IgG F(ab')2 (Amersham, Arlington Heights, IL). Detection was performed by use of enhanced chemoluminescence (ECL; Amersham).

For immunoblotting with Abs to JAK family kinases or STAT proteins, membranes were blocked in TBS containing 0.1% Tween 20 and 5% BSA, incubated sequentially with primary Ab and horseradish peroxidase-conjugated donkey anti-rabbit IgG F(ab')2 (Amersham), and detected with ECL. When a membrane was reprobed, it was first treated in reducing SDS buffer (100 mM 2-ME, 2% SDS, 62.5 mM Tris-HCl, pH 6.7).

Proliferation of 2D6 cells

2D6 cells (1.5 or 2 x 104/well) were cultured with various doses of rIL-12 for 2 days in 96-well flat-bottom microculture plates (Corning 25860; Corning Glass Works, Corning, NY). Cells were harvested after a final 6-h pulse with 20 kBq/well of [3H]TdR. Results were calculated from [3H]TdR uptake and expressed as mean cpm (±SE) of triplicate cultures.

IFN-{gamma} production by 2D6 cells

2D6 cells (2 x 105/well) were cultured with various doses of rIL-12 in 24-well culture plates (Corning 25820). After 24 h, supernatants were harvested and stored at -20°C until use.

Measurement of IFN-{gamma} concentration

IFN-{gamma} concentration was measured by ELISA: mouse IFN-{gamma} ELISA kits were purchased from Genzyme (Cambridge, MA), and our own ELISA system was prepared using two types of anti-mouse IFN-{gamma} mAb (XMG1.2 (Endogen, Cambridge, MA)) and biotinylated R4-6A2 (R4-6A2 was purified from R4-6A2 hybridoma and biotinylated in our laboratory) as well as mouse rIFN-{gamma} provided from Shionogi. A quantity amounting to 1 U/ml in our ELISA system corresponded to approximately 100 pg/ml in Genzyme ELISA kits.

cDNA probes for IL-12R ß1 and ß2 subunits

cDNA probes for IL-12R ß-chains (IL-12Rß1 and IL-12Rß2) were cloned from murine whole spleen cells. Total RNA was isolated from murine whole spleen cells that were treated for 48 h with 2 µg/ml Con A. This RNA was then used as a template for first-strand cDNA synthesis. The mouse IL-12R cDNA fragments were cloned from this cDNA by use of Taq DNA polymerase, standard PCR conditions, a 5'-sense oligonucleotide GTTGAGAAGACATCGTTCCC, and a 3'-antisense oligonucleotide TCCAGTTGTACAGGTACTGG based on sequence 152–171 and 475–494, respectively, from the sequence of mouse IL-12Rß1 (24) as well as a 5'-sense oligonucleotide TGAAATCAGGGTGCATGCAC, and a 3'-antisense oligonucleotide GTTTGCTGGATCTGGAATGG based on sequence 1668–1687 and 2177–2196, respectively, from the sequence of mouse IL-12Rß2 (10). The PCR products were purified by agarose gel electrophoresis and ligated to the vector as described (25). Briefly, Bluescript (Stratagene, La Jolla, CA) plasmid was digested with EcoRV and incubated with Taq polymerase with the use of standard buffer conditions in the presence of 2 mM dTTP for 2 h at 70°C. After phenol extraction and precipitation, the T vector was ready for cloning. PCR products were then ligated to the vector.

Measurement of mRNA expression

Total cellular RNA was isolated by the acid guanidium thiocyanate-phenol-chloroform method, and mRNA levels were determined using the RNase protection assay, according to the procedure as described (26). Briefly, 10 µg of total cellular RNA was hybridized in solution to a 32P-labeled antisense riboprobe for 16 h at 50°C in 80% formamide. The riboprobe prepared from the IL-12Rß1 or IL-12Rß2 plasmid was linearized with HindIII (IL-12Rß1) or PvuII (IL-12Rß2), and in vitro transcription was initiated in the presence of [{alpha}-32P]UTP. The protected fragment (343 bp for IL-12Rß1, and 208 bp for IL-12Rß2) was separated on a denaturing sequencing gel, followed by autoradiography. As an internal control for the amount of RNA loaded onto the gel, RNA was simultaneously hybridized to antisense 32P-labeled probe for the ß2-microglobulin gene, which yielded a 127-bp protected fragment.

Immunofluorescence and flow cytometry

The detection of IL-12R was performed as previously described (23). Briefly, 2D6 cells (1 x 106) were incubated with 7.5 ng of rIL-12 in 10 µl medium for 60 min at 4°C. Cells were washed and then incubated with 1 µg of rat anti-mouse IL-12 mAb (C17.8) for 30 min at 4°C. After washing, cells were allowed to react with 0.1 µg of biotinylated mouse anti-rat IgG, followed by incubation with phycoerythrin-conjugated streptavidin. Stained cells were analyzed with a FACSCalibur (Becton Dickinson, San Jose, CA).

Nuclear extract preparation and electrophoretic mobility shift assay (EMSA)

Nuclear extracts were prepared essentially as described previously (27), except that the following buffers were used. After washing with PBS, cells were resuspended in 50 mM HEPES (pH 7.5), 100 mM sodium fluoride, 10 mM sodium pyrophosphate, 2 mM sodium o-vanadate, 2 mM sodium molybdate, 2 mM EDTA (HEPES buffer) supplemented with 0.2% Nonidet P-40, 10 mM magnesium chloride, 10 µg/ml aprotinin, 2 µg/ml leupeptin, and 2 mM Pefabloc (Boehringer Mannheim, Indianapolis, IN). After 1 min on ice, the nuclei were pelleted and washed in the same buffer, but without Nonidet P-40. The nuclei were again pelleted and then extracted with vigorous agitation at 4°C in HEPES buffer containing 0.1% Nonidet P-40, 0.3 M sodium chloride, 10% glycerol, and protease inhibitors, as above.

Mobility shift assays were performed in a total volume of 20 µl in the following buffer: 10 mM HEPES-NaOH (pH 7.9), 1 mM EDTA, 30 mM NaCl, 0.5 mM magnesium chloride, 0.1% Nonidet P-40, 1 mM DTT, 1 mg/ml BSA, and 10% glycerol. Each reaction, also containing 1 µg of poly(dI-dC) and 10 fmol of 32P end-labeled probe, was initiated by the addition of 10 µg of nuclear extract and allowed to incubate at room temperature for 30 min before electrophoretic analysis on a 5% polyacrylamide gel in 0.25x TBE (Tris-borate/EDTA) buffer.

The following oligonucleotide probes were purchased from Santa Cruz Biotechnology: STAT4, 5'-GAGCCTGATTTCCCCGAAATGATGAGC-3' (28), and STAT5, 5'-AGATTTCTAGGAATTCAATCC-3' (29).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tyrosine phosphorylation of TYK2/JAK2 and STAT3/STAT4 induced in 2D6IL-12 cells following IL-12 stimulation

IL-12 has been shown to induce tyrosine phosphorylation of TYK2/JAK2 and STAT3/STAT4 among the JAK and STAT family members, respectively (13, 16, 17). We examined whether this is also the case with cells of an IL-12-responsive T cell clone, 2D6. 2D6 cells harvested from cultures maintained with IL-12 (2D6IL-12) were starved of IL-12 for 24 h and restimulated with IL-12. Lysates prepared from these 2D6IL-12 cells were immunoprecipitated with antisera against TYK2 or JAK2. Immunoprecipitates were resolved by SDS-PAGE and analyzed by anti-phosphotyrosine immunoblotting. As shown in Fig. 1GoA (upper panels), TYK2 and JAK2 from IL-12-stimulated 2D6 cells were phosphorylated on tyrosine residues, whereas those from cells unstimulated or stimulated with IL-2 were not. The same blot was stripped of detecting Ab and reprobed with antisera against TYK2 and JAK2 to confirm equal loading of kinases on each lane (Fig. 1GoA, lower panels).



View larger version (72K):
[in this window]
[in a new window]
 
FIGURE 1. Tyrosine phosphorylation of TYK2 and JAK2 in 2D6 cells following IL-12 stimulation. 2D6 cells harvested from cultures containing IL-12 (2D6IL-12) were starved of IL-12 for 24 h. A, Cells were untreated or treated with 250 pg/ml rIL-12 or 50 U/ml rIL-2 for 10 min. Cell lysates were immunoprecipitated with antiserum against either TYK2 or JAK2, immunoblotted with anti-phosphotyrosine mAb (upper panels), and then stripped and reblotted with anti-TYK2 or anti-JAK2 antiserum (lower panel). B, Cells were untreated or treated with either 250 pg/ml rIL-12 or 50 U/ml rIL-2 for 10 min. Cell lysates were immunoprecipitated with antiserum against either JAK1, JAK2, TYK2, or JAK3, and blotted with anti-phosphotyrosine mAb. The results are a representative of three similar experiments.

 
2D6 can also proliferate in response to IL-2 (23). Our previous study indicated that IL-12-induced proliferation of 2D6 cells is not due to the induction of an IL-2 autocrine mechanism, but is independent of IL-2, because the proliferation was not inhibited by anti-IL-2 mAb (23) and neither IL-2 bioactivity nor mRNA was detected in IL-12-stimulated 2D6 cells (our unpublished observations). Consistent with this, IL-12 did not induce the phosphorylation of JAK kinases as seen after IL-2 stimulation (Fig. 1GoB): IL-2 induces the phosphorylation of JAK1 and JAK3 in 2D6 cells, as described for other studies (30), whereas IL-12 stimulation failed to cause the phosphorylation of JAK1 and JAK3.

We also confirmed the phosphorylation of STAT proteins in 2D6 cells. Fig. 2Go shows that IL-12, but not IL-2, induces tyrosine phosphorylation of STAT3 and STAT4. Together, the results indicate that IL-12 activates the thus far described components of the JAK-STAT signaling pathway in 2D6 cells.



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 2. Tyrosine phosphorylation of STAT3 and STAT4 in 2D6 cells following IL-12 stimulation. 2D6IL-12 prepared after starvation of IL-12 were untreated or treated with 250 pg/ml rIL-12 or 50 U/ml rIL-2 for 10 min. Lysates were immunoprecipitated with antiserum to STAT3 or STAT4 and blotted with anti-phosphotyrosine mAb. The results are a representative of two similar experiments.

 
Both 2D6IL-12 and 2D6IL-2 express IL-12R ß1 and ß2 subunits and exhibit comparable levels of proliferation in response to IL-12

2 D6 cells could be maintained in cultures containing rIL-2 instead of rIL-12, yielding the IL-2-supported 2D6 subline (2D6IL-2). We examined the expression of IL-12R on this 2D6IL-2 subline as well as the standard 2D6 cells maintained with IL-12 (2D6IL-12). The mRNA expression of IL-12R ß1 and ß2 subunits was assessed by the RNase protection assay. Fig. 3GoA shows that both 2D6 lines express the two IL-12R subunits, although there are some differences in the mRNA levels of ß1 and ß2 subunits between the two 2D6 lines. IL-12R levels were also assessed by incubating 2D6 cells with rIL-12 and then staining them by immunofluorescence with anti-IL-12 mAb, as described (23, 31). Comparable levels of IL-12R were detected on 2D6IL-12 and 2D6IL-2 by flow cytometry analyses, which is consistent with our previous observations (31). We next compared the IL-12 responsiveness of two 2D6 lines, 2D6IL-12 and 2D6IL-2, in proliferation assays. Fig. 4Go shows that these two lines proliferated similarly in response to IL-12, which is accordant with the data for comparable levels of IL-12R expression on both lines.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 3. 2D6IL-12 and 2D6IL-2 express comparable levels of IL-12R. 2D6IL-2 cells were obtained from cultures after seven passages in IL-2-containing medium. A, Total RNA was isolated from 2D6IL-12 and 2D6IL-2 and subjected to the RNase protection assay. Ten micrograms of RNA were used for hybridization. The results are a representative of two similar experiments. B, 2D6 cells were incubated with rIL-12 and then stained by immunofluorescence with rat anti-IL-12 mAb or control rat IgG. The results are a representative of three similar experiments.

 


View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 4. Comparable levels of proliferation of 2D6IL-12 and 2D6IL-2 cells following IL-12 stimulation. 2D6IL-2 cells were obtained from cultures after 7 (Expt. 1) or 14 passages (Expt. 2) in IL-2-containing medium. 2D6IL-12 and 2D6IL-2 cells (1.5 x 104/well in Expt. 1, or 2 x 104/well in Expt. 2) were stimulated with indicated doses of rIL-12 for 24 h (left panels) or 48 h (right panels) in 96-well microculture plates and pulse labeled with 20 kBq/well of [3H]TdR for the final 6 h.

