| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
S
and Sequential SµS
, SS DNA Recombination1
*
Division of Molecular Immunology, Department of Pathology, Cornell University Medical College, and
Immunology Program, Cornell University Graduate School of Medical Sciences, New York, NY 10021
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1-C1 and I2-C2
transcripts, mature VHDJH-C1 and
VHDJH-C2 transcripts, and IgA secretion.
These events are associated with not only direct Sµ
S, but also
sequential SµS
, SS DNA recombination, and are ablated
by neutralizing anti-TGF-ß but not IL-10 Ab, and indicating that
TGF-ß, not IL-10, is a crucial mediator of the transcriptional
activation and recombination of human C1 and C2 genes. Our
findings in CL-01 cells were reproduced in freshly isolated naive
sIgM+ sIgD+ B lymphocytes. Thus, engagement of
CD40, in the absence of other (known) stimuli, is sufficient to
effectively induce switching to IgA in human B cells. This is effected
by direct and sequential DNA recombination events, which are both
dependent upon endogenous TGF-ß secreted by the CD40L-induced B
cells. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mainly because of the lack of an optimal in vitro B cell model,
previous studies have provided valuable but incomplete information on
the requirements for and the modalities of class switching to IgA. In
the mouse, SµS DNA recombination is preceded by the
expression of germline C transcripts (I-C transcripts),
consisting of mRNA that reflects the sequence of the I exon,
located upstream of the corresponding S region, and that of the C
exons (1, 2). It occurs through looping out and excision of the
intervening chromosomal DNA, which is released as an extrachromosomal
reciprocal recombination product or "switch circle" (2), and brings
a given rearranged VHDJH gene segment in
proximity of the targeted downstream CH gene. The
transcriptional activation of C genes has been suggested to be
induced by TGF-ß, but the induction of SµS DNA recombination
is thought to require additional signals, such as those provided by LPS
or IL-2 (3, 4). In addition, high rates of IgA secretion have been
effectively induced in murine resting B cells by surface IgD (sIgD)
crosslinking and concomitant exposure to either LPS or CD40 ligand
(CD40L, CD154), TGF-ß, IL-4, and IL-5 (5), indicating that efficient
induction of switching to IgA may require multiple inducing stimuli.
Studies in human B cells have suggested that TGF-ß triggers both
I1-C1 and I2-C2 germline transcription (6) but induces
VHDJH-C1 and
VHDJH-C2 mature transcription only in the
presence of additional costimulatory signals, such as those provided by
Branhamella catarrhalis (7), Staphylococcus
aureus Cowan I, or CD40 engagement (8, 9, 10, 11). IL-10 has also
been implicated as playing a critical role in the events leading to
VHDJH-C mature transcription and IgA
synthesis (8, 10, 12, 13), but definitive proof that IL-10 directs
SµS DNA recombination has not been provided. Because of the
heterogeneity of the human B cell fractions used in many studies (10, 14), a thorough discrimination between switching to IgA and replication
and differentiation of IgA+ B cell precursors has not
always been possible, thereby hampering a definition of the relative
contribution of IL-10 and TGF-ß to the induction of C1 and C2
transcriptional activation, and VHDJH-C1 and
VHDJH-C2 mature transcription. The
suggestion that B cells can produce TGF-ß and IL-10 (15, 16) adds
further complexity to the definition of the precise role of these
endogenous cytokines in switching to IgA. Finally, still awaiting a
definition are the relative contribution of sequential SµS,
SS (if any) DNA recombination to the generation of mature
VHDJH-C1 and
VHDJH-C2 transcripts, and the minimal
requirements for induction of DNA recombination to C, as an
intermediate step in such a putative sequential switching to C1 or
C2.
In this study, we have used our recently identified human monoclonal
model of GC differentiation, sIgM+ sIgD+ CL-01
cells (17, 18, 19), as well as freshly isolated naive B cells to define the
requirements for and the transcriptional and recombinatorial modalities
of switching to IgA. Our findings indicate that switching to IgA in the
human is dependent upon CD40 engagement and induction of endogenous
TGF-ß and is associated with not only direct SµS but also
sequential SµS, SS DNA recombination.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The human monoclonal CL-01 sIgM+ sIgD+ B
cell line, a Burkitt’s lymphoma carrying the t(8; 14) translocation
and spontaneously secreting IgM, has been described (17, 18, 19, 20). PBMCs
were isolated from healthy subjects, depleted of T cells (17, 18, 21),
tagged with a FITC-conjugated mouse mAb to human IgD (Southern
Biotechnology Associates, Birmingham, AL), and then reacted with
anti-FITCisomer 1 Microbeads (Miltenyi Biotec, Auburn,
CA). The samples were kept on ice throughout these manipulations.
Highly purified (naive) sIgD+ B cells were segregated using
a MACS magnetic sorter (Miltenyi Biotec). The purity of these
sIgD+ B cells was demonstrated by the lack of
detectable VHDJH-C and
VHDJH-C transcripts using a nested
RT-PCR with a VH FR3 sense primer and C, C antisense
primers as described later in this section (not shown). B cells were
cultured in RPMI 1640 medium (Life Technologies, Grand Island, NY)
supplemented with 10% heat-inactivated FCS, 2 mM
L-glutamine, 100 U/ml penicillin, and 100 mg/ml
streptomycin. For the Ig switching experiments, B cells were cultured
at 0.5–1.0 x 104/well in 96-well plates at a 2:1
ratio with irradiated (4000 rad) human embryonic kidney 293 cells
transfected with human CD8 or CD40L (CD8-293 cells and CD40L-293 cells,
respectively) in a 200-µl volume. CD40L-293 cells express surface
CD40L at threefold higher density than L cells transfected with CD40L
(not shown). In some experiments, soluble trimeric human
CD40L/leucine-zipper fusion protein (htCD40L) (Immunex, Seattle, WA)
was used at 500 ng/ml instead of CD40L-293 cells.
TGF-ß, IL-10, and IgA
Human TGF-ß1 (Genzyme, Cambridge, MA), and IL-10 (Schering-Plough, Kenilworth, NJ) were used at 0.5 ng/ml and 100 ng/ml, respectively. Neutralizing anti-TGF-ß Ab and anti-IL-10 Ab (Genzyme) were used at the saturating concentration of 30 µg/ml. At this concentration, the anti-TGF-ß Ab effectively neutralizes [3H]TdR uptake by mink lung epithelial CCL64 cells (see below), and the anti-IL-10 Ab abrogates IL-10-induced IgM and IgG secretion by human B cells (our unpublished results and 17 . Active TGF-ß was measured in the culture fluids using a bioassay based upon [3H]TdR uptake by mink lung epithelial CCL64 cells (American Type Culture Collection, Manassas, VA) (22). Culture fluids were also tested for total human TGF-ß and IL-10 content using specific ELISAs performed according to the manufacturer’s instructions (Biosource International, Camarillo, CA). Supernatants were assessed for IgA content using a specific ELISA (19). IgA1 and IgA2 were measured using ELISA based on specific anti-IgA1 and anti-IgA2 mAbs (23).
Fluorescence flow cytometric analysis
B cells (105) were reacted for 30 min on ice with FITC- and phycoerytrin-conjugated Abs to human IgM (Sigma, St. Louis, MN) and IgA (Southern Biotechnology Associates) and then washed with PBS containing 3% BSA. Cells (104) were analyzed using FACScalibur (Becton Dickinson Immunocytometry Systems, Mountain View, CA), and the data were processed using the Macintosh CELLQuest software program (Becton Dickinson Immunocytometry Systems), which includes the Kolmogorov-Smirnov analysis tool (24).
PCR amplification of IH-CH transcripts, VHDJH-CH transcripts, and ß-actin
RNA was isolated from 3 x 106 CL-01 cells
using the RNeasy Total RNA Kit (Qiagen, Cathsworth, CA) and then
reverse transcribed using the SuperScript Preamplification System for
first strand cDNA synthesis (Life Technologies). Germline I1-C1,
I2-C2, and I1-C1, as well as mature
VHDJH-C1,
VHDJH-C2,
VHDJH-C1, and ß-actin transcript cDNAs
were PCR-amplified as described (19).
Identification of extrachromosomal switch DNA circles
S-Sµ, S-S, and S-Sµ switch circles were
PCR-amplified from genomic DNA (500 ng) in a 50-µl volume containing
50 nM of each of the appropriate sense and antisense primers (19). To
amplify S-Sµ switch circles, the I1/2 sense primer 5'
CAGCAGCCCTCTTGGCAGGCAGCCAG 3' (spanning residues 843–868 of the
consensus I sequence, GenBank Accession Number L04540) was used in
combination with the 3' Sµ antisense primer 5'
TGAGTGCCCTCACTACTTGCGTCCCG 3' (Sµ region residues 4345–4373,
X56795). To amplify S-S switch circles, the I1/2 sense primer
was used in association with the 3' S antisense primer 5'
CCTGCCTCCCAGTGTCCTGCATTACTTCTG 3' (consensus 3' S sequence residues
3596–3625, U39737). The primers used for the amplification of
S-Sµ switch circles are reported elsewhere (25). The PCR
conditions were: 10 min denaturation at 94°C, followed by 10 min
annealing at 68°C (DNA polymerase was added at this step); then, 1
min denaturation at 94°C, 2 min annealing at 68°C, and 3 min
extension at 72°C for 30 cycles. A second PCR was performed using the
product of the first PCR as a template, together with the internal
sense primer I1/2 5' CTCAGCACTGCGGGCCCTCCA 3' (consensus I
sequence residue 918–938, L04540) in combination with the internal
antisense primer 3' Sµ 5' CAGACTGTCATGGCTATCAGGGGTGGCGGGG 3'
(Sµ sequence residues 2981–3361, X56795), or 3' S 5'
CCCTGGAGTCCCACTGCAGGTG 3' (S sequence residues 3340–3361,
U39737). The DNAs PCR-amplified from switch circles were identified by
Southern blotting using 5' I, 5' S, 3' S, and 3' Sµ
region-specific probes generated by PCR amplification of artificial
plasmid templates (19). Purified PCR-amplified switch circle DNAs were
cloned using the TA cloning method (Invitrogen, Carlsbad, CA). Positive
clones were PCR-identified using the 5' S sense primer (S region
residues 40–60) in combination with the above 3' S or 3' Sµ
antisense primers, and then sequenced by the dideoxynucleotide chain
termination method using the TaqTrack DNA Sequencing System (Promega,
Madison, WI). Each sequence was derived from the analysis of six
independent recombinant clones. The DNA sequences were analyzed using
the BLAST algorithm, as found in the National Center for Biotechnology
Information web page, and the GenBank DNA sequence database.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We addressed the requirements for switching to IgA using our
monoclonal model of human GC differentiation, sIgM+
sIgD+ CL-01 cells. These B cells switch to all seven
downstream Ig isotypes upon exposure to physiologic stimuli, i.e.,
CD40L and cytokines (19). CL-01 cells were cultured with CD40L-293
cells alone, CD40L-293 cells and TGF-ß1, CD40L-293 cells and IL-10,
CD40L-293 cells and both TGF-ß1 and IL-10, or, as controls, CD8-293
cells alone, CD8-293 cells and TGF-ß1, CD8-293 cells and IL-10, or
CD8-293 cells and both TGF-ß1 and IL-10. After 8 days, CL-01 cells
were analyzed for sIgM and sIgA by fluorescence flow cytometry.
Virtually all CL-01 cells cultured with CD8-293 cells alone or with
TGF-ß1 and/or IL-10 lacked sIgA (Fig. 1
, A–D). In contrast, CL-01
cells cultured with CD40L-293 cells gave rise to sIgM+
sIgA+ and sIgM- sIgA+ cells (Fig. 1E, cells in the right upper and lower quadrants equal about
2% and 5% of total cells, respectively). The proportion of
sIgM- sIgA+ cells increased in the presence of
(exogenous) TGF-ß1 (
8%) or IL-10 (12%) and was further
boosted by both TGF-ß1 and IL-10 (about 16%) (Fig. 1, F–H).
|
, I and J). The
virtual abrogation of IgA switching by anti-TGF-ß but not
anti-IL-10 Ab, even in the presence of excess IL-10 (200 ng/ml)
(Fig. 1, K and L), further indicated that
TGF-ß, not IL-10, mediated switching to IgA. To substantiate the
indication by the above experiments that active TGF-ß is secreted
by CD40L-induced B cells, CL-01 cells were cultured with CD40L-293,
soluble htCD40L, or control CD8-293 cells. After 2, 5, and 8 days, the
culture fluids were analyzed for both total and active TGF-ß and
total IL-10, which has also been reported to be produced by activated B
cells (16). Unstimulated CL-01 cells secreted some TGF-ß and IL-10,
but secretion of TGF-ß and IL-10 was enhanced more than fourfold upon
engagement of CD40 by CD40L-293 cells (Fig. 2) or soluble htCD40L (not shown). A
significant proportion of the secreted TGF-ß was in the
active form.
|
CD40 engagement induces TGF-ß-dependent germline
I1-C1/I2-C2 and mature
VHDJH-C1/C2 transcription and IgA
secretion in human B cells
Recombination to a downstream CH gene is preceded by
targeted IH-CH germline transcription and
leads to the expression of
VHDJH-CH mature
transcripts, which are translated into functional Ig proteins (27). To
investigate the role of CD40L and endogenous TGF-ß in the
transcriptional activation of human C1 and C2 genes, CL-01 cells
were cultured in medium only, with control CD8-293 cells alone, CD8-293
cells and TGF-ß1, CD40L-293 cells alone, CD40L-293 cells and
TGF-ß1, CD40L-293 cells and neutralizing anti-TGF-ß Ab, soluble
htCD40L alone, soluble htCD40L and TGF-ß1, or soluble htCD40L and
neutralizing anti-TGF-ß1 Ab. Germline I-C and mature
VHDJH-C transcript cDNAs were PCR amplified
from cultured CL-01 cells after 2 and 5 days, respectively, and the
amount of secreted IgA was measured in the culture fluids after 8 days.
CL-01 cells cultured alone or with CD8-293 cells, in the presence or in
the absence of TGF-ß1, neither secreted detectable amounts of IgA nor
expressed germline I-C or mature
VHDJH-C transcripts (Fig. 3A). Exposure of CL-01 cells
to CD40L-293 cells or soluble htCD40L resulted in induction of germline
I1-C1 and I2-C2 transcription, mature
VHDJH-C1 and
VHDJH-C2 transcription, and IgA (both IgA1
and IgA2) secretion (Fig. 3A and not shown), which,
consistent with the experiments of Fig. 1, was enhanced by exogenous
TGF-ß1 and abrogated by the neutralization of endogenous TGF-ß.
|
B and not
shown), further indicating that CD40 engagement, in the absence of
other stimuli, effectively induces human B cells to initiate
germline I-C and mature VHDJH-C
transcription and IgA secretion. These events are crucially mediated by
the endogenous TGF-ß that is secreted by the CD40L-induced B cells.
CD40 engagement induces not only direct SµS but also
sequential SµS, SS DNA recombination in human B
cells
Switch recombination occurs between two different S regions, each
located 5' of the recombining CH genes. While switching to
IgG or IgE in human B cells has been formally associated with S-S DNA
recombination (25, 28), IgA has not been conclusively shown to be
associated with a recombinatorial event. Rather, the consistent
occurrence of circulating sIgM+ sIgA+ B cells
has suggested the possibility that in humans IgA synthesis results from
alternative RNA splicing rather than DNA recombination (29, 30). To
analyze the role of SS DNA recombination in switching to IgA, CL-01
cells were cultured in medium only, with CD8-293 cells and TGF-ß1, or
with CD40L-293 cells alone. After 5 days, genomic DNA was extracted
from the cultured CL-01 cells, and the extrachromosomal S-Sµ and
S-S DNA switch circles were amplified using specific PCRs. No
junctional S-Sµ or S-S DNAs were amplified from CL-01 cells
cultured with CD8-293 cells with or without TGF-ß (Fig. 4, A and D,
lanes 1 and 2). In contrast, S-Sµ (0.45,
0.7, and 1.3 kb) and S-S junctional cDNAs (0.9 kb) were
consistently amplified from three independent cultures of CL-01 cells
with CD40L-293 cells (Fig. 4, A and D,
lanes 2, 3, and 4). The
extrachromosomal S-Sµ or S-S switch circle origin of the PCR
DNAs was verified by sequential hybridization with specific
[-32P]-I and -Sµ or -S probes. The 0.7- and
1.3-kb, but not the 0.45-kb S-Sµ fragments hybridized with the
I and Sµ probes (Fig. 5,
B and C), while the 0.9-kb S-S product
hybridized with the specific [-32P]-I and -S
probes (Fig. 5, E and F), indicating that both
direct SµS and sequential SµS, SS DNA
recombination had occurred in the CD40L-induced B cells.
|
|
-Sµ and only one S-S switch
circles in our multiple experimental samples suggested that both direct
and sequential switch DNA recombination occurred at the level of yet to
be characterized "hotspots," and perhaps reflects the monoclonality
of our Ig switch model. To characterize these putative hotspots, and to
define the subclass composition of the S-Sµ and S-S switch
circles, the PCR DNAs that hybridized in the above experiments were
cloned, and three clones from each DNA were sequenced. The and
genes involved in the S-S DNA recombination were determined by careful
analysis of key nucleotides within the I and S regions. All three
clones from each fragment were identical and consisted of a S1
region combined with a Sµ and S1 region, respectively (Fig. 5). In
the S1-Sµ circles, the breakpoint was located within the S1
region, while, in the S1-S circles it was at the 3' end of the
I1 sequence, suggesting that direct and sequential recombination to
C1 involves different breakpoints.
IL-10 enhances the CD40L-induced IgA secretion but does not trigger
transcriptional activation of the C1 and C2 genes
It has been suggested that IL-10 plays a role in directing
switching to IgA (10, 13, 31), but such a role was not supported by our
demonstrations that the neutralization of IL-10 does not affect
switching to IgA, while that of TGF-ß ablates the IL-10-dependent
expansion of sIgA+ B cells (Fig. 1, I–L). We
analyzed the role of IL-10 in the transcriptional activation and
recombination of the human C1 and C2 genes using CL-01 cells
cultured with control CD8-293 cells alone, CD8-293 cells and IL-10,
CD40L-293 cells alone, CD40L-293 cells and IL-10, CD40L-293 cells and
anti-IL-10 Ab, CD40L-293 cells and both IL-10 and anti-IL-10
Ab, or CD40L-293 cells and both IL-10 and anti-TGF-ß Ab. Germline
I-C and mature VHDJH-C transcripts
were PCR amplified from the CL-01 cells cultured for 2 and 5 days,
respectively. Secreted IgA was measured in the culture fluids after 8
days. Upon incubation with CD8-293 cells alone (not shown), or with
IL-10, CL-01 cells neither secreted IgA nor expressed germline or
mature C transcripts (Fig. 6). In
contrast, and as expected from the findings of Fig. 1, upon culture
with CD40L-293 cells CL-01 cells secreted significant amounts of IgA
and expressed germline I1-C1, I2-C2, and mature
VHDJH-C1,
VHDJH-C2 transcripts. Expression of C1
and C2 transcripts and IgA production were both boosted by exogenous
IL-10 and were only marginally affected by neutralizing anti-IL-10
Ab, suggesting that endogenous IL-10 played only a minor role, if any,
in the overall CD40-induced IgA production. The amount of
anti-IL-10 Ab used far exceeded that required to neutralize the
endogenous IL-10, as suggested by the original titration of this Ab
(see Materials and Methods), and by the demonstration that
an identical amount of the same Ab completely reversed the boost of IgA
production induced by exogenous IL-10 but not residual IgA production
(Fig. 6). The ablation of IgA production by anti-TGF-ß Ab in
CL-01 cells cultured with CD40L-293 cells and supplemented with
exogenous IL-10 further indicated that CD40-induced switching to IgA is
dependent on endogenous TGF-ß and not IL-10 (Fig. 6). It also
suggested that IL-10 is not directly involved in the transcriptional
activation of C1 and C2 genes, which, rather, is strictly
dependent on the presence of endogenous TGF-ß.
|
S but also sequential SµS, SS DNA
recombination in CD40L-induced human B cells
Having shown that switching to IgA can occur through direct
SµS or sequential SµS, SS DNA recombination,
and because of the putative ability of IL-10 to mediate switching to
IgG (12, 25, 27, 32), we addressed the issue as to whether endogenous
IL-10 plays a role in mediating DNA recombination to C, as a
first step in the sequential SµS, SS DNA
recombination. Germline I1-C1, I1-C1, and I2-C2
(after 2 days of culture) and mature
VHDJH-C1,
VHDJH-C1, and
VHDJH-C2 transcripts, as well as
S-Sµ, S-Sµ, and S-S switch circles (after 5 days) were
PCR-amplified in CL-01 cells that were cultured with CD40L-293 cells in
the presence or in the absence of neutralizing anti-IL-10 or
anti-TGF-ß Ab. The concentration of secreted IgA and IgG was
measured in the culture fluids after 8 days. We chose to analyze
I1-C1 transcripts because of their putative involvement in
sequential DNA recombination to C1, which is generally more
frequently targeted than C2. The neutralization of endogenous IL-10
did not interfere with these DNA transcriptional and recombinatorial
events (Fig. 7) but abrogated the
secretion of IgG (not shown). In contrast, the neutralization of
endogenous TGF-ß abrogated both germline I1-C1, I1-C1,
I1-C1, and mature VHDJH-C1, -C1,
-C2 transcription, as well as the generation of S-Sµ,
S-Sµ, and S-S switch circles (Fig. 7), and IgG and IgA
secretion (not shown), further confirming the TGF-ß dependency of the
transcriptional activation and recombination of the human C1 and
C2 genes and demonstrating that endogenous TGF-ß effectively
mediates SµS1 DNA recombination as a first step in sequential
recombination to C1.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 and C2 gene transcription
and recombination; and 3) the role of direct SµS and, if any,
sequential SµS, SS DNA recombination. We have
ascertained the physiologic significance of our findings in freshly
isolated circulating sIgM+ sIgD+ B cells.
Previous in vitro experiments have suggested that a mitogenic stimulus,
such as LPS or CD40L, does not trigger switching to IgA unless
(exogenous) TGF-ß is added to the B cell culture (3, 4, 5, 6, 7, 8, 25). Our
findings confirm that TGF-ß is required for switching to IgA, and
show that the required TGF-ß can be secreted by the CD40L-induced B
cells. They demonstrate that in the absence of any other stimuli, CD40
engagement is sufficient to induce not only I1-C1 and I2-C2
germline transcripts, but also VHDJH-C1 and
VHDJH-C2 mature transcripts, switch DNA
recombination (as assessed by the detection of S-Sµ and S-S
switch circles) and surface and secreted IgA, and that this induction
is strictly dependent on the CD40L-induced B cell-derived endogenous
TGF-ß. The less vigorous response and secretion of endogenous TGF-ß
by B cells challenged by the "less physiologic" agonistic
anti-CD40 mAb or CD40L-transfected L cells, which express surface
CD40L at a much lower density than CD40L-293 cells (see Materials
and Methods), may explain the failure to induce IgA class
switching in naive human B cells by other investigators (29, 31).
The suggestion that CD40L and TGF-ß do not induce IgA1 and IgA2
production in human naive B cells unless IL-10 is present (12, 14) and
that this cytokine is crucial for the induction of mature
VHDJH-C1 and
VHDJH-C2 transcription (10) have suggested a
crucial role for IL-10 in the molecular events that lead to IgA
switching. Our experiments show that, like TGF-ß, endogenous IL-10 is
produced by CD40-activated human B cells, but its neutralization by
specific Ab does not significantly affect germline and mature C
transcription, nor does it affect the generation of S-derived switch
circles, suggesting that this cytokine is not responsible for the
induction of C1 or C2 gene transcription and switch DNA
recombination. They also show that in CD40L-stimulated B cells, IL-10
significantly increases both the number of sIgA+
lymphocytes and the amount of secreted IgA. This biologic activity is
specific in that it is reversed by neutralizing anti-IL-10 Ab. Thus,
our findings indicate that IL-10 cannot substitute for TGF-ß in the
induction of IgA switching, rather it would boost proliferation and IgA
secretion in already switched sIgA+ B cells.
TGF-ß is a ubiquitous pleiotropic cytokine that is secreted in a
latent form and is activated by proteolytic cleavage (26). A major
limitation in understanding how TGF-ß induces switching to IgA is the
scarcity of information on the source(s) of active TGF-ß at the
presumptive site of induction of C1 and C2 gene transcription,
mainly the mucosa-associated lymphoid tissue, including the Peyer’s
patches (26), and the regulation of the activation of the latent form
of newly synthesized TGF-ß1. Our findings indicate that B cells are a
major source of TGF-ß, which, upon CD40 activation, is activated and
secreted in amounts sufficient to mediate effective class switching to
IgA. The functional independence of CD40L-induced B cells from
paracrine TGF-ß may constitute an advantage at those sites, such as
digestive and respiratory mucosae, where the prompt production of IgA
effector molecules is crucial for an effective defense against viral
and microbial pathogens. In addition, unlike paracrine TGF-ß1, B
cell-derived TGF-ß1 may be secreted in amounts devoid of
antiproliferative effects, which could hamper switching to IgA due to
the functional linkage of the cell cycle with DNA recombination (26, 27).
In human B cells, direct SµS DNA recombination has been
formally documented only in two cases (33, 34), and the contribution to
IgA switching of sequential DNA recombination to C through an
intervening isotype has never been formally addressed to the best of
our knowledge. Our experiments show that both direct SµS1 and
sequential SµS1, S1S1 DNA recombination, as assessed
by the identification of S1-Sµ and S1-S1 switch circles and
VHDJH-C1 mature transcripts, contribute to
IgA switching in human monoclonal sIgM+ sIgD+ B
cells. These experiments also show that sequential SµS1,
S1S1 DNA recombination is induced effectively by CD40
engagement in the absence of other (known) stimuli and is mediated by
endogenous TGF-ß, as the intermediate SµS1 switching (giving
rise to S1-Sµ and S1-S1 circles) was ablated by the
neutralizing anti-TGF-ß but not anti-IL-10 Ab. These
experiments strengthen the role of direct SµS DNA
recombination in human switching to IgA (33) and extend it to include
the additional contribution of sequential SµS, SS DNA
recombination to this process. By demonstrating that both direct
SµS and sequential SµS, SS DNA recombinations
are mediated by endogenous TGF-ß but not IL-10, despite the suggested
IgG switch-inducing potential of IL-10 (25), these experiments further
findings in the mouse suggesting that TGF-ß directs switching to not
only C but also C genes (35, 36) and extend our recent
observation that IL-10 cannot induce the activation of the regulatory
sequence upstream of human S1 in luciferase reporter gene
assays.4
The induction of both C1 and C2 germline and mature transcription
in monoclonal CL-01 cells suggests that a single B cell clonotype can
undergo switching to C1 and/or C2 in response to the same
IgA-inducing stimuli, i.e., CD40. This finding is consistent with the
high homology of the human C1 and C2 gene upstream regulatory
sequences, which contain overlapping PU-1/SP-1, cAMP-responsive element
(CRE), and E box motifs (7, 37). These motifs have been shown in
chloramphenicol acetyl transferase (CAT) assays to mediate
either basal or TGF-ß/phorbol ester-induced activity (7, 37). The
lack of S2 regions in the switch circles analyzed here possibly
reflect the relative scarcity of switching to C2 compared with C1
in human B cells. The DNA breakpoint was consistently different in the
switch circles generated from direct and sequential DNA recombination
to C1. In the S1-Sµ circles, this breakpoint was located
within the S1 region, consistently proximal to a 5' TGAG 3' motif,
which has been reported to be associated with S region recombination
sites (38). In the S1-S1 switch circles, the breakpoint
was at the 3' end of the I1 sequence, indicating a possible
involvement of I1 in DNA recombination, perhaps owing to the
presence of a 
-like recombination hotspot element within the I1
proximal promoter region (39). Interestingly, the junctional sequences
of the S1-Sµ and S1-S1 switch circles obtained from B cells
induced by CD40L were similar to those of the respective circles from B
cells induced by CD40L and IL-4 or IL-10 (not shown, see 19 .
Thus, switch S recombination can occur within either the S or the
I region, and S-Sµ and S-S DNA recombination junctions
can be conserved even if induced by different stimuli.
Our demonstration that CD40 engagement alone is sufficient to
effectively trigger C1 and C2 gene transcriptional activation and
targeted S1 and S2 DNA recombination allows us to speculate that
switching to IgA can take place in districts in which B cell CD40 is
engaged by CD40L borne on cells other than T lymphocytes, such as
mast-cells, endothelial cells, or dendritic cells (40, 41, 42), in the
lamina propria mucosae of the respiratory and digestive tracts. At
these sites, the TGF-ß necessary to trigger switching to IgA, as well
as to IgG, can be provided by the CD40L-activated B cells. Endogenous
TGF-ß could mediate both direct Sµ S and sequential
SµS, SS switch DNA recombination. IL-10, which is also
produced by CD40L-activated B cells, may further enhance the
TGF-ß-mediated IgA and IgG switching, not only by enhancing the
replication and secretion of already switched B cells, but also
amplifying the effects of both endogenously present and/or exogenously
added TGF-ß through either a synergistic and/or additive effect, or,
possibly, by indirectly or directly influencing TGF-ß levels in
culture. Collectively, our findings define CD40 engagement and B
cell-derived TGF-ß as the two key factors in directing both direct
SµS and sequential SµS, SS switch
recombination in human B cells, but provide no clue to the
intracellular signaling pathways emanating from CD40 and TGF-ßR and
mediating the transcriptional activation of the C and C genes.
The definition of these pathways and that of the elements capable of
binding to the evolutionary conserved regulatory regions upstream of
these Ig H chain C genes are presently pursued in our laboratory
through transfection experiments involving selected human Ig H chain
locus DNA elements and human CL-01 cells.
|
Acknowledgments |
|---|
-Sµ, S-Sµ, and S-S construct;
Dr. S. Lederman (College of Physicians and Surgeons, Columbia
University, New York, NY) for providing us with CD8- and CD40L-293
cells; Dr. S. Narula (Schering-Plough Research Institute,
Kenilworth, NJ) for providing us with human rIL-4 and human rIL-10;
Dr. R. Goodwin and Ms. K. S. Picha (Immunex, Seattle,
WA) for their gift of soluble trimeric human CD40L/leucine-zipper
fusion protein; and Dr. T. A. McCaffrey for helping us with the
measurements of TGF-ß. |
Footnotes |
|---|
2 Address correspondence and reprint request to Dr. Paolo Casali, Division of Molecular Immunology, Department of Pathology, Cornell University Medical College, 1300 York Avenue, New York, NY 10021.
3 Abbreviations used in this paper: GC, germinal center; CD40L, CD40 ligand; CD40L-293, human CD40L-transfected human embryonic kidney 293 cells; CH, C region of the Ig H chain; FR3, framework 3; htCD40L, trimeric human CD40L/leucine-zipper fusion protein; I, intervening region; IH-CH, germline Ig transcripts; S, switch region; sIg, surface Ig; VHDJH-CH, productive Ig transcripts.
4 A. Schaffer, A. Cerutti, H. Zan, and P. Casali. Submitted for publication.
Received for publication March 24, 1998. Accepted for publication July 9, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
germline transcripts in B lymphoma I.29µ: transforming growth factor-ß activates transcription of the unrearranged C gene. J. Immunol. 147:4374.[Abstract]
1 and C2 germ-line transcripts. Int. Immunol. 3:1107.1 and C2 germ-line and mature transcripts in human peripheral blood B cells. J. Immunol. 153:1466.[Abstract]
µ-
isotype switch in IL-4 treated human B lymphoblastoid cells: evidence for sequential switch. J. Immunol. 149:1075.[Abstract]
/Sµ switch circular DNA in human B cells. J. Clin. Invest. 98:1527.[Medline]
1 and I2 germline promoter elements: proximal positive and distal negative elements may regulate the tissue specific expression of C1 and C2 germline transcripts. Int. Immunol. 5:271.1 region contains a TGF-ß1 responsive enhancer and a putative recombination hotspot. Int. Immunol. 8:1191.
This article has been cited by other articles:
|
|
 |
|
  M. M. Sira, T. Yoshida, M. Takeuchi, Y. Kashiwayama, T. Futatani, H. Kanegane, A. Sasahara, Y. Ito, M. Mizuguchi, T. Imanaka, et al. A novel immunoregulatory protein in human colostrum, syntenin-1, for promoting the development of IgA-producing cells from cord blood B cells Int. Immunol., July 10, 2009; (2009) dxp067v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Endsley, L. M. Njongmeta, E. Shell, M. W. Ryan, A. J. Indrikovs, S. Ulualp, R. M. Goldblum, W. Mwangi, and D. M. Estes Human IgA-Inducing Protein from Dendritic Cells Induces IgA Production by Naive IgD+ B Cells J. Immunol., February 15, 2009; 182(4): 1854 - 1859. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Stavnezer and J. Kang The Surprising Discovery That TGF{beta} Specifically Induces the IgA Class Switch J. Immunol., January 1, 2009; 182(1): 5 - 7. [Full Text] [PDF]
|
|
|
|
|
|
D. T. Avery, V. L. Bryant, C. S. Ma, R. de Waal Malefyt, and S. G. Tangye IL-21-Induced Isotype Switching to IgG and IgA by Human Naive B Cells Is Differentially Regulated by IL-4 J. Immunol., August 1, 2008; 181(3): 1767 - 1779. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Mizusawa, M. Kawamura, M. Takamori, T. Kashiyama, A. Fujita, M. Usuzawa, H. Saitoh, Y. Ashino, I. Yano, and T. Hattori Increased Synthesis of Anti-Tuberculous Glycolipid Immunoglobulin G (IgG) and IgA with Cavity Formation in Patients with Pulmonary Tuberculosis Clin. Vaccine Immunol., March 1, 2008; 15(3): 544 - 548. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. So and M. Croft Cutting Edge: OX40 Inhibits TGF-beta- and Antigen-Driven Conversion of Naive CD4 T Cells into CD25+Foxp3+ T cells J. Immunol., August 1, 2007; 179(3): 1427 - 1430. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Bergqvist, E. Gardby, A. Stensson, M. Bemark, and N. Y. Lycke Gut IgA Class Switch Recombination in the Absence of CD40 Does Not Occur in the Lamina Propria and Is Independent of Germinal Centers J. Immunol., December 1, 2006; 177(11): 7772 - 7783. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Pihoker, L. K. Gilliam, C. S. Hampe, and A. Lernmark Autoantibodies in Diabetes Diabetes, December 1, 2005; 54(suppl_2): S52 - S61. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Montesinos-Rongen, R. Schmitz, C. Courts, W. Stenzel, D. Bechtel, G. Niedobitek, I. Blumcke, G. Reifenberger, A. von Deimling, B. Jungnickel, et al. Absence of Immunoglobulin Class Switch in Primary Lymphomas of the Central Nervous System Am. J. Pathol., June 1, 2005; 166(6): 1773 - 1779. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. C. Kim, C. R. Edmonston, X. Wu, A. Schaffer, and P. Casali The HoxC4 Homeodomain Protein Mediates Activation of the Immunoglobulin Heavy Chain 3' hs1,2 Enhancer in Human B Cells: RELEVANCE TO CLASS SWITCH DNA RECOMBINATION J. Biol. Chem., October 1, 2004; 279(40): 42258 - 42269. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Machida, K. T.-H. Cheng, V. M.-H. Sung, K. J. Lee, A. M. Levine, and M. M. C. Lai Hepatitis C Virus Infection Activates the Immunologic (Type II) Isoform of Nitric Oxide Synthase and Thereby Enhances DNA Damage and Mutations of Cellular Genes J. Virol., August 15, 2004; 78(16): 8835 - 8843. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S Danese, M Sans, and C Fiocchi The CD40/CD40L costimulatory pathway in inflammatory bowel disease Gut, July 1, 2004; 53(7): 1035 - 1043. [Full Text] [PDF]
|
|
|
|
|
|
B. He, N. Raab-Traub, P. Casali, and A. Cerutti EBV-Encoded Latent Membrane Protein 1 Cooperates with BAFF/BLyS and APRIL to Induce T Cell-Independent Ig Heavy Chain Class Switching J. Immunol., November 15, 2003; 171(10): 5215 - 5224. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Austin, K. M. Haas, S. M. Naugler, A. A. Bajer, D. Garcia-Tapia, and D. M. Estes Identification and Characterization of a Novel Regulatory Factor: IgA-Inducing Protein J. Immunol., August 1, 2003; 171(3): 1336 - 1342. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Papadakis, C. Landers, J. Prehn, E. A. Kouroumalis, S. T. Moreno, J.-C. Gutierrez-Ramos, M. R. Hodge, and S. R. Targan CC Chemokine Receptor 9 Expression Defines a Subset of Peripheral Blood Lymphocytes with Mucosal T Cell Phenotype and Th1 or T-Regulatory 1 Cytokine Profile J. Immunol., July 1, 2003; 171(1): 159 - 165. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Schaffer, E. C. Kim, X. Wu, H. Zan, L. Testoni, S. Salamon, A. Cerutti, and P. Casali Selective Inhibition of Class Switching to IgG and IgE by Recruitment of the HoxC4 and Oct-1 Homeodomain Proteins and Ku70/Ku86 to Newly Identified ATTT cis-Elements J. Biol. Chem., June 13, 2003; 278(25): 23141 - 23150. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Von der Thusen, J. Kuiper, T. J. C. Van Berkel, and E. A. L. Biessen Interleukins in Atherosclerosis: Molecular Pathways and Therapeutic Potential Pharmacol. Rev., March 1, 2003; 55(1): 133 - 166. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. G. Tangye, A. Ferguson, D. T. Avery, C. S. Ma, and P. D. Hodgkin Isotype Switching by Human B Cells Is Division-Associated and Regulated by Cytokines J. Immunol., October 15, 2002; 169(8): 4298 - 4306. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Spieker-Polet, P.-C. Yam, and K. L. Knight Functional Analysis of I{alpha} Promoter Regions of Multiple IgA Heavy Chain Genes J. Immunol., April 1, 2002; 168(7): 3360 - 3368. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Shimoda, T. Nakamura, Y. Takahashi, H. Asanuma, S.-i. Tamura, T. Kurata, T. Mizuochi, N. Azuma, C. Kanno, and T. Takemori Isotype-specific Selection of High Affinity Memory B Cells in Nasal-associated Lymphoid Tissue J. Exp. Med., December 3, 2001; 194(11): 1597 - 1608. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. H. Ottensmeier and F. K. Stevenson Isotype switch variants reveal clonally related subpopulations in diffuse large B-cell lymphoma Blood, October 1, 2000; 96(7): 2550 - 2556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Zan, Z. Li, K. Yamaji, P. Dramitinos, A. Cerutti, and P. Casali B Cell Receptor Engagement and T Cell Contact Induce bcl-6 Somatic Hypermutation in Human B Cells: Identity with Ig Hypermutation J. Immunol., July 15, 2000; 165(2): 830 - 839. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Schaffer, A. Cerutti, S. Shah, H. Zan, and P. Casali The Evolutionarily Conserved Sequence Upstream of the Human Ig Heavy Chain S{gamma}3 Region Is an Inducible Promoter: Synergistic Activation by CD40 Ligand and IL-4 Via Cooperative NF-{kappa}B and STAT-6 Binding Sites J. Immunol., May 1, 1999; 162(9): 5327 - 5336. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Zan, A. Cerutti, P. Dramitinos, A. Schaffer, Z. Li, and P. Casali Induction of Ig Somatic Hypermutation and Class Switching in a Human Monoclonal IgM+ IgD+ B Cell Line In Vitro: Definition of the Requirements and Modalities of Hypermutation J. Immunol., March 15, 1999; 162(6): 3437 - 3447. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
