| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Production Following IL-12 Stimulation1
Biomedical Research Center, Osaka University Medical School, Yamada-oka, Suita, Osaka, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production of 2D6 cells. 2D6 cells could be maintained with either
IL-12 or IL-2. 2D6 lines maintained with IL-12 (2D6IL-12)
or IL-2 (2D6IL-2) exhibited comparable levels of
proliferation, but produced large or only small amounts of IFN-,
respectively, when restimulated with IL-12 after starvation of either
cytokine. 2D6IL-12 induced TYK2 and STAT4 phosphorylation.
In contrast, their phosphorylation was marginally induced in
2D6IL-2. The reduced STAT4 phosphorylation was due to a
progressive decrease in the amount of STAT4 protein along with the
passages in IL-2-containing medium. 2D6IL-12 and
2D6IL-2 similarly proliferating in response to IL-12
induced comparable levels of JAK2 activation and STAT5 phosphorylation.
JAK2 was associated with STAT5, and IL-12-induced STAT5 phosphorylation
was elicited in the absence of JAK3 activation. These results indicate
that IL-12 has the capacity to induce/maintain STAT4 and STAT5
proteins, and that TYK2 and JAK2 activation correlate with STAT4
phosphorylation/IFN- induction and STAT5 phosphorylation/cellular
proliferation, respectively. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, by T cells and NK cells (3, 4), and
supports the growth (5, 6) and enhances the cytolytic activity of both
cell types (3, 7). Together with the effect on the differentiation of
naive CD4+ T cells toward the Th1 phenotype (8, 9), IL-12
promotes induction of cell-mediated immunity. Despite the importance of IL-12 functions, the molecular mechanisms through which this cytokine exerts its biologic effects are poorly understood. Recent studies have revealed that a functional IL-12R complex is composed of two ß-type cytokine receptor subunits (10). Cytokine receptors lacking intrinsic tyrosine kinase activity induce rapid tyrosine phosphorylation of signaling proteins through association with members of the Janus (JAK)3 family of protein tyrosine kinases (11, 12). Like other cytokine receptors, the stimulation of IL-12R with IL-12 was shown to result in the activation of two JAK family members, JAK2 and TYK2 (13). Activation of JAKs leads to the tyrosine phosphorylation of a family of STATs that are important in the regulation of gene expression by cytokine receptors (14, 15). Accordingly, IL-12 was found to induce the tyrosine phosphorylation of two STAT family members, STAT3 and STAT4, defining the components of the JAK-STAT signaling pathway activated through IL-12R (16, 17). Both TYK2 and JAK2 have been shown to be involved in the signal transduction via other cytokine receptors, including the IFN (18, 19), IL-6 (20), and IL-3/granulocyte-macrophage CSF (21, 22) cytokine families. While simultaneous activation of TYK2 and JAK2 is induced in IL-12R signaling, the relative requirements for these two JAKs in the phosphorylation of STATs and the expression of various IL-12 bioactivities remain to be investigated.
In the present study, we investigated, using an IL-12-responsive T cell
clone (2D6), the requirements for the components of the JAK-STAT
signaling pathway in the two IL-12 bioactivities, T cell proliferation
and IFN- production. 2D6 could be maintained with either IL-12
(2D6IL-12) or IL-2 (2D6IL-2).
2D6IL-12 and 2D6IL-2 lines exhibited comparable
levels of proliferation, but high and low levels of IFN- production,
respectively, in response to IL-12. In contrast to phosphorylation of
TYK2 and STAT4 in 2D6IL-12, the phosphorylation levels were
only marginal in 2D6IL-2. The reduced STAT4 activation was
due largely to a decrease in the amount of STAT4 protein. The two 2D6
lines capable of proliferating in response to IL-12 exhibited
comparable levels of JAK2 activation and STAT5 phosphorylation. The
phosphorylation of STAT5 associated with JAK2 was found to be induced
in the absence of JAK3 activation. These results indicate that IL-12
has the capacity to induce/maintain STAT4 and STAT5, and that TYK2
activation is associated with STAT4 phosphorylation leading to IFN-
induction, while JAK2 activation correlates with STAT5 phosphorylation
and cellular proliferation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The IL-12-responsive T cell clone, 2D6, was established by maintaining alloreactive 4-86 Th cells in the presence of rIL-12 alone without stimulation with allogeneic APCs (23). 2D6 exhibited high levels of proliferation in response to as little as 1 pg/ml of rIL-12. 2D6 cells maintained with rIL-12 (250 pg/ml) were used after intensive washing, as the standard IL-12-dependent 2D6. In some experiments, 2D6, which were maintained with rIL-2 (50 U/ml) instead of rIL-12 for 1–20 passages, were used as an IL-2-supported subline. This subline was designated 2D6IL-2, and the standard line was designated 2D6IL-12 for distinction.
Reagents
Murine rIL-12 and rIL-2 were kindly provided by Genetics Institute (Cambridge, MA) and Shionogi (Osaka, Japan), respectively. The following polyclonal rabbit antisera and mAb were purchased: polyclonal anti-JAK2, anti-TYK2, anti-STAT3, anti-STAT4, and anti-STAT5 antisera (both anti-STAT5a/b and anti-STAT5a) were from Santa Cruz Biotechnology (Santa Cruz, CA); polyclonal rabbit anti-JAK1 and anti-JAK3 antisera were from Upstate Biotechnology (Lake Placid, NY); and anti-phosphotyrosine mAb (PY20) was from Transduction Laboratories (Lexington, KY).
Immunoprecipitation and immunoblotting
Stimulated cells were washed before being lysed in buffer containing 1% Triton X-100 and 0.5% Nonidet P-40. Lysates were immunoprecipitated with anti-JAK1, anti-JAK2, anti-TYK2, anti-JAK3, anti-STAT3, anti-STAT4, or anti-STAT5 antisera conjugated to protein A-coupled Sepharose beads. The immunoprecipitates were resolved on 7.5% SDS-polyacrylamide gels and transferred to Immobilon (Millipore, Bedford, MA).
For immunoblotting with anti-phosphotyrosine mAb, membranes were blocked in Tris-buffered saline (TBS) containing 1% fish gelatin, 5% BSA, and 0.1% Tween-20, and sequentially incubated with anti-phosphotyrosine mAb and horseradish peroxidase-conjugated sheep anti-mouse IgG F(ab')2 (Amersham, Arlington Heights, IL). Detection was performed by use of enhanced chemoluminescence (ECL; Amersham).
For immunoblotting with Abs to JAK family kinases or STAT proteins, membranes were blocked in TBS containing 0.1% Tween 20 and 5% BSA, incubated sequentially with primary Ab and horseradish peroxidase-conjugated donkey anti-rabbit IgG F(ab')2 (Amersham), and detected with ECL. When a membrane was reprobed, it was first treated in reducing SDS buffer (100 mM 2-ME, 2% SDS, 62.5 mM Tris-HCl, pH 6.7).
Proliferation of 2D6 cells
2D6 cells (1.5 or 2 x 104/well) were cultured with various doses of rIL-12 for 2 days in 96-well flat-bottom microculture plates (Corning 25860; Corning Glass Works, Corning, NY). Cells were harvested after a final 6-h pulse with 20 kBq/well of [3H]TdR. Results were calculated from [3H]TdR uptake and expressed as mean cpm (±SE) of triplicate cultures.
IFN- production by 2D6 cells
2D6 cells (2 x 105/well) were cultured with various doses of rIL-12 in 24-well culture plates (Corning 25820). After 24 h, supernatants were harvested and stored at -20°C until use.
Measurement of IFN- concentration
IFN- concentration was measured by ELISA: mouse IFN- ELISA
kits were purchased from Genzyme (Cambridge, MA), and our own ELISA
system was prepared using two types of anti-mouse IFN- mAb
(XMG1.2 (Endogen, Cambridge, MA)) and biotinylated R4-6A2 (R4-6A2 was
purified from R4-6A2 hybridoma and biotinylated in our laboratory) as
well as mouse rIFN- provided from Shionogi. A quantity amounting to
1 U/ml in our ELISA system corresponded to approximately 100 pg/ml in
Genzyme ELISA kits.
cDNA probes for IL-12R ß1 and ß2 subunits
cDNA probes for IL-12R ß-chains (IL-12Rß1 and IL-12Rß2) were cloned from murine whole spleen cells. Total RNA was isolated from murine whole spleen cells that were treated for 48 h with 2 µg/ml Con A. This RNA was then used as a template for first-strand cDNA synthesis. The mouse IL-12R cDNA fragments were cloned from this cDNA by use of Taq DNA polymerase, standard PCR conditions, a 5'-sense oligonucleotide GTTGAGAAGACATCGTTCCC, and a 3'-antisense oligonucleotide TCCAGTTGTACAGGTACTGG based on sequence 152–171 and 475–494, respectively, from the sequence of mouse IL-12Rß1 (24) as well as a 5'-sense oligonucleotide TGAAATCAGGGTGCATGCAC, and a 3'-antisense oligonucleotide GTTTGCTGGATCTGGAATGG based on sequence 1668–1687 and 2177–2196, respectively, from the sequence of mouse IL-12Rß2 (10). The PCR products were purified by agarose gel electrophoresis and ligated to the vector as described (25). Briefly, Bluescript (Stratagene, La Jolla, CA) plasmid was digested with EcoRV and incubated with Taq polymerase with the use of standard buffer conditions in the presence of 2 mM dTTP for 2 h at 70°C. After phenol extraction and precipitation, the T vector was ready for cloning. PCR products were then ligated to the vector.
Measurement of mRNA expression
Total cellular RNA was isolated by the acid guanidium
thiocyanate-phenol-chloroform method, and mRNA levels were determined
using the RNase protection assay, according to the procedure as
described (26). Briefly, 10 µg of total cellular RNA was hybridized
in solution to a 32P-labeled antisense riboprobe for
16 h at 50°C in 80% formamide. The riboprobe prepared from the
IL-12Rß1 or IL-12Rß2 plasmid was linearized
with HindIII (IL-12Rß1) or PvuII
(IL-12Rß2), and in vitro transcription was initiated in
the presence of [
-32P]UTP. The protected fragment (343
bp for IL-12Rß1, and 208 bp for IL-12Rß2)
was separated on a denaturing sequencing gel, followed by
autoradiography. As an internal control for the amount of RNA loaded
onto the gel, RNA was simultaneously hybridized to antisense
32P-labeled probe for the ß2-microglobulin
gene, which yielded a 127-bp protected fragment.
Immunofluorescence and flow cytometry
The detection of IL-12R was performed as previously described (23). Briefly, 2D6 cells (1 x 106) were incubated with 7.5 ng of rIL-12 in 10 µl medium for 60 min at 4°C. Cells were washed and then incubated with 1 µg of rat anti-mouse IL-12 mAb (C17.8) for 30 min at 4°C. After washing, cells were allowed to react with 0.1 µg of biotinylated mouse anti-rat IgG, followed by incubation with phycoerythrin-conjugated streptavidin. Stained cells were analyzed with a FACSCalibur (Becton Dickinson, San Jose, CA).
Nuclear extract preparation and electrophoretic mobility shift assay (EMSA)
Nuclear extracts were prepared essentially as described previously (27), except that the following buffers were used. After washing with PBS, cells were resuspended in 50 mM HEPES (pH 7.5), 100 mM sodium fluoride, 10 mM sodium pyrophosphate, 2 mM sodium o-vanadate, 2 mM sodium molybdate, 2 mM EDTA (HEPES buffer) supplemented with 0.2% Nonidet P-40, 10 mM magnesium chloride, 10 µg/ml aprotinin, 2 µg/ml leupeptin, and 2 mM Pefabloc (Boehringer Mannheim, Indianapolis, IN). After 1 min on ice, the nuclei were pelleted and washed in the same buffer, but without Nonidet P-40. The nuclei were again pelleted and then extracted with vigorous agitation at 4°C in HEPES buffer containing 0.1% Nonidet P-40, 0.3 M sodium chloride, 10% glycerol, and protease inhibitors, as above.
Mobility shift assays were performed in a total volume of 20 µl in the following buffer: 10 mM HEPES-NaOH (pH 7.9), 1 mM EDTA, 30 mM NaCl, 0.5 mM magnesium chloride, 0.1% Nonidet P-40, 1 mM DTT, 1 mg/ml BSA, and 10% glycerol. Each reaction, also containing 1 µg of poly(dI-dC) and 10 fmol of 32P end-labeled probe, was initiated by the addition of 10 µg of nuclear extract and allowed to incubate at room temperature for 30 min before electrophoretic analysis on a 5% polyacrylamide gel in 0.25x TBE (Tris-borate/EDTA) buffer.
The following oligonucleotide probes were purchased from Santa Cruz Biotechnology: STAT4, 5'-GAGCCTGATTTCCCCGAAATGATGAGC-3' (28), and STAT5, 5'-AGATTTCTAGGAATTCAATCC-3' (29).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
IL-12 has been shown to induce tyrosine phosphorylation of
TYK2/JAK2 and STAT3/STAT4 among the JAK and STAT family members,
respectively (13, 16, 17). We examined whether this is also the case
with cells of an IL-12-responsive T cell clone, 2D6. 2D6 cells
harvested from cultures maintained with IL-12
(2D6IL-12) were starved of IL-12 for 24 h
and restimulated with IL-12. Lysates prepared from these
2D6IL-12 cells were immunoprecipitated with antisera
against TYK2 or JAK2. Immunoprecipitates were resolved by SDS-PAGE and
analyzed by anti-phosphotyrosine immunoblotting. As shown in Fig. 1
A (upper panels),
TYK2 and JAK2 from IL-12-stimulated 2D6 cells were phosphorylated on
tyrosine residues, whereas those from cells unstimulated or stimulated
with IL-2 were not. The same blot was stripped of detecting Ab and
reprobed with antisera against TYK2 and JAK2 to confirm equal loading
of kinases on each lane (Fig. 1A, lower panels).
|
B): IL-2 induces the
phosphorylation of JAK1 and JAK3 in 2D6 cells, as described for other
studies (30), whereas IL-12 stimulation failed to cause the
phosphorylation of JAK1 and JAK3.
We also confirmed the phosphorylation of STAT proteins in 2D6 cells.
Fig. 2 shows that IL-12, but not IL-2,
induces tyrosine phosphorylation of STAT3 and STAT4. Together, the
results indicate that IL-12 activates the thus far described components
of the JAK-STAT signaling pathway in 2D6 cells.
|
2 D6 cells could be maintained in cultures containing rIL-2
instead of rIL-12, yielding the IL-2-supported 2D6 subline
(2D6IL-2). We examined the expression of IL-12R on this
2D6IL-2 subline as well as the standard 2D6 cells
maintained with IL-12 (2D6IL-12). The mRNA expression of
IL-12R ß1 and ß2 subunits was assessed by
the RNase protection assay. Fig. 3A shows that both 2D6 lines
express the two IL-12R subunits, although there are some differences in
the mRNA levels of ß1 and ß2 subunits
between the two 2D6 lines. IL-12R levels were also assessed by
incubating 2D6 cells with rIL-12 and then staining them by
immunofluorescence with anti-IL-12 mAb, as described (23, 31).
Comparable levels of IL-12R were detected on 2D6IL-12 and
2D6IL-2 by flow cytometry analyses, which is consistent
with our previous observations (31). We next compared the IL-12
responsiveness of two 2D6 lines, 2D6IL-12 and
2D6IL-2, in proliferation assays. Fig. 4 shows that these two lines proliferated
similarly in response to IL-12, which is accordant with the data for
comparable levels of IL-12R expression on both lines.
|
|
We compared the activation of TYK2 and JAK2 between
2D6IL-12 and 2D6IL-2 following IL-12
stimulation. As shown in Fig. 5, IL-12
stimulation caused increased tyrosine phosphorylation of JAK2 protein
in both 2D6IL-12 and 2D6IL-2 cells. The
appreciably larger amount of JAK2 protein and higher level of JAK2
phosphorylation were observed for 2D6IL-2 compared with
those in 2D6IL-12, which was consistently observed. In
contrast, the phosphorylation of TYK2 was induced in
2D6IL-12 cells, but was hardly detectable in
2D6IL-2 cells. This was the case under conditions in which
comparable amounts of TYK2 protein were present in both cell types.
|
We also compared the activation of STAT3 and STAT4 between
2D6IL-12 and 2D6IL-2 following IL-12
stimulation. As shown in Fig. 6,
2D6IL-12 cells contain STAT3 and STAT4 proteins. The
phosphorylation of STAT3 and STAT4 was again observed in
2D6IL-12 cells stimulated with IL-12. Fig. 6 further shows
that the phosphorylation of STAT3 is induced more potently in
2D6IL-2 than in 2D6IL-12 cells. In contrast,
the phosphorylation of STAT4 in 2D6IL-2 was very weak
compared with that in 2D6IL-12. We examined the DNA-binding
activity of activated STAT4 by the EMSA. Nuclear extracts were prepared
from 2D6IL-12 and 2D6IL-2 unstimulated or
stimulated with IL-12 and examined for binding to an oligonucletide
probe corresponding to a consensus binding site for STAT4 (28). As
shown in Fig. 7A, nuclear
extracts from IL-12-stimulated 2D6IL-12 cells contained
proteins that bound to the STAT4-related sequence. This gel-shift band
was not observed in the presence of an excess of unlabeled probe. The
IL-12-induced DNA-protein complex was only marginally observed for
extracts from IL-12-stimulated 2D6IL-2 or unstimulated
2D6IL-12 or 2D6IL-2. Together, these
observations demonstrate that STAT4 activation and STAT4 DNA-binding
activity are induced only in 2D6IL-12 following IL-12
stimulation. It should also be noted that the amount of STAT4 protein
was found to be decreased in 2D6IL-2. This indicates a
quantitative change selective to STAT4 because the amounts of STAT3
protein in the same lysates were comparable between
2D6IL-12 and 2D6IL-2.
|
|
A). There was
almost no difference in the amount of STAT4 protein between
2D6IL-12 and 2D6IL-2 (one passage). However,
detectable levels of difference were observed in STAT4 phosphorylation
between these two types of cells. The amounts of STAT4 protein as well
as the levels of STAT4 phosphorylation decreased with the times of
passages in medium containing IL-2. 2D6IL-2 cells
maintained through multiple passages with IL-2 exhibited marginal (7
passages) or almost zero (14 passages) levels of STAT4 phosphorylation
that were associated with a decrease in the amounts of STAT4 protein.
|
B examines the time course of STAT4
phosphorylation in 2D6IL-2 cells. Five-times-passaged (P:5)
2D6IL-2 containing reduced but detectable amounts of STAT4
protein was used for this purpose. The level of phosphorylation
significantly increased from 10 min to 1 h after IL-12
stimulation, and the maximum level was observed 5–10 h after the
stimulation. Even this maximum level of STAT4 phosphorylation in
2D6IL-2 was much lower than the level in
2D6IL-12. While the delayed peak of STAT4
phosphorylation was obtained for five-times-passaged (Fig. 8B) or seven-times-passaged (data not shown)
2D6IL-2 cells, such a time course of STAT4 phosphorylation
was no longer observed for long-time-passaged 2D6 cells such as
2D6IL-2 (P:14) (data not shown). Together, there were
several steps of difference in STAT4 activation: only the level of
STAT4 phosphorylation differed between 2D6IL-12 and
2D6IL-2 (P:1); in contrast to 2D6IL-2 (P:1),
the amounts of STAT4 remarkably decreased in 2D6IL-2 (P:5
or 7) and 2D6IL-2 (P:14). The former (2D6IL-2,
P:5) induced considerable levels of STAT4 phosphorylation at later time
points after IL-12 stimulation, but the latter (2D6IL-2,
P:14) did not. It should also be noted that there was a difference in
the size of tyrosine-phosphorylated STAT4 in 2D6IL-2 cells
harvested 10 min and 1–10 h after stimulation. Such an alteration is
in parallel to the change of the major band of STAT4 protein detected
by anti-STAT4 immunoblotting (lower panel in Fig. 8B). This may be explained by a recent study of Cho et al.
(32), which demonstrated that ligand-induced serine phosphorylation is
responsible for the cytokine-induced electrophoretic mobility shift of
STAT4.
IFN- production of 2D6IL-12 and 2D6IL-2
cells following IL-12 stimulation
We next compared IL-12-stimulated IFN- production between
2D6IL-12 and 2D6IL-2 lines.
2D6IL-12 and 2D6IL-2 were starved of each
cytokine used for maintenance and then stimulated with IL-12. Fig. 9 shows that 2D6IL-12 produce
IFN- in an IL-12 dose-dependent manner. In contrast,
2D6IL-2 exhibited apparently reduced levels of IFN-
production. Their capacity to produce IFN- in response to IL-12
decreased along with the passages in IL-2 medium, and
2D6IL-2 harvested after 14 passages could produce only
marginal amounts of IFN- even by stimulation with 1000 pg/ml IL-12.
The reduced capacity of 2D6IL-2 cells to produce IFN-
was not due to the problem of the viability or impaired functional
status based on starvation because portions of the same cells exhibited
comparable levels of [3H]TdR uptake: for example,
[3H]TdR uptake of 2D6IL-12 and
2D6IL-2 (P:14) following stimulation with 1000 pg/ml IL-12
were 75,357 ± 3,201 and 74,235 ± 3,110, respectively. Thus,
2D6IL-12 and 2D6IL-2 have different capacities
to produce IFN- in response to IL-12.
|
STAT5 is known to be phosphorylated following IL-2
stimulation during IL-2-dependent growth promotion (12, 33, 34). We
finally investigated whether STAT5 is phosphorylated in
2D6IL-12 and/or 2D6IL-2 following stimulation
with either IL-2 or IL-12. Fig. 10A shows that STAT5 protein
is contained/maintained in the two 2D6 lines (lower
panel of Fig. 10A) and that IL-2 induces high levels of
STAT5 phosphorylation in both 2D6IL-12 and
2D6IL-2 (upper panel). Although the activation
of JAK3 was not observed in both 2D6IL-12 and
2D6IL-2 following IL-12 stimulation (Fig. 1B),
phosphorylation of STAT5 was also induced by stimulation with IL-12
(upper panel of Fig. 10A). STAT5 phosphorylation
was detected similarly with antiserum against STAT5a/b or STAT5a (data
not shown). The level of IL-12-induced STAT5 phosphorylation was
appreciably higher in 2D6IL-2 than in 2D6IL-12,
while both of these levels were apparently lower compared with those
induced by IL-2 stimulation.
|
B). High levels of gel-shift
bands were observed for extracts from both lines of 2D6 cells following
IL-2 stimulation. The bands were also generated by those from
IL-12-stimulated 2D6IL-12 and 2D6IL-2, although
the levels were apparently lower than those of IL-2-stimulated 2D6
cells. Thus, the phosphorylation levels of STAT5 correlate with the
STAT5 DNA-binding activity in IL-12/IL-2-stimulated
2D6IL-12 or 2D6IL-2.
More importantly, JAK2 was found to be associated with STAT5, as shown
by anti-JAK2 immunoblotting for anti-STAT5 immunoprecipitates
(Fig. 10B). Thus, the results show that JAK2 is associated
with STAT5 in both 2D6IL-12 and 2D6IL-2 and
that following IL-12 stimulation, comparable levels of STAT5
phosphorylation are induced along with JAK2 activation (Fig. 5) and
proliferation (Fig. 4).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, respectively, but proliferate similarly in
response to IL-12. The former line exhibits potent levels of TYK2 and
STAT4 phosphorylation compared with the latter. However, both lines
displayed similar levels of JAK2 and STAT5 phosphorylation. These
results suggest that the activation of TYK2 and STAT4 is responsible
for IFN- induction. In contrast, comparable levels of proliferation
correlate with the phosphorylation of JAK2 and STAT5 that have been
regarded as a set of signaling molecules in the IL-3-dependent growth
(35). Thus, the present study provides observations worthy of
consideration regarding the linkage between the JAKs and STATs used in
IL-12R signaling as well as the role of IL-12 in maintaining the levels
of JAK and STAT proteins during cultures with IL-12 stimulation alone.
It has been established that IL-12 activates two JAK kinases and two
STAT proteins: JAK2 and TYK2 for the former (13), and STAT4 and STAT3
for the latter (16, 17). IL-12 exhibits a number of bioactivities
through stimulating IL-12R ß1 and ß2
subunits and subsequently activating the above signaling molecules.
However, it has not been determined how each of these molecules is
associated with either IL-12R subunit and is responsible for the
expression of a particular IL-12 bioactivity. IL-12R signaling has been
investigated mainly using mitogen-activated or Ag-stimulated fresh T
cells as IL-12-responsive cells (13, 16, 36). While these are regarded
as physiologic responders, a limitation may exist in examining some
IL-12 bioactivities, such as the capacity of IL-12 to induce
proliferation and expression of various intracellular molecules. In
this context, we have recently established a T cell clone highly
reactive to IL-12 (23). The clone termed 2D6 exhibited various
IL-12-related features, including proliferation and IFN- production
in response to IL-12. Thus, this clone permitted us to investigate the
requirement for cytokines in the induction/maintenance of IL-12
responsiveness/IL-12R expression as well as the roles of JAK/STAT
molecules in the induction of cellular proliferation vs IFN-
production.
Recent studies have shown the role of IL-12 in the
induction/maintenance of IL-12 responsiveness (37), and more
specifically of IL-12R ß1 and ß2 subunits
(38, 39, 40). Thus, triggering of TCR on naive T cells is sufficient for
the initial expression of functional IL-12R on TCR-stimulated T cells
(39). Depending on the cytokines present during the differentiation, T
cells develop into IL-12-responsive Th1 or IL-12-unresponsive Th2
cells. It is obvious that IL-12 enhances the expression of IL-12R,
especially of the ß2 subunit, a signal-transducing
component of the IL-12R (38, 39, 40), and ensures the differentiation into
Th1 (38, 39). In addition to IL-12, several cytokines have been
described to up-regulate or down-regulate the expression of the IL-12R
ß2 subunit (37, 38, 39, 40). These include IFN-, IFN-, and
IL-4, although some of the results are seemingly controversial.
In relation to the above context, the results obtained with the 2D6
clone need to be discussed from several aspects. The fact that 2D6
cells can be maintained solely with IL-12 and continuously express
function IL-12R is compatible with the previous results, which showed
the capacity of IL-12 to induce/enhance the expression of IL-12R (38, 39). This clone continues to produce IFN- during maintenance with
IL-12. Therefore, the possibility may be raised that instead of IL-12,
IFN- contributes directly to maintaining/enhancing IL-12R
expression. However, this possibility is unlikely because IL-12
responsiveness and IL-12R-mediated signaling were not affected in 2D6
cells from cultures containing IL-12 and sufficient amounts of
anti-IFN- mAb (our unpublished observations). In addition, our
present results showed that 2D6 cells can also be maintained in
cultures containing IL-2 instead of IL-12, and such 2D6 cells
(designated here 2D6IL-2) continuously express functional
IL-12R; namely, the expression of IL-12R ß1 and
ß2 subunits can be maintained by IL-2 as well as IL-12.
Our study using the standard 2D6 (2D6IL-12) and
2D6IL-2 lines provided the following important information
and implications. Both 2D6 lines expressing IL-12R ß1 and
ß2 subunits proliferated almost equally in response to
IL-12. However, 2D6IL-12 and 2D6IL-2 differed
in the capacity to produce IFN- in response to IL-12. This
difference was associated with differential induction or activation of
STAT4 protein between two lines, which is consistent with the reports
that STAT4 is responsible for IFN- induction (41, 42). The failure
of 2D6IL-2 to produce IFN- in response to IL-12
correlated with the lack of TYK2 phosphorylation. Thus, our results
imply that both IL-12 and IL-2 can maintain the expression of IL-12R,
while the IL-12R-mediated signaling to IFN- production is
successfully induced by IL-12, but not by IL-2.
Furthermore, the present study showed the noteworthy observations
regarding the induction and activation of STAT4. First, STAT4 protein
was maintained in 2D6 cells in cultures containing IL-12, whereas it
was gradually and progressively decreased as the number of passages of
2D6 cells in IL-2-containing medium increased. In this regard, Bacon et
al. (16) reported that resting T cells do not express STAT4 protein and
that the expression of STAT4 was induced following stimulation with
agents such as PHA. Moreover, their results showed that the time course
of STAT4 induction mirrors the kinetics of induction of IL-12R
expression and the acquisition of IL-12 responsiveness (43), raising a
possibility that IL-12 may act as a mediator capable of stimulating
STAT4 expression. Our present results support this possibility. Namely,
it appears that IL-12, but not IL-2, has the capacity to
induce/maintain STAT4 protein. Accordingly, the reduction of STAT4
phosphorylation in 2D6IL-2 was ascribed largely to a
decrease in the amount of this protein. Second, STAT4 phosphorylation
correlates more closely with the activation of TYK2 than JAK2. Thus,
our results strongly suggest not only the role of IL-12 in the
induction of STAT4, but also the linkage of TYK2 activation to STAT4
phosphorylation responsible for IFN- induction.
Regarding the role of STAT4 in the induction of proliferation, studies
using STAT4-deficient mice have revealed that mitogen-activated T cells
from these mice can neither produce IFN- nor proliferate in response
to IL-12 (41). Thus, there is a possibility that STAT4 functions as a
signaling molecule leading to proliferation. In the present 2D6 model,
2D6IL-2 cells that were harvested after 14 passages with
IL-2 medium and found to express only a small amount of STAT4 protein
exhibited comparable levels of IL-12-induced proliferation with those
for 2D6IL-12 cells. These observations may make the above
possibility unlikely in the 2D6 cell system. However, more detailed
analyses will be required to conclude this, including experiments that
involve the introduction of a dominant-negative STAT4 protein into 2D6
cells.
Because JAK2 activation was induced in both 2D6IL-12
and 2D6IL-2, its significance should also be considered.
This may be done in terms of the role of JAK2 in inducing proliferation
rather than IFN- production. In relation to this, an interesting
aspect of the present observations concerns the induction of STAT5
phosphorylation in 2D6 cells following IL-12 stimulation. STAT5
phosphorylation has been demonstrated to be induced in association with
JAK3 activation following IL-2 stimulation (12, 13, 33, 44). Both JAK3
and STAT5 activation were also observed in 2D6IL-12 and
2D6IL-2 following IL-2 stimulation. Compared with
strikingly high levels of STAT5 phosphorylation after IL-2 stimulation,
the levels of STAT5 phosphorylation induced with IL-12 were weak but
significant. The fact that such an IL-12-induced STAT5 phosphorylation
occurred in the absence of JAK3 activation suggests the involvement of
the JAK kinase(s) other than JAK3. In fact, JAK2 has been shown to
activate STAT5 following stimulation with various cytokines, including
IL-3 (28, 45), IL-5 (28), and granulocyte-macrophage CSF (28). In
addition to the role of STAT5 in IL-2-induced T cell proliferation (44, 46), the combination of JAK2-STAT5 has been shown to represent a
set of signaling molecules for cytokine-dependent cellular
proliferation (28, 35, 45).
It is obvious that IL-12 stimulation leads to activating both JAK2 and STAT5 in 2D6 cells. The phosphorylation of STAT5 in 2D6 cells may occur directly as a result of IL-12-induced JAK2 activation or indirectly through stimulation with endogenous IL-2 that might be produced following IL-12 stimulation. However, the latter possibility appears to be unlikely because 1) neither IL-2 activity nor mRNA was detected in IL-12-stimulated 2D6 cells (our unpublished observations); 2) STAT5 phosphorylation was not affected by addition of anti-IL-2-neutralizing mAb (our unpublished observations); and 3) IL-12 failed to induce JAK3 activation. Moreover, we found that STAT5 is associated with JAK2 in 2D6IL-12 and 2D6IL-2. Thus, it is possible that JAK2 activated with IL-12 phosphorylates STAT5, and IL-12-dependent proliferation utilizes this JAK2-STAT5 signaling circuit in 2D6 cells as in an IL-3-dependent growth promotion. In this context, we recently found that stimulation of Con A-induced T cell blasts with IL-12 induces a significant, albeit weak, level of STAT5 phosphorylation (our unpublished observations). Further studies will be required to establish that the STAT5 phosphorylation observed in Con A blasts following stimulation with IL-12 takes place without the involvement of endogenous IL-2.
Our present results illustrate that IL-12 has the capacity to
induce/maintain both STAT4 and STAT5. Through the association with a
particular JAK family member, these STAT proteins play a crucial role
in either IFN- production or proliferation following IL-12
stimulation. These observations have significant implications for
understanding molecular mechanisms underlying the IL-12R signaling. The
2D6 system could also provide an intriguing model to design the
manipulation of IL-12-induced bioactivities through regulating the
activation of various signaling molecules such as STAT4 and STAT5.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Hiromi Fujiwara, Biomedical Research Center, Osaka University Medical School, 2-2, Yamada-oka, Suita, Osaka 565, Japan.
3 Abbreviations used in this paper: JAK, Janus kinase; EMSA, electrophoretic mobility shift assay.
Received for publication March 23, 1998. Accepted for publication July 27, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production by natural killer cell stimulatory factor: characterization of the responder cells and synergy with other inducers. J. Exp. Med. 173:869./ß signaling pathway. Cell 70:313.[Medline]
signal transduction pathway. Nature 366:166.[Medline]
rapidly induces in human monocytes a DNA-binding factor that recognizes the response region within the promoter of the gene for the high-affinity Fc receptor. Proc. Natl. Acad. Sci. USA 89:11964. interferon activation site-binding protein expressed in early myeloid differentiation. Mol. Cell. Biol. 14:4342.-inducing factor in enhanced production of IFN-. J. Immunol. 159:2125.: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J. Immunol. 157:4781.[Abstract]
and interleukin-4 regulate T cell interleukin-12 responsiveness through the differential modulation of high-affinity interleukin-12 receptor expression. Eur. J. Immunol. 27:647.[Medline]
This article has been cited by other articles:
|
|
 |
|
  V. Paunovic, H. P. Carroll, K. Vandenbroeck, and M. Gadina Signalling, inflammation and arthritis: Crossed signals: the role of interleukin (IL)-12, -17, -23 and -27 in autoimmunity Rheumatology, June 1, 2008; 47(6): 771 - 776. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Yoshimoto, M. Furuhata, S. Kamiya, M. Hisada, H. Miyaji, Y. Magami, K. Yamamoto, H. Fujiwara, and J. Mizuguchi Positive Modulation of IL-12 Signaling by Sphingosine Kinase 2 Associating with the IL-12 Receptor {beta}1 Cytoplasmic Region J. Immunol., August 1, 2003; 171(3): 1352 - 1359. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Nishikomori, T. Usui, C.-Y. Wu, A. Morinobu, J. J. O'Shea, and W. Strober Activated STAT4 Has an Essential Role in Th1 Differentiation and Proliferation That Is Independent of Its Role in the Maintenance of IL-12R{beta}2 Chain Expression and Signaling J. Immunol., October 15, 2002; 169(8): 4388 - 4398. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Burdelya, R. Catlett-Falcone, A. Levitzki, F. Cheng, L. B. Mora, E. Sotomayor, D. Coppola, J. Sun, S. Sebti, W. S. Dalton, et al. Combination Therapy with AG-490 and Interleukin 12 Achieves Greater Antitumor Effects than Either Agent Alone Mol. Cancer Ther., September 1, 2002; 1(11): 893 - 899. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-S. Park, Y.-F. Yang, X.-Y. Zhou, K. Toyooka, Y. Yashiro-Ohtani, W.-R. Park, M. Tomura, X.-G. Tai, T. Hamaoka, and H. Fujiwara Reversible CD8 expression induced by common cytokine receptor {gamma} chain-dependent cytokines in a cloned CD4+ Th1 cell line Int. Immunol., March 1, 2002; 14(3): 259 - 266. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nakahira, H.-J. Ahn, W.-R. Park, P. Gao, M. Tomura, C.-S. Park, T. Hamaoka, T. Ohta, M. Kurimoto, and H. Fujiwara Synergy of IL-12 and IL-18 for IFN-{gamma} Gene Expression: IL-12-Induced STAT4 Contributes to IFN-{gamma} Promoter Activation by Up-Regulating the Binding Activity of IL-18-Induced Activator Protein 1 J. Immunol., February 1, 2002; 168(3): 1146 - 1153. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nakahira, M. Tomura, M. Iwasaki, H.-J. Ahn, Y. Bian, T. Hamaoka, T. Ohta, M. Kurimoto, and H. Fujiwara An Absolute Requirement for STAT4 and a Role for IFN-{gamma} as an Amplifying Factor in IL-12 Induction of the Functional IL-18 Receptor Complex J. Immunol., August 1, 2001; 167(3): 1306 - 1312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. Verhagen, T. de Boer, H. H. Smits, F. A.W. Verreck, E. A. Wierenga, M. Kurimoto, D. A. Lammas, D. S. Kumararatne, O. Sanal, F. P. Kroon, et al. Residual Type 1 Immunity in Patients Genetically Deficient for Interleukin 12 Receptor {beta}1 (IL-12R{beta}1): Evidence for an IL-12R{beta}1-independent Pathway of IL-12 Responsiveness in Human T Cells J. Exp. Med., August 14, 2000; 192(4): 517 - 528. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. Wang, D. A. Frank, and J. Ritz Interleukin-2 enhances the response of natural killer cells to interleukin-12 through up-regulation of the interleukin-12 receptor and STAT4 Blood, May 15, 2000; 95(10): 3183 - 3190. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