 
Comparison of tyrosine phosphorylation of JAK kinases between 2D6IL-12 and 2D6IL-2 stimulated with IL-12

We compared the activation of TYK2 and JAK2 between 2D6IL-12 and 2D6IL-2 following IL-12 stimulation. As shown in Fig. 5Go, IL-12 stimulation caused increased tyrosine phosphorylation of JAK2 protein in both 2D6IL-12 and 2D6IL-2 cells. The appreciably larger amount of JAK2 protein and higher level of JAK2 phosphorylation were observed for 2D6IL-2 compared with those in 2D6IL-12, which was consistently observed. In contrast, the phosphorylation of TYK2 was induced in 2D6IL-12 cells, but was hardly detectable in 2D6IL-2 cells. This was the case under conditions in which comparable amounts of TYK2 protein were present in both cell types.



View larger version (68K):
[in this window]
[in a new window]
 
FIGURE 5. Tyrosine phosphorylation of JAK2/Tyk2 in 2D6IL-12 and 2D6IL-2 following IL-12 stimulation. 2D6IL-12 and 2D6IL-2 cells (7 passages with IL-2) obtained after cytokine starvation were stimulated with rIL-12. Cells were harvested 10 min after IL-12 stimulation. Lysates were immunoprecipitated with antiserum to JAK2 or Tyk2 and blotted with anti-phosphotyrosine mAb. The same blots were reprobed with antisera to JAK2/Tyk2. The results are representative of three similar experiments.

 
Comparison of tyrosine phosphorylation of STAT proteins between 2D6IL-12 and 2D6IL-2 stimulated with IL-12

We also compared the activation of STAT3 and STAT4 between 2D6IL-12 and 2D6IL-2 following IL-12 stimulation. As shown in Fig. 6Go, 2D6IL-12 cells contain STAT3 and STAT4 proteins. The phosphorylation of STAT3 and STAT4 was again observed in 2D6IL-12 cells stimulated with IL-12. Fig. 6Go further shows that the phosphorylation of STAT3 is induced more potently in 2D6IL-2 than in 2D6IL-12 cells. In contrast, the phosphorylation of STAT4 in 2D6IL-2 was very weak compared with that in 2D6IL-12. We examined the DNA-binding activity of activated STAT4 by the EMSA. Nuclear extracts were prepared from 2D6IL-12 and 2D6IL-2 unstimulated or stimulated with IL-12 and examined for binding to an oligonucletide probe corresponding to a consensus binding site for STAT4 (28). As shown in Fig. 7GoA, nuclear extracts from IL-12-stimulated 2D6IL-12 cells contained proteins that bound to the STAT4-related sequence. This gel-shift band was not observed in the presence of an excess of unlabeled probe. The IL-12-induced DNA-protein complex was only marginally observed for extracts from IL-12-stimulated 2D6IL-2 or unstimulated 2D6IL-12 or 2D6IL-2. Together, these observations demonstrate that STAT4 activation and STAT4 DNA-binding activity are induced only in 2D6IL-12 following IL-12 stimulation. It should also be noted that the amount of STAT4 protein was found to be decreased in 2D6IL-2. This indicates a quantitative change selective to STAT4 because the amounts of STAT3 protein in the same lysates were comparable between 2D6IL-12 and 2D6IL-2.



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 6. Tyrosine phosphorylation of STAT3 and STAT4 in 2D6IL-12 and 2D6IL-2 following IL-12 stimulation. Portions of the same lysates as those from cells used in Fig. 5Go were immunoprecipitated with antiserum to STAT3 or STAT4 and blotted with anti-phosphotyrosine mAb, and then reprobed with antiserum to STAT3/STAT4.

 


View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 7. The binding of nuclear extracts from IL-12- or IL-2-stimulated 2D6IL-12 or 2D6IL-2 cells to the STAT4- or STAT5-related sequence. Nuclear extracts were prepared from IL-12- or IL-2-stimulated 2D6IL-12 or 2D6IL-2 cells. An EMSA was done using an oligonucleotide corresponding the STAT4 (A) or STAT5 (B) DNA-binding sequence. Lanes 5 (A) and 7 (B), Competition was performed by incubating extracts with a 100-fold molar excess of unlabeled oligonucleotide before addition of labeled probe.

 
Additional experiments were performed to more accurately investigate the change in the amounts of STAT4 protein and the levels of phosphorylation along with the passage of 2D6 cells in IL-2-containing medium (Fig. 8GoA). There was almost no difference in the amount of STAT4 protein between 2D6IL-12 and 2D6IL-2 (one passage). However, detectable levels of difference were observed in STAT4 phosphorylation between these two types of cells. The amounts of STAT4 protein as well as the levels of STAT4 phosphorylation decreased with the times of passages in medium containing IL-2. 2D6IL-2 cells maintained through multiple passages with IL-2 exhibited marginal (7 passages) or almost zero (14 passages) levels of STAT4 phosphorylation that were associated with a decrease in the amounts of STAT4 protein.



View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 8. The amount of STAT4 protein and level of IL-12-stimulated STAT4 phosphorylation decrease along with passages in IL-2 medium. A, 2D6IL-2 cells were obtained after 1, 7, or 14 passages in IL-2-containing medium. These 2D6IL-2 cells and 2D6IL-12 cells were starved of each cytokine for 24 h and stimulated with IL-12. Lysates obtained from cells 10 min after stimulation were subjected to anti-STAT4 immunoprecipitation and immunoblotting with anti-phosphotyrosine and reblotting with anti-STAT4 antiserum. B, 2D6IL-2 cells obtained after 5 passages were stimulated with IL-12, and lysates were prepared various minutes (m) or hours (h) later.

 
Fig. 8GoB examines the time course of STAT4 phosphorylation in 2D6IL-2 cells. Five-times-passaged (P:5) 2D6IL-2 containing reduced but detectable amounts of STAT4 protein was used for this purpose. The level of phosphorylation significantly increased from 10 min to 1 h after IL-12 stimulation, and the maximum level was observed 5–10 h after the stimulation. Even this maximum level of STAT4 phosphorylation in 2D6IL-2 was much lower than the level in 2D6IL-12. While the delayed peak of STAT4 phosphorylation was obtained for five-times-passaged (Fig. 8GoB) or seven-times-passaged (data not shown) 2D6IL-2 cells, such a time course of STAT4 phosphorylation was no longer observed for long-time-passaged 2D6 cells such as 2D6IL-2 (P:14) (data not shown). Together, there were several steps of difference in STAT4 activation: only the level of STAT4 phosphorylation differed between 2D6IL-12 and 2D6IL-2 (P:1); in contrast to 2D6IL-2 (P:1), the amounts of STAT4 remarkably decreased in 2D6IL-2 (P:5 or 7) and 2D6IL-2 (P:14). The former (2D6IL-2, P:5) induced considerable levels of STAT4 phosphorylation at later time points after IL-12 stimulation, but the latter (2D6IL-2, P:14) did not. It should also be noted that there was a difference in the size of tyrosine-phosphorylated STAT4 in 2D6IL-2 cells harvested 10 min and 1–10 h after stimulation. Such an alteration is in parallel to the change of the major band of STAT4 protein detected by anti-STAT4 immunoblotting (lower panel in Fig. 8GoB). This may be explained by a recent study of Cho et al. (32), which demonstrated that ligand-induced serine phosphorylation is responsible for the cytokine-induced electrophoretic mobility shift of STAT4.

IFN-{gamma} production of 2D6IL-12 and 2D6IL-2 cells following IL-12 stimulation

We next compared IL-12-stimulated IFN-{gamma} production between 2D6IL-12 and 2D6IL-2 lines. 2D6IL-12 and 2D6IL-2 were starved of each cytokine used for maintenance and then stimulated with IL-12. Fig. 9Go shows that 2D6IL-12 produce IFN-{gamma} in an IL-12 dose-dependent manner. In contrast, 2D6IL-2 exhibited apparently reduced levels of IFN-{gamma} production. Their capacity to produce IFN-{gamma} in response to IL-12 decreased along with the passages in IL-2 medium, and 2D6IL-2 harvested after 14 passages could produce only marginal amounts of IFN-{gamma} even by stimulation with 1000 pg/ml IL-12. The reduced capacity of 2D6IL-2 cells to produce IFN-{gamma} was not due to the problem of the viability or impaired functional status based on starvation because portions of the same cells exhibited comparable levels of [3H]TdR uptake: for example, [3H]TdR uptake of 2D6IL-12 and 2D6IL-2 (P:14) following stimulation with 1000 pg/ml IL-12 were 75,357 ± 3,201 and 74,235 ± 3,110, respectively. Thus, 2D6IL-12 and 2D6IL-2 have different capacities to produce IFN-{gamma} in response to IL-12.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 9. Differential capacities of 2D6IL-12 and 2D6IL-2 to produce IFN-{gamma} in response to IL-12. 2D6IL-2 cells obtained after 1, 7, or 14 passages with IL-2 and 2D6IL-12 cells were starved of each cytokine for 24 h and stimulated with indicated doses of IL-12. After 24 h, culture supernatants were harvested, and concentrations of IFN-{gamma} were measured by ELISA. The results are a representative of three similar experiments.

 
IL-12 induces tyrosine phosphorylation of STAT5 in two 2D6 lines

STAT5 is known to be phosphorylated following IL-2 stimulation during IL-2-dependent growth promotion (12, 33, 34). We finally investigated whether STAT5 is phosphorylated in 2D6IL-12 and/or 2D6IL-2 following stimulation with either IL-2 or IL-12. Fig. 10GoA shows that STAT5 protein is contained/maintained in the two 2D6 lines (lower panel of Fig. 10GoA) and that IL-2 induces high levels of STAT5 phosphorylation in both 2D6IL-12 and 2D6IL-2 (upper panel). Although the activation of JAK3 was not observed in both 2D6IL-12 and 2D6IL-2 following IL-12 stimulation (Fig. 1GoB), phosphorylation of STAT5 was also induced by stimulation with IL-12 (upper panel of Fig. 10GoA). STAT5 phosphorylation was detected similarly with antiserum against STAT5a/b or STAT5a (data not shown). The level of IL-12-induced STAT5 phosphorylation was appreciably higher in 2D6IL-2 than in 2D6IL-12, while both of these levels were apparently lower compared with those induced by IL-2 stimulation.



View larger version (61K):
[in this window]
[in a new window]
 
FIGURE 10. Tyrosine phosphorylation of STAT5 in 2D6IL-12 and 2D6IL-2 cells and association of STAT5 with JAK2. A, 2D6IL-12 and 2D6IL-2 (7 passages with IL-2) were starved of each cytokine and stimulated with IL-12 or IL-2. Lysates were immunoprecipitated with antiserum to STAT5a/b and blotted with anti-phosphotyrosine mAb, and then reprobed with antiserum to STAT5a/b. B, Portions of the same immunoprecipitates as in A were blotted with antiserum to JAK2.

 
The STAT5 DNA-binding activity of nuclear extracts from IL-12- or IL-2-stimulated 2D6IL-12 or 2D6IL-2 cells was examined in the EMSA (Fig. 7GoB). High levels of gel-shift bands were observed for extracts from both lines of 2D6 cells following IL-2 stimulation. The bands were also generated by those from IL-12-stimulated 2D6IL-12 and 2D6IL-2, although the levels were apparently lower than those of IL-2-stimulated 2D6 cells. Thus, the phosphorylation levels of STAT5 correlate with the STAT5 DNA-binding activity in IL-12/IL-2-stimulated 2D6IL-12 or 2D6IL-2.

More importantly, JAK2 was found to be associated with STAT5, as shown by anti-JAK2 immunoblotting for anti-STAT5 immunoprecipitates (Fig. 10GoB). Thus, the results show that JAK2 is associated with STAT5 in both 2D6IL-12 and 2D6IL-2 and that following IL-12 stimulation, comparable levels of STAT5 phosphorylation are induced along with JAK2 activation (Fig. 5Go) and proliferation (Fig. 4Go).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results obtained in this study show that an IL-12-responsive T cell clone (2D6IL-12) and the IL-2-supported subline (2D6IL-2) derived from the standard 2D6 clone produce high and low levels of IFN-{gamma}, respectively, but proliferate similarly in response to IL-12. The former line exhibits potent levels of TYK2 and STAT4 phosphorylation compared with the latter. However, both lines displayed similar levels of JAK2 and STAT5 phosphorylation. These results suggest that the activation of TYK2 and STAT4 is responsible for IFN-{gamma} induction. In contrast, comparable levels of proliferation correlate with the phosphorylation of JAK2 and STAT5 that have been regarded as a set of signaling molecules in the IL-3-dependent growth (35). Thus, the present study provides observations worthy of consideration regarding the linkage between the JAKs and STATs used in IL-12R signaling as well as the role of IL-12 in maintaining the levels of JAK and STAT proteins during cultures with IL-12 stimulation alone.

It has been established that IL-12 activates two JAK kinases and two STAT proteins: JAK2 and TYK2 for the former (13), and STAT4 and STAT3 for the latter (16, 17). IL-12 exhibits a number of bioactivities through stimulating IL-12R ß1 and ß2 subunits and subsequently activating the above signaling molecules. However, it has not been determined how each of these molecules is associated with either IL-12R subunit and is responsible for the expression of a particular IL-12 bioactivity. IL-12R signaling has been investigated mainly using mitogen-activated or Ag-stimulated fresh T cells as IL-12-responsive cells (13, 16, 36). While these are regarded as physiologic responders, a limitation may exist in examining some IL-12 bioactivities, such as the capacity of IL-12 to induce proliferation and expression of various intracellular molecules. In this context, we have recently established a T cell clone highly reactive to IL-12 (23). The clone termed 2D6 exhibited various IL-12-related features, including proliferation and IFN-{gamma} production in response to IL-12. Thus, this clone permitted us to investigate the requirement for cytokines in the induction/maintenance of IL-12 responsiveness/IL-12R expression as well as the roles of JAK/STAT molecules in the induction of cellular proliferation vs IFN-{gamma} production.

Recent studies have shown the role of IL-12 in the induction/maintenance of IL-12 responsiveness (37), and more specifically of IL-12R ß1 and ß2 subunits (38, 39, 40). Thus, triggering of TCR on naive T cells is sufficient for the initial expression of functional IL-12R on TCR-stimulated T cells (39). Depending on the cytokines present during the differentiation, T cells develop into IL-12-responsive Th1 or IL-12-unresponsive Th2 cells. It is obvious that IL-12 enhances the expression of IL-12R, especially of the ß2 subunit, a signal-transducing component of the IL-12R (38, 39, 40), and ensures the differentiation into Th1 (38, 39). In addition to IL-12, several cytokines have been described to up-regulate or down-regulate the expression of the IL-12R ß2 subunit (37, 38, 39, 40). These include IFN-{alpha}, IFN-{gamma}, and IL-4, although some of the results are seemingly controversial.

In relation to the above context, the results obtained with the 2D6 clone need to be discussed from several aspects. The fact that 2D6 cells can be maintained solely with IL-12 and continuously express function IL-12R is compatible with the previous results, which showed the capacity of IL-12 to induce/enhance the expression of IL-12R (38, 39). This clone continues to produce IFN-{gamma} during maintenance with IL-12. Therefore, the possibility may be raised that instead of IL-12, IFN-{gamma} contributes directly to maintaining/enhancing IL-12R expression. However, this possibility is unlikely because IL-12 responsiveness and IL-12R-mediated signaling were not affected in 2D6 cells from cultures containing IL-12 and sufficient amounts of anti-IFN-{gamma} mAb (our unpublished observations). In addition, our present results showed that 2D6 cells can also be maintained in cultures containing IL-2 instead of IL-12, and such 2D6 cells (designated here 2D6IL-2) continuously express functional IL-12R; namely, the expression of IL-12R ß1 and ß2 subunits can be maintained by IL-2 as well as IL-12.

Our study using the standard 2D6 (2D6IL-12) and 2D6IL-2 lines provided the following important information and implications. Both 2D6 lines expressing IL-12R ß1 and ß2 subunits proliferated almost equally in response to IL-12. However, 2D6IL-12 and 2D6IL-2 differed in the capacity to produce IFN-{gamma} in response to IL-12. This difference was associated with differential induction or activation of STAT4 protein between two lines, which is consistent with the reports that STAT4 is responsible for IFN-{gamma} induction (41, 42). The failure of 2D6IL-2 to produce IFN-{gamma} in response to IL-12 correlated with the lack of TYK2 phosphorylation. Thus, our results imply that both IL-12 and IL-2 can maintain the expression of IL-12R, while the IL-12R-mediated signaling to IFN-{gamma} production is successfully induced by IL-12, but not by IL-2.

Furthermore, the present study showed the noteworthy observations regarding the induction and activation of STAT4. First, STAT4 protein was maintained in 2D6 cells in cultures containing IL-12, whereas it was gradually and progressively decreased as the number of passages of 2D6 cells in IL-2-containing medium increased. In this regard, Bacon et al. (16) reported that resting T cells do not express STAT4 protein and that the expression of STAT4 was induced following stimulation with agents such as PHA. Moreover, their results showed that the time course of STAT4 induction mirrors the kinetics of induction of IL-12R expression and the acquisition of IL-12 responsiveness (43), raising a possibility that IL-12 may act as a mediator capable of stimulating STAT4 expression. Our present results support this possibility. Namely, it appears that IL-12, but not IL-2, has the capacity to induce/maintain STAT4 protein. Accordingly, the reduction of STAT4 phosphorylation in 2D6IL-2 was ascribed largely to a decrease in the amount of this protein. Second, STAT4 phosphorylation correlates more closely with the activation of TYK2 than JAK2. Thus, our results strongly suggest not only the role of IL-12 in the induction of STAT4, but also the linkage of TYK2 activation to STAT4 phosphorylation responsible for IFN-{gamma} induction.

Regarding the role of STAT4 in the induction of proliferation, studies using STAT4-deficient mice have revealed that mitogen-activated T cells from these mice can neither produce IFN-{gamma} nor proliferate in response to IL-12 (41). Thus, there is a possibility that STAT4 functions as a signaling molecule leading to proliferation. In the present 2D6 model, 2D6IL-2 cells that were harvested after 14 passages with IL-2 medium and found to express only a small amount of STAT4 protein exhibited comparable levels of IL-12-induced proliferation with those for 2D6IL-12 cells. These observations may make the above possibility unlikely in the 2D6 cell system. However, more detailed analyses will be required to conclude this, including experiments that involve the introduction of a dominant-negative STAT4 protein into 2D6 cells.

Because JAK2 activation was induced in both 2D6IL-12 and 2D6IL-2, its significance should also be considered. This may be done in terms of the role of JAK2 in inducing proliferation rather than IFN-{gamma} production. In relation to this, an interesting aspect of the present observations concerns the induction of STAT5 phosphorylation in 2D6 cells following IL-12 stimulation. STAT5 phosphorylation has been demonstrated to be induced in association with JAK3 activation following IL-2 stimulation (12, 13, 33, 44). Both JAK3 and STAT5 activation were also observed in 2D6IL-12 and 2D6IL-2 following IL-2 stimulation. Compared with strikingly high levels of STAT5 phosphorylation after IL-2 stimulation, the levels of STAT5 phosphorylation induced with IL-12 were weak but significant. The fact that such an IL-12-induced STAT5 phosphorylation occurred in the absence of JAK3 activation suggests the involvement of the JAK kinase(s) other than JAK3. In fact, JAK2 has been shown to activate STAT5 following stimulation with various cytokines, including IL-3 (28, 45), IL-5 (28), and granulocyte-macrophage CSF (28). In addition to the role of STAT5 in IL-2-induced T cell proliferation (44, 46), the combination of JAK2-STAT5 has been shown to represent a set of signaling molecules for cytokine-dependent cellular proliferation (28, 35, 45).

It is obvious that IL-12 stimulation leads to activating both JAK2 and STAT5 in 2D6 cells. The phosphorylation of STAT5 in 2D6 cells may occur directly as a result of IL-12-induced JAK2 activation or indirectly through stimulation with endogenous IL-2 that might be produced following IL-12 stimulation. However, the latter possibility appears to be unlikely because 1) neither IL-2 activity nor mRNA was detected in IL-12-stimulated 2D6 cells (our unpublished observations); 2) STAT5 phosphorylation was not affected by addition of anti-IL-2-neutralizing mAb (our unpublished observations); and 3) IL-12 failed to induce JAK3 activation. Moreover, we found that STAT5 is associated with JAK2 in 2D6IL-12 and 2D6IL-2. Thus, it is possible that JAK2 activated with IL-12 phosphorylates STAT5, and IL-12-dependent proliferation utilizes this JAK2-STAT5 signaling circuit in 2D6 cells as in an IL-3-dependent growth promotion. In this context, we recently found that stimulation of Con A-induced T cell blasts with IL-12 induces a significant, albeit weak, level of STAT5 phosphorylation (our unpublished observations). Further studies will be required to establish that the STAT5 phosphorylation observed in Con A blasts following stimulation with IL-12 takes place without the involvement of endogenous IL-2.

Our present results illustrate that IL-12 has the capacity to induce/maintain both STAT4 and STAT5. Through the association with a particular JAK family member, these STAT proteins play a crucial role in either IFN-{gamma} production or proliferation following IL-12 stimulation. These observations have significant implications for understanding molecular mechanisms underlying the IL-12R signaling. The 2D6 system could also provide an intriguing model to design the manipulation of IL-12-induced bioactivities through regulating the activation of various signaling molecules such as STAT4 and STAT5.


    Acknowledgments
 
We are grateful to Mari Yoneyama and Tomoko Katsuta for secretarial assistance.


    Footnotes
 
1 This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture, Japan. Back

2 Address correspondence and reprint requests to Dr. Hiromi Fujiwara, Biomedical Research Center, Osaka University Medical School, 2-2, Yamada-oka, Suita, Osaka 565, Japan. Back

3 Abbreviations used in this paper: JAK, Janus kinase; EMSA, electrophoretic mobility shift assay. Back

Received for publication March 23, 1998. Accepted for publication July 27, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Trinchieri, G.. 1994. Interleukin-12: a cytokine produced by antigen-presenting cells with immunoregulatory functions in the generation of T-helper cells type 1 and cytotoxic lymphocytes. Blood 84:4008.[Free Full Text]
  2. Brunda, M. J.. 1994. Interleukin-12. J. Leukocyte Biol. 55:280.[Abstract]
  3. Kobayashi, M., L. Fitz, M. Ryan, R. M. Hewick, S. C. Clark, S. Chan, R. Loudon, F. Sherman, B. Perussia, G. Trinchieri. 1989. Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J. Exp. Med. 170:827.[Abstract/Free Full Text]
  4. Chan, S. H., B. Perussia, J. W. Gupta, M. Kobayashi, M. Pospisil, H. A. Young, S. F. Wolf, D. Young, S. C. Clark, G. Trinchieri. 1991. Induction of interferon {gamma} production by natural killer cell stimulatory factor: characterization of the responder cells and synergy with other inducers. J. Exp. Med. 173:869.[Abstract/Free Full Text]
  5. Robertson, M. J., R. J. Soiffer, S. F. Wolf, T. J. Manley, C. Donahue, D. Young, S. H. Herrmann, J. Ritz. 1992. Response of human natural killer (NK) cells to NK cell stimulatory factor (NKSF): cytolytic activity and proliferation of NK cells are differentially regulated by NKSF. J. Exp. Med. 175:779.[Abstract/Free Full Text]
  6. Gately, M. K., B. B. Desai, A. G. Wolitzky, P. M. Quinn, C. M. Dwyer, F. J. Podlaski, P. C. Familletti, F. Sinigaglia, R. Chizonnite, U. Gubler, A. S. Stern. 1991. Regulation of human lymphocyte proliferation by a heterodimeric cytokine, IL-12 (cytotoxic lymphocyte maturation factor). J. Immunol. 147:874.[Abstract]
  7. Stern, A. S., F. J. Podlaski, J. D. Hulmes, Y. C. Pan, P. M. Quinn, A. G. Wolitzky, P. C. Familletti, D. L. Stremlo, T. Truitt, R. Chizzonite, M. K. Gately. 1990. Purification to homogeneity and partial characterization of cytotoxic lymphocyte maturation factor from human B-lymphoblastoid cells. Proc. Natl. Acad. Sci. USA 87:6808.[Abstract/Free Full Text]
  8. Manetti, R., P. Parronchi, M. G. Giudizi, M. P. Piccinni, E. Maggi, G. Trinchieri, S. Romagnani. 1993. Natural killer cell stimulatory factor (interleukin 12 (IL-12)) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4-producing Th cells. J. Exp. Med. 177:1199.[Abstract/Free Full Text]
  9. Guler, M. L., J. D. Gorham, C. S. Hsieh, A. J. Mackey, R. G. Steen, W. F. Dietrich, K. M. Murphy. 1996. Genetic susceptibility to Leishmania: IL-12 responsiveness in TH1 cell development. Science 271:984.[Abstract]
  10. Presky, D. H., H. Yang, L. J. Minetti, A. O. Chua, N. Nabavi, C. Y. Wu, M. K. Gately, U. Gubler. 1996. A functional interleukin 12 receptor complex is composed of two ß-type cytokine receptor subunits. Proc. Natl. Acad. Sci. USA 93:14002.[Abstract/Free Full Text]
  11. Ihle, J. N.. 1995. The Janus protein tyrosine kinases in hematopoietic cytokine signaling. Semin. Immunol. 7:247.[Medline]
  12. Johnston, J. A., C. M. Bacon, M. C. Riedy, J. J. O’Shea. 1996. Signaling by IL-2 and related cytokines: JAKs, STATs, and relationship to immunodeficiency. J. Leukoc. Biol. 60:441.[Abstract]
  13. Bacon, C. M., D. W. McVicar, J. R. Ortaldo, R. C. Rees, J. J. O’Shea, J. A. Johnston. 1995. Interleukin 12 (IL-12) induces tyrosine phosphorylation of JAK2 and TYK2: differential use of Janus family tyrosine kinases by IL-2 and IL-12. J. Exp. Med. 181:399.[Abstract/Free Full Text]
  14. Schindler, C., Jr J. Darnell. 1995. Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu. Rev. Biochem. 64:621.[Medline]
  15. Ihle, J. N., B. A. Witthuhn, F. W. Quelle, K. Yamamoto, O. Silvennoinen. 1995. Signaling through the hematopoietic cytokine receptors. Annu. Rev. Immunol. 13:369.[Medline]
  16. Bacon, C. M., III E. F. Petricoin, J. R. Ortaldo, R. C. Rees, A. C. Larner, J. A. Johnston, J. J. O’Shea. 1995. Interleukin 12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes. Proc. Natl. Acad. Sci. USA 92:7307.[Abstract/Free Full Text]
  17. Jacobson, N. G., S. J. Szabo, R. M. Weber-Nordt, Z. Zhong, R. D. Schreiber, Jr J. Darnell, K. M. Murphy. 1995. Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J. Exp. Med. 181:1755.[Abstract/Free Full Text]
  18. Velazquez, L., M. Fellous, G. R. Stark, S. Pellegrini. 1992. A protein tyrosine kinase in the interferon {alpha}/ß signaling pathway. Cell 70:313.[Medline]
  19. Watling, D., D. Guschin, M. Muller, O. Silvennoinen, B. A. Witthuhn, F. W. Quelle, N. C. Rogers, C. Schindler, G. R. Stark, J. N. Ihle, I. M. Kerr. 1993. Complementation by the protein tyrosine kinase JAK2 of a mutant cell line defective in the interferon-{gamma} signal transduction pathway. Nature 366:166.[Medline]
  20. Stahl, N., T. G. Boulton, T. Farruggella, N. Y. Ip, S. Davis, B. A. Witthuhn, F. W. Quelle, O. Silvennoinen, G. Barbieri, S. Pellegrini, J. N. Ihle, G. D. Yancopoulos. 1994. Association and activation of Jak-Tyk kinases by CNTF-LIF-OSM-IL-6 ß receptor components. Science 263:92.[Abstract/Free Full Text]
  21. Silvennoinen, O., B. A. Witthuhn, F. W. Quelle, J. L. Cleveland, T. Yi, J. N. Ihle. 1993. Structure of the murine Jak2 protein-tyrosine kinase and its role in interleukin 3 signal transduction. Proc. Natl. Acad. Sci. USA 90:8429.[Abstract/Free Full Text]
  22. Quelle, F. W., N. Sato, B. A. Witthuhn, R. C. Inhorn, M. Eder, A. Miyajima, J. D. Griffin, J. N. Ihle. 1994. JAK2 associates with the ßc chain of the receptor for granulocyte-macrophage colony-stimulating factor, and its activation requires the membrane-proximal region. Mol. Cell. Biol. 14:4335.[Abstract/Free Full Text]
  23. Maruo, S., H. J. Ahn, W. G. Yu, M. Tomura, M. Wysocka, N. Yamamoto, M. Kobayashi, T. Hamaoka, G. Trinchieri, H. Fuijiwara. 1997. Establishment of an IL-12-responsive T cell clone: its characterization and utilization in the quantitation of IL-12 activity. J. Leukocyte Biol. 61:346.[Abstract]
  24. Chua, A. O., V. L. Wilkinson, D. H. Presky, U. Gubler. 1995. Cloning and characterization of a mouse IL-12 receptor-ß component. J. Immunol. 155:4286.[Abstract]
  25. Marchuk, D., M. Drumm, A. Saulino, F. S. Collins. 1991. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 19:1154.[Free Full Text]
  26. Wilson, K. C., D. S. Finbloom. 1992. Interferon {gamma} rapidly induces in human monocytes a DNA-binding factor that recognizes the {gamma} response region within the promoter of the gene for the high-affinity Fc {gamma} receptor. Proc. Natl. Acad. Sci. USA 89:11964.[Abstract/Free Full Text]
  27. Masuda, E. S., H. Tokumitsu, A. Tsuboi, J. Shlomai, P. Hung, K. Arai, N. Arai. 1993. The granulocyte-macrophage colony-stimulating factor promoter cis-acting element CLE0 mediates induction signals in T cells and is recognized by factors related to AP1 and NFAT. Mol. Cell. Biol. 13:7399.[Abstract/Free Full Text]
  28. Mui, A. L., H. Wakao, A. M. O’Farrell, N. Harada, A. Miyajima. 1995. Interleukin-3, granulocyte-macrophage colony stimulating factor and interleukin-5 transduce signals through two STAT5 homologs. EMBO J. 14:1166.[Medline]
  29. Yamamoto, K., F. W. Quelle, W. E. Thierfelder, B. L. Kreider, D. J. Gilbert, N. A. Jenkins, N. G. Copeland, O. Silvennoinen, J. N. Ihle. 1994. Stat4, a novel {gamma} interferon activation site-binding protein expressed in early myeloid differentiation. Mol. Cell. Biol. 14:4342.[Abstract/Free Full Text]
  30. Johnston, J. A., M. Kawamura, R. A. Kirken, Y. Q. Chen, T. B. Blake, K. Shibuya, J. R. Ortaldo, D. W. McVicar, J. J. O’Shea. 1994. Phosphorylation and activation of the Jak-3 Janus kinase in response to interleukin-2. Nature 370:151.[Medline]
  31. Ahn, H. J., S. Maruo, M. Tomura, J. Mu, T. Hamaoka, K. Nakanishi, S. Clark, M. Kurimoto, H. Okamura, H. Fujiwara. 1997. A mechanism underlying synergy between IL-12 and IFN-{gamma}-inducing factor in enhanced production of IFN-{gamma}. J. Immunol. 159:2125.[Abstract/Free Full Text]
  32. Cho, S. S., C. M. Bacon, C. Sudarshan, R. C. Rees, D. Finbloom, R. Pine, J. J. O’Shea. 1996. Activation of STAT4 by IL-12 and IFN-{alpha}: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J. Immunol. 157:4781.[Abstract]
  33. Lin, J. X., T. S. Migone, M. Tsang, M. Friedmann, J. A. Weatherbee, L. Zhou, A. Yamauchi, E. T. Bloom, J. Mietz, S. John, W. J. Leonard. 1995. The role of shared receptor motifs and common Stat proteins in the generation of cytokine pleiotropy and redundancy by IL-2, IL-4, IL-7, IL-13, and IL-15. Immunity 2:331.[Medline]
  34. Hou, J., U. Schindler, W. J. Henzel, S. C. Wong, S. L. McKnight. 1995. Identification and purification of human Stat proteins activated in response to interleukin-2. Immunity 2:321.[Medline]
  35. Mui, A. L., H. Wakao, T. Kinoshita, T. Kitamura, A. Miyajima. 1996. Suppression of interleukin-3-induced gene expression by a C-terminal truncated Stat5: role of Stat5 in proliferation. EMBO J. 15:2425.[Medline]
  36. Szabo, S. J., N. G. Jacobson, A. S. Dighe, U. Gubler, K. M. Murphy. 1995. Developmental commitment to the Th2 lineage by extinction of IL-12 signaling. Immunity 2:665.[Medline]
  37. Gollob, J. A., H. Kawasaki, J. Ritz. 1997. Interferon-{gamma} and interleukin-4 regulate T cell interleukin-12 responsiveness through the differential modulation of high-affinity interleukin-12 receptor expression. Eur. J. Immunol. 27:647.[Medline]
  38. Szabo, S. J., A. S. Dighe, U. Gubler, K. M. Murphy. 1997. Regulation of the interleukin (IL)-12R ß2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185:817.[Abstract/Free Full Text]
  39. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.[Abstract/Free Full Text]
  40. Galbiati, F., L. Rogge, J. C. Guery, S. Smiroldo, L. Adorini. 1998. Regulation of the IL-12 receptor ß2 subunit by soluble antigen and IL-12 in vivo. Eur. J. Immunol. 28:209.[Medline]
  41. Kaplan, M. H., Y. L. Sun, T. Hoey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382:174.[Medline]
  42. Thierfelder, W. E., J. M. van-Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, R. T. Carson, M. Y. Sangster, D. A. Vignali, P. C. Doherty, G. C. Grosveld, J. N. Ihle. 1996. Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382:171.[Medline]
  43. Desai, B. B., P. M. Quinn, A. G. Wolitzky, P. K. Mongini, R. Chizzonite, M. K. Gately. 1992. IL-12 receptor. II. Distribution and regulation of receptor expression. J. Immunol. 148:3125.[Abstract]
  44. Wakao, H., N. Harada, T. Kitamura, A. L. Mui, A. Miyajima. 1995. Interleukin 2 and erythropoietin activate STAT5/MGF via distinct pathways. EMBO J. 14:2527.[Medline]
  45. Azam, M., H. Erdjument-Bromage, B. L. Kreider, M. Xia, F. Quelle, R. Basu, C. Saris, P. Tempst, J. N. Ihle, C. Schindler. 1995. Interleukin-3 signals through multiple isoforms of Stat5. EMBO J. 14:1402.[Medline]
  46. Friedmann, M. C., T. S. Migone, S. M. Russell, W. J. Leonard. 1996. Different interleukin 2 receptor ß-chain tyrosines couple to at least two signaling pathways and synergistically mediate interleukin 2-induced proliferation. Proc. Natl. Acad. Sci. USA 93:2077.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Rheumatology (Oxford)Home page
V. Paunovic, H. P. Carroll, K. Vandenbroeck, and M. Gadina
Signalling, inflammation and arthritis: Crossed signals: the role of interleukin (IL)-12, -17, -23 and -27 in autoimmunity
Rheumatology, June 1, 2008; 47(6): 771 - 776.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Yoshimoto, M. Furuhata, S. Kamiya, M. Hisada, H. Miyaji, Y. Magami, K. Yamamoto, H. Fujiwara, and J. Mizuguchi
Positive Modulation of IL-12 Signaling by Sphingosine Kinase 2 Associating with the IL-12 Receptor {beta}1 Cytoplasmic Region
J. Immunol., August 1, 2003; 171(3): 1352 - 1359.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Nishikomori, T. Usui, C.-Y. Wu, A. Morinobu, J. J. O'Shea, and W. Strober
Activated STAT4 Has an Essential Role in Th1 Differentiation and Proliferation That Is Independent of Its Role in the Maintenance of IL-12R{beta}2 Chain Expression and Signaling
J. Immunol., October 15, 2002; 169(8): 4388 - 4398.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
L. Burdelya, R. Catlett-Falcone, A. Levitzki, F. Cheng, L. B. Mora, E. Sotomayor, D. Coppola, J. Sun, S. Sebti, W. S. Dalton, et al.
Combination Therapy with AG-490 and Interleukin 12 Achieves Greater Antitumor Effects than Either Agent Alone
Mol. Cancer Ther., September 1, 2002; 1(11): 893 - 899.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
C.-S. Park, Y.-F. Yang, X.-Y. Zhou, K. Toyooka, Y. Yashiro-Ohtani, W.-R. Park, M. Tomura, X.-G. Tai, T. Hamaoka, and H. Fujiwara
Reversible CD8 expression induced by common cytokine receptor {gamma} chain-dependent cytokines in a cloned CD4+ Th1 cell line
Int. Immunol., March 1, 2002; 14(3): 259 - 266.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Nakahira, H.-J. Ahn, W.-R. Park, P. Gao, M. Tomura, C.-S. Park, T. Hamaoka, T. Ohta, M. Kurimoto, and H. Fujiwara
Synergy of IL-12 and IL-18 for IFN-{gamma} Gene Expression: IL-12-Induced STAT4 Contributes to IFN-{gamma} Promoter Activation by Up-Regulating the Binding Activity of IL-18-Induced Activator Protein 1
J. Immunol., February 1, 2002; 168(3): 1146 - 1153.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Nakahira, M. Tomura, M. Iwasaki, H.-J. Ahn, Y. Bian, T. Hamaoka, T. Ohta, M. Kurimoto, and H. Fujiwara
An Absolute Requirement for STAT4 and a Role for IFN-{gamma} as an Amplifying Factor in IL-12 Induction of the Functional IL-18 Receptor Complex
J. Immunol., August 1, 2001; 167(3): 1306 - 1312.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. E. Verhagen, T. de Boer, H. H. Smits, F. A.W. Verreck, E. A. Wierenga, M. Kurimoto, D. A. Lammas, D. S. Kumararatne, O. Sanal, F. P. Kroon, et al.
Residual Type 1 Immunity in Patients Genetically Deficient for Interleukin 12 Receptor {beta}1 (IL-12R{beta}1): Evidence for an IL-12R{beta}1-Independent Pathway of IL-12 Responsiveness in Human T Cells
J. Exp. Med., August 21, 2000; 192(4): 517 - 528.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. S. Wang, D. A. Frank, and J. Ritz
Interleukin-2 enhances the response of natural killer cells to interleukin-12 through up-regulation of the interleukin-12 receptor and STAT4
Blood, May 15, 2000; 95(10): 3183 - 3190.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahn, H.-J.
Right arrow Articles by Fujiwara, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahn, H.-J.
Right arrow Articles by Fujiwara, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS