The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zan, H.
Right arrow Articles by Casali, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zan, H.
Right arrow Articles by Casali, P.
The Journal of Immunology, 1998, 161: 5217-5225.
Copyright © 1998 by The American Association of Immunologists

CD40 Engagement Triggers Switching to IgA1 and IgA2 in Human B Cells Through Induction of Endogenous TGF-ß: Evidence for TGF-ß But Not IL-10-Dependent Direct Sµ->S{alpha} and Sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA Recombination1

Hong Zan*, Andrea Cerutti*, Patricia Dramitinos*, András Schaffer*,{dagger} and Paolo Casali2,*,{dagger}

* Division of Molecular Immunology, Department of Pathology, Cornell University Medical College, and {dagger} Immunology Program, Cornell University Graduate School of Medical Sciences, New York, NY 10021


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IgA are major effectors of antimicrobial defense in the respiratory and digestive tracts. We have analyzed the requirements for and the modalities of switching to IgA using our recently identified monoclonal model of human germinal center differentiation, CL-01 B cells. CL-01 cells bear surface IgM (sIgM) and sIgD and switch to all seven downstream isotypes in response to physiologic stimuli. In these cells, CD40 engagement by CD40 ligand induces production of endogenous TGF-ß and IL-10, expression of germline I{alpha}1-C{alpha}1 and I{alpha}2-C{alpha}2 transcripts, mature VHDJH-C{alpha}1 and VHDJH-C{alpha}2 transcripts, and IgA secretion. These events are associated with not only direct Sµ->S{alpha}, but also sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA recombination, and are ablated by neutralizing anti-TGF-ß but not IL-10 Ab, and indicating that TGF-ß, not IL-10, is a crucial mediator of the transcriptional activation and recombination of human C{alpha}1 and C{alpha}2 genes. Our findings in CL-01 cells were reproduced in freshly isolated naive sIgM+ sIgD+ B lymphocytes. Thus, engagement of CD40, in the absence of other (known) stimuli, is sufficient to effectively induce switching to IgA in human B cells. This is effected by direct and sequential DNA recombination events, which are both dependent upon endogenous TGF-ß secreted by the CD40L-induced B cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Class switching to IgA represents a crucial effector component of the immune response at the host environment interface. Switching of IgM+ IgD+ precursors to IgA+ B cells in the germinal centers (GCs3) of the lymph nodes, spleen, and respiratory and intestinal tract-associated lymphoid tissue gives rise to Abs that are readily transported across the respiratory and intestinal mucosae, and are endowed with effector properties that are critical for the local humoral immune response. IgA secreted into breast milk passively immunize the neonate against microbial pathogens in early life. Specific IgA effectively hamper the entrance of bacteria and viruses through the respiratory and intestinal mucosae throughout life, and patients with IgA deficiency are affected by repeated upper respiratory tract and/or gastrointestinal infections.

Mainly because of the lack of an optimal in vitro B cell model, previous studies have provided valuable but incomplete information on the requirements for and the modalities of class switching to IgA. In the mouse, Sµ->S{alpha} DNA recombination is preceded by the expression of germline C{alpha} transcripts (I{alpha}-C{alpha} transcripts), consisting of mRNA that reflects the sequence of the I{alpha} exon, located upstream of the corresponding S{alpha} region, and that of the C{alpha} exons (1, 2). It occurs through looping out and excision of the intervening chromosomal DNA, which is released as an extrachromosomal reciprocal recombination product or "switch circle" (2), and brings a given rearranged VHDJH gene segment in proximity of the targeted downstream CH gene. The transcriptional activation of C{alpha} genes has been suggested to be induced by TGF-ß, but the induction of ->S{alpha} DNA recombination is thought to require additional signals, such as those provided by LPS or IL-2 (3, 4). In addition, high rates of IgA secretion have been effectively induced in murine resting B cells by surface IgD (sIgD) crosslinking and concomitant exposure to either LPS or CD40 ligand (CD40L, CD154), TGF-ß, IL-4, and IL-5 (5), indicating that efficient induction of switching to IgA may require multiple inducing stimuli.

Studies in human B cells have suggested that TGF-ß triggers both I{alpha}1-C{alpha}1 and I{alpha}2-C{alpha}2 germline transcription (6) but induces VHDJH-C{alpha}1 and VHDJH-C{alpha}2 mature transcription only in the presence of additional costimulatory signals, such as those provided by Branhamella catarrhalis (7), Staphylococcus aureus Cowan I, or CD40 engagement (8, 9, 10, 11). IL-10 has also been implicated as playing a critical role in the events leading to VHDJH-C{alpha} mature transcription and IgA synthesis (8, 10, 12, 13), but definitive proof that IL-10 directs Sµ->S{alpha} DNA recombination has not been provided. Because of the heterogeneity of the human B cell fractions used in many studies (10, 14), a thorough discrimination between switching to IgA and replication and differentiation of IgA+ B cell precursors has not always been possible, thereby hampering a definition of the relative contribution of IL-10 and TGF-ß to the induction of C{alpha}1 and C{alpha}2 transcriptional activation, and VHDJH-C{alpha}1 and VHDJH-C{alpha}2 mature transcription. The suggestion that B cells can produce TGF-ß and IL-10 (15, 16) adds further complexity to the definition of the precise role of these endogenous cytokines in switching to IgA. Finally, still awaiting a definition are the relative contribution of sequential Sµ->S{gamma}, S{gamma}->S{alpha} (if any) DNA recombination to the generation of mature VHDJH-C{alpha}1 and VHDJH-C{alpha}2 transcripts, and the minimal requirements for induction of DNA recombination to C{gamma}, as an intermediate step in such a putative sequential switching to C{alpha}1 or C{alpha}2.

In this study, we have used our recently identified human monoclonal model of GC differentiation, sIgM+ sIgD+ CL-01 cells (17, 18, 19), as well as freshly isolated naive B cells to define the requirements for and the transcriptional and recombinatorial modalities of switching to IgA. Our findings indicate that switching to IgA in the human is dependent upon CD40 engagement and induction of endogenous TGF-ß and is associated with not only direct ->S{alpha} but also sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA recombination.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human B cells

The human monoclonal CL-01 sIgM+ sIgD+ B cell line, a Burkitt’s lymphoma carrying the t(8; 14) translocation and spontaneously secreting IgM, has been described (17, 18, 19, 20). PBMCs were isolated from healthy subjects, depleted of T cells (17, 18, 21), tagged with a FITC-conjugated mouse mAb to human IgD (Southern Biotechnology Associates, Birmingham, AL), and then reacted with anti-FITCisomer 1 Microbeads (Miltenyi Biotec, Auburn, CA). The samples were kept on ice throughout these manipulations. Highly purified (naive) sIgD+ B cells were segregated using a MACS magnetic sorter (Miltenyi Biotec). The purity of these sIgD+ B cells was demonstrated by the lack of detectable VHDJH-C{gamma} and VHDJH-C{alpha} transcripts using a nested RT-PCR with a VH FR3 sense primer and C{gamma}, C{alpha} antisense primers as described later in this section (not shown). B cells were cultured in RPMI 1640 medium (Life Technologies, Grand Island, NY) supplemented with 10% heat-inactivated FCS, 2 mM L-glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin. For the Ig switching experiments, B cells were cultured at 0.5–1.0 x 104/well in 96-well plates at a 2:1 ratio with irradiated (4000 rad) human embryonic kidney 293 cells transfected with human CD8 or CD40L (CD8-293 cells and CD40L-293 cells, respectively) in a 200-µl volume. CD40L-293 cells express surface CD40L at threefold higher density than L cells transfected with CD40L (not shown). In some experiments, soluble trimeric human CD40L/leucine-zipper fusion protein (htCD40L) (Immunex, Seattle, WA) was used at 500 ng/ml instead of CD40L-293 cells.

TGF-ß, IL-10, and IgA

Human TGF-ß1 (Genzyme, Cambridge, MA), and IL-10 (Schering-Plough, Kenilworth, NJ) were used at 0.5 ng/ml and 100 ng/ml, respectively. Neutralizing anti-TGF-ß Ab and anti-IL-10 Ab (Genzyme) were used at the saturating concentration of 30 µg/ml. At this concentration, the anti-TGF-ß Ab effectively neutralizes [3H]TdR uptake by mink lung epithelial CCL64 cells (see below), and the anti-IL-10 Ab abrogates IL-10-induced IgM and IgG secretion by human B cells (our unpublished results and 17 . Active TGF-ß was measured in the culture fluids using a bioassay based upon [3H]TdR uptake by mink lung epithelial CCL64 cells (American Type Culture Collection, Manassas, VA) (22). Culture fluids were also tested for total human TGF-ß and IL-10 content using specific ELISAs performed according to the manufacturer’s instructions (Biosource International, Camarillo, CA). Supernatants were assessed for IgA content using a specific ELISA (19). IgA1 and IgA2 were measured using ELISA based on specific anti-IgA1 and anti-IgA2 mAbs (23).

Fluorescence flow cytometric analysis

B cells (105) were reacted for 30 min on ice with FITC- and phycoerytrin-conjugated Abs to human IgM (Sigma, St. Louis, MN) and IgA (Southern Biotechnology Associates) and then washed with PBS containing 3% BSA. Cells (104) were analyzed using FACScalibur (Becton Dickinson Immunocytometry Systems, Mountain View, CA), and the data were processed using the Macintosh CELLQuest software program (Becton Dickinson Immunocytometry Systems), which includes the Kolmogorov-Smirnov analysis tool (24).

PCR amplification of IH-CH transcripts, VHDJH-CH transcripts, and ß-actin

RNA was isolated from 3 x 106 CL-01 cells using the RNeasy Total RNA Kit (Qiagen, Cathsworth, CA) and then reverse transcribed using the SuperScript Preamplification System for first strand cDNA synthesis (Life Technologies). Germline I{alpha}1-C{alpha}1, I{alpha}2-C{alpha}2, and I{gamma}1-C{gamma}1, as well as mature VHDJH-C{alpha}1, VHDJH-C{alpha}2, VHDJH-C{gamma}1, and ß-actin transcript cDNAs were PCR-amplified as described (19).

Identification of extrachromosomal switch DNA circles

S{alpha}-Sµ, S{alpha}-S{gamma}, and S{gamma}-Sµ switch circles were PCR-amplified from genomic DNA (500 ng) in a 50-µl volume containing 50 nM of each of the appropriate sense and antisense primers (19). To amplify S{alpha}-Sµ switch circles, the I{alpha}1/2 sense primer 5' CAGCAGCCCTCTTGGCAGGCAGCCAG 3' (spanning residues 843–868 of the consensus I{alpha} sequence, GenBank Accession Number L04540) was used in combination with the 3' Sµ antisense primer 5' TGAGTGCCCTCACTACTTGCGTCCCG 3' (Sµ region residues 4345–4373, X56795). To amplify S{alpha}-S{gamma} switch circles, the I{alpha}1/2 sense primer was used in association with the 3' S{gamma} antisense primer 5' CCTGCCTCCCAGTGTCCTGCATTACTTCTG 3' (consensus 3' S{gamma} sequence residues 3596–3625, U39737). The primers used for the amplification of S{gamma}-Sµ switch circles are reported elsewhere (25). The PCR conditions were: 10 min denaturation at 94°C, followed by 10 min annealing at 68°C (DNA polymerase was added at this step); then, 1 min denaturation at 94°C, 2 min annealing at 68°C, and 3 min extension at 72°C for 30 cycles. A second PCR was performed using the product of the first PCR as a template, together with the internal sense primer I{alpha}1/2 5' CTCAGCACTGCGGGCCCTCCA 3' (consensus I{alpha} sequence residue 918–938, L04540) in combination with the internal antisense primer 3' Sµ 5' CAGACTGTCATGGCTATCAGGGGTGGCGGGG 3' (Sµ sequence residues 2981–3361, X56795), or 3' S{gamma} 5' CCCTGGAGTCCCACTGCAGGTG 3' (S{gamma} sequence residues 3340–3361, U39737). The DNAs PCR-amplified from switch circles were identified by Southern blotting using 5' I{alpha}, 5' S{gamma}, 3' S{gamma}, and 3' Sµ region-specific probes generated by PCR amplification of artificial plasmid templates (19). Purified PCR-amplified switch circle DNAs were cloned using the TA cloning method (Invitrogen, Carlsbad, CA). Positive clones were PCR-identified using the 5' S{alpha} sense primer (S{alpha} region residues 40–60) in combination with the above 3' S{gamma} or 3' Sµ antisense primers, and then sequenced by the dideoxynucleotide chain termination method using the TaqTrack DNA Sequencing System (Promega, Madison, WI). Each sequence was derived from the analysis of six independent recombinant clones. The DNA sequences were analyzed using the BLAST algorithm, as found in the National Center for Biotechnology Information web page, and the GenBank DNA sequence database.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CD40 engagement induces human sIgA- B cells to switch to sIgA+, in a fashion that is dependent on endogenously secreted TGF-ß

We addressed the requirements for switching to IgA using our monoclonal model of human GC differentiation, sIgM+ sIgD+ CL-01 cells. These B cells switch to all seven downstream Ig isotypes upon exposure to physiologic stimuli, i.e., CD40L and cytokines (19). CL-01 cells were cultured with CD40L-293 cells alone, CD40L-293 cells and TGF-ß1, CD40L-293 cells and IL-10, CD40L-293 cells and both TGF-ß1 and IL-10, or, as controls, CD8-293 cells alone, CD8-293 cells and TGF-ß1, CD8-293 cells and IL-10, or CD8-293 cells and both TGF-ß1 and IL-10. After 8 days, CL-01 cells were analyzed for sIgM and sIgA by fluorescence flow cytometry. Virtually all CL-01 cells cultured with CD8-293 cells alone or with TGF-ß1 and/or IL-10 lacked sIgA (Fig. 1Go, A–D). In contrast, CL-01 cells cultured with CD40L-293 cells gave rise to sIgM+ sIgA+ and sIgM- sIgA+ cells (Fig. 1GoE, cells in the right upper and lower quadrants equal about 2% and 5% of total cells, respectively). The proportion of sIgM- sIgA+ cells increased in the presence of (exogenous) TGF-ß1 (~8%) or IL-10 (~12%) and was further boosted by both TGF-ß1 and IL-10 (about 16%) (Fig. 1Go, F–H).



View larger version (61K):
[in this window]
[in a new window]
 
FIGURE 1. CD40 engagement induces human sIgM+ sIgA- B cells to switch to sIgM+ sIgA+ and sIgM- sIgA+ cells. sIgM+ sIgD+ CL-01 cells were cocultured with control CD8-293 cells alone, CD8-293 cells and TGF-ß1 (0.5 ng/ml), CD8-293 cells and IL-10 (100 ng/ml), CD8-293 cells and TGF-ß1 and IL-10; CD40L-293 cells alone, CD40L-293 cells and TGF-ß1, CD40L-293 cells and IL-10, CD40L-293 cells and TGF-ß1 and IL-10; CD40L-293 cells and anti-TGF-ß Ab (30 µg/ml); CD40L-293 cells and anti-IL-10 Ab (30 µg/ml); CD40L-293 cells and IL-10 and anti-TGF-ß Ab; or CD40L-293 cells and IL-10 and anti-IL-10 Ab (30 µg/ml). After 8 days, the B cells were analyzed by fluorescence flow cytometry for sIgM and sIgA expression. Numbers inside quadrants are percentages of the total cells. The results depicted are representative of three independent experiments.

 
It has been suggested that activated human B cells express TGF-ß mRNA (10, 15), but it is unknown whether this mRNA is translated into a secreted protein, particularly in the active form (26). To determine the contribution of endogenous TGF-ß and IL-10 to the CD40L-induced generation of sIgA+ cells, CL-01 cells were cultured with CD40L-293 cells in the presence of a neutralizing Ab to either TGF-ß or IL-10, and then analyzed for sIgM and sIgA expression. Switching to sIgA was virtually abrogated by the neutralization of endogenous TGF-ß but not IL-10 (Fig. 1Go, I and J). The virtual abrogation of IgA switching by anti-TGF-ß but not anti-IL-10 Ab, even in the presence of excess IL-10 (200 ng/ml) (Fig. 1Go, K and L), further indicated that TGF-ß, not IL-10, mediated switching to IgA. To substantiate the indication by the above experiments that active TGF-ß is secreted by CD40L-induced B cells, CL-01 cells were cultured with CD40L-293, soluble htCD40L, or control CD8-293 cells. After 2, 5, and 8 days, the culture fluids were analyzed for both total and active TGF-ß and total IL-10, which has also been reported to be produced by activated B cells (16). Unstimulated CL-01 cells secreted some TGF-ß and IL-10, but secretion of TGF-ß and IL-10 was enhanced more than fourfold upon engagement of CD40 by CD40L-293 cells (Fig. 2Go) or soluble htCD40L (not shown). A significant proportion of the secreted TGF-ß was in the active form.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 2. CD40 engagement induces human B cells to secrete active TGF-ß and IL-10. sIgM+ sIgD+ CL-01 cells were cultured in the presence of control CD8-293 cells (white bars) or CD40L-293 cells (gray bars), and total and active (hatched section of bar) TGF-ß (A) and IL-10 (B) accumulated in the culture fluids were measured by a functional bioassay and a specific ELISA, respectively, after 2, 5, or 8 days. Values are mean ± SD of four determinations.

 
These experiments show that in human sIgM+ sIgD+ B cells switching to sIgA+ is effectively induced by CD40 engagement and is mediated by the endogenous TGF-ß, not IL-10, that is secreted in an active form by the CD40L-induced B cells.

CD40 engagement induces TGF-ß-dependent germline I{alpha}1-C{alpha}1/I{alpha}2-C{alpha}2 and mature VHDJH-C{alpha}1/C{alpha}2 transcription and IgA secretion in human B cells

Recombination to a downstream CH gene is preceded by targeted IH-CH germline transcription and leads to the expression of VHDJH-CH mature transcripts, which are translated into functional Ig proteins (27). To investigate the role of CD40L and endogenous TGF-ß in the transcriptional activation of human C{alpha}1 and C{alpha}2 genes, CL-01 cells were cultured in medium only, with control CD8-293 cells alone, CD8-293 cells and TGF-ß1, CD40L-293 cells alone, CD40L-293 cells and TGF-ß1, CD40L-293 cells and neutralizing anti-TGF-ß Ab, soluble htCD40L alone, soluble htCD40L and TGF-ß1, or soluble htCD40L and neutralizing anti-TGF-ß1 Ab. Germline I{alpha}-C{alpha} and mature VHDJH-C{alpha} transcript cDNAs were PCR amplified from cultured CL-01 cells after 2 and 5 days, respectively, and the amount of secreted IgA was measured in the culture fluids after 8 days. CL-01 cells cultured alone or with CD8-293 cells, in the presence or in the absence of TGF-ß1, neither secreted detectable amounts of IgA nor expressed germline I{alpha}-C{alpha} or mature VHDJH-C{alpha} transcripts (Fig. 3GoA). Exposure of CL-01 cells to CD40L-293 cells or soluble htCD40L resulted in induction of germline I{alpha}1-C{alpha}1 and I{alpha}2-C{alpha}2 transcription, mature VHDJH-C{alpha}1 and VHDJH-C{alpha}2 transcription, and IgA (both IgA1 and IgA2) secretion (Fig. 3GoA and not shown), which, consistent with the experiments of Fig. 1Go, was enhanced by exogenous TGF-ß1 and abrogated by the neutralization of endogenous TGF-ß.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 3. CD40 engagement induces expression of germline I{alpha}1-C{alpha}1 and I{alpha}2-C{alpha}2 transcripts, mature VHDJH-C{alpha}1 and VHDJH-C{alpha}2 transcripts, and IgA production in human B cells. Histograms show the concentration (ng/ml) of IgA accumulated in the fluids of sIgM+ sIgD+ CL-01 cells (A) or freshly isolated sIgM+ sIgD+ naive B cells (B) cultured for 8 days with medium alone, CD8-293 cells alone, CD8-293 cells and TGF-ß1 (0.5 ng/ml), CD40L-293 cells alone, CD40L-293 cells and TGF-ß1, or CD40L-293 cells and anti-TGF-ß Ab (30 µg/ml). Values are mean ± SD of four determinations from three independent experiments. Gels show bands derived from the fractionation of I{alpha}1-C{alpha}1 and I{alpha}2-C{alpha}2 germline transcript cDNAs and of VHDJH-C{alpha}1 and VHDJH-C{alpha}2 transcript cDNAs amplified from B cells harvested after 2 and 5 days, respectively, from the above cultures (1% agarose gel). The gels depicted here were obtained from one of three independent experiments yielding similar results.

 
These findings were reproduced in freshly isolated human naive sIgM+ sIgD+ B cells (Fig. 3GoB and not shown), further indicating that CD40 engagement, in the absence of other stimuli, effectively induces human B cells to initiate germline I{alpha}-C{alpha} and mature VHDJH-C{alpha} transcription and IgA secretion. These events are crucially mediated by the endogenous TGF-ß that is secreted by the CD40L-induced B cells.

CD40 engagement induces not only direct Sµ->S{alpha} but also sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA recombination in human B cells

Switch recombination occurs between two different S regions, each located 5' of the recombining CH genes. While switching to IgG or IgE in human B cells has been formally associated with S-S DNA recombination (25, 28), IgA has not been conclusively shown to be associated with a recombinatorial event. Rather, the consistent occurrence of circulating sIgM+ sIgA+ B cells has suggested the possibility that in humans IgA synthesis results from alternative RNA splicing rather than DNA recombination (29, 30). To analyze the role of S->S DNA recombination in switching to IgA, CL-01 cells were cultured in medium only, with CD8-293 cells and TGF-ß1, or with CD40L-293 cells alone. After 5 days, genomic DNA was extracted from the cultured CL-01 cells, and the extrachromosomal S{alpha}-Sµ and S{alpha}-S{gamma} DNA switch circles were amplified using specific PCRs. No junctional S{alpha}-Sµ or S{alpha}-S{gamma} DNAs were amplified from CL-01 cells cultured with CD8-293 cells with or without TGF-ß (Fig. 4Go, A and D, lanes 1 and 2). In contrast, S{alpha}-Sµ (~0.45, 0.7, and 1.3 kb) and S{alpha}-S{gamma} junctional cDNAs (~0.9 kb) were consistently amplified from three independent cultures of CL-01 cells with CD40L-293 cells (Fig. 4Go, A and D, lanes 2, 3, and 4). The extrachromosomal S{alpha}-Sµ or S{alpha}-S{gamma} switch circle origin of the PCR DNAs was verified by sequential hybridization with specific [{alpha}-32P]-I{alpha} and -Sµ or -S{gamma} probes. The 0.7- and 1.3-kb, but not the 0.45-kb S{alpha}-Sµ fragments hybridized with the I{alpha} and Sµ probes (Fig. 5Go, B and C), while the 0.9-kb S{alpha}-S{gamma} product hybridized with the specific [{alpha}-32P]-I{alpha} and -S{gamma} probes (Fig. 5Go, E and F), indicating that both direct ->S{alpha} and sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA recombination had occurred in the CD40L-induced B cells.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 4. CD40 engagement induces not only direct Sµ->S{alpha} but also sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA recombination in human B cells. S{alpha}-Sµ (A) and S{alpha}-S{gamma} (D) extrachromosomal reciprocal DNA recombination products (switch circles) were PCR amplified from genomic DNA of sIgM+ sIgD+ CL-01 cells cocultured for 5 days with control CD8-293 cells alone (lane 1), CD8-293 cells and TGF-ß1 (0.5 ng/ml) (lane 2), or CD40L-293 cells alone (lanes 3, 4, and 5), and fractionated through a 1% agarose gel. The PCR-amplified DNAs were blotted and hybridized with [{alpha}-32P]-I{alpha} (B and E) and -Sµ (C) or -S{gamma} (F) probes.

 


View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 5. Junctional sequences of the S{alpha}-Sµ and S{alpha}-S{gamma} DNA switch circles from the experiment of Fig. 4Go. S{alpha}-Sµ and S{alpha}-S{gamma} Southern blot-positive PCR DNAs were cloned, and three clones from each DNA (indicated as A1, A2, A3; B1, B2, B3; and C1, C2, C3) were sequenced. Dashes indicate identities. Arrows indicate the breakpoint site within S{alpha}, Sµ, or S{gamma} region (top and bottom sequences). The number of the breakpoint site corresponds to the residue number of the S{alpha}, the Sµ, and the S{gamma} sequences as given in the EMBL/GenBank/DDBJ sequence database under accession number L04540, X56795, and U39737, respectively.

 
The detection of only two S{alpha}-Sµ and only one S{alpha}-S{gamma} switch circles in our multiple experimental samples suggested that both direct and sequential switch DNA recombination occurred at the level of yet to be characterized "hotspots," and perhaps reflects the monoclonality of our Ig switch model. To characterize these putative hotspots, and to define the subclass composition of the S{alpha}-Sµ and S{alpha}-S{gamma} switch circles, the PCR DNAs that hybridized in the above experiments were cloned, and three clones from each DNA were sequenced. The {alpha} and {gamma} genes involved in the S-S DNA recombination were determined by careful analysis of key nucleotides within the I{alpha} and S{gamma} regions. All three clones from each fragment were identical and consisted of a S{alpha}1 region combined with a Sµ and S{gamma}1 region, respectively (Fig. 5Go). In the S{alpha}1-Sµ circles, the breakpoint was located within the S{alpha}1 region, while, in the S{alpha}1-S{gamma} circles it was at the 3' end of the I{alpha}1 sequence, suggesting that direct and sequential recombination to C{alpha}1 involves different breakpoints.

IL-10 enhances the CD40L-induced IgA secretion but does not trigger transcriptional activation of the C{alpha}1 and C{alpha}2 genes

It has been suggested that IL-10 plays a role in directing switching to IgA (10, 13, 31), but such a role was not supported by our demonstrations that the neutralization of IL-10 does not affect switching to IgA, while that of TGF-ß ablates the IL-10-dependent expansion of sIgA+ B cells (Fig. 1Go, I–L). We analyzed the role of IL-10 in the transcriptional activation and recombination of the human C{alpha}1 and C{alpha}2 genes using CL-01 cells cultured with control CD8-293 cells alone, CD8-293 cells and IL-10, CD40L-293 cells alone, CD40L-293 cells and IL-10, CD40L-293 cells and anti-IL-10 Ab, CD40L-293 cells and both IL-10 and anti-IL-10 Ab, or CD40L-293 cells and both IL-10 and anti-TGF-ß Ab. Germline I{alpha}-C{alpha} and mature VHDJH-C{alpha} transcripts were PCR amplified from the CL-01 cells cultured for 2 and 5 days, respectively. Secreted IgA was measured in the culture fluids after 8 days. Upon incubation with CD8-293 cells alone (not shown), or with IL-10, CL-01 cells neither secreted IgA nor expressed germline or mature C{alpha} transcripts (Fig. 6Go). In contrast, and as expected from the findings of Fig. 1Go, upon culture with CD40L-293 cells CL-01 cells secreted significant amounts of IgA and expressed germline I{alpha}1-C{alpha}1, I{alpha}2-C{alpha}2, and mature VHDJH-C{alpha}1, VHDJH-C{alpha}2 transcripts. Expression of C{alpha}1 and C{alpha}2 transcripts and IgA production were both boosted by exogenous IL-10 and were only marginally affected by neutralizing anti-IL-10 Ab, suggesting that endogenous IL-10 played only a minor role, if any, in the overall CD40-induced IgA production. The amount of anti-IL-10 Ab used far exceeded that required to neutralize the endogenous IL-10, as suggested by the original titration of this Ab (see Materials and Methods), and by the demonstration that an identical amount of the same Ab completely reversed the boost of IgA production induced by exogenous IL-10 but not residual IgA production (Fig. 6Go). The ablation of IgA production by anti-TGF-ß Ab in CL-01 cells cultured with CD40L-293 cells and supplemented with exogenous IL-10 further indicated that CD40-induced switching to IgA is dependent on endogenous TGF-ß and not IL-10 (Fig. 6Go). It also suggested that IL-10 is not directly involved in the transcriptional activation of C{alpha}1 and C{alpha}2 genes, which, rather, is strictly dependent on the presence of endogenous TGF-ß.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 6. IL-10 enhances IgA secretion in human B cells induced by CD40L. Histograms show the concentration (ng/ml) of IgA accumulated in the fluid of CL-01 cells incubated for 8 days with CD8-293 cells and IL-10 (200 ng/ml), CD40L-293 cells alone, CD40L-293 cells and IL-10, CD40L-293 cells and anti-IL-10 Ab, CD40L-293 cells and both IL-10 and anti-IL-10, or CD40L-293 cells and both IL-10 and anti-TGF-ß1 Ab. Values are mean ± SD of four determinations from three independent experiments. Gels show bands derived from the fractionation of germline I{alpha}1-C{alpha}1 and I{alpha}2-C{alpha}2 transcripts and from mature VHDJH-C{alpha}1 and VHDJH-C{alpha}2 transcript cDNAs amplified from CL-01 cells harvested from the above cultures after 2 and 5 days, respectively (1% agarose gel). The gels depicted here were obtained from one of three independent experiments yielding similar results.

 
Endogenous TGF-ß, but not IL-10, mediates not only direct Sµ->S{alpha} but also sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA recombination in CD40L-induced human B cells

Having shown that switching to IgA can occur through direct Sµ->S{alpha} or sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA recombination, and because of the putative ability of IL-10 to mediate switching to IgG (12, 25, 27, 32), we addressed the issue as to whether endogenous IL-10 plays a role in mediating DNA recombination to C{gamma}, as a first step in the sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA recombination. Germline I{gamma}1-C{gamma}1, I{alpha}1-C{alpha}1, and I{alpha}2-C{alpha}2 (after 2 days of culture) and mature VHDJH-C{gamma}1, VHDJH-C{alpha}1, and VHDJH-C{alpha}2 transcripts, as well as S{gamma}-Sµ, S{alpha}-Sµ, and S{alpha}-S{gamma} switch circles (after 5 days) were PCR-amplified in CL-01 cells that were cultured with CD40L-293 cells in the presence or in the absence of neutralizing anti-IL-10 or anti-TGF-ß Ab. The concentration of secreted IgA and IgG was measured in the culture fluids after 8 days. We chose to analyze I{gamma}1-C{gamma}1 transcripts because of their putative involvement in sequential DNA recombination to C{alpha}1, which is generally more frequently targeted than C{alpha}2. The neutralization of endogenous IL-10 did not interfere with these DNA transcriptional and recombinatorial events (Fig. 7Go) but abrogated the secretion of IgG (not shown). In contrast, the neutralization of endogenous TGF-ß abrogated both germline I{gamma}1-C{gamma}1, I{alpha}1-C{alpha}1, I{alpha}1-C{alpha}1, and mature VHDJH-C{gamma}1, -C{alpha}1, -C{alpha}2 transcription, as well as the generation of S{gamma}-Sµ, S{alpha}-Sµ, and S{alpha}-S{gamma} switch circles (Fig. 7Go), and IgG and IgA secretion (not shown), further confirming the TGF-ß dependency of the transcriptional activation and recombination of the human C{alpha}1 and C{alpha}2 genes and demonstrating that endogenous TGF-ß effectively mediates ->S{gamma}1 DNA recombination as a first step in sequential recombination to C{alpha}1.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 7. Endogenous TGF-ß, but not IL-10, mediates both direct Sµ->S{alpha} and sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA recombination in CD40L-induced human B cells. Fractionation (1% agarose gel) of the germline I{gamma}1-C{gamma}1, VHDJH-C{gamma}1, I{alpha}1-C{alpha}1, I{alpha}2-C{alpha}2, and mature VHDJH-C{gamma}1, VHDJH-C{alpha}1, and VHDJH-C{alpha}2 transcript cDNAs, and S{gamma}-Sµ (~2.0 kb), S{alpha}-Sµ (~1.5, 0.8, and 0.5 kb), and S{alpha}-S{gamma} (~1.5, and 0.9 kb) switch circle DNAs PCR amplified from CL-01 cells cultured for 2 and 5 days, respectively, in the presence of CD40L-293 cells alone, CD40L-293 cells and anti-IL-10 Ab, or CD40L-293 cells and anti-TGF-ß Ab. The identity of these DNA products was verified as reported in the experiments of Figs. 4Go and 5Go (not shown). ß-actin cDNA is shown as a control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have used our monoclonal model of GC B cell differentiation, sIgM+ sIgD+ CL-01 cells, to address important aspects of switching to IgA in the human, including: 1) the definition of the minimal requirements for induction; 2) the secretion of endogenous TGF-ß and IL-10 by B cells, and the contribution of these cytokines to the induction of the C{alpha}1 and C{alpha}2 gene transcription and recombination; and 3) the role of direct Sµ->S{alpha} and, if any, sequential ->S{gamma}, S{gamma}->S{alpha} DNA recombination. We have ascertained the physiologic significance of our findings in freshly isolated circulating sIgM+ sIgD+ B cells. Previous in vitro experiments have suggested that a mitogenic stimulus, such as LPS or CD40L, does not trigger switching to IgA unless (exogenous) TGF-ß is added to the B cell culture (3, 4, 5, 6, 7, 8, 25). Our findings confirm that TGF-ß is required for switching to IgA, and show that the required TGF-ß can be secreted by the CD40L-induced B cells. They demonstrate that in the absence of any other stimuli, CD40 engagement is sufficient to induce not only I{alpha}1-C{alpha}1 and I{alpha}2-C{alpha}2 germline transcripts, but also VHDJH-C{alpha}1 and VHDJH-C{alpha}2 mature transcripts, switch DNA recombination (as assessed by the detection of S{alpha}-Sµ and S{alpha}-S{gamma} switch circles) and surface and secreted IgA, and that this induction is strictly dependent on the CD40L-induced B cell-derived endogenous TGF-ß. The less vigorous response and secretion of endogenous TGF-ß by B cells challenged by the "less physiologic" agonistic anti-CD40 mAb or CD40L-transfected L cells, which express surface CD40L at a much lower density than CD40L-293 cells (see Materials and Methods), may explain the failure to induce IgA class switching in naive human B cells by other investigators (29, 31).

The suggestion that CD40L and TGF-ß do not induce IgA1 and IgA2 production in human naive B cells unless IL-10 is present (12, 14) and that this cytokine is crucial for the induction of mature VHDJH-C{alpha}1 and VHDJH-C{alpha}2 transcription (10) have suggested a crucial role for IL-10 in the molecular events that lead to IgA switching. Our experiments show that, like TGF-ß, endogenous IL-10 is produced by CD40-activated human B cells, but its neutralization by specific Ab does not significantly affect germline and mature C{alpha} transcription, nor does it affect the generation of S{alpha}-derived switch circles, suggesting that this cytokine is not responsible for the induction of C{alpha}1 or C{alpha}2 gene transcription and switch DNA recombination. They also show that in CD40L-stimulated B cells, IL-10 significantly increases both the number of sIgA+ lymphocytes and the amount of secreted IgA. This biologic activity is specific in that it is reversed by neutralizing anti-IL-10 Ab. Thus, our findings indicate that IL-10 cannot substitute for TGF-ß in the induction of IgA switching, rather it would boost proliferation and IgA secretion in already switched sIgA+ B cells.

TGF-ß is a ubiquitous pleiotropic cytokine that is secreted in a latent form and is activated by proteolytic cleavage (26). A major limitation in understanding how TGF-ß induces switching to IgA is the scarcity of information on the source(s) of active TGF-ß at the presumptive site of induction of C{alpha}1 and C{alpha}2 gene transcription, mainly the mucosa-associated lymphoid tissue, including the Peyer’s patches (26), and the regulation of the activation of the latent form of newly synthesized TGF-ß1. Our findings indicate that B cells are a major source of TGF-ß, which, upon CD40 activation, is activated and secreted in amounts sufficient to mediate effective class switching to IgA. The functional independence of CD40L-induced B cells from paracrine TGF-ß may constitute an advantage at those sites, such as digestive and respiratory mucosae, where the prompt production of IgA effector molecules is crucial for an effective defense against viral and microbial pathogens. In addition, unlike paracrine TGF-ß1, B cell-derived TGF-ß1 may be secreted in amounts devoid of antiproliferative effects, which could hamper switching to IgA due to the functional linkage of the cell cycle with DNA recombination (26, 27).

In human B cells, direct Sµ->S{alpha} DNA recombination has been formally documented only in two cases (33, 34), and the contribution to IgA switching of sequential DNA recombination to C{alpha} through an intervening isotype has never been formally addressed to the best of our knowledge. Our experiments show that both direct ->S{alpha}1 and sequential Sµ->S{gamma}1, S{gamma}1->S{alpha}1 DNA recombination, as assessed by the identification of S{alpha}1-Sµ and S{alpha}1-S{gamma}1 switch circles and VHDJH-C{gamma}1 mature transcripts, contribute to IgA switching in human monoclonal sIgM+ sIgD+ B cells. These experiments also show that sequential Sµ->S{gamma}1, S{gamma}1->S{alpha}1 DNA recombination is induced effectively by CD40 engagement in the absence of other (known) stimuli and is mediated by endogenous TGF-ß, as the intermediate ->S{gamma}1 switching (giving rise to S{gamma}1-Sµ and S{alpha}1-S{gamma}1 circles) was ablated by the neutralizing anti-TGF-ß but not anti-IL-10 Ab. These experiments strengthen the role of direct Sµ->S{alpha} DNA recombination in human switching to IgA (33) and extend it to include the additional contribution of sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA recombination to this process. By demonstrating that both direct Sµ->S{alpha} and sequential Sµ->S{gamma}, S{gamma}->S{alpha} DNA recombinations are mediated by endogenous TGF-ß but not IL-10, despite the suggested IgG switch-inducing potential of IL-10 (25), these experiments further findings in the mouse suggesting that TGF-ß directs switching to not only C{alpha} but also C{gamma} genes (35, 36) and extend our recent observation that IL-10 cannot induce the activation of the regulatory sequence upstream of human S{gamma}1 in luciferase reporter gene assays.4

The induction of both C{alpha}1 and C{alpha}2 germline and mature transcription in monoclonal CL-01 cells suggests that a single B cell clonotype can undergo switching to C{alpha}1 and/or C{alpha}2 in response to the same IgA-inducing stimuli, i.e., CD40. This finding is consistent with the high homology of the human C{alpha}1 and C{alpha}2 gene upstream regulatory sequences, which contain overlapping PU-1/SP-1, cAMP-responsive element (CRE), and E box motifs (7, 37). These motifs have been shown in chloramphenicol acetyl transferase (CAT) assays to mediate either basal or TGF-ß/phorbol ester-induced activity (7, 37). The lack of S{alpha}2 regions in the switch circles analyzed here possibly reflect the relative scarcity of switching to C{alpha}2 compared with C{alpha}1 in human B cells. The DNA breakpoint was consistently different in the switch circles generated from direct and sequential DNA recombination to C{alpha}1. In the S{alpha}1-Sµ circles, this breakpoint was located within the S{alpha}1 region, consistently proximal to a 5' TGAG 3' motif, which has been reported to be associated with S region recombination sites (38). In the S{alpha}1-S{gamma}1 switch circles, the breakpoint was at the 3' end of the I{alpha}1 sequence, indicating a possible involvement of I{alpha}1 in DNA recombination, perhaps owing to the presence of a {chi}-like recombination hotspot element within the I{alpha}1 proximal promoter region (39). Interestingly, the junctional sequences of the S{alpha}1-Sµ and S{alpha}1-S{gamma}1 switch circles obtained from B cells induced by CD40L were similar to those of the respective circles from B cells induced by CD40L and IL-4 or IL-10 (not shown, see 19 . Thus, switch S{alpha} recombination can occur within either the S{alpha} or the I{alpha} region, and S{alpha}-Sµ and S{alpha}-S{gamma} DNA recombination junctions can be conserved even if induced by different stimuli.

Our demonstration that CD40 engagement alone is sufficient to effectively trigger C{alpha}1 and C{alpha}2 gene transcriptional activation and targeted S{alpha}1 and S{alpha}2 DNA recombination allows us to speculate that switching to IgA can take place in districts in which B cell CD40 is engaged by CD40L borne on cells other than T lymphocytes, such as mast-cells, endothelial cells, or dendritic cells (40, 41, 42), in the lamina propria mucosae of the respiratory and digestive tracts. At these sites, the TGF-ß necessary to trigger switching to IgA, as well as to IgG, can be provided by the CD40L-activated B cells. Endogenous TGF-ß could mediate both direct Sµ-> S{alpha} and sequential Sµ->S{gamma}, S{gamma}->S{alpha} switch DNA recombination. IL-10, which is also produced by CD40L-activated B cells, may further enhance the TGF-ß-mediated IgA and IgG switching, not only by enhancing the replication and secretion of already switched B cells, but also amplifying the effects of both endogenously present and/or exogenously added TGF-ß through either a synergistic and/or additive effect, or, possibly, by indirectly or directly influencing TGF-ß levels in culture. Collectively, our findings define CD40 engagement and B cell-derived TGF-ß as the two key factors in directing both direct Sµ->S{alpha} and sequential Sµ->S{gamma}, S{gamma}->S{alpha} switch recombination in human B cells, but provide no clue to the intracellular signaling pathways emanating from CD40 and TGF-ßR and mediating the transcriptional activation of the C{alpha} and C{gamma} genes. The definition of these pathways and that of the elements capable of binding to the evolutionary conserved regulatory regions upstream of these Ig H chain C genes are presently pursued in our laboratory through transfection experiments involving selected human Ig H chain locus DNA elements and human CL-01 cells.


    Acknowledgments
 
We thank Dr. E. E. Max (Center for Biologic Evaluation and Research, Food and Drug Administration, Bethesda, MD) for providing us with artificial S{gamma}-Sµ, S{alpha}-Sµ, and S{alpha}-S{gamma} construct; Dr. S. Lederman (College of Physicians and Surgeons, Columbia University, New York, NY) for providing us with CD8- and CD40L-293 cells; Dr. S. Narula (Schering-Plough Research Institute, Kenilworth, NJ) for providing us with human rIL-4 and human rIL-10; Dr. R. Goodwin and Ms. K. S. Picha (Immunex, Seattle, WA) for their gift of soluble trimeric human CD40L/leucine-zipper fusion protein; and Dr. T. A. McCaffrey for helping us with the measurements of TGF-ß.


    Footnotes
 
1 This work was supported by United States Public Service Grant AR 40908. Back

2 Address correspondence and reprint request to Dr. Paolo Casali, Division of Molecular Immunology, Department of Pathology, Cornell University Medical College, 1300 York Avenue, New York, NY 10021. Back

3 Abbreviations used in this paper: GC, germinal center; CD40L, CD40 ligand; CD40L-293, human CD40L-transfected human embryonic kidney 293 cells; CH, C region of the Ig H chain; FR3, framework 3; htCD40L, trimeric human CD40L/leucine-zipper fusion protein; I, intervening region; IH-CH, germline Ig transcripts; S, switch region; sIg, surface Ig; VHDJH-CH, productive Ig transcripts. Back

4 A. Schaffer, A. Cerutti, H. Zan, and P. Casali. Submitted for publication. Back

Received for publication March 24, 1998. Accepted for publication July 9, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Shockett, P., J. Stavnezer. 1991. Effect of cytokines on switching to IgA and {alpha} germline transcripts in B lymphoma I.29µ: transforming growth factor-ß activates transcription of the unrearranged C{alpha} gene. J. Immunol. 147:4374.[Abstract]
  2. Whitmore, A. C., D. M. Prowse, G. Haughton, L. Arnold. 1991. Ig isotype switching in B lymphocytes: the effect of T cell-derived interleukins, cytokines, cholera toxin, and antigen on isotype switch frequency of a cloned B cell lymphoma. Int. Immunol. 3:95.[Abstract/Free Full Text]
  3. Iwasato, T., H. Arakawa, A. Shimizu, T. Honjo, H. Yamagishi. 1992. Biased distribution of recombination sites within S regions upon immunoglobulin class switch recombination induced by transforming growth factor ß and lipopolysaccharide. J. Exp. Med. 175:1539.[Abstract/Free Full Text]
  4. Lebman, D. A., M. J. Park, S. Hansen-Bundy, A. Pandya. 1994. Mechanism for transforming growth factor ß regulation of a mRNA in lipopolysaccharide-stimulated B cells. Int. Immunol. 6:113.[Abstract/Free Full Text]
  5. McIntyre, T. M., M. R. Kehry, C. M. Snapper. 1995. Novel in vitro model for high rate IgA class switching. J. Immunol. 154:3156.[Abstract]
  6. Islam, K. B., L. Nilsson, P. Sideras, L. Hammarström, C. I. E. Smith. 1991. TGF-ß1 induces germ-line transcripts of both IgA subclasses in human B lymphocytes. Int. Immunol. 3:1099.[Abstract/Free Full Text]
  7. Nillson, L., K. B. Islam, O. Olafsson, L. Zalcberg, C. Samakovlis, L. Hammarström, C. I. E. Smith, P. Sideras. 1991. Structure of TGF-ß1-induced human immunoglobulin C{alpha}1 and C{alpha}2 germ-line transcripts. Int. Immunol. 3:1107.[Abstract/Free Full Text]
  8. van Vlasselaer, P., J. Punnonen, J. E. de Vries. 1992. Transforming growth factor-ß directs IgA switching in human B cells. J. Immunol. 148:2062.[Abstract]
  9. Jumper, M. D., J. B. Splawski, P. E. Lipsky, K. Meek. 1994. Ligation of CD40 induces sterile transcripts of multiple Ig H chain isotypes in human B cells. J. Immunol. 152:438.[Abstract]
  10. Kitani, A., W. Strober. 1994. Differential regulation of C{alpha}1 and C{alpha}2 germ-line and mature transcripts in human peripheral blood B cells. J. Immunol. 153:1466.[Abstract]
  11. Jumper, M. D., Y. Nishioka, P. E. Lipsky, K. Meek. 1995. Regulation of human B cell function by recombinant CD40 ligand and other TNF-related ligands. J. Immunol. 155:2369.[Abstract]
  12. Rousset, F., E. Garcia, T. DeFrance, C. Peronne, N. Vezzio, D. Hsu, R. Kastelstein, K.W. Moore, J. Banchereau. 1991. Human and viral IL-10 are potent growth and differentiation factors for activated human B lymphocytes. Proc. Natl. Acad. Sci. USA 89:1890.[Abstract/Free Full Text]
  13. DeFrance, T., B. Vanbervliet, F. Briere, I. Durand, F. Rousset, J. Banchereau. 1992. Interleukin 10 and transforming growth factor ß cooperate to induce anti-CD40-activated naive human B cells to secrete immunoglobulin A. J. Exp. Med. 175:671.[Abstract/Free Full Text]
  14. Arpin, C., J. Déchanet, C. Van Kooten, P. Merville, G. Grouard, F. Brière, J. Banchereau, Y.J. Liu. 1995. Generation of memory B cells and plasma cells in vitro. Science 268:720.[Abstract/Free Full Text]
  15. Matthes, T., C. Werner-Favre, H. Tang, X. Zhang, V. Kindler, R. H. Zubler. 1993. Cytokine mRNA expression during an in vitro response of human B lymphocytes: kinetics of B cell tumor necrosis factor alpha, interleukin (IL)-6, IL-10, and transforming growth factor beta 1 mRNAs. J. Exp. Med. 178:521.[Abstract/Free Full Text]
  16. Burdin, N., K. van Kooten, L. Galibert, J. S. Abrams, J. Banchereau, F. Rousset. 1995. Endogenous IL-6 and IL-10 contribute to the differentiation of CD40-activated human B lymphocytes. J. Immunol. 154:2533.[Abstract]
  17. Cerutti, A., A. Schaffer, S. Shah, H. Zan, and P. Casali. 1998. A monoclonal model of terminal B cell differentiation. Human IgM+ IgD+CL-01 cells secrete endogenous IL-6 and undergo IL-6-dependent plasmacytoid differentiation upon stimulation with CD40L and IL-10. In Molecular and Genetic Approaches to Disease: Immunology, Hematology and Oncology. Y. Niho, ed. Kyushu University Press, Fukuoka, Japan. Vol. 2.
  18. Cerutti, A., A. Schaffer, S. Shah, H. Zan, H.-C. Liou, R. G. Goodwin, P. Casali. 1998. CD30 is a CD40L-inducible molecule that negatively regulates CD40-mediated immunoglobulin class switching in non antigen-selected human B cells. Immunity 9:247.[Medline]
  19. Cerutti, A., H. Zan, A. Schaffer, L. Bergsagel, N. Harindranath, E. E. Max, P. Casali. 1998. A human monoclonal B cell line as a model of IgG, IgA, and IgE class switching induced by physiological stimuli. J. Immunol. 160:2145.[Abstract/Free Full Text]
  20. Schettino, E. W., A. Cerutti, N. Chiorazzi, P. Casali. 1998. Lack of intraclonal diversification in Ig heavy and light chain V region genes expressed by CD5+ IgM+ chronic lymphocytic leukemia B cells: a multiple time point analysis. J. Immunol. 160:820.[Abstract/Free Full Text]
  21. Kasaian, M. T., H. Ikematsu, P. Casali. 1992. Identification and analysis of a novel human surface CD5-B lymphocyte subset producing natural antibodies. J. Immunol. 148:2690.[Abstract]
  22. McCaffrey, T. A., S. Consigli, B. Du, D. J. Falcone, T. A. Sanborn, A. M. Spokojny, J. H. L. Bush. 1995. Decreased type II/type I TGF-ß receptor ratio in cells derived from human atherosclerotic lesions: conversion from an antiproliferative to profibrotic response to TGF-ß1. J. Clin. Invest. 96:2667.
  23. Kasaian, M. T., H. Ikematsu, J. E. Balow, P. Casali. 1994. Structure of the VH and VL segments of monoreactive and polyreactive IgA autoantibodies to DNA in patients with systemic lupus erythematosus. J. Immunol. 152:3137.[Abstract]
  24. Young, I. T.. 1977. Use of the Kolmogorov-Smirnov test for analysis of histograms from flow systems and other sources. J. Histochem. Cytochem. 25:935.[Abstract]
  25. Malisan, F., F. Briere, J. M. Bridon, N. Harindranath., F. C. Mills, E. E. Max, J. Bancherau, H. Martinez-Valdez. 1996. Interleukin-10 induces immunoglobulin G isotype switch recombination in human CD40-activated naive B lymphocytes. J. Exp. Med. 183:937.[Abstract/Free Full Text]
  26. Stavnezer, J.. 1995. Regulation of antibody production and class switching by TGF-ß. J. Immunol. 55:1647.
  27. Stavnezer, J.. 1996. Antibody class switching. Adv. Immunol. 61:79.[Medline]
  28. Mill, F. C., G. Thyphronitis, F. D. Finkelman, E. E. Max. 1992. I{gamma} µ-{epsilon} isotype switch in IL-4 treated human B lymphoblastoid cells: evidence for sequential switch. J. Immunol. 149:1075.[Abstract]
  29. Kinashi, T., T. Godal, Y. Noma, N. R. Ling, Y. Yaoita, T. Honjo. 1987. Human neoplastic B cells express more than two isotypes of immunoglobulins without deletion of heavy-chain constant-region genes. Genes Dev. 1:465.[Abstract/Free Full Text]
  30. Kunimoto, D. Y., M. C. Sneller, L. Clafin, J. F. Mushinski, W. Strober. 1993. Molecular analysis of double isotype expression in IgA switching. J. Immunol. 150:1338.[Abstract]
  31. Fayette, J., B. Dubois, S. Vandenabeele, J. M. Bridon, B. Vanderbliet, I. Durand, J. Banchereau, C. Caux, F. Brière. 1997. Human dendritic cells skew isotype switching of CD40-activated naive B cells towards IgA1 and IgA2. J. Exp. Med. 11:1909.
  32. Briere, F., C. Servet-Delprat, J.-M. Bridon, J.-M. Saint-Remy, J. Banchereau. 1994. Human interleukin-10 induces naive surface immunoglobulin D+ (sIgD) B cells to secrete IgG1 and IgG3. J. Exp. Med. 179:757.[Abstract/Free Full Text]
  33. Fujieda, S., J. A. Waschek, K. Zhang, A. Saxon. 1996. Vasoactive intestinal peptide induces S{alpha}/Sµ switch circular DNA in human B cells. J. Clin. Invest. 98:1527.[Medline]
  34. Islam, K. B., B. Baskin, L. Nilsson, L. Hammarstrom, P. Sideras, C. I. E. Smith. 1994. Molecular analysis of IgA deficiency: evidence of impaired switching to IgA. J. Immunol. 152:1442.[Abstract]
  35. McIntyre, T. M., D. R. Klinmann, P. Rothman, M. Lugo, J. R. Dasch, J. J. Mond, C. M. Snapper. 1993. Transforming growth factor ß 1 selectively stimulates immunoglobulin G2b secretion by lipopolysaccharide-activated murine B cells. J. Exp. Med. 177:1031.[Abstract/Free Full Text]
  36. Snapper, C. M., W. Waegell, H. Beerninink, J. R. Dasch. 1993. Transforming growth factor-ß1 is required for secretion of IgG of all subclass by LPS-activated murine B cell in vitro. J. Immunol. 151:4625.[Abstract]
  37. Nilsson, L., P. Sideras. 1993. The human I{alpha}1 and I{alpha}2 germline promoter elements: proximal positive and distal negative elements may regulate the tissue specific expression of C{alpha}1 and C{alpha}2 germline transcripts. Int. Immunol. 5:271.[Abstract/Free Full Text]
  38. Chou, C., S. L. Morrison. 1993. A common sequence motif near nonhomologous recombination breakpoints involving Ig sequences. J. Immunol. 150:5350.[Abstract]
  39. Nilsson, L., P. Grant, I. Larsson, S. Pettersson, P. Sideras. 1995. The human I{alpha}1 region contains a TGF-ß1 responsive enhancer and a putative recombination hotspot. Int. Immunol. 8:1191.
  40. Gauchat, J.-F., S. Henchoz, G. Mazzei, J.P. Aubry, T. Brunner, H. Blasey, P. Life, D. Talabot, L. Flores-Romo, J. Thompson, K. Kishi, J. Butterfield, C. Dahinden, J.-Y. Bonnefoy. 1993. Induction of IgE synthesis in B cells by mast cells and basophils. Nature 365:340.[Medline]
  41. Pinchuk, L. M., S. J. Klaus, D. M. Magaletti, G. V. Pinchuk, J. P. Norsen, E. A. Clark. 1996. Functional CD40 ligand expressed by human blood dendritic cells is up-regulated by CD40 ligation. J. Immunol. 157:4363.[Abstract]
  42. Mach, F., U. Schombeck, G.K. Sukhova, T. Bourcier, J. Y. Bonnefoy, J. S. Pober, P. Libby. 1997. Functional CD40 ligand is expressed on vascular endothelial cells, smooth muscle cells, and macrophages: implication for CD40-CD40 ligand signaling in atherosclerosis. Proc. Natl. Acad. Sci. USA 94:1931.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Int ImmunolHome page
M. M. Sira, T. Yoshida, M. Takeuchi, Y. Kashiwayama, T. Futatani, H. Kanegane, A. Sasahara, Y. Ito, M. Mizuguchi, T. Imanaka, et al.
A novel immunoregulatory protein in human colostrum, syntenin-1, for promoting the development of IgA-producing cells from cord blood B cells
Int. Immunol., September 1, 2009; 21(9): 1013 - 1023.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Endsley, L. M. Njongmeta, E. Shell, M. W. Ryan, A. J. Indrikovs, S. Ulualp, R. M. Goldblum, W. Mwangi, and D. M. Estes
Human IgA-Inducing Protein from Dendritic Cells Induces IgA Production by Naive IgD+ B Cells
J. Immunol., February 15, 2009; 182(4): 1854 - 1859.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Stavnezer and J. Kang
The Surprising Discovery That TGF{beta} Specifically Induces the IgA Class Switch
J. Immunol., January 1, 2009; 182(1): 5 - 7.
[Full Text] [PDF]


Home page
J. Immunol.Home page
D. T. Avery, V. L. Bryant, C. S. Ma, R. de Waal Malefyt, and S. G. Tangye
IL-21-Induced Isotype Switching to IgG and IgA by Human Naive B Cells Is Differentially Regulated by IL-4
J. Immunol., August 1, 2008; 181(3): 1767 - 1779.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
M. Mizusawa, M. Kawamura, M. Takamori, T. Kashiyama, A. Fujita, M. Usuzawa, H. Saitoh, Y. Ashino, I. Yano, and T. Hattori
Increased Synthesis of Anti-Tuberculous Glycolipid Immunoglobulin G (IgG) and IgA with Cavity Formation in Patients with Pulmonary Tuberculosis
Clin. Vaccine Immunol., March 1, 2008; 15(3): 544 - 548.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. So and M. Croft
Cutting Edge: OX40 Inhibits TGF-beta- and Antigen-Driven Conversion of Naive CD4 T Cells into CD25+Foxp3+ T cells
J. Immunol., August 1, 2007; 179(3): 1427 - 1430.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Bergqvist, E. Gardby, A. Stensson, M. Bemark, and N. Y. Lycke
Gut IgA Class Switch Recombination in the Absence of CD40 Does Not Occur in the Lamina Propria and Is Independent of Germinal Centers
J. Immunol., December 1, 2006; 177(11): 7772 - 7783.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. Pihoker, L. K. Gilliam, C. S. Hampe, and A. Lernmark
Autoantibodies in Diabetes
Diabetes, December 1, 2005; 54(suppl_2): S52 - S61.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Montesinos-Rongen, R. Schmitz, C. Courts, W. Stenzel, D. Bechtel, G. Niedobitek, I. Blumcke, G. Reifenberger, A. von Deimling, B. Jungnickel, et al.
Absence of Immunoglobulin Class Switch in Primary Lymphomas of the Central Nervous System
Am. J. Pathol., June 1, 2005; 166(6): 1773 - 1779.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. C. Kim, C. R. Edmonston, X. Wu, A. Schaffer, and P. Casali
The HoxC4 Homeodomain Protein Mediates Activation of the Immunoglobulin Heavy Chain 3' hs1,2 Enhancer in Human B Cells: RELEVANCE TO CLASS SWITCH DNA RECOMBINATION
J. Biol. Chem., October 1, 2004; 279(40): 42258 - 42269.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Machida, K. T.-H. Cheng, V. M.-H. Sung, K. J. Lee, A. M. Levine, and M. M. C. Lai
Hepatitis C Virus Infection Activates the Immunologic (Type II) Isoform of Nitric Oxide Synthase and Thereby Enhances DNA Damage and Mutations of Cellular Genes
J. Virol., August 15, 2004; 78(16): 8835 - 8843.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
S Danese, M Sans, and C Fiocchi
The CD40/CD40L costimulatory pathway in inflammatory bowel disease
Gut, July 1, 2004; 53(7): 1035 - 1043.
[Full Text] [PDF]


Home page
J. Immunol.Home page
B. He, N. Raab-Traub, P. Casali, and A. Cerutti
EBV-Encoded Latent Membrane Protein 1 Cooperates with BAFF/BLyS and APRIL to Induce T Cell-Independent Ig Heavy Chain Class Switching
J. Immunol., November 15, 2003; 171(10): 5215 - 5224.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. S. Austin, K. M. Haas, S. M. Naugler, A. A. Bajer, D. Garcia-Tapia, and D. M. Estes
Identification and Characterization of a Novel Regulatory Factor: IgA-Inducing Protein
J. Immunol., August 1, 2003; 171(3): 1336 - 1342.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. A. Papadakis, C. Landers, J. Prehn, E. A. Kouroumalis, S. T. Moreno, J.-C. Gutierrez-Ramos, M. R. Hodge, and S. R. Targan
CC Chemokine Receptor 9 Expression Defines a Subset of Peripheral Blood Lymphocytes with Mucosal T Cell Phenotype and Th1 or T-Regulatory 1 Cytokine Profile
J. Immunol., July 1, 2003; 171(1): 159 - 165.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Schaffer, E. C. Kim, X. Wu, H. Zan, L. Testoni, S. Salamon, A. Cerutti, and P. Casali
Selective Inhibition of Class Switching to IgG and IgE by Recruitment of the HoxC4 and Oct-1 Homeodomain Proteins and Ku70/Ku86 to Newly Identified ATTT cis-Elements
J. Biol. Chem., June 13, 2003; 278(25): 23141 - 23150.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
J. H. Von der Thusen, J. Kuiper, T. J. C. Van Berkel, and E. A. L. Biessen
Interleukins in Atherosclerosis: Molecular Pathways and Therapeutic Potential
Pharmacol. Rev., March 1, 2003; 55(1): 133 - 166.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. G. Tangye, A. Ferguson, D. T. Avery, C. S. Ma, and P. D. Hodgkin
Isotype Switching by Human B Cells Is Division-Associated and Regulated by Cytokines
J. Immunol., October 15, 2002; 169(8): 4298 - 4306.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Spieker-Polet, P.-C. Yam, and K. L. Knight
Functional Analysis of I{alpha} Promoter Regions of Multiple IgA Heavy Chain Genes
J. Immunol., April 1, 2002; 168(7): 3360 - 3368.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Shimoda, T. Nakamura, Y. Takahashi, H. Asanuma, S.-i. Tamura, T. Kurata, T. Mizuochi, N. Azuma, C. Kanno, and T. Takemori
Isotype-specific Selection of High Affinity Memory B Cells in Nasal-associated Lymphoid Tissue
J. Exp. Med., December 3, 2001; 194(11): 1597 - 1608.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. H. Ottensmeier and F. K. Stevenson
Isotype switch variants reveal clonally related subpopulations in diffuse large B-cell lymphoma
Blood, October 1, 2000; 96(7): 2550 - 2556.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Zan, Z. Li, K. Yamaji, P. Dramitinos, A. Cerutti, and P. Casali
B Cell Receptor Engagement and T Cell Contact Induce bcl-6 Somatic Hypermutation in Human B Cells: Identity with Ig Hypermutation
J. Immunol., July 15, 2000; 165(2): 830 - 839.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Schaffer, A. Cerutti, S. Shah, H. Zan, and P. Casali
The Evolutionarily Conserved Sequence Upstream of the Human Ig Heavy Chain S{gamma}3 Region Is an Inducible Promoter: Synergistic Activation by CD40 Ligand and IL-4 Via Cooperative NF-{kappa}B and STAT-6 Binding Sites
J. Immunol., May 1, 1999; 162(9): 5327 - 5336.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Zan, A. Cerutti, P. Dramitinos, A. Schaffer, Z. Li, and P. Casali
Induction of Ig Somatic Hypermutation and Class Switching in a Human Monoclonal IgM+ IgD+ B Cell Line In Vitro: Definition of the Requirements and Modalities of Hypermutation
J. Immunol., March 15, 1999; 162(6): 3437 - 3447.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zan, H.
Right arrow Articles by Casali, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zan, H.
Right arrow Articles by Casali, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS