| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Formation and Neutrophil Sequestration into the Murine Lungs1
*
Unité de Pharmacologie Cellulaire, Unité Associée IP/Institut National de la Santé et de la Recherche Médicale (INSERM) 485, and
Unité d’Histopathologie, Institut Pasteur, Paris, France; and
Commissariat à l’Energie Atomique (CEA), Service de Pharmacologie et d’Immunologie, CEA Saclay, Gif sur Yvette, France
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
were found
in plasma as well as its transcripts in the lung tissues. Using
immunologic (anti-TNF- and anti-granulocyte Abs), and
pharmacologic (dexamethasone and vinblastine) tools, it is demonstrated
that BHR is apparently neither related to the presence of neutrophils
in the pulmonary microvasculature nor to the synthesis of TNF-. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
as a potential mediator of acute LPS-induced lung inflammation, we
became interested in the functional consequences of lung inflammation
and observed that i.n. administration of LPS to mice induces a
strain-dependent early (1.5–6 h) increase of airway resistance and a
late (>24 h) increase in airway responsiveness to aerosolized
methacholine (Lefort et al., manuscript in preparation). Because the
direct administration of LPS into the airways induces both the early
and late effects, as well as an intense activation of alveolar
macrophages and recruitment of neutrophils, we developed an alternative
protocol to minimize the early effect of LPS and to properly study the
enhanced responsiveness to inhaled methacholine, i.e., to
bronchopulmonary hyperreactivity (BHR).
In the present study, we show that i.p. administration of LPS to mice
is followed by a minor, if any, immediate effect on the airways, thus
allowing the uncovering of a marked, early, dose-dependent BHR in
response to methacholine. Using immunologic and pharmacologic tools, we
have demonstrated that BHR is apparently not due to TNF- production
nor to neutrophil recruitment to the lung.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The anti-TNF- Ab, chimeric TN3 19-12
1 (CNT3), as well
as the control isotype mAb, L2, were kind gifts of Dr. G. Higgs,
Celltech Therapeutics, Slough, U.K. LPS (Escherichia
coli 055:B5) was from Difco Laboratories, Detroit, MI.
Dexamethasone phosphate, hexadecyltrimethyl ammonium bromide (HTAB),
EDTA, O-dianisidine dihydrochloride, hydrogen peroxide
(H2O2), and N-formyl-Nle-Leu-Phe
(FNLP) were from Sigma Chemical, St. Louis, MO. HBSS was from Life
Technologies, Paisley, U.K. Methacholine (acetyl-ß-methacholine
chloride) was from Aldrich-Chemie, Steinheim, Germany.
Mice
Six-week-old male C57BL/6 mice were provided by the Centre d’Elevage R. Janvier (Le Genest Saint-Isle, France). Mice were treated i.p. with either LPS (at different concentrations) or an equivalent volume of saline, the solvent for LPS. Later, at specific time intervals, animals were challenged with methacholine for the study of BHR, as described below.
BHR determination
Mice were placed in a whole-body plethysmographic chamber (Buxco
Electronics, Sharon, CT) to analyze the respiratory waveforms. After a
4-min stabilization, mice received methacholine for 20 s by
aerosolization (3 x 10-2 M in the aerosolator,
Aldrich-Chemie). The resulting airways resistance was expressed as
Penh = [Te (expiratory time)/40% of Tr (relaxation time) - 1]
x Pef (peak expiratory flow)/Pif (peak inspiratory flow) x 0.67,
according to the manufacturer’s instructions. Results were expressed
as 
Penh, corresponding to the difference between the basal and
maximal values. It is notable that upon LPS administration, the basal
values increased at most (at 3 h) by 0.5 arbitrary units, i.e., by
<10% of the values obtained upon methacholine challenge.
Analysis of airway inflammation
To collect bronchoalveolar lavage fluid (BALF), animals were
anesthetized with 12 mg/kg of sodium pentobarbitone i.p., trachea were
cannulated, and lungs were washed eight times with 0.5 ml saline to
provide 4 ml of BALF. Aliquots of each BALF were used to evaluate the
total and differential cell number. BALF supernatants were collected by
centrifugation and stored at -20°C until assayed for TNF- levels.
Blood was also collected over anticoagulant, and plasma was prepared by
centrifugation. Samples were then stored and processed as for BALF
supernatants. In some experiments, FNLP (2 mg/kg) was applied i.n.
3 h after i.p. administration of LPS or saline.
For histologic analysis, lungs were fixed in paraformaldehyde, and serial 5-µ sections were performed followed by staining with hematoxylin/eosin.
Measurement of TNF- production by enzyme immunometric
assay
Levels of TNF- in the BALF were determined by an enzyme
immunometric assay. This method relies on the reaction of thiol groups
of mAb Fa' fragments with maleimido groups previously introduced into
acetylcholinesterase (AchE) as previously described (7). As for
anti-IL-5 Abs (8), anti-TNF- mAb MP6-XT22, and MP6-XT3 were
purified from ascitic fluids (cloned hybridomas kindly provided by Dr.
P. Minoprio, Institut Pasteur, Paris, France), using the affinity
chromatography method on a protein G column (HiTrap affinity columns,
Pharmacia Biotechnology, Uppsala, Sweden) after precipitation by
ammonium sulfate. Characteristics of these rat anti-murine TNF-
mAb were described in details elsewhere (9).
Immunometric assays were performed in 96-well microtiter plates
(MaxiSorp; Nunc, Roskilde, Denmark), coated with 10 µg/ml of the rat
anti-murine TNF- mAb, MP6-XT3, as described previously (10). The
one-step procedure used for immunometric assays involved the
simultaneous addition of 100 µl of TNF- standards (7.8–1,000
pg/ml) or samples, and 100 µl of the second rat anti-murine
TNF- mAb, MP6-XT22-AChE conjugated, at a concentration of 10 Ellman
U/ml. After incubation for 18 h at 4°C, the plates were
extensively washed and solid-phase bound AChE activity was determined
colorimetrically by adding 200 µl of Ellman’s medium. Absorbance was
read at 405 nm with an automatic microplate reader (Dynatech MR 5000;
Dynatech Laboratories, Saint Cloud, France). The lower limit of
detection of this assay is 
15 pg TNF-/ml sample.
TNF- mRNA transcript levels
Lungs were isolated and thoroughly washed with saline via the
pulmonary artery, and poly(A)+ mRNAs were isolated using the Poly(A)
tract system 1000 (Promega Corp., Madison, WI) and an Ultraturrax (T25;
Janke and Kunkel, IKA-Laortechnik, Stanfen, Germany) for
homogenization. Intron-differential RT-PCR was performed using specific
primers for TNF- (sense, CTTGTGGCAGGGGCCACCACGCTC; antisense,
CTCAGCGCTGAGTTGGTCCCCCTTCTC) and for ß-actin (sense,
GGACTCCTATGTGGGTGACGAGG; antisense, GGGAGAGCATAGCCCTCGGTAGAT)
as control. The cDNAs were synthesized in 25 µl using 5 µg of total
RNAs, 0.5 mg oligo(dT12–18), or hexamers as primers,
0.5 U RNasin (Promega France, Charbonnieres, France) and 200 U M-MTLV
reverse transcriptase RNase H- (Promega) in the manufacturer’s buffer,
for 1 h at 42°C. Hot-start PCR was performed on a Peltier
thermal cycler apparatus type 200 (MJ Research, Watertown, MA). For a
100-µl reaction, 4 µl of cDNA (serial dilutions), primers (100 mM
each), dNTP (0.2 mM each), and Biotaq polymerase (2.5 U) (Bioprobe
Systems, Montreuil, France) in the manufacturer’s buffer were used.
The thermocycling protocol was as follows: 95°C for 3 min, then 30
cycles (actin) or 33 cycles (TNF-) of: 95°C for 45 s, 62°C
for 45 s, and 72°C for 45 s, then a final incubation at
72°C for 7 min. Amplification products were resolved on a 1.5%
agarose gel containing 0.5 µg/ml ethydium bromide, then
transferred onto a nylon membrane (Hybond N+, Amersham,
Amersham, U.K.) in 0.4 N NaOH overnight, and finally hybridized with
the corresponding cDNA probes (PvuII- PvuII
fragment for TNF- and BglII-kpnI fragment for
ß-actin), and labeled by random priming with
[-32P]dCTP (3.000 Ci/mmol, Amersham). Washing was
performed twice for 30 min with 2x saline sodium citrate (sodium
chloride, 175 g/L; sodium citrate, 88.2 g/L), and twice for 30 min with
0.5x SSC; and quantification was done on a PhosphorImager (Molecular
Dynamics, Sunnyvale, CA), comparing TNF- and ß-actin levels.
Results were obtained in the exponential phase of the PCR reaction by
varying dilutions and cycle number (from 24 to 39).
Preparation of the rabbit anti-murine TNF- Igs
Female HY/CR rabbits (2.5 kg, Charles River, Saint Aubin les
Elboeuf, France) were immunized three times at 2-wk intervals with 50,
25, and 25 µg of murine rTNF- (Immugenex, Los Angeles, CA)
emulsified in adjuvant (Hunter TiterMax; CytRx, Norcross, GA). The
animals were bled 7 days after the second injection, and Igs were
prepared from the serum by precipitation with 40% saturated ammonium
sulfate (v/v). The presence of specific Abs was checked in vitro by
testing the inhibition of the cytotoxic effect of TNF- on WEHI
cells. Following the third injection, animal were bled every 3 wk for
several mo, and sera were pooled. Precipitated Igs were dialyzed
overnight against PBS and stored at 4°C at a final concentration of 9
mg/ml (No. H42031).
Preparation of the anti-granulocyte Abs
RB6-8C5 (anti-Ly-6G) is a rat IgG2b mAb (11) that binds selectively to and depletes mouse neutrophils and eosinophils, but not lymphocytes or macrophages (12). This anti-granulocyte mAb was purified from ascitic fluids (cloned hybridomas kindly provided by Dr. G. Millon, Institut Pasteur) through precipitation with 45% saturated ammonium sulfate (v/v). Following dialysis at 4°C against PBS, Igs were filtered (0.22 µm) and then stored at 4°C at a final concentration of 5 mg/ml. One i.p. administration of 200 µg of such a preparation to mice led within 24 h to a complete absence of circulating neutrophils, which last for 5 days (data not shown).
Determination of lung myeloperoxidase (MPO) activity
Lung tissue MPO activity was determined following a previously described method (13) with minor modifications. After bronchoalveolar lavage, the lungs were removed from the thorax, blotted with gauze to remove blood, and frozen at -20°C until assay. In some experiments, before being removed, lung vessels were flushed to discard circulating blood. The left atrium was thus open, and 5 ml of saline were gently perfused into the right ventricle. Collected lungs were then homogenized for 30 s (Potter-Elvejhem glass homogenizer, Thomas, Philadelphia, PA) at 4°C in 1 ml PBS. The corresponding extracts were centrifuged (10,000 x g, 10 min, 4°C), and supernatants containing hemoglobin were discarded. The pellets were resuspended in 1 ml PBS supplemented with HTAB (0.5%) and EDTA (5 mM) and homogenized again. Following centrifugation, 50 µl of supernatants were placed in a test tube with 200 µl PBS-HTAB-EDTA, 2 ml HBSS, 100 µl O-dianisidine dihydrochloride (1.25 mg/ml), and 100 µl H2O2 (0.05% = 0.4 mM). After 15 min of incubation while shaking at 37°C, the reaction was stopped by the addition of 100 µl NaN3 (1%). The MPO activity was determined as change in absorbance at 460 nM.
Statistical analysis
Each point corresponds to the mean ± SEM of 3 to 6 values obtained from distinct mice. Statistical differences were determined using the one-way analysis of variance (ANOVA), and p < 0.05 was considered significant. Individual groups were compared using the unpaired Student’s t test. Significance is indicated by an asterisk (*) on the figures when p < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We studied first the effects of the i.p. administration of LPS on
the intensity of the airway responses to aerosolized methacholine. As
illustrated in Figure 1
A, the
direct bronchoconstrictor effects of methacholine alone were minor at
the concentration used (first column). In contrast, the injection of
LPS induced, after 3 h, a dose-dependent augmentation of the
responses to methacholine. Penh was significantly increased at a
dose of 0.3 mg/kg, reaching a plateau at 1 mg/kg LPS. The kinetics of
LPS-induced BHR were also studied, using 1 mg/kg LPS. Under those
conditions, BHR was observed as early as 90 min (Fig. 1B) and reached a plateau at 4.5 h. Normal
responsiveness was restored within 24 h.
|
Microscopic examination showed no ultrastructural lesions of the
lungs or the airways nor neutrophil recruitment to the alveoli from
LPS-treated mice, but showed a marked accumulation of neutrophils
lining the endothelium of the capillaries (Fig. 2). In agreement, the BALF of mice
treated with LPS through the i.p. route were also neutrophil free,
while a dramatic increase in the number of neutrophils was observed
following i.n. administration of the same dose of LPS, thus validating
the efficacy of LPS (data not shown). Since a strong correlation
between the number of intravascular neutrophils and the lung content in
the enzyme marker MPO has been described (14), this parameter was
measured to quantify the total neutrophil sequestration to the lungs.
Three h after i.p. injection of LPS, the absorbance at 460 nm was of
0.83 ± 0.07 for LPS-treated mice, as compared with 0.04 ±
0.01 for control (p < 0.05; n
= 21), a 20-fold increase.
|
10% and still
amounted to an increase of 17-fold above the basal levels. Such a
result demonstrated that neutrophils sequestered onto the vessels
firmly adhered to the endothelial wall. MPO evaluation confirmed the histologic observations and suggested that LPS triggers a signal at the peritoneal, systemic, or lung level, leading to the accumulation of neutrophils in the pulmonary vasculature, but failing to induce a full signal at the epithelial level to insure BALF invasion. Indeed, under the present experimental protocol, neutrophils, although not invading tissue, were prone to do so. This was demonstrated by instilling i.n. FNLP (a synthetic bacterial peptide that activates macrophages and neutrophils) 3 h after i.p. administration of LPS. As a result, numerous neutrophils invaded the BALF, as shown by increased cell counts in BALF collected 3 h after FNLP challenge, i.e., 5.03 ± 1.53 x 105 neutrophils/lung compared with 0.05 ± 0.01 x 105 neutrophils/lung (n = 3) for animals also receiving FNLP but 3 h after the i.p. administration of saline. The lungs and/or the neutrophils are thus markedly modified by the i.p. administration of LPS in such a way that neutrophils readily invade the tissues.
Effect of LPS on TNF- production in blood and gene expression in
lungs
Upon treatment of mice with i.p. LPS, a high level of TNF- was
observed in plasma at 90 min, which was absent at 180 min (Fig. 3, A and B),
under conditions in which no TNF- was found in the peritoneal lavage
or in the BALF (not shown). This enhanced protein production was
accompanied by an intense expression of TNF- transcripts in the
lungs (Fig. 4, A and
B). It is thus likely that LPS given i.p. is rapidly
absorbed into the blood and reaches the lungs.
|
|
production, neutrophil
recruitment, and BHR
At this stage, it seemed possible that LPS-induced BHR, TNF-
gene expression, and protein production were associated. To investigate
this hypothesis, three different approaches were used.
First, the recognized anti-inflammatory agent dexamethasone was
administered at different doses, and the various parameters used were
studied. When dexamethasone was administered s.c. twice at 5 mg/kg, 18
and 1 h before LPS challenge, the generation of TNF- in plasma
and BHR was suppressed (Fig. 3
A), as was the
transcription of TNF- (Fig. 4A). By contrast, when
dexamethasone was administered twice at 0.625 mg/kg (18 and 1 h
before LPS challenge), BHR was not affected, but TNF- protein
production was still suppressed (Fig. 3B) and
specific transcript expression practically abrogated (Fig. 4B). Even though both doses of dexamethasone
suppressed TNF- formation, the total MPO activity of the lungs was
not reduced. In fact, it was constantly augmented, although not always
significantly (Fig. 5). This indicates
that TNF- production can be suppressed without inhibiting BHR or
neutrophil accumulation in the lung vasculature.
|
.
The Ab CTN3 (9.2 mg/ml) was given i.v. (200 µl) and i.n. (40 µl)
18 h before the i.p. administration of LPS, and animals were
studied after 3 h. As seen in Figure 6A, BHR was not significantly
reduced upon such a treatment. Similarly, a rabbit polyclonal Ab
raised against murine TNF- was inactive against BHR (Fig. 6A), although increased TNF- contents in the blood
of LPS-treated mice were reduced to the background level (not shown),
confirming adequate neutralization. Surprisingly, under these
experimental conditions, enrichments of the lungs in MPO were also not
affected (Fig. 6B). As a validation of the efficacy
of the protocol, these Abs were effective in significantly reducing,
although not suppressing, the neutrophil recruitment to the BALF and
the lung enrichment in MPO induced by the i.n. administration of LPS
(data not shown). In agreement, neither the i.p. nor the i.n.
administration of TNF- up to 50 µg/kg induced BHR (not shown).
|
). This result strongly suggests that
neutrophil accumulation in the vasculature of the lungs and BHR induced
by i.p. LPS are not associated. To confirm this concept, we also tested
the effects of the anti-granulocyte mAb RB6-8C5. As illustrated in
Figure 7, under conditions in which there is a total absence of
circulating neutrophils, BHR was again not affected, while MPO activity
was fully abrogated.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(22). The main consequence of LPS inhalation is the induction
of a huge neutrophil recruitment to the air spaces (5). A relationship
between airway inflammation and nonallergic BHR has been suggested.
Thus, in an experimental dog model, airway responsiveness closely
correlated with the number of neutrophils in the airway epithelium
(23). Similarly, inhalation of C5a caused lung inflammation and an
increase of responsiveness to histamine in rabbits (24). Conversely,
other studies suggested that the influx of neutrophils may not be
involved. This is particularly the case in a study performed by Pauwels
et al. (3), in which no correlations were found between inflammation
and BHR in a rat model of inhalation of LPS.
It is of note that i.p. injections of LPS cause neutrophil infiltration
in the alveolar spaces in rats (13), but induce neutrophil
sequestration in the lung vasculature without any transpulmonary
recruitment in mice (13, 25), BALF being thus neutrophil free. This
insight led us to administer LPS i.p. to mice, to study the resulting
BHR and the role of neutrophils and TNF-. A further advantage of the
model we used is that, in our hands, i.n. administration of LPS to mice
induces a direct, long-lasting increase in airway resistance,
preventing subsequent evaluation of BHR (Lefort et al., manuscript in
preparation).
The present data clearly show that i.p. LPS augments the reactivity of
the lungs to methacholine, a prototype bronchoconstrictor agents. This
BHR was accompanied by the induction of TNF- synthesis and by an
accumulation of neutrophils in the capillaries as observed by light
microscopy and confirmed by the increased MPO found in the lung tissues
in the absence of recruitment into the BALF.
TNF- has been implicated as a mediator of LPS-induced BHR in rats
(22). Under our experimental conditions, LPS triggered within 90 min a
transient appearance of TNF- in the blood as well as specific
transcripts in the lungs. This strongly suggests that LPS rapidly
entered the blood stream and reached the competent cells within the
lung tissue; it is in agreement with the recent data of Hirano (13)
showing that the concentration of LPS in the peritoneal fluid decreased
exponentially following i.p. treatment, while the concentration in the
blood increased up to 1 h and returned to a basal level within
4 h. As expected from the data reported by others (26, 27),
pretreatment of mice with dexamethasone, twice at 5 mg/kg, totally
abrogated the synthesis of TNF-. Concomitantly, BHR was also
suppressed. Nonetheless, experimental conditions were found, using a
small dose of dexamethasone (0.625 mg/kg) for which, although TNF-
formation was still abrogated, BHR was not at all mitigated. This
dissociation between TNF- and BHR was substantiated by another
approach using two different specific TNF- Abs, which, at effective
doses (TNF- was no more detectable in blood), failed to modify BHR.
These results contrast with the observations of Kips et al. (22). An
obvious explanation is that the two models are different. Indeed, in
the present report, LPS was given i.p., while Kips et al. (22) gave it
by the intratracheal route. In confirmation, experiments in progress in
our laboratory (Lefort et al., manuscript in preparation) using the
latter route, also show that TNF- is partially involved in BHR. It
is of note that neither dexamethasone nor the specific TNF- Abs
modified the content of MPO recovered from lungs collected from
LPS-treated mice, which initially suggested an association between
neutrophil accumulation in the microvasculature and BHR.
Such a potential involvement of neutrophils is supported by experimental data from the literature (23, 24) and also by our own results. Indeed, we observed that neutrophils 1) firmly adhere to the vessel walls and 2) are readily liable to transmigrate in the airspaces. It is obvious that following i.p. administration of LPS, neutrophils are not in a resting state but are somehow activated. To verify whether this could account for BHR, two different procedures were used to suppress neutrophil recruitment. Mice were treated either with vinblastine or with an anti-granulocyte Ab, which resulted in the complete absence of circulating neutrophils. As expected, i.p. administration of LPS to those neutrophil-depleted animals failed to enhance MPO activity in the lungs. Surprisingly, under both situations, BHR was not affected, clearly demonstrating that neutrophils are not involved in LPS-induced BHR.
BHR is thus apparently neither related to the presence of neutrophils
in the pulmonary microvasculature nor to the synthesis of TNF-. This
does not imply that neutrophils and/or TNF- cannot modulate other
expressions of BHR. Indeed, as mentioned above, conditions were found
(i.n. administration of LPS) for which a participation of TNF- is
evident. Nonetheless, even under the latter conditions, TNF- does
not account for the whole response, and accordingly, the primary role
is played by another factor. This putative factor is most probably
essential in triggering BHR when LPS is given i.p. and has yet to be
defined.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Pr. B. B. Vargaftig, Unité de Pharmacologie Cellulaire, Unité Associée Institut Pasteur, INSERM 485, Institut Pasteur, 25 rue du Dr. Roux, 75 015 Paris, France. E-mail address:
3 Abbreviations used in this paper: i.n., intranasal(ly); BHR, bronchopulmonary hyperreactivity; MPO, myeloperoxidase; HTAB, hexadecyltrimethyl ammonium bromide; BALF, bronchoalveolar lavage fluid; AchE, acetylcholinesterase; Penh, pause enhanced.
Received for publication September 25, 1997. Accepted for publication March 6, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and 1ß: development of two immunometric assays (EIA) using acetylcholinesterase and application to biological media. J. Immunol. Methods 123:193.[Medline]
This article has been cited by other articles:
|
|
 |
|
  E. Doz, S. Rose, N. Court, S. Front, V. Vasseur, S. Charron, M. Gilleron, G. Puzo, I. Fremaux, Y. Delneste, et al. Mycobacterial Phosphatidylinositol Mannosides Negatively Regulate Host Toll-like Receptor 4, MyD88-dependent Proinflammatory Cytokines, and TRIF-dependent Co-stimulatory Molecule Expression J. Biol. Chem., August 28, 2009; 284(35): 23187 - 23196. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Poole, T. A. Wyatt, P. J. Oldenburg, M. K. Elliott, W. W. West, J. H. Sisson, S. G. Von Essen, and D. J. Romberger Intranasal organic dust exposure-induced airway adaptation response marked by persistent lung inflammation and pathology in mice Am J Physiol Lung Cell Mol Physiol, June 1, 2009; 296(6): L1085 - L1095. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Haller, D. Hyde, N. Deliolanis, R. de Kleine, M. Niedre, and V. Ntziachristos Visualization of pulmonary inflammation using noninvasive fluorescence molecular imaging J Appl Physiol, March 1, 2008; 104(3): 795 - 802. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Gupta, X. Su, B. Popov, J. W. Lee, V. Serikov, and M. A. Matthay Intrapulmonary Delivery of Bone Marrow-Derived Mesenchymal Stem Cells Improves Survival and Attenuates Endotoxin-Induced Acute Lung Injury in Mice J. Immunol., August 1, 2007; 179(3): 1855 - 1863. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. K. Quintana, C. Cannet, E. Schaeublin, S. Zurbruegg, R. Sugar, L. Mazzoni, C. P. Page, J. R. Fozard, and N. Beckmann Identification with MRI of the pleura as a major site of the acute inflammatory effects induced by ovalbumin and endotoxin challenge in the airways of the rat Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L651 - L657. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Togbe, S. Schnyder-Candrian, B. Schnyder, I. Couillin, I. Maillet, F. Bihl, D. Malo, B. Ryffel, and V. F. J. Quesniaux TLR4 gene dosage contributes to endotoxin-induced acute respiratory inflammation J. Leukoc. Biol., September 1, 2006; 80(3): 451 - 457. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Moffatt, R. Lever, and C. P. Page Activation of corticotropin-releasing factor receptor-2 causes bronchorelaxation and inhibits pulmonary inflammation in mice FASEB J, September 1, 2006; 20(11): 1877 - 1879. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. I. Nigo, M. Yamashita, K. Hirahara, R. Shinnakasu, M. Inami, M. Kimura, A. Hasegawa, Y. Kohno, and T. Nakayama Regulation of allergic airway inflammation through Toll-like receptor 4-mediated modification of mast cell function PNAS, February 14, 2006; 103(7): 2286 - 2291. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Noulin, V. F. J. Quesniaux, S. Schnyder-Candrian, B. Schnyder, I. Maillet, T. Robert, B. B. Vargaftig, B. Ryffel, and I. Couillin Both Hemopoietic and Resident Cells Are Required for MyD88-Dependent Pulmonary Inflammatory Response to Inhaled Endotoxin J. Immunol., November 15, 2005; 175(10): 6861 - 6869. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Balloy, M. Si-Tahar, O. Takeuchi, B. Philippe, M.-A. Nahori, M. Tanguy, M. Huerre, S. Akira, J.-P. Latge, and M. Chignard Involvement of Toll-Like Receptor 2 in Experimental Invasive Pulmonary Aspergillosis Infect. Immun., September 1, 2005; 73(9): 5420 - 5425. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Su, E. Camerer, J. R. Hamilton, S. R. Coughlin, and M. A. Matthay Protease-Activated Receptor-2 Activation Induces Acute Lung Inflammation by Neuropeptide-Dependent Mechanisms J. Immunol., August 15, 2005; 175(4): 2598 - 2605. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Schnyder-Candrian, V. F. J. Quesniaux, F. Di Padova, I. Maillet, N. Noulin, I. Couillin, R. Moser, F. Erard, B. B. Vargaftig, B. Ryffel, et al. Dual Effects of p38 MAPK on TNF-Dependent Bronchoconstriction and TNF-Independent Neutrophil Recruitment in Lipopolysaccharide-Induced Acute Respiratory Distress Syndrome J. Immunol., July 1, 2005; 175(1): 262 - 269. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Geisler, H. Algul, M. Riemann, and R. M. Schmid Questioning Current Concepts in Acute Pancreatitis: Endotoxin Contamination of Porcine Pancreatic Elastase Is Responsible for Experimental Pancreatitis-Associated Distant Organ Failure J. Immunol., May 15, 2005; 174(10): 6431 - 6439. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Balloy, M. Huerre, J.-P. Latge, and M. Chignard Differences in Patterns of Infection and Inflammation for Corticosteroid Treatment and Chemotherapy in Experimental Invasive Pulmonary Aspergillosis Infect. Immun., January 1, 2005; 73(1): 494 - 503. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Barczyk, E. Sozanska, M. Trzaska, and W. Pierzchala Decreased Levels of Myeloperoxidase in Induced Sputum of Patients With COPD After Treatment With Oral Glucocorticoids Chest, August 1, 2004; 126(2): 389 - 393. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Assier, V. Jullien, J. Lefort, J.-L. Moreau, J. P. Di Santo, B. B. Vargaftig, J. R. Lapa e Silva, and J. Theze NK Cells and Polymorphonuclear Neutrophils Are Both Critical for IL-2-Induced Pulmonary Vascular Leak Syndrome J. Immunol., June 15, 2004; 172(12): 7661 - 7668. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Deleuze, J. Lefort, M. F. Bureau, D. Scherman, and B. B. Vargaftig LPS-induced bronchial hyperreactivity: interference by mIL-10 differs according to site of delivery Am J Physiol Lung Cell Mol Physiol, January 1, 2004; 286(1): L98 - L105. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-C. Alves-Guerra, S. Rousset, C. Pecqueur, Z. Mallat, J. Blanc, A. Tedgui, F. Bouillaud, A.-M. Cassard-Doulcier, D. Ricquier, and B. Miroux Bone Marrow Transplantation Reveals the in Vivo Expression of the Mitochondrial Uncoupling Protein 2 in Immune and Nonimmune Cells during Inflammation J. Biol. Chem., October 24, 2003; 278(43): 42307 - 42312. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. B. Vargaftig and M. Singer Leukotrienes mediate part of Ova-induced lung effects in mice via EGFR Am J Physiol Lung Cell Mol Physiol, October 1, 2003; 285(4): L808 - L818. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.C. Kips, G.P. Anderson, J.J. Fredberg, U. Herz, M.D. Inman, M. Jordana, D.M. Kemeny, J. Lotvall, R.A. Pauwels, C.G. Plopper, et al. Murine models of asthma Eur. Respir. J., August 1, 2003; 22(2): 374 - 382. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. B. Vargaftig and M. Singer Leukotrienes Mediate Murine Bronchopulmonary Hyperreactivity, Inflammation, and Part of Mucosal Metaplasia and Tissue Injury Induced by Recombinant Murine Interleukin-13 Am. J. Respir. Cell Mol. Biol., April 1, 2003; 28(4): 410 - 419. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Singer, J. Lefort, and B. B. Vargaftig Granulocyte Depletion and Dexamethasone Differentially Modulate Airways Hyperreactivity, Inflammation, Mucus Accumulation, and Secretion Induced by rmIL-13 or Antigen Am. J. Respir. Cell Mol. Biol., January 1, 2002; 26(1): 74 - 84. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. KANEHIRO, M. LAHN, M. J. MAKELA, A. DAKHAMA, M. FUJITA, A. JOETHAM, R. J. MASON, W. BORN, and E. W. GELFAND Tumor Necrosis Factor-alpha Negatively Regulates Airway Hyperresponsiveness through gamma delta T Cells Am. J. Respir. Crit. Care Med., December 15, 2001; 164(12): 2229 - 2238. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Zeldin, C. Wohlford-Lenane, P. Chulada, J. Alyce Bradbury, P. E. Scarborough, V. Roggli, R. Langenbach, and D. A. Schwartz Airway Inflammation and Responsiveness in Prostaglandin H Synthase-Deficient Mice Exposed to Bacterial Lipopolysaccharide Am. J. Respir. Cell Mol. Biol., October 1, 2001; 25(4): 457 - 465. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Lefort, L. Motreff, and B. Boris Vargaftig Airway Administration of Escherichia coli Endotoxin to Mice Induces Glucocorticosteroid-Resistant Bronchoconstriction and Vasopermeation Am. J. Respir. Cell Mol. Biol., March 1, 2001; 24(3): 345 - 351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. S. SILVERMAN, G. T. DE SANCTIS, J. BOYCE, J. A. MACLEAN, A. JIAO, F. H. Y. GREEN, H. GRASEMANN, D. FAUNCE, G. FITZMAURICE, G.-P. SHI, et al. The Transcription Factor Early Growth-response Factor 1 Modulates Tumor Necrosis Factor-{alpha}, Immunoglobulin E, and Airway Responsiveness in Mice Am. J. Respir. Crit. Care Med., March 1, 2001; 163(3): 778 - 785. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Chignard and V. Balloy Neutrophil recruitment and increased permeability during acute lung injury induced by lipopolysaccharide Am J Physiol Lung Cell Mol Physiol, December 1, 2000; 279(6): L1083 - L1090. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-D. HELD and S. UHLIG Mechanisms of Endotoxin-Induced Airway and Pulmonary Vascular Hyperreactivity in Mice Am. J. Respir. Crit. Care Med., October 1, 2000; 162(4): 1547 - 1552. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
