The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grewe, M.
Right arrow Articles by Krutmann, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grewe, M.
Right arrow Articles by Krutmann, J.
The Journal of Immunology, 1998, 161: 415-420.
Copyright © 1998 by The American Association of Immunologists

Human Eosinophils Produce Biologically Active IL-12: Implications for Control of T Cell Responses

Markus Grewe*, Wolfgang Czech{dagger}, Akimichi Morita*, Thomas Werfel{ddagger}, Michaela Klammer*, Alexander Kapp{ddagger}, Thomas Ruzicka*, Erwin Schöpf{dagger} and Jean Krutmann1,*

* Department of Dermatology, Heinrich-Heine-University, Düsseldorf, Germany; {dagger} Department of Dermatology, Albert-Ludwigs-University, Freiburg, Germany; and {ddagger} Department of Dermatology, Medizinische Hochschule Hannover, Hannover, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present study assessed the capacity of eosinophils (EOS) to synthesize the cytokine IL-12. Blood-derived, highly purified human EOS from six atopic patients and two nonatopic individuals were treated in culture with IL-4, IL-5, granulocyte-macrophage CSF, IFN-{gamma}, TNF-{alpha}, IL-1{alpha}, RANTES, and complement 5a, respectively. The expression of both IL-12 protein and mRNAs for the p35 and p40 IL-12 subunits was strongly induced in all donors by the Th2-like cytokines IL-4 and granulocyte-macrophage CSF and was also moderately induced by TNF-{alpha} and IL-1{alpha}. IL-5 treatment resulted in IL-12 synthesis in four atopic donors and one nonatopic donor, whereas IFN-{gamma} induced IL-12 synthesis in only two atopic donors. In contrast, RANTES exclusively induced mRNA for the p40 subunit without detectable protein release, and complement 5a had no effect on IL-12 mRNA or protein expression. EOS-derived IL-12 was biologically active, because supernatants derived from IL-4-treated EOS superinduced the Con A-induced expression of IFN-{gamma} by a human Th1-like T cell line. This activity was neutralized by anti-IL-12 Abs. In conclusion, EOS secrete biologically active IL-12 after treatment with selected cytokines, which mainly represent the Th2-like type. Consequently, EOS may promote a switch from Th2-like to Th1-like immune responses in atopic and parasitic diseases.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Eosinophilic granulocytes play an important role in host defense against parasites (1), some drug reactions, and allergic diseases including atopic dermatitis, allergic asthma, and allergic rhinitis (2, 3). Attraction into inflamed tissue and the subsequent activation of eosinophils (EOS)2 is regulated by a wide set of biologic response modifiers, including chemokines (4, 5) and cytokines, among which those of the Th2-like type (e.g., IL-3, IL-4, IL-5, and granulocyte-macrophage CSF (GM-CSF)) are of particular importance (6, 7, 8, 9, 10, 11, 12). EOS contain large amounts of various granule proteins and degranulate and release stored proteins upon activation (13). In addition, activated EOS are able to generate reactive oxygen intermediates (14, 15). For some time, these functions were thought to constitute the only contribution of EOS to inflammatory responses.

Recently, EOS have been shown to synthesize and release cytokines, including IL-4 (16) and IL-5 (17). Within the model of Th1- and Th2-like immune responses, IL-4 and IL-5 belong to the Th2-like cytokines. Therefore, EOS are not only activated by Th2-like cytokines but are also able to support Th2-like inflammatory responses and consequently perpetuate allergic diseases. Parasite defense as well as allergic diseases, especially atopic dermatitis, are also characterized by the activation of IFN-{gamma}-producing NK cells (18, 19) and Th1-like T cells (20, 21, 22), respectively. The differentiation of these lymphocyte subsets is driven primarily by the cytokine IL-12 (23, 24). EOS infiltration is a hallmark for parasitosis (25, 26) as well as for atopic eczema (27), and EOS might therefore contribute to the generation and differentiation of those IFN-{gamma}-producing T cells that are involved in these diseases. Therefore, we assessed the capacity of EOS to produce biologically active IL-12.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients

Venous blood samples were obtained from patients and healthy volunteers after written informed consent. The atopy syndrome of patients ("atopics") was based on 1) a personal history of allergic asthma, allergic rhinoconjunctivitis, and/or atopic dermatitis, 2) enhanced serum IgE levels, and 3) the presence of specific IgE directed against house dust mite protein. Healthy volunteers ("nonatopics") did not fulfill any of these criteria.

Isolation of human eosinophilic granulocytes

Human granulocytes were isolated from the heparin-anticoagulated venous blood of six atopic donors and two nonatopic donors as described previously (28). For further purification of the EOS, the granulocytes were resuspended at a concentration of 107/ml in HEPES-buffered HBSS (pH 7.4) containing 1 mg/ml BSA (HBSS/BSA). EOS were purified using a modification of a method described previously (29). For this purpose immunomagnetic beads (Dynabeads M-450, Dynal, Oslo, Norway) were coated with anti-CD16 mAb. In brief, 2 ml beads (4 x 108 beads/ml) were mixed with 50 µl anti-CD16 Ab (1 mg/ml) and incubated for 24 h at 4°C in Minosorp tubes (Nunc, Roskilde, Denmark) on a rotary mixer. Coated beads were washed three times in HBSS/BSA and retrieved using a Dynal magnetic particle concentrator (MPC-6; Dynal). The anti-CD16 Ab-coated beads were stored at a concentration of 2 x 108 beads/ml HBSS/BSA under sterile conditions at 4°C for a maximum of 1 wk. A total of 1 ml of granulocytes was centrifuged in Minosorp tubes for 7 min at 820 x g at 4°C; the supernatant was aspirated, and 500 µl of the anti-CD16 Ab-coated beads were added subsequently to the pellet. The mixture was incubated for 1 h at 4°C on a rotary mixer. Thereafter, HBSS/BSA was added, and the cells which were coupled to the beads were removed magnetically using the magnetic particle concentrator. The supernatant was aspirated, and residual beads were removed by a second magnetic separation step. The resulting supernatant was washed as described above, and the resulting EOS were resuspended in HBSS/BSA. If necessary, the magnetic purification procedure was repeated once more. The EOS were quantitated with Kimura stain (30) in a Neubauer counting chamber (Bender and Hobein, Berlin, Germany). Cytospin preparations of the cells had a purity of >95% as shown by Pappenheim stain. Highly purified EOS were further separated by centrifugation on Percoll (Kabi Pharmacia, Freiburg, Germany) density gradients (31). For this purpose, five-step discontinuous density gradients (750 µl of each interface per gradient) were formed with a peristaltic pump (Varioperpex II pump; Kabi Pharmacia) in 5-ml round-bottom polystyrene tubes. In brief, gradients consisted of 1.080, 1.085, 1.09, and 1.100 g/ml of isotonic-buffered Percoll solution. EOS (5 x 106), purified as described above, were washed twice and resuspended in 750 µl Percoll solution (density of 1.070 g/ml). Percoll gradients were overlaid with these cells and centrifuged for 20 min at 1600 x g at 10°C. Thereafter, the cells in the interphases were collected, immediately washed twice with HBSS/BSA, and resuspended as described below. EOS with a density of <1.082 g/ml were defined considered hypodense (32). Cells were stained and counted as described above; there were no differences in the viability of the cells (92–95%) between the fractions as judged by trypan blue exclusion. The cells had a purity of >98% as shown by Pappenheim stain.

Isolation of human peripheral blood monocytes

PBMCs were obtained from the heparinized blood of healthy human volunteers by Ficoll-Hypaque (Pharmacia, Freiburg, Germany) density sedimentation as described previously (33). These cells were allowed to adhere to plastic tissue culture dishes for 1 h. Next, the plastic-adherent cells were gently scraped off, centrifuged, and washed with RPMI 1640 three times. These cells were >90% nonspecific esterase positive and are referred to as monocytes in this study.

Stimulations

Freshly prepared EOS (500,000 cells/stimulation) were treated with complement 5a (C5a) (10-7 mol/l), human rGM-CSF (rhGM-CSF) (30 ng/ml, Sigma, Munich, Germany), rhRANTES (100 ng/ml), rhTNF-{alpha} (500 U/ml), rhIL-1{alpha} (400 pg/ml), rhIFN-{gamma} (100 U/ml), rhIL-4 (40 ng/ml), and rhIL-5 (10 ng/ml) and left in culture for 4 h or 24 h, respectively. Monocytes were treated with rhGM-CSF, rhIL-4, rhIL-5, and rhIFN-{gamma} in the aforementioned concentrations and remained in culture for 4 h. As controls, EOS as well as monocytes were kept in culture without treatment for the desired period of time. Recombinant human cytokines were purchased from Genzyme (Rüsselsheim, Germany). After stimulations, cells were centrifuged for 10 min at 300 x g, supernatants were harvested, and cells were taken up in guanidinium isothiocyanate buffer (34).

RNA extraction

Total RNA was extracted using a modified acidic chloroform/phenol protocol (34). Total RNA was washed and pelleted three times in 70% ethanol and then routinely taken up in 200 µl aqua bidest.

RT-PCR

Cytokine mRNA expression was measured by differential RT-PCR that was conducted as described previously (35, 36). Specifically, total RNA was reverse transcribed using mouse Maloney leukemia virus reverse transcriptase and an oligo(dT)18 primer. For an estimation of similar amounts of cDNA used for PCR, samples were screened for the expression of ß-actin as a housekeeping gene. Therefore, 1/200 of total cDNA was subjected routinely to 24 PCR cycles, which was within the linear amplification range for cycle numbers, using a primer pair for ß-actin. The product was subjected directly to ion-exchange chromatography that was connected to an on-line UV spectrophotometer (A260 nm), allowing an exact quantification of amplification products. Relative amounts of cDNA from each sample to be inserted into the PCR were calculated to yield similar amounts of ß-actin PCR products; these calculations were confirmed by repeating RT-PCR for ß-actin with the calculated amount of cDNA.

For investigation of cytokine mRNA expression, five times more cDNA was inserted than for ß-actin PCR. PCR was conducted with 28 cycles, which was within the linear amplification range for all cytokine cDNAs. The following primer pairs specific for the p35 and p40 subunits of IL-12 and for ß-actin were used (5'-3'): IL-12 p35 subunit: ACCCAGGAATGTTCCCATGC and TCTGTCAATAGTCACTGCCCG; IL-12 p40 subunit: AAAGGAGGCGAGGTTCTAAGCC and TTTGCGGCAGATGACCGTGG; and ß-Actin: GTGGGGCGCCCCAGGCACCA and CTCCTTAATGTCACGCACGATTTC.

Additionally, a PCR for ß-actin was performed in parallel to each cytokine PCR as described above. Furthermore, the PCR for each cytokine sample was conducted at least two times. Products were quantified by ion-exchange chromatography as described above. To ensure the identity of products, their chromatogram peaks were collected, digested with an appropriate endonuclease, and fragments were visualized on agarose gel by ethidium bromide staining.

Detection of IL-12 protein

For the detection of the hIL-12 present in the 24-h supernatants of EOS (500,000 cells/ml culture medium), a highly sensitive hIL-12 ELISA was employed (Laboserv, Gießen, Germany). This ELISA is able to detect the IL-12 heterodimer as well as the p70 homodimer with a detection limit of 5 pg/ml.

Determination of biologic activity of EOS-derived IL-12

For the detection of the IL-12-specific biologic activity, cells from a previously described human T cell line of Th1-like phenotype (22) were incubated in the presence of EOS conditioned medium (CM) with an addition of neutralizing anti-IL-12 Abs (Genzyme) or the respective isotype control Ab. As positive controls, T cells were incubated in the presence of 20 ng rhIL-12 (Genzyme). After a 48-h culture in the presence of Con A (10 µg/ml, Sigma, Munich, Germany), the IFN-{gamma} mRNA expression of T cells was determined by RT-PCR (see above) as described previously (22) using the following primer pair (5'-3'): GCATCGTTTTGGGTTCTCTTGGC and CAGCATCTGACTCCTTTTTCGC.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The supernatants of unstimulated EOS contained low amounts of IL-12 protein as detected by ELISA. The same result was obtained when EOS were cultured for 24 h in the presence of C5a, rhRANTES, rhTNF-{alpha}, and rhIL-1{alpha}, respectively. In marked contrast, EOS stimulated with rhGM-CSF or rhIL-4 released high amounts of IL-12 protein into the culture medium regardless of whether cells were obtained from atopics or nonatopics (Table IGo). Stimulating EOS with rhIL-5 resulted in significant IL-12 protein release in four of six atopic donors and one of two nonatopic donors. In two of the atopic donors, rhIFN-{gamma} induced high amounts of IL-12 protein production as assayed by IL-12 ELISA. As assessed by RT-PCR analysis, freshly purified as well as unstimulated, cultured EOS did not express detectable amounts of IL-12 mRNA for both subunits. An increase in IL-12 protein release was always associated with IL-12 mRNA expression for both IL-12 subunits, the IL-12 p35 and IL-12 p40 protein (Fig. 1Go, A–C). In addition, treating EOS with rhRANTES led to the selective up-regulation of IL-12 p40 mRNA (Fig. 1Go, A and C) without an increase of IL-12 protein in the culture medium, although the ELISA used was able to cross-react with the IL-12 p40 subunit alone. The expression of mRNA was maximal at 4 h after stimulation, but not yet associated with IL-12 protein secretion at this time point. IL-12 mRNA signals were weak and only inconsistently observed in 24-h-stimulated EOS (data not shown). To exclude the possibility that IL-12 mRNA signals in EOS preparations are due to monocytes contaminating the preparation in a manner analogous to the EOS experiments, purified monocytes were stimulated with rhIL-4, rhIL-5, rhGM-CSF, and rhIFN-{gamma}. The RT-PCR results (Fig. 2Go) demonstrated constitutively expressed mRNA for both IL-12 subunits. Expression of the p40 subunit remained essentially unaltered after any of the stimulations. In contrast, treating monocytes with either IL-4 or IL-5 led to a strong down-regulation of IL-12 p35 mRNA, whereas GM-CSF and IFN-{gamma} stimulations were not able to influence IL-12 p35 mRNA expression significantly.


View this table:
[in this window]
[in a new window]
 
Table I. IL-12 protein production by stimulated human eosinophils1

 


View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 1. A indicates the representative RT-PCR results for the IL-12 p35, IL-12 p40, and ß-actin expression of EOS from donor 2 (see Table IGo). The 4-h stimulation of EOS, the isolation of RNA, and the RT-PCR conducted with the respective primer pairs are described in Materials and Methods. The amplification products were visualized using an ethidium bromide-stained agarose gel. Lanes 1 through 8 depict the results from the following stimulations: 1, IL-4; 2, IL-5; 3, GM-CSF; 4, IFN-{gamma}; 5, RANTES; 6, unstimulated control; 7, C5a; 8, IL-1{alpha}; and 9, TNF-{alpha}. B and C are a summary of the semiquantitative RT-PCR conducted for IL-12 p35 (B) and IL-12 p40 (C) from donors 1 through 8 (see Table IGo). The purification and stimulation of EOS, the isolation of RNA, the semiquantitative RT-PCR conducted with primer pairs for IL-12 p35 and ß-actin as a housekeeping gene, as well as the quantification of amplification products by ion-exchange chromatography were conducted as described in Materials and Methods. Data are given as the fold expression of unstimulated EOS (control = 1) and represent the mean ± SD from all donors assessed. High SDs for IL-5- and IFN-{gamma}-stimulated EOS result from interindividual differences in responsiveness toward these cytokines (see results in Table IGo for comparison).

 


View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 2. Representative RT-PCR results for IL-12 p35, IL-12 p40, and ß-actin expression of monocytes. The 4-h stimulation of monocytes, the isolation of RNA, and the RT-PCR conducted with the respective primer pairs are described in Materials and Methods. The amplification products were visualized using an ethidium bromide-stained agarose gel. Lanes 1 through 5 depict results from the following stimulations: 1, unstimulated control; 2, IL-4; 3, IL-5; 4, GM-CSF; and 5, IFN-{gamma}. The data represent one of three essentially identical experiments.

 
The bioactivity of EOS-secreted IL-12 was assessed according to its capacity to enhance IFN-{gamma} expression in human Th1 cells (Fig. 3Go, A and B). In this assay, rhIL-12 is able to superinduce the Con A-induced expression of IFN-{gamma} mRNA. Supernatants derived from rhIL-4-treated EOS were able to enhance IFN-{gamma} mRNA expression in a range that was comparable with the effect of rhIL-12. This effect was completely blocked by the addition of neutralizing anti-IL-12 Abs but not by a respective isotype control Ab. In contrast, the addition of supernatants from rhIFN-{gamma}-stimulated EOS, which did not secrete ELISA-detectable IL-12, did not affect IFN-{gamma} mRNA in Th1 cells.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 3. A, Semiquantitative RT-PCR for IFN-{gamma} mRNA expression by human Th1-like T cells. Human skin-derived T cells (22) were cultured for 24 h in the presence of Con A (ConA), Con A and IL-12 (IL-12), or Con A and EOS CM (EOS supernatant) from IL-4- (IL-4) or IFN-{gamma} (IFN{gamma})-stimulated EOS with (+aIL-12) or without the addition of neutralizing anti-IL-12 Ab, or T cells were left untreated (C). IFN-{gamma} mRNA expression was assessed by semiquantitative RT-PCR as described in Materials and Methods and is given as a fold expression of Con A (equaling 1) -induced IFN-{gamma} mRNA expression (mean ± SD of two independent experiments). B, Semiquantitative RT-PCR for IFN-{gamma} mRNA expression by human Th1-like T cells. Human skin-derived T cells (22) were cultured for 24 h in the presence of Con A (2), Con A and IL-12 (3), or EOS CM from IL-4- (4) or IFN-{gamma}- (6) stimulated EOS with (5) or without the addition of neutralizing anti-IL-12 Ab, or T cells were left untreated (1). IFN-{gamma} and ß-actin mRNA expression was assessed by RT-PCR as described in Materials and Methods, and amplification products were subjected to ion-exchange chromatography, visualized, and quantified by an on-line UV spectrophotometer as described in Materials and Methods. The amplification signals for ß-actin are shown on the left panel and those for IFN-{gamma} are shown on the right panel as a three dimensional presentation of ion-exchange chromatograms.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present study demonstrates 1) EOS expression of IL-12 mRNA for the IL-12 p35 and p40 subunits, 2) the secretion of IL-12 protein by EOS as measured by ELISA, and 3) the presence of IL-12 bioactivity in the supernatants of stimulated EOS. This finding indicates that human eosinophilic granulocytes are endowed with the capacity to synthesize and secrete biologically active IL-12. The amount of IL-12 protein released is above the levels observed in cultured human keratinocytes (37) and may be comparable with that released by cells from the monocytic lineage. IL-12 protein production was preceded by an up-regulation of mRNA for both IL-12 subunits in every case. This may indicate that EOS IL-12 protein is synthesized de novo via the gene expression of IL-12 p35 and p40, and that it is not due to the release of preformed protein, as has been described for other EOS-derived cytokines (16, 17, 38). Since EOS preparations were derived from peripheral blood, it may be argued that the IL-12 expression observed might be due to <=2% contamination with monocytes. However, stimulation experiments using purified peripheral blood monocytes revealed clear differences when compared with the respective EOS experiments. In particular, the constitutive mRNA expression of both IL-12 subunits and the completely different IL-12 mRNA expression pattern following cytokine stimulations of monocytes clearly demonstrate that the results obtained for EOS cannot be explained by a monocytic contamination of EOS preparations.

EOS IL-12 production was dependent upon the donor as well as the treatment of EOS with selected biologic response modifiers. IL-12 release by EOS that were derived from the two nonatopic donors was much lower than from cells that were derived from all of the atopic individuals. This result, although obtained with a limited number of donors, is in line with previous observations that EOS from atopic donors are in a preactivated status, which allows increased cytokine production (e.g., of IL-4) (16). Responsiveness toward IL-5 and IFN-{gamma} was characterized by high interindividual differences, whereas IL-4 and GM-CSF consistently induced IL-12 secretion. However, in responsive EOS preparations, IFN-{gamma} as well as IL-5 induced the secretion of large amounts of IL-12 protein that even exceeded those observed after IL-4 stimulations. This functional heterogeneity of EOS upon cytokine treatment may emerge from different environmental conditions in a given individual, which may be able to prime EOS responses toward distinct cytokines. Taken together, most of the cytokines leading to EOS IL-12 production are Th2-like cytokines (IL-4, GM-CSF, and IL-5), although the effects of the Th1-like cytokine IFN-{gamma} cannot generally be excluded.

By virtue of their capacity to secrete IL-12 upon exposure to Th2-like cytokines, EOS may play a previously unrecognized role in switching an ongoing Th2-dominated immune response to a Th1-response. The present data were derived from in vitro experiments, but it is interesting to speculate whether EOS IL-12 secretion might also influence T cell-mediated immune responses in vivo. For example, the sequential activation of Th2-like followed by Th1-like T cell activation was observed in positive inhalant allergen patch test reactions in atopic dermatitis patients (39, 40); such test reactions are used as a model to study the pathogenesis of atopic dermatitis. For this system, it has been reported that the tested skin areas during the initiation phase are characterized by 1) an increased in situ expression of Th2-like cytokines and 2) infiltration with activated EOS. This is followed by the development of an eczematous skin reaction, which is preceded by an in situ expression of IL-12 (39) and, in contrast to the early phase, is characterized by strong IFN-{gamma} expression. Thus, one could put forward a model in which the initial Th2-dominated environment induces EOS to secrete IL-12 which in turn supports the expression of IFN-{gamma} by Th1-like T cells.

EOS-derived IL-12 may also play a role in parasite defense. It could be speculated that EOS-derived IL-12 supports the development of the Th1-like immune response that is required for successful defense. For example, IL-12 production is crucial for the activation of NK cells and for the survival of the infected animal (41, 42, 43) in toxoplasma infection. Thus far, macrophages have been thought to be the major IL-12 source (42). In light of the present observations, it is intriguing to speculate that EOS may contribute to IL-12 production during parasitosis and consequently to the effective elimination of parasites.

However, the described IL-12 production by human EOS and its exact pathophysiologic role needs to be investigated further with regard to the broad range of diseases involving eosinophilic granulocytes.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. Jean Krutmann, Clinical and Experimental Photodermatology, Department of Dermatology, Heinrich-Heine-University, Moorenstr. 5, D-40225 Düsseldorf, Germany. E-mail address: Back

2 Abbreviations used in this paper: EOS, eosinophil(s); GM-CSF, granulocyte-macrophage CSF; C5a, complement 5a; h, human; CM, conditioned medium. Back

Received for publication August 8, 1997. Accepted for publication February 25, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Butterworth, A. E.. 1984. Cell-mediated damage to helminths. Adv. Parasitol. 23:143.[Medline]
  2. Gleich, G. J., C. R. Adolphson. 1986. The eosinophil leukocyte: structure and function. Adv. Immunol. 39:177.[Medline]
  3. Wardlaw, A. J., A. B. Kay. 1987. The role of the eosinophil in the pathogenesis of asthma. Allergy 42:321.[Medline]
  4. Proost, P., A. Wuyts, J. van Damme. 1996. The role of chemokines in inflammation. Int. J. Clin. Lab. Res. 26:211.[Medline]
  5. Baggiolini, M., B. Dewald, B. Moser. 1997. Human chemokines: an update. Annu. Rev. Immunol. 15:675.[Medline]
  6. Silberstein, D. S., W. F. Owen, J. C. Gasson, J. F. DiPersio, D. W. Golde, J. C. Bina, R. Soberman, K. F. Austen, J. R. David. 1986. Enhancement of human eosinophil cytotoxicity and leukotriene synthesis by biosynthetic (recombinant) granulocyte-macrophage CSF. J. Immunol. 137:3290.[Abstract]
  7. Owen, W. F., M. E. Rothenburg, D. S. Silberstein, J. C. Gasson, R. L. Stevens, K. F. Austen, R. J. Soberman. 1987. Regulation of human eosinophil viability, density, and function by granulocyte/macrophage colony-stimulating factor in the presence of 3T3 fibroblasts. J. Exp. Med. 166:129.[Abstract/Free Full Text]
  8. Rothenburg, M. E., J. Petersen, R. L. Stevens, D. S. Silberstein, D. T. McKenzie, K. F. Austen, W. F. Owen. 1989. IL-5-dependent conversion of normodense human eosinophils to the hypodense phenotype uses 3T3 fibroblasts for enhanced viability, accelerated hypodensity, and sustained antibody-dependent cytotoxicity. J. Immunol. 143:2311.[Abstract]
  9. Rothenburg, M. E., W. F. Owen, D. S. Silberstein, J. Woods, R. J. Soberman, K. F. Austen, R. L. Stevens. 1988. Human eosinophils have prolonged survival, enhanced functional properties and become hypodense when exposed to human interleukin-3. J. Clin. Invest. 81:1986.
  10. Her, E., J. Frazer, K. F. Austen, W. F. Owen. 1991. Eosinophil hematopoietins antagonize the programmed cell death of human eosinophils: cytokine and glucocorticoid effects on eosinophils maintained by endothelial cell-conditioned medium. J. Clin. Invest. 88:1982.
  11. Schleimer, R. P., S. A. Sterbinsky, J. Kaiser, C. A. Bickel, D. A. Klunk, K. Tomioka, W. Newman, F. W. Luscinskas, M. A. Gimbrone, B. W. McIntyre, B. S. Bochner. 1992. IL-4 induces adherence of human eosinophils and basophils but not neutrophils to endothelium: association with expression of VCAM-1. J. Immunol. 148:1086.[Abstract]
  12. Hirai, K., M. Miyamasu, T. Takaishi, Y. Morita. 1997. Regulation of the function of eosinophils and basophils. Crit. Rev. Immunol. 17:325.[Medline]
  13. Ackerman, S. J.. 1993. Characterization and functions of eosinophil granule proteins. S. Makino, and T. Fukuda, eds. Eosinophils: Biological and Clinical Aspects 33.-74. CRC Press, Boca Raton.
  14. Elsner, J., M. Oppermann, W. Czech, G. Dobos, E. Schöpf, J. Norgauer, A. Kapp. 1994. C3a activates reactive oxygen radical species production and intracellular calcium transients in human eosinophils. Eur. J. Immunol. 24:518.[Medline]
  15. Shult, P. A., F. M. Graziano, W. W. Busse. 1985. Enhanced eosinophil luminol-dependent chemiluminescence in allergic rhinitis. J. Allergy Clin. Immunol. 77:702.
  16. Moqbel, R., S. Ying, J. Barkans, T. M. Newman, P. Kimmit, M. Wakelin, L. Taborda-Barata, Q. Meng, C. J. Corrigan, S. R. Durham, A. B. Kay. 1995. Identification of messenger RNA for IL-4 in human eosinophils with granule localization and release of the translated product. J. Immunol. 155:4939.[Abstract]
  17. Dubucquoi, S., P. Desreumaux, A. Janin, O. Klein, M. Goldman, J. Tavernier, A. Capron, M. Capron. 1994. Interleukin 5 synthesis by eosinophils: association with granules and immunoglobulin-dependent secretion. J. Exp. Med. 179:703.[Abstract/Free Full Text]
  18. Wynn, T. A., I. P. Oswald, I. A. Eltoum, P. Caspar, C. J. Lowenstein, F. A. Lewis, S. L. James, A. Sher. 1994. Elevated expression of Th1 cytokines and nitric oxide synthase in the lungs of vaccinated mice after challenge infection with Schistosoma mansoni. J. Immunol. 153:5200.[Abstract]
  19. Reiner, S. L., R. M. Locksley. 1995. The regulation of immunity to Leishmania major. Annu. Rev. Immunol. 13:151.[Medline]
  20. Grewe, M., K. Gyufko, E. Schöpf, J. Krutmann. 1994. Lesional expression of interferon-{gamma} in atopic eczema. Lancet 343:25.[Medline]
  21. Ohmen, J. D., J. M. Hanifin, B. J. Nickoloff, T. H. Rea, R. Wyzykowski, J. Kim, D. Jullien, T. McHugh, A. S. Nassif, S. C. Chan, R. L. Modlin. 1995. Overexpression of IL-10 in atopic dermatitis: contrasting cytokine patterns with delayed-type hypersensitivity reactions. J. Immunol. 154:1956.[Abstract]
  22. Werfel, T., A. Morita, M. Grewe, H. Renz, U. Wahn, J. Krutmann, A. Kapp. 1996. Allergen specificity of skin-infiltrating T cells is not restricted to a type-2 cytokine pattern in chronic skin lesions of atopic dermatitis. J. Invest. Dermatol. 107:871.[Medline]
  23. Brunda, M. J.. 1994. Interleukin-12. J. Leukocyte Biol. 55:280.[Abstract]
  24. Germann, T., E. Rude. 1995. Interleukin-12. Int. Arch. Allergy Immunol. 108:103.[Medline]
  25. Butterworth, A. E., R. F. Sturrock, V. Houba, P. H. Rees. 1974. Antibody-dependent cell-mediated damage to schistosomula in vitro. Nature 252:503.[Medline]
  26. Butterworth, A. E., R. F. Sturrock, V. Houba, A. A. Mahmoud, A. Sher, P. H. Rees. 1975. Eosinophils as mediators of antibody-dependent damage to schistosomula. Nature 256:727.[Medline]
  27. Bruynzeel-Koomen, C. A. F. M., D. F. van Wichen, C. J. F. Spry, P. Venge, P. L. B. Bruynzeel.. 1988. Active participation of eosinophils in patch test reactions to inhalant allergens in patients with atopic dermatitis. Br. J. Dermatol. 118:229.[Medline]
  28. Kapp, A., M. Danner, T. A. Luger, C. Hauser, E. Schöpf. 1987. Granulocyte-activating mediators (GRAM): generation by human epidermal cells. Arch. Dermatol. Res. 279:470.[Medline]
  29. Hansel, T. T., J. D. Pound, D. Pilling, G. D. Kitas, M. Salmon, T. A. Gentle, S. S. Lee, R. A. Thompson. 1989. Purification of human blood eosinophils by negative selection using immunomagnetic beads. J. Immunol. Methods 122:97.[Medline]
  30. Kimura, I., Y. Moritani, Y. Tanizaki. 1973. Basophils in bronchial asthma with reference to reagin-type allergy. Clin. Allergy 3:195.[Medline]
  31. Peters, M., G. J. Gleich, S. L. Dunnette, T. Fukuda. 1988. Ultrastructural study of eosinophils from patients with hypereosinophilic syndrome: a morphological basis of hypodense eosinophils. Blood 71:780.[Abstract/Free Full Text]
  32. Yukawa, T., C. Kroegel, T. Fukuda, K. F. Chung, P. J. Barnes. 1989. Density heterogeneity of eosinophil leukocytes: induction of hypodense eosinophils by platelet-activating factor. Immunology 68:140.[Medline]
  33. Krutmann, J., I. U. Khan, R. S. Wallis, F. Zhang, E. A. Rich, J. J. Ellner, C. A. Elmets. 1990. Cell membrane is a major locus for ultraviolet B-induced alterations in accessory cells. J. Clin. Invest. 85:1529.
  34. Chomzynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  35. Henninger, H. P., R. Hoffmann, M. Grewe, A. Schulze-Specking, K. Decker. 1993. Purification and quantitative analysis of nucleic acids by anion-exchange-high-performance liquid chromatography. Biochem. Biophys. Hoppe-Seyler 374:625.
  36. Grewe, M., K. Gyufko, A. Budnik, T. Ruzicka, S. Olaizola-Horn, M. Berneburg, J. Krutmann. 1996. Interleukin-1 receptors type I and type II are differentially regulated in human keratinocytes by ultraviolet B radiation. J. Invest. Dermatol. 107:865.[Medline]
  37. Muller, G., J. Saloga, T. Germann, I. Bellinghausen, M. Mohamadzadeh, J. Knop, A. H. Enk. 1994. Identification and induction of human keratinocyte-derived IL-12. J. Clin. Invest. 94:1799.
  38. Yousefi, S., S. Hemmann, M. Weber, C. Hölzer, K. Hartung, K. Blaser, H.-U. Simon. 1995. IL-8 is expressed by human peripheral blood eosinophils: evidence for increased secretion in asthma. J. Immunol. 154:5481.[Abstract]
  39. Grewe, M., S. Walther, K. Gyufko, W. Czech, E. Schöpf, J. Krutmann. 1995. Analysis of the cytokine pattern expressed in situ in inhalant allergen patch test reactions of atopic dermatitis patients. J. Invest. Dermatol. 105:407.[Medline]
  40. Thepen, T., E. G. Langeveld-Wildschut, I. C. Bihari, D. F. van Wichen, F. C. van Reijsen, G. C. Mudde, C. A. F. M. Bruijnzeel-Koomen. 1996. Biphasic response against aeroallergen in atopic dermatitis showing a switch from an initial Th2 response in situ: an immunocytochemical study. J. Allergy Clin. Immunol. 97:828.[Medline]
  41. Tripp, C. S., S. F. Wolf, E. R. Unanue. 1993. Interleukin 12 and tumor necrosis factor alpha are costimulators of interferon gamma production by natural killer cells in severe combined immunodeficiency mice with listeriosis, and interleukin 10 is a physiologic antagonist. Proc. Natl. Acad. Sci. USA 90:3725.[Abstract/Free Full Text]
  42. Gazzinelli, R. T., M. Wysocka, S. Hayashi, E. Y. Denkers, S. Hieny, P. Caspar, G. Trinchieri, A. Sher. 1994. Parasite-induced IL-12 stimulates early IFN-{gamma} synthesis and resistance during acute infection with Toxoplasma gondii. J. Immunol. 153:2533.[Abstract]
  43. Gazzinelli, R. T., S. Hayashi, M. Wysocka, L. Carrera, R. Kuhn, W. Muller, F. Roberge, G. Trinchieri, A. Sher. 1994. Role of IL-12 in the initiation of cell-mediated immunity by Toxoplasma gondii and its regulation by IL-10 and nitric oxide. J. Eukaryot. Microbiol. 41:9.



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
L. A. Spencer, C. T. Szela, S. A. C. Perez, C. L. Kirchhoffer, J. S. Neves, A. L. Radke, and P. F. Weller
Human eosinophils constitutively express multiple Th1, Th2, and immunoregulatory cytokines that are secreted rapidly and differentially
J. Leukoc. Biol., January 1, 2009; 85(1): 117 - 123.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. Voskas, Y. Babichev, L. S. Ling, J. Alami, Y. Shaked, R. S. Kerbel, B. Ciruna, and D. J. Dumont
An eosinophil immune response characterizes the inflammatory skin disease observed in Tie-2 transgenic mice
J. Leukoc. Biol., July 1, 2008; 84(1): 59 - 67.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
R. Moqbel and J. J. Coughlin
Differential Secretion of Cytokines
Sci. Signal., June 6, 2006; 2006(338): pe26 - pe26.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K.-i. Yamanaka, R. Clark, R. Dowgiert, D. Hurwitz, M. Shibata, B. E. Rich, K. Hirahara, D. A. Jones, S. Eapen, H. Mizutani, et al.
Expression of Interleukin-18 and Caspase-1 in Cutaneous T-Cell Lymphoma
Clin. Cancer Res., January 15, 2006; 12(2): 376 - 382.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. O. Odemuyiwa, A. Ghahary, Y. Li, L. Puttagunta, J. E. Lee, S. Musat-Marcu, A. Ghahary, and R. Moqbel
Cutting Edge: Human Eosinophils Regulate T Cell Subset Selection through Indoleamine 2,3-Dioxygenase
J. Immunol., November 15, 2004; 173(10): 5909 - 5913.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Schmid-Grendelmeier, F. Altznauer, B. Fischer, C. Bizer, A. Straumann, G. Menz, K. Blaser, B. Wuthrich, and H.-U. Simon
Eosinophils Express Functional IL-13 in Eosinophilic Inflammatory Diseases
J. Immunol., July 15, 2002; 169(2): 1021 - 1027.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Bandeira-Melo, K. Sugiyama, L. J. Woods, M. Phoofolo, D. M. Center, W. W. Cruikshank, and P. F. Weller
IL-16 Promotes Leukotriene C4 and IL-4 Release from Human Eosinophils via CD4- and Autocrine CCR3-Chemokine-Mediated Signaling
J. Immunol., May 1, 2002; 168(9): 4756 - 4763.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Yagi, H. Nagai, Y. Iigo, T. Akimoto, T. Arai, and M. Kubo
Development of Atopic Dermatitis-Like Skin Lesions in STAT6-Deficient NC/Nga Mice
J. Immunol., February 15, 2002; 168(4): 2020 - 2027.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. R. MacKenzie, J. Mattes, L. A. Dent, and P. S. Foster
Eosinophils Promote Allergic Disease of the Lung by Regulating CD4+ Th2 Lymphocyte Function
J. Immunol., September 15, 2001; 167(6): 3146 - 3155.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
M J Plummeridge, L Armstrong, M A Birchall, and A B Millar
Reduced production of interleukin 12 by interferon gamma primed alveolar macrophages from atopic asthmatic subjects
Thorax, October 1, 2000; 55(10): 842 - 847.
[Abstract] [Full Text]


Home page
BloodHome page
R. Bheekha-Escura, D. W. MacGlashan Jr, J. M. Langdon, and S. M. MacDonald
Human recombinant histamine-releasing factor activates human eosinophils and the eosinophilic cell line, AML14-3D10
Blood, September 15, 2000; 96(6): 2191 - 2198.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
K. M. Al-Qaoud, E. Pearlman, T. Hartung, J. Klukowski, B. Fleischer, and A. Hoerauf
A new mechanism for IL-5-dependent helminth control: neutrophil accumulation and neutrophil-mediated worm encapsulation in murine filariasis are abolished in the absence of IL-5
Int. Immunol., June 1, 2000; 12(6): 899 - 908.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
A. O. MAGNAN, L. G. MÉLY, C. A. CAMILLA, M. M. BADIER, F. A. MONTERO-JULIAN, C. M. GUILLOT, B. B. CASANO, S. J. PRATO, V. FERT, P. BONGRAND, et al.
Assessment of the Th1/Th2 Paradigm in Whole Blood in Atopy and Asthma . Increased IFN-gamma -producing CD8+ T Cells in Asthma
Am. J. Respir. Crit. Care Med., June 1, 2000; 161(6): 1790 - 1796.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
G. C. de Gast, H.-J. Klümpen, F. A. Vyth-Dreese, M.-J. Kersten, N. C. V. Verra, J. Sein, D. Batchelor, W. J. Nooijen, and J. H. Schornagel
Phase I Trial of Combined Immunotherapy with Subcutaneous Granulocyte Macrophage Colony-stimulating Factor, Low-Dose Interleukin 2, and Interferon {{alpha}} in Progressive Metastatic Melanoma and Renal Cell Carcinoma
Clin. Cancer Res., April 1, 2000; 6(4): 1267 - 1272.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
N. A. Lee and J. J. Lee
The Macroimportance of the Pulmonary Immune Microenvironment
Am. J. Respir. Cell Mol. Biol., September 1, 1999; 21(3): 298 - 302.
[Full Text]


Home page
JEMHome page
G. Woerly, N. Roger, S. Loiseau, D. Dombrowicz, A. Capron, and M. Capron
Expression of Cd28 and Cd86 by Human Eosinophils and Role in the Secretion of Type 1 Cytokines (Interleukin 2 and Interferon {gamma}): Inhibition by Immunoglobulin a Complexes
J. Exp. Med., August 16, 1999; 190(4): 487 - 496.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
M. A. Giembycz and M. A. Lindsay
Pharmacology of the Eosinophil
Pharmacol. Rev., June 1, 1999; 51(2): 213 - 340.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grewe, M.
Right arrow Articles by Krutmann, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grewe, M.
Right arrow Articles by Krutmann, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS