|
|
||||||||
Department of Medical Biochemistry, University of Wales College of Medicine, Heath Park, Cardiff, United Kingdom
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
DAF is a glycosylphosphatidylinositol (GPI)-linked glycoprotein comprising four SCR domains followed by a serine/threonine rich-stretch that is heavily O glycosylated (5). The C regulatory activity of DAF resides in its ability to accelerate the decay of the classical and alternative pathway C3 convertases, C4b2a and C3bBb. Several mAbs capable of inhibiting the function of DAF have been generated, and all of these target SCR3, indicating that this region is critical for association with the C3 convertase (6). However, deletions of individual SCRs demonstrate that SCR2 and -3 are both required for efficient regulation in the classical pathway, while SCR2, -3, and -4 are all required for alternative pathway regulation (7). A second form of human DAF is generated by alternative splicing in the gene, causing a frame shift resulting in a hydrophilic carboxyl terminus, which is predicted to encode a secreted form of the protein (8).
DAF was isolated from guinea pig erythrocytes a year before the isolation of human DAF (9). Subsequently, progress on characterizing decay-accelerating activities from nonhuman species has been slow. A rabbit analogue of DAF was isolated in 1987 (10), mouse DAF was identified in 1989 (11), and DAF was purified from orangutan erythrocytes in 1990 (12). Although DAF in each of these species was similar in many respects to the human protein, some interesting differences emerged. Guinea pig, rabbit, and orangutan DAF were all GPI anchored, but mouse DAF was suggested to contain both GPI-anchored and transmembrane forms. Guinea pig erythrocyte DAF was shown to consist of three distinct species with a molecular mass of 55, 70, and 88 kDa, respectively, all of which had identical amino-terminal sequences (13). In the rat, the only regulator of the C3 convertases so far described is Crry, a 6- or 7-SCR transmembrane molecule that has both decay accelerating and cofactor activities for the convertases and has been suggested to fulfill the roles of both MCP and DAF (14, 15). In order to better understand the factors controlling C activation in rodents during the induction of experimental models of C-mediated disease, it is essential to comprehend fully the regulatory proteins involved. Therefore, we have set out to identify and characterize CRP in the rat. We report here the identification and functional and molecular characterization of the rat analogue of DAF.
| Materials and Methods |
|---|
|
|
|---|
Molecular biology.
All general reagents were from Sigma Chemical (Poole, U.K.) unless
otherwise stated. Rat cDNA and genomic libraries were from Stratagene
(La Jolla, CA). UltraSpec RNA isolation medium was from Biotecx,
(Houston, TX). RNase H- Superscript reverse transcriptase,
RNase H, terminal deoxynucleotide transferase, and all
restriction enzymes were from Life Technologies (Paisley, U.K.). Nick
columns for radioactive probe purification, Taq polymerase,
and buffers were from Pharmacia (Milton Keynes, U.K.), Vent DNA
polymerase was from New England Biolabs (Hitchin, U.K.), and dNTPs were
from Bioline (London, U.K.). The RNase inhibitor rRNasin and the
pGEM-T vector kit were from Promega (Southampton, U.K.). Geneclean II
DNA purification kit was from Anachem (Luton, U.K.), and plasmid
purification kits were from Qiagen (Dorking, U.K.). Hybond-N nylon
membranes, Rapid-Hyb buffer, Rediprime DNA labeling system, and
[
-32P]dCTP were from Amersham (Little Chalfont, U.K.).
Oligonucleotide primers were synthesized in-house on an ABI model 394
synthesizer (Applied Biosystems, Warrington, U.K.). The expression
vector pDR2EF1
was a gift from Dr I. Anegon (Institut National de la
Santé et de la Recherche Médicale U437, Nantes, France)
(16) and contains the hygromycin resistance gene, which allows the
selection of stable colonies, and the powerful polypeptide chain
elongation factor 1
promotor.
Tissues, cells, and sera. Mouse and rat sera were obtained fresh from the animal facility of the University of Wales College of Medicine. All serum was stored at -70°C. Rat erythrocytes were obtained fresh from the same facility and collected into 20 mM EDTA before processing for Western blot and flow cytometry. The mouse fibroblast cell line NIH-3T3 was obtained from the European Collection of Animal Cell Cultures (Porton Down, U.K.). The rat fibroblast cell line RAT2 was obtained from the American Type Culture Collection (Manassas, VA). All cell lines were propagated in DMEM supplemented with 10% FCS, glutamine, pyruvate, and penicillin/streptomycin.
Antibodies. mAbs against rat DAF (RDIII-7 and RDII-24) were generated by repeated immunization of BALB/C mice with NIH-3T3 cells transfected with rat DAF cDNA as described below. The transfected cells were used as immunogen and for screening clones for anti-DAF reactivity. The production and characterization of anti-rat DAF mAbs will be described in detail elsewhere. Mouse monoclonal anti-human C3 (C3/30; known to cross-react with rat C3) was the kind gift of Dr. Peter Taylor (Novartis, Horsham, U.K.). Horseradish peroxidase-conjugated secondary Abs against mouse and rabbit Ig were obtained from Bio-Rad Laboratories (Hertfordshire, U.K.). Phycoerythrin-conjugated secondary Abs against mouse and rabbit Ig were obtained from Dako (Buckinghamshire, U.K.) and Sigma-Aldrich (Dorset, U.K.), respectively. Mouse monoclonal anti-rat CD59 (6D1) was raised in this laboratory and is described elsewhere (17). Mouse monoclonal anti-human DAF (1H4) was a kind gift from Dr. Wendell Rosse (Duke University, Durham, NC).
Screening a rat cDNA library
A 489-bp probe encompassing nucleotides 4492 of the mouse DAF
cDNA sequence (GenBank accession no. L41366) was generated by PCR from
mouse testis cDNA and isolated by elution from a low melting point
agarose gel. The probe was radiolabeled with
[
-32P]dCTP using the Rediprime kit (Amersham)
according to the manufacturers protocol. The labeled probe was
purified from residual nucleotide using a Nick column (Pharmacia). A
rat kidney Uni-ZAP XR cDNA library (Stratagene) was plated out at
40,000 plaque-forming units (pfu) per plate and grown on a lawn
of XL1-Blue Escherichia coli for 8 h. Duplicate lifts
were taken using Hybond-N nylon membranes. These were denatured in 1.5
M NaCl/0.5 M NaOH, neutralized in 1.5 M NaCl/0.5 M Tris (pH 8.0),
washed in 2x SSC, and UV cross-linked in a Stratagene Stratalinker.
Membranes were prehybridized in Rapid-Hyb buffer for 1 h at 55°C
before addition of the radiolabeled probe and incubation for a further
18 h at 55°C. Membranes were then washed (twice in 1x SSC/0.1%
SDS for 10 min at room temperature and once in 0.2x SSC/0.1% SDS for
5 min at 65°C) and exposed to x-ray film for 18 h at -70°C.
Agar plugs containing plaques positive on both of the duplicate membranes were picked, eluted in 1 ml saline magnesium buffer for 24 h, and replated. The above screening protocol was then repeated. Individual positive plaques were picked and eluted in saline magnesium buffer. The cDNA insert was recovered from the phage using the Exassist/SOLR system (Stratagene). Individual bacterial colonies containing recombinant phagemid were grown in Luria-Bertani broth containing 50 µg/ml kanamycin, and the phagemid DNA was purified using a QIAprep spin plasmid miniprep kit (Qiagen). Automated sequencing was conducted in-house using an ABI model 377 DNA sequencer (Applied Biosystems).
Derivation of the 5' end of rat DAF cDNA
The 5' end of the cDNA encoding rat DAF was obtained using a modification of the rapid amplification of cDNA ends (RACE) method described by Frohman (18). A rat DAF-specific primer RDAF-RT (ATTTCCAACCAGAATGAAGCC) (6 pmol), derived from the cDNA sequence obtained from the cDNA library clone, was used in the reverse transcription of the 5' end of the mRNA from 10 µg total RNA from rat kidney. After reverse transcription, the RNA was degraded by incubation for 20 min at 37°C with 2.5U RNase H. The single-stranded cDNA generated by reverse transcription was purified from primers and enzyme using the Geneclean II kit (Anachem). The purified cDNA was polyadenylated at its 3' end by incubation with 10 U of terminal deoxynucleotide transferase (Life Technologies) in the presence of 5 mM ATP at 37°C for 5 min, then 65°C for 10 min. The mixture was heated to 95°C to denature the enzyme, and 5% of the resulting polyadenylated single-stranded cDNA was used directly in the first PCR amplification. Second-strand synthesis was performed using a poly(dT) adaptor primer QT (CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCT17), which binds to the newly synthesized poly(A) tail and consequently adds an extra 35 bases of unique sequence to the cDNA end. PCR amplification of the rat DAF cDNA was performed using primers specific for this unique sequence, Q0 (CCAGTGAGCAGAGTGACG) and Q1 (GAGGACTCGAGCTCAAGC), and the rat DAF-specific primers RDAF-E (CTTTCCTCTCGAATTCTTCC), RDAF-D (GATTTTTGGTGGGTCTGGAC), and RDAF-L (CAGTTCTCTAGGATTAGGGC), which were designed from the cDNA sequence obtained from the degenerate PCR reaction. In the first amplification, the cDNA was amplified using 3 pmol QT primer, 25 pmol Q0, and 25 pmol RDAF-E, under the following conditions: 96°C for 5 min, 50°C for 2 min (ramp, 2.5), 72°C for 40 min, followed by 30 cycles of 94°C for 1 min, 58°C for 1 min, and 72°C for 2 min. A 1-µl aliquot of a 1:20 dilution of the first reaction was reamplified using 25 pmol of each of the nested primers Q1 and RDAF-D under the following conditions: 94°C for 1 min, 60°C for 1 min (ramp, 2.5), and 72°C for 2 min for 30 cycles. A 1-µl aliquot of a 1:20 dilution of the second reaction was further amplified by the nested primers Q1 and RDAF-L under the same conditions.
Derivation of the 3' end of rat DAF GPI cDNA
The 3' end of the cDNA encoding the GPI-anchored form of rat DAF was obtained using a modification of the RACE method, described by Frohman (18). The poly(dT) adaptor primer QT (28 pmol) was used to reverse transcribe mRNA from 10 µg of total RNA from rat testes, kidney, and lung. Nested PCR was performed using Q0 and Q1 along with rat DAF-specific primers RDAF-A (GAGGAATTAGTATGGTCTCC), RDAF-B (CCAACTGACATATTATTCGG), and RDAF-C (CAAAGGGTACAAGCTGGTCGG), designed from the cDNA sequence obtained from the clones isolated from the cDNA library. In the first amplification, 7% of the QT-primed cDNA was amplified using 25 pmol of primers Q0 and RDAF-A under the following reaction conditions: 94°C for 30 s, 56°C for 1 min (ramp, 2.5), and 72°C for 2 min for 30 cycles. In the second amplification, a 1-µl aliquot of a 1:20 dilution of the first reaction was amplified using 25 pmol of Q1 and 25 pmol of RDAF-B under the following reaction conditions: 94°C for 30 s, 60°C for 1 min (ramp, 2.5), and 72°C for 2 min for 30 cycles. In the third amplification, a 1-µl aliquot of a 1:20 dilution of the second amplification was amplified using 25 pmol of Q1 and 25 pmol of RDAF-C under the following reaction conditions: 94°C for 30 s, 60°C for 1 min (ramp, 2.5), and 72°C for 2 min for 30 cycles.
Cloning and sequencing of PCR products
Purified PCR products were ligated into the pGEM-T vector
(Promega) according to manufacturers protocol. The vector was then
electroporated into electrocompetent DH5
E. coli at 2.5
kV, 25 µFD, and 200
using a Bio-Rad Genepulser, and transformed
bacteria were selected out by ampicillin resistance. Positive colonies
were picked and grown overnight in LB broth containing 50 µg/ml
ampicillin at 37°C, and the plasmids were purified using the QIAprep
spin plasmid kit (Qiagen).
Automated sequencing was conducted in-house using an ABI model 377 DNA sequencer (Applied Biosystems).
Northern blot analysis
Total RNA was extracted from tissue samples using UltraSpec RNA isolation reagents (Biotecx). Messenger RNA was isolated from 0.51 mg of total RNA using the Poly(A)ttract magnetic isolation kit (Promega). Purified mRNA (23 µg) was separated on a 1% formaldehyde-agarose gel, transferred to Hybond-N nylon membranes (Amersham), and probed using 32P-labeled cDNA probes specific for glyceraldehyde phosphate dehydrogenase (GAPDH; gift of Dr. D. Llewellyn, Department of Medical Biochemistry, University of Wales College of Medicine) or SCR14 of rat DAF. RNA markers (Promega) were used to determine the size of the RNA species identified by autoradiography.
RT-PCR analysis
Total RNA from rat tissues was reverse transcribed using random hexamer DNA primers. The presence of cDNA encoding the two forms of rat DAF was determined by PCR using primer MRDAF-T (GGAGACTGCGGCCCACCTCC) along with either RD59-Y (GGTGGATCCGACCATTCCAGACAACCTCC) or RD59-Z (GGTGGATCCTTTCCCACTTAACAATGCCC) to amplify the full length coding sequences, excluding the signal peptide. Cycling conditions were: 94°C for 30 s, 56°C for 30 s, 72°C for 2 min for 5 cycles, followed by 94°C for 30 s, 66°C for 30 s, and 72°C for 2 min for 25 cycles. The PCR products were run on a gel, blotted, and probed using specific probes. Primers specific for GAPDH were used to amplify the cDNA as an internal control.
Southern blot analysis
Genomic DNA was prepared from rat tail snips (1 mm) as described elsewhere (19). The DNA (10 µg) was digested with four restriction enzymes that did not cleave within the rat DAF cDNA sequence, BamHI, EcoRV, PstI, and XbaI, in single and double digests. The digested DNA was run on a 0.8% agarose gel, denatured with 0.5 M NaOH, neutralized with 1 M Tris (pH 7.5), and blotted onto Hybond-N membranes. After UV cross-linking, the membranes were probed with radiolabeled DNA probes specific for SCR1 and -3 of rat DAF, generated as described above.
Screening a rat genomic library
The templates corresponding to the four SCRs were generated
individually by PCR and radiolabeled with [
-32P]dCTP
as described above. A rat kidney
FIX II genomic library
(Stratagene) was plated at 40,000 pfu/plate and grown on a lawn of
XL1-Blue MRA (P2) strain E. coli for 8 h. Lifts were
taken and hybridized as above. Agar plugs containing plaques positive
on both of the duplicate membranes were picked, eluted in 1 ml SM
buffer for 24 h, and replated. The above screening protocol was
then repeated. Individual positive plaques were picked and eluted in SM
buffer.
Purification of genomic phage DNA
Phage was plated at sufficient density to give complete host bacterial lysis of the lawn of XL1-Blue after an overnight incubation. The phage from these fully lysed plates was eluted in 10 ml of SM buffer for 5 h. The buffer, containing eluted phage, was transferred to a 50-ml Falcon tube, 1 ml chloroform was added, and the tube was vortexed and centrifuged at 8000 x g for 10 min to pellet any bacterial or agarose debris. The supernatant was transferred to a fresh tube; 5 U RNase A, 18,000 U RNase T1, and 600 U DNase 1 were added; and the mixture was incubated at 37°C for 30 min.
The
phage particles were precipitated by the addition of 6 ml of
solution 1 (20% polyethylene glycol (PEG 8000), 2 M NaCl, in SM
buffer) on ice for 45 min. The mixture was centrifuged at 8000 x
g for 20 min and the pellet air dried before resuspension in
0.5 ml SM buffer. Solution 2 (200 µl; 1.5% SDS, 0.3 M Tris-HCl, pH
8.0, 0.15 M EDTA) was added and the mixture incubated at 68°C for 15
min to lyse phage particles. Addition of 250 µl of solution 3 (3 M
potassium acetate, 11.5% v/v glacial acetic acid) followed by
incubation on ice for 20 min before centrifugation at 1300 rpm for 10
min. The supernatant was transferred to a separate tube and the DNA
precipitated by addition of 0.5 volumes of isopropanol and incubation
on ice for 5 min, followed by centrifugation. The pellet was
resuspended in TE buffer and the DNA reprecipitated by the addition of
2.5 µl 5 M NaCl and 100 µl ethanol. After a 75% ethanol wash, the
pellet was resuspended in 50 µl Tris-EDTA (TE) buffer.
Digestion of the phage DNA with NotI allowed recovery of the genomic DNA insert, which was ligated into pBluescript, previously cut with NotI and dephosphorylated using shrimp alkaline phosphatase (Boehringer Mannheim, Lewes, U.K.).
Clones containing the genomic inserts were purified and used as a
template for PCR within and between exons, using primers from within
the individual SCRs. To sequence the remainder of the signal peptide,
genomic clones positive for SCR1 were digested with pst1 and
BamHI restriction enzymes in single and double digests.
These fragments were run on agarose gels, purified by Geneclean
(Anachem), and ligated into pBluescript, previously digested with the
same enzymes. After electroporation into DH5
bacteria, clones were
PCR screened and sequenced.
Expression of rat DAF
At the time we wished to express rat DAF, the signal peptide
sequence was not identified. We therefore generated by two-stage PCR a
construct in which the cDNA encoding the signal peptide from mouse DAF
was coupled to the rat DAF GPI-coding region cDNA. Two primers, MRDAF-R
(GGTTCTAGATTCTACCTGGGGCTATGATCC) and MRDAF-S
(GGCATTAGGAATGTCTGGAGG), were designed to PCR amplify the mouse DAF
signal peptide, including the Kozak sequence essential for ribosomal
recognition of the translational start site, and a 36-bp region of
exact homology between mouse and rat DAF. The GPI-specific primer
RD59-Y along with MRDAF-T (described above) was used to PCR amplify the
cDNA for the putative GPI-anchored form of rat DAF. These two PCR
products were then mixed in equimolar ratios and PCR amplified using
the two outside primers MRDAF-R and RD59-Y to give the full length
construct. Vent DNA polymerase (New England Biolabs) was used in all
PCRs to minimize the introduction of errors. The PCR primers MRDAF-R
and RD59-Y contained XbaI and BamHI
restriction sites, respectively, ensuring the correct orientation of
the insert in the pDR2
EF1
expression vector. After
electroporation into DH5
, colonies were picked and the plasmids
purified. The presence and fidelity of the rat DAF cDNA construct in
the vector was confirmed by DNA sequencing. The insert was released by
digestion with XbaI and EcoRI, purified from an
agarose gel using Geneclean II (Anachem), and ligated into the
pDR2
EF1
expression vector, which had been digested with
XbaI and EcoRV. An identical strategy was used
with the cDNA encoding the putative secretory form of DAF.
The NIH-3T3 murine fibroblast cell line was transfected using lipofectamine, as described (20, 21), with the empty expression vector (negative control) or with expression vectors containing either form of rat DAF cDNA, human DAF cDNA, or rat CD59 cDNA. Surface expression of each molecule was assessed by flow cytometry using saturating amounts of the appropriate mAbs or irrelevant control Abs, followed by a phycoerythrin-conjugated secondary Ab. The effects of various agents on the surface expression of rat and human DAF were examined. To remove nonspecific binding, cells were subjected to two cycles of acid washing in PBS at pH 2, followed by three washes in PBS at pH 7. Trypsin sensitivity and susceptibility to cleavage by phosphatidylinositol-specific phospholipase C (PIPLC; 0.4 U/ml, Peninsula Laboratories, St. Helens, U.K.) were assessed by incubation at 37°C for 90 min with the appropriate enzyme. Cells were then stained as described above for flow cytometry. All samples were run in triplicate, and each experiment was replicated on at least four separate occasions.
Expression of rat DAF was confirmed by Western blotting of cell lysates and growth media. Cells were grown to confluency in 80-cm2 cell culture flasks; fresh medium was then added and the cells grown for a further 72 h. Medium was decanted, centrifuged to remove cellular debris, and mixed with an equal volume of reducing or nonreducing SDS-PAGE sample buffer. Cells were harvested by scraping from a confluent 80-cm2 flask and centrifuged at 2,000 x g for 10 min. This pellet was resuspended in 0.5 ml of ice-cold 1% Triton X-114 in hypertonic lysis buffer, pH 7, and vortexed for 30 min. Insoluble material was removed by centrifugation at 13,000 x g at 4°C, and the supernatant was layered onto 0.5 ml of ice-cold 6% sucrose/1% Triton X-114, and incubated at 37°C for 15 min to allow phase separation. The lower detergent-rich layer was recovered after centrifugation and mixed with an equal volume of nonreducing loading buffer. The same protocol was also used with 100 µl of packed rat erythrocytes. Aliquots (10 µl) were run on 10% SDS-PAGE gels. Gels were blotted and probed with Abs as described previously (22).
Functional assays
The GPI-DAF-transfected cells and vector-transfected cells were cultured overnight in 24-well plates (105 cells/well). NIH-3T3 cells spontaneously activate rat, mouse, and human C (our unpublished observations), but to gain maximal C3 deposition, normal rat serum was mixed at a 3:1 ratio with serum taken from rats that had been previously immunized with untransfected NIH-3T3 cells. To measure C3 deposition, adherent cells cultured for 24 h were washed twice in PBS and overlayed with a 1:4 dilution of rat serum in veronal-buffered saline. Following a 10-min incubation at 37°C, the serum was removed and the cells were washed in flow cytometry medium (FCM; PBS/2% BSA/15 nM EDTA), which both stopped activation of C and disaggregated the cells for flow cytometry. The cells were resuspended in FCM to 0.5 ml, and 0.25 ml was removed and incubated with a 1/100 dilution of monoclonal anti-C3 Ab (C3-30), while the remaining 0.25 ml was incubated with the same dilution of isotype-matched control Ab (OX-23). The cells were then analyzed by flow cytometry. Background staining (OX-23) was subtracted from the value for C3 binding for each sample.
| Results |
|---|
|
|
|---|
Screening of a rat kidney cDNA phage library (4.8 x 105 pfu) with a mouse DAF probe identified two positive clones from separate plates, which were isolated and sequenced in their entirety. Both contained identical sequences of 1411 bp in length within which was a region of 678 bp which was highly homologous to the published mouse DAF cDNA encoding amino acids 106335 (22). Through this region, which encompassed part of SCR2, all of SCR3 and 4, and the ST-rich region in mouse DAF, the predicted amino acid sequence was 65% identical, strongly indicating that the isolated cDNA was a rat analogue of DAF. The remaining 733-bp region, encoding 112 amino acids before the stop codon, was not homologous with any of the reported forms of mouse, human, or guinea pig DAF at the amino acid or nucleotide level. The amino acid sequence of this 112-amino acid "tail" had no consensus GPI-addition signal and no hydrophobic domains indicative of a transmembrane protein, raising the possibility that it might be a secreted protein (hereafter termed "secreted").
Cloning of rat DAF using RACE
A 5'RACE approach was used to clone the cDNA encoding the amino-terminal portion of rat DAF. After three rounds of PCR amplification, a single 453-bp product from rat kidney cDNA was cloned and sequenced. This cDNA encoded SCR1 and 2 as well as part of the signal peptide of rat DAF. Despite several further attempts and many modifications of the RT reaction, we were unable to isolate longer products containing the rest of the signal peptide and the 5' untranslated region (UTR).
To determine whether other forms of rat DAF cDNA existed with different
3' ends, as shown in other species, 3'RACE was performed on mRNA from
rat testes, lung, and kidney. After three rounds of amplification, a
single 971-bp product was obtained from all three tissues. Sequencing
of the cloned PCR product revealed a 3' sequence different from that in
the clone isolated from the cDNA library. The two sequences were
identical up to residue 1143 in the coding sequence except that the PCR
product contained an additional 51-bp sequence encoding a
stretch of 17 amino acids in the ST-rich region (residues
Lys293Val309 in the coding region; underlined
in Fig. 1
). After residue
Gly347, the two sequences diverged; instead of encoding the
unique 112-amino acid tail, the PCR product encoded an 18-amino acid
hydrophobic stretch that was highly predictive of a GPI anchor addition
signal (hereafter termed GPI).
|
|
Northern blot analysis of mRNA from five tissues revealed a 2.4-kb
species that was expressed abundantly in the lung and, on longer
exposure, was also seen in the kidney, liver, and spleen (Fig. 3
). A 1.4-kb species was expressed
abundantly in the testes and, on longer exposure, was also detected in
the lung, kidney, and spleen. Comparison of the expression level of
each species in each tissue with the expression of GAPDH confirmed the
predominance of the 2.4-kb species in lung and the extremely high level
of expression of the 1.4-kb species in testis. Expression in other
tissues was low or undetectable by this technique.
|
|
Genomic DNA was digested with restriction enzymes, Southern
blotted, and probed with radiolabeled DNA specific for SCR1 and SCR3
(Fig. 5
). BamHI and
EcoRV digests gave single bands of 9.7 kb and 6.4 kb,
respectively, with both SCR1- and SCR3-specific probes. The
PstI digest produced single bands of 8.0 kb with SCR3 and
1.6 kb with SCR1. The XbaI digest produced a single band of
6.8 kb with SCR1, but two bands of 6.8 kb and 11 kb with SCR3. These
two bands were equal in intensity and were approximately one-half the
intensity of the bands from the BamHI and PstI
digests. Double digests using combinations of BamHI,
PstI, and EcoRV produced single bands when probed
with either SCR1 or -3, whereas double digests using XbaI
always produced two bands of reduced intensity (not shown).
|
Screening of a rat genomic
phage library (4.8 x
105 pfu) with a mixture of SCR-specific cDNA probes
identified four positive clones from separate plates. Digestion of
purified phage DNA with NotI released inserts ranging from
1219 kb, all of which were cloned into pBluescript. PCR within exons
revealed that two clones contained all four SCRs, one clone contained
only SCR1 and -2, while the fourth clone contained only SCR3 and -4.
The data revealed that SCR3 was split between two exons 1.3 kb apart,
hereafter termed SCR3a and SCR3b. PCR between exons determined that the
size of intronic DNA between SCR1 and -2 was 2.5 kb, SCR2 and -3a was
1.6 kb, and SCR3b and -4 was 6 kb.
A genomic clone containing all four SCRs was digested with pstI and BamHI and cloned into pBluescript for sequencing. SCR1 and SCR2 were present in two separate 1.6-kb fragments from the pstI digestion. A 0.8-kb fragment from the pstI and BamHI double digest contained the DNA encoding the elusive signal peptide.
Expression of the GPI-anchored and secretory forms of rat DAF in NIH-3T3 cells
Expression was assessed by flow cytometry and Western blot using
specific mouse mAbs against rat DAF, RDIII-7, and RDII-24, generated
in-house. Fig. 6
A shows the
relative surface expression levels of the two forms of rat DAF as
compared with the vector control-transfected cells. The level of
expression of GPI-anchored rat DAF in the transfected cell line,
assessed by flow cytometry, was 14-fold that of endogenous DAF on rat
erythrocytes and 30-fold that of the rat fibroblast cell line RAT-2
(data not included). The secretory form of rat DAF showed low levels of
cell surface expression,
10-fold less than that of the
GPI-linked form. Fig. 6
B shows the effects of the three
treatments on the expression of rat or human DAF on the transfected
cells. Acid wash increased the levels of anti-rat DAF binding to
the secretory DAF expressing cells by
80%, but had little effect on
binding to GPI-DAF-expressing cells; similarly, 1H4 binding to human
DAF expressing cells was unaffected. Trypsinization also had little
effect on human DAF expression, but almost completely removed both
forms of rat DAF from the cell surface. PIPLC treatment reduced
the levels of both human DAF and rat GPI-DAF by 90%, but caused a 20%
increase in Ab binding to the cells expressing the secretory form of
rat DAF.
|
|
Protection against C was assessed in transfected cells by
measuring C3 deposition. Rat C3 deposition on each of the rat
DAF-transfected lines, measured by flow cytometry, was compared with
human DAF-transfected cells, using cells transfected with vector alone
as a control. Cells highly expressing rat CD59 were also used as a
control to determine whether any of the observed effects were artifacts
of the high expression of protein at the cell surface. Vector control
or rat CD59-expressing cells had similar, high levels of C3 deposited
on their cell surface, whereas C3 deposition on human DAF- and rat
GPI-DAF-expressing cells was reduced by
70% (Fig. 6
C).
The cells expressing secretory rat DAF had a reduction in C3 deposition
of
20% compared with the controls.
| Discussion |
|---|
|
|
|---|
Within the last 2 years, the cloning of the cDNAs for both murine and guinea pig DAF have been described. Multiple cDNAs encoding guinea pig DAF were isolated from a spleen library (13). All encoded the four SCR structures that typify DAF and were identical with one another and 58% identical to human DAF through this region. However, alternative splicing generated several different isoforms that differed in the length of the ST-rich region, a feature also found in human MCP, in which the STP region is encoded on several exons that can be alternatively spliced (29). In addition, alternative splicing of two exons in the region encoding the carboxyl teminus of the protein-generated cDNAs encoding transmembrane, GPI-anchored, and secreted forms. Mouse DAF, independently cloned in three laboratories, provides an even more complex story (23, 30, 31). The protein was encoded on two separate genes, which were 85% identical at the nucleotide level and 78% identical at the amino acid level but encoded, respectively, GPI-anchored (Daf-gpi) and transmembrane (Daf-tm) forms of the protein. By Northern analysis, mRNA encoding the GPI-linked form of DAF was present in relative abundance in all tissues, whereas mRNA encoding the transmembrane form was abundant only in the testis and was weakly detected in lymphoid tissue. Mouse DAF GPI was 47% identical to both human and guinea pig DAF at the amino acid level (30).
Crry remains the only membrane CRP acting on the C3 convertase identified in the rat. The demonstration of DAF analogues in mice and guinea pigs led us to suspect that rats would also express DAF. We used a cDNA probe derived from the coding region of mouse DAF to screen a rat kidney cDNA library and identified clones containing the bulk of the rat DAF coding sequence (part of SCR2, the whole of SCR3 and -4, and the ST-rich region) that was highly homologous with the published sequence of mouse DAF, a long tail of 733 bp unrelated to published DAF sequences, and a 3'UTR region. The long tail encoded 112 amino acids of protein sequence before the stop codon, which contained no motifs predictive of GPI or transmembrane anchoring, suggesting that the product was secreted. This species was thus termed secreted DAF. Searches of protein and DNA databases have failed to identify any significant homologies with the tail, which represents a novel sequence. The same sequence was obtained from multiple clones and could be identified in mRNA isolated from rat tissues, making it unlikely that it was an artifact generated during creation of the cDNA library.
Most of the missing 5' sequence was obtained by 5'RACE, which generated
a single specific product from rat kidney RNA containing the remainder
of the cDNA coding for the mature protein, but only part of the signal
peptide and no 5'UTR. All attempts to obtain the remainder of the
signal peptide by modification of the 5'RACE reaction and use of a
thermostable reverse transcriptase failed to produce a longer product.
Isolation of phage containing portions of the rat DAF gene from the
genomic library allowed cloning and sequencing of fragments of genomic
DNA within which the signal peptide was identified. Analysis of this
extra 5' sequence revealed a highly GC-rich region likely to form a
hairpin loop in the RNA, perhaps explaining our inability to sequence
this region by 5'RACE (Fig. 1
).
A second form of rat DAF was obtained by 3'RACE using DNA from the
kidney, lung, and testis. The product was, apart from an additional 51
bp encoding an extra 17 amino acids in the ST-rich region, identical to
the library clone up to residue Gly347. Thereafter, the
sequence encoded a hydrophobic stretch of 18 amino acids before a stop
that was highly predictive of a GPI-addition consensus sequence, which
was therefore termed GPI-DAF. The additional sequence, encoding
residues Lys293 to Val309, was present in all
15 clones of GPI-DAF cDNA sequenced, but none of 5 secreted DAF cDNA
clones. Mouse DAF is encoded on two closely linked genes,
Daf-gpi and Daf-tm (23, 30, 31). Identity of
sequence through the coding regions makes it highly likely that the two
forms of rat DAF are encoded on a single gene and derived by
alternative splicing. To confirm this possibility, we subjected genomic
DNA to digestion with a panel of restriction enzymes chosen not to cut
in the coding region and Southern blotted the digests with probes
specific for SCR1 and SCR3 of rat DAF (Fig. 5
). Both single and double
digests of genomic DNA yielded only single bands when probed with
either SCR1 or SCR3 for all four enzymes, with the sole exception of
the XbaI digest probed with SCR3. In human DAF, SCR3 alone
among the SCRs is encoded on two exons (32). In the rat, PCR across
SCR3 in genomic phage clones produced a 1.5-kb product instead of the
192-bp product expected for a single exon, indicating that here too the
SCR is encoded on two exons. The data thus clearly show that DAF is
encoded on a single gene in the rat.
Northern blot analysis of purified mRNA probed with the the SCR region
of rat DAF revealed two major bands of 2.4 and 1.4 kb, which were
differentially expressed across a range of tissues (Fig. 3
). These were
similar in size to the two major bands of human DAF (2.2 and 1.5 kb),
mouse GPI-DAF (2.8 and 1.4 kb), and guinea pig DAF (2.42.5 kb and
1.61.8 kb) (8, 13, 23). Expression of rat DAF mRNA was particularly
abundant in the testis (1.4 kb predominant) and lung (2.4 kb
predominant). RT-PCR of RNA from various tissues using primers specific
for the GPI or secreted form of rat DAF identified both forms,
expressed to varying degrees, in all tissues tested, with the exception
of the liver, which did not express the secreted form (Fig. 4
). By
Northern blot analysis, only the 2.4-kb species was detectable in
liver; we therefore suggest that the 2.4-kb species encodes GPI-DAF.
The 1.4-kb species, extremely highly expressed in testis, is too small
to encode secreted DAF, and therefore is likely also to encode the GPI
form. This suggestion is supported by the RT-PCR data, which show that
both testis (1.4 kb predominant) and lung (2.4 kb predominant) express
an abundance of GPI-DAF. The reasons for this tissue specificity of
length of mRNA species is unclear, but a similar situation pertains in
the mouse, where the testis expresses only the smaller 1.4-kb
transcript of GPI-DAF; this transcript is preferentially up-regulated
by estrogen in the uterus (31), indicating that hormonal factors may
play a part in regulating the expression of the two major RNA species.
To express the two full length rat DAF proteins in the absence of the
signal peptide sequence, chimeras were constructed containing the
signal peptide from mouse DAF. High level surface expression of GPI-DAF
was achieved, as shown by flow cytometry and Western blot analysis of
cell lysates. The protein was efficiently removed by PIPLC treatment,
confirming GPI anchoring; unlike human DAF, it was trypsin sensitive
(Fig. 6
). A small amount of protein was present in the cell
supernatants (Fig. 7
). The expressed protein efficiently
protected cells against C attack, reducing C3 fragment deposition by
70%; human CD59 was similarly effective in the same system, but rat
CD59 expressed at high levels had no effect on C3 deposition (Fig. 6
).
Secreted DAF was abundant in the medium, as detected by Western blot
(Fig. 7
). Under nonreducing conditions, secreted DAF aggregated to form
a high molecular mass aggregate, although some was present as a dimer
(140 kDa) or monomer (70 kDa). Under reducing conditions, all of the
aggregated protein reduced to the 70 kDa monomeric form. Flow cytometry
revealed that a small proportion of secretory DAF was expressed on the
cell surface (Fig. 6
). The mechanism by which this protein attaches to
the membrane is not clear, but treatment with PIPLC failed to remove
the protein, and acid washing to disrupt noncovalent interactions
similarly had no effect. Cell-bound secreted DAF did confer some
protection against C attack, reducing C3 fragment deposition by
25%
compared with controls.
The data demonstrate that rats, like mice, express in addition to Crry an analogue of human DAF. No information has yet been published on the expression of mouse DAF protein, and no function has been demonstrated. Here, we show that rat DAF protein is an inhibitor of C and is abundantly expressed on rat erythrocytes and rat cell lines. It will be of interest to analyze the relative contributions of Crry and DAF to the protection of rat cells in vitro and in vivo.
| Footnotes |
|---|
2 The nucleotide sequences used in this study are registered under GenBank accession numbers AF039583 and AF039584. ![]()
3 Address correspondence and reprint requests to Dr. B. Paul Morgan, Department of Medical Biochemistry, University of Wales College of Medicine, Heath Park, Cardiff, CF4 4XX, U.K. E-mail address: ![]()
4 Abbreviations used in this paper: CRP, complement regulatory protein; DAF, decay-accelerating factor; RDAF, rat DAF-specific primer; RACE, rapid amplification of cDNA ends; UTR, untranslated region; GPI, glycosylphosphatidylinositol; PIPLC, phosphatidylinositol-specific phospholipase C; MCP, membrane cofactor protein; RCA, regulators of C activation; SCR, short consensus repeat; pfu, plaque-forming unit; GAPDH, glyceraldehyde phosphate dehydrogenase. ![]()
Received for publication January 29, 1998. Accepted for publication July 20, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R P Lisak, J A Benjamins, B Bealmear, B Yao, S Land, L Nedelkoska, and D Skundric Differential effects of Th1, monocyte/macrophage and Th2 cytokine mixtures on early gene expression for immune-related molecules by central nervous system mixed glial cell cultures Multiple Sclerosis, April 1, 2006; 12(2): 149 - 168. [Abstract] [PDF] |
||||
![]() |
M. C Gieske, G. Y. Na, Y. Koo, M. Jo, T. E Curry Jr, and C. Ko Decay-accelerating factor in the periovulatory rat ovary J. Endocrinol., August 1, 2005; 186(2): 303 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Andoh, K. Kinoshita, I. Rosenberg, and D. K. Podolsky Intestinal Trefoil Factor Induces Decay-Accelerating Factor Expression and Enhances the Protective Activities Against Complement Activation in Intestinal Epithelial Cells J. Immunol., October 1, 2001; 167(7): 3887 - 3893. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-M. Qian, X. Qin, T. Miwa, X. Sun, J. A. Halperin, and W.-C. Song Identification and Functional Characterization of a New Gene Encoding the Mouse Terminal Complement Inhibitor CD59 J. Immunol., September 1, 2000; 165(5): 2528 - 2534. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Perez de la Lastra, C. L. Harris, S. J. Hinchliffe, D. S. Holt, N. K. Rushmere, and B. P. Morgan Pigs Express Multiple Forms of Decay-Accelerating Factor (CD55), All of Which Contain Only Three Short Consensus Repeats J. Immunol., September 1, 2000; 165(5): 2563 - 2573. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. McGrath, G. W. G. Wilkinson, O. B. Spiller, and B. P. Morgan Development of Adenovirus Vectors Encoding Rat Complement Regulators for Use in Therapy in Rodent Models of Inflammatory Diseases J. Immunol., December 15, 1999; 163(12): 6834 - 6840. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Alexander, B. K. Hack, P. N. Cunningham, and R. J. Quigg A Protein with Characteristics of Factor H Is Present on Rodent Platelets and Functions as the Immune Adherence Receptor J. Biol. Chem., August 17, 2001; 276(34): 32129 - 32135. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |