|
|
||||||||




*
Department of Dermatology, Heinrich-Heine-University, Düsseldorf, Germany;
Department of Dermatology, Albert-Ludwigs-University, Freiburg, Germany; and
Department of Dermatology, Medizinische Hochschule Hannover, Hannover, Germany
| Abstract |
|---|
|
|
|---|
, TNF-
,
IL-1
, RANTES, and complement 5a, respectively. The expression of
both IL-12 protein and mRNAs for the p35 and p40 IL-12 subunits was
strongly induced in all donors by the Th2-like cytokines IL-4 and
granulocyte-macrophage CSF and was also moderately induced by TNF-
and IL-1
. IL-5 treatment resulted in IL-12 synthesis in four atopic
donors and one nonatopic donor, whereas IFN-
induced IL-12 synthesis
in only two atopic donors. In contrast, RANTES exclusively induced mRNA
for the p40 subunit without detectable protein release, and complement
5a had no effect on IL-12 mRNA or protein expression. EOS-derived IL-12
was biologically active, because supernatants derived from IL-4-treated
EOS superinduced the Con A-induced expression of IFN-
by a human
Th1-like T cell line. This activity was neutralized by anti-IL-12
Abs. In conclusion, EOS secrete biologically active IL-12 after
treatment with selected cytokines, which mainly represent the Th2-like
type. Consequently, EOS may promote a switch from Th2-like to Th1-like
immune responses in atopic and parasitic diseases. | Introduction |
|---|
|
|
|---|
Recently, EOS have been shown to synthesize and release cytokines,
including IL-4 (16) and IL-5 (17). Within the model of Th1- and
Th2-like immune responses, IL-4 and IL-5 belong to the Th2-like
cytokines. Therefore, EOS are not only activated by Th2-like cytokines
but are also able to support Th2-like inflammatory responses and
consequently perpetuate allergic diseases. Parasite defense as well as
allergic diseases, especially atopic dermatitis, are also characterized
by the activation of IFN-
-producing NK cells (18, 19) and Th1-like T
cells (20, 21, 22), respectively. The differentiation of these lymphocyte
subsets is driven primarily by the cytokine IL-12 (23, 24). EOS
infiltration is a hallmark for parasitosis (25, 26) as well as for
atopic eczema (27), and EOS might therefore contribute to the
generation and differentiation of those IFN-
-producing T cells that
are involved in these diseases. Therefore, we assessed the capacity of
EOS to produce biologically active IL-12.
| Materials and Methods |
|---|
|
|
|---|
Venous blood samples were obtained from patients and healthy volunteers after written informed consent. The atopy syndrome of patients ("atopics") was based on 1) a personal history of allergic asthma, allergic rhinoconjunctivitis, and/or atopic dermatitis, 2) enhanced serum IgE levels, and 3) the presence of specific IgE directed against house dust mite protein. Healthy volunteers ("nonatopics") did not fulfill any of these criteria.
Isolation of human eosinophilic granulocytes
Human granulocytes were isolated from the heparin-anticoagulated venous blood of six atopic donors and two nonatopic donors as described previously (28). For further purification of the EOS, the granulocytes were resuspended at a concentration of 107/ml in HEPES-buffered HBSS (pH 7.4) containing 1 mg/ml BSA (HBSS/BSA). EOS were purified using a modification of a method described previously (29). For this purpose immunomagnetic beads (Dynabeads M-450, Dynal, Oslo, Norway) were coated with anti-CD16 mAb. In brief, 2 ml beads (4 x 108 beads/ml) were mixed with 50 µl anti-CD16 Ab (1 mg/ml) and incubated for 24 h at 4°C in Minosorp tubes (Nunc, Roskilde, Denmark) on a rotary mixer. Coated beads were washed three times in HBSS/BSA and retrieved using a Dynal magnetic particle concentrator (MPC-6; Dynal). The anti-CD16 Ab-coated beads were stored at a concentration of 2 x 108 beads/ml HBSS/BSA under sterile conditions at 4°C for a maximum of 1 wk. A total of 1 ml of granulocytes was centrifuged in Minosorp tubes for 7 min at 820 x g at 4°C; the supernatant was aspirated, and 500 µl of the anti-CD16 Ab-coated beads were added subsequently to the pellet. The mixture was incubated for 1 h at 4°C on a rotary mixer. Thereafter, HBSS/BSA was added, and the cells which were coupled to the beads were removed magnetically using the magnetic particle concentrator. The supernatant was aspirated, and residual beads were removed by a second magnetic separation step. The resulting supernatant was washed as described above, and the resulting EOS were resuspended in HBSS/BSA. If necessary, the magnetic purification procedure was repeated once more. The EOS were quantitated with Kimura stain (30) in a Neubauer counting chamber (Bender and Hobein, Berlin, Germany). Cytospin preparations of the cells had a purity of >95% as shown by Pappenheim stain. Highly purified EOS were further separated by centrifugation on Percoll (Kabi Pharmacia, Freiburg, Germany) density gradients (31). For this purpose, five-step discontinuous density gradients (750 µl of each interface per gradient) were formed with a peristaltic pump (Varioperpex II pump; Kabi Pharmacia) in 5-ml round-bottom polystyrene tubes. In brief, gradients consisted of 1.080, 1.085, 1.09, and 1.100 g/ml of isotonic-buffered Percoll solution. EOS (5 x 106), purified as described above, were washed twice and resuspended in 750 µl Percoll solution (density of 1.070 g/ml). Percoll gradients were overlaid with these cells and centrifuged for 20 min at 1600 x g at 10°C. Thereafter, the cells in the interphases were collected, immediately washed twice with HBSS/BSA, and resuspended as described below. EOS with a density of <1.082 g/ml were defined considered hypodense (32). Cells were stained and counted as described above; there were no differences in the viability of the cells (9295%) between the fractions as judged by trypan blue exclusion. The cells had a purity of >98% as shown by Pappenheim stain.
Isolation of human peripheral blood monocytes
PBMCs were obtained from the heparinized blood of healthy human volunteers by Ficoll-Hypaque (Pharmacia, Freiburg, Germany) density sedimentation as described previously (33). These cells were allowed to adhere to plastic tissue culture dishes for 1 h. Next, the plastic-adherent cells were gently scraped off, centrifuged, and washed with RPMI 1640 three times. These cells were >90% nonspecific esterase positive and are referred to as monocytes in this study.
Stimulations
Freshly prepared EOS (500,000 cells/stimulation) were treated
with complement 5a (C5a) (10-7 mol/l),
human rGM-CSF (rhGM-CSF) (30 ng/ml, Sigma, Munich, Germany), rhRANTES
(100 ng/ml), rhTNF-
(500 U/ml), rhIL-1
(400 pg/ml), rhIFN-
(100 U/ml), rhIL-4 (40 ng/ml), and rhIL-5 (10 ng/ml) and left in
culture for 4 h or 24 h, respectively. Monocytes were treated
with rhGM-CSF, rhIL-4, rhIL-5, and rhIFN-
in the aforementioned
concentrations and remained in culture for 4 h. As controls, EOS
as well as monocytes were kept in culture without treatment for the
desired period of time. Recombinant human cytokines were purchased from
Genzyme (Rüsselsheim, Germany). After stimulations, cells were
centrifuged for 10 min at 300 x g, supernatants were
harvested, and cells were taken up in guanidinium isothiocyanate
buffer (34).
RNA extraction
Total RNA was extracted using a modified acidic chloroform/phenol protocol (34). Total RNA was washed and pelleted three times in 70% ethanol and then routinely taken up in 200 µl aqua bidest.
RT-PCR
Cytokine mRNA expression was measured by differential RT-PCR that was conducted as described previously (35, 36). Specifically, total RNA was reverse transcribed using mouse Maloney leukemia virus reverse transcriptase and an oligo(dT)18 primer. For an estimation of similar amounts of cDNA used for PCR, samples were screened for the expression of ß-actin as a housekeeping gene. Therefore, 1/200 of total cDNA was subjected routinely to 24 PCR cycles, which was within the linear amplification range for cycle numbers, using a primer pair for ß-actin. The product was subjected directly to ion-exchange chromatography that was connected to an on-line UV spectrophotometer (A260 nm), allowing an exact quantification of amplification products. Relative amounts of cDNA from each sample to be inserted into the PCR were calculated to yield similar amounts of ß-actin PCR products; these calculations were confirmed by repeating RT-PCR for ß-actin with the calculated amount of cDNA.
For investigation of cytokine mRNA expression, five times more cDNA was inserted than for ß-actin PCR. PCR was conducted with 28 cycles, which was within the linear amplification range for all cytokine cDNAs. The following primer pairs specific for the p35 and p40 subunits of IL-12 and for ß-actin were used (5'-3'): IL-12 p35 subunit: ACCCAGGAATGTTCCCATGC and TCTGTCAATAGTCACTGCCCG; IL-12 p40 subunit: AAAGGAGGCGAGGTTCTAAGCC and TTTGCGGCAGATGACCGTGG; and ß-Actin: GTGGGGCGCCCCAGGCACCA and CTCCTTAATGTCACGCACGATTTC.
Additionally, a PCR for ß-actin was performed in parallel to each cytokine PCR as described above. Furthermore, the PCR for each cytokine sample was conducted at least two times. Products were quantified by ion-exchange chromatography as described above. To ensure the identity of products, their chromatogram peaks were collected, digested with an appropriate endonuclease, and fragments were visualized on agarose gel by ethidium bromide staining.
Detection of IL-12 protein
For the detection of the hIL-12 present in the 24-h supernatants of EOS (500,000 cells/ml culture medium), a highly sensitive hIL-12 ELISA was employed (Laboserv, Gießen, Germany). This ELISA is able to detect the IL-12 heterodimer as well as the p70 homodimer with a detection limit of 5 pg/ml.
Determination of biologic activity of EOS-derived IL-12
For the detection of the IL-12-specific biologic activity, cells
from a previously described human T cell line of Th1-like phenotype
(22) were incubated in the presence of EOS conditioned medium (CM) with
an addition of neutralizing anti-IL-12 Abs (Genzyme) or the
respective isotype control Ab. As positive controls, T cells were
incubated in the presence of 20 ng rhIL-12 (Genzyme). After a 48-h
culture in the presence of Con A (10 µg/ml, Sigma, Munich, Germany),
the IFN-
mRNA expression of T cells was determined by RT-PCR (see
above) as described previously (22) using the following primer pair
(5'-3'): GCATCGTTTTGGGTTCTCTTGGC and CAGCATCTGACTCCTTTTTCGC.
| Results |
|---|
|
|
|---|
, and rhIL-1
,
respectively. In marked contrast, EOS stimulated with rhGM-CSF or
rhIL-4 released high amounts of IL-12 protein into the culture medium
regardless of whether cells were obtained from atopics or nonatopics
(Table I
induced high amounts of IL-12 protein production as assayed
by IL-12 ELISA. As assessed by RT-PCR analysis, freshly purified as
well as unstimulated, cultured EOS did not express detectable amounts
of IL-12 mRNA for both subunits. An increase in IL-12 protein release
was always associated with IL-12 mRNA expression for both IL-12
subunits, the IL-12 p35 and IL-12 p40 protein (Fig. 1
. The RT-PCR results (Fig. 2
stimulations were not able to influence IL-12 p35 mRNA expression
significantly.
|
|
|
expression in human Th1 cells (Fig. 3
mRNA. Supernatants derived from rhIL-4-treated
EOS were able to enhance IFN-
mRNA expression in a range that was
comparable with the effect of rhIL-12. This effect was completely
blocked by the addition of neutralizing anti-IL-12 Abs but not by a
respective isotype control Ab. In contrast, the addition of
supernatants from rhIFN-
-stimulated EOS, which did not secrete
ELISA-detectable IL-12, did not affect IFN-
mRNA in Th1 cells.
|
| Discussion |
|---|
|
|
|---|
2% contamination with monocytes. However,
stimulation experiments using purified peripheral blood monocytes
revealed clear differences when compared with the respective EOS
experiments. In particular, the constitutive mRNA expression of both
IL-12 subunits and the completely different IL-12 mRNA expression
pattern following cytokine stimulations of monocytes clearly
demonstrate that the results obtained for EOS cannot be explained by a
monocytic contamination of EOS preparations.
EOS IL-12 production was dependent upon the donor as well as the
treatment of EOS with selected biologic response modifiers. IL-12
release by EOS that were derived from the two nonatopic donors was much
lower than from cells that were derived from all of the atopic
individuals. This result, although obtained with a limited number of
donors, is in line with previous observations that EOS from atopic
donors are in a preactivated status, which allows increased cytokine
production (e.g., of IL-4) (16). Responsiveness toward IL-5 and IFN-
was characterized by high interindividual differences, whereas IL-4 and
GM-CSF consistently induced IL-12 secretion. However, in responsive EOS
preparations, IFN-
as well as IL-5 induced the secretion of large
amounts of IL-12 protein that even exceeded those observed after IL-4
stimulations. This functional heterogeneity of EOS upon cytokine
treatment may emerge from different environmental conditions in a given
individual, which may be able to prime EOS responses toward distinct
cytokines. Taken together, most of the cytokines leading to EOS IL-12
production are Th2-like cytokines (IL-4, GM-CSF, and IL-5), although
the effects of the Th1-like cytokine IFN-
cannot generally be
excluded.
By virtue of their capacity to secrete IL-12 upon exposure to Th2-like
cytokines, EOS may play a previously unrecognized role in switching an
ongoing Th2-dominated immune response to a Th1-response. The present
data were derived from in vitro experiments, but it is interesting to
speculate whether EOS IL-12 secretion might also influence T
cell-mediated immune responses in vivo. For example, the sequential
activation of Th2-like followed by Th1-like T cell activation was
observed in positive inhalant allergen patch test reactions in atopic
dermatitis patients (39, 40); such test reactions are used as a model
to study the pathogenesis of atopic dermatitis. For this system, it has
been reported that the tested skin areas during the initiation phase
are characterized by 1) an increased in situ expression of Th2-like
cytokines and 2) infiltration with activated EOS. This is followed by
the development of an eczematous skin reaction, which is preceded by an
in situ expression of IL-12 (39) and, in contrast to the early phase,
is characterized by strong IFN-
expression. Thus, one could put
forward a model in which the initial Th2-dominated environment induces
EOS to secrete IL-12 which in turn supports the expression of IFN-
by Th1-like T cells.
EOS-derived IL-12 may also play a role in parasite defense. It could be speculated that EOS-derived IL-12 supports the development of the Th1-like immune response that is required for successful defense. For example, IL-12 production is crucial for the activation of NK cells and for the survival of the infected animal (41, 42, 43) in toxoplasma infection. Thus far, macrophages have been thought to be the major IL-12 source (42). In light of the present observations, it is intriguing to speculate that EOS may contribute to IL-12 production during parasitosis and consequently to the effective elimination of parasites.
However, the described IL-12 production by human EOS and its exact pathophysiologic role needs to be investigated further with regard to the broad range of diseases involving eosinophilic granulocytes.
| Footnotes |
|---|
2 Abbreviations used in this paper: EOS, eosinophil(s); GM-CSF, granulocyte-macrophage CSF; C5a, complement 5a; h, human; CM, conditioned medium. ![]()
Received for publication August 8, 1997. Accepted for publication February 25, 1998.
| References |
|---|
|
|
|---|
in atopic eczema. Lancet 343:25.[Medline]
synthesis and resistance during acute infection with Toxoplasma gondii. J. Immunol. 153:2533.[Abstract]
This article has been cited by other articles:
![]() |
L. A. Spencer, C. T. Szela, S. A. C. Perez, C. L. Kirchhoffer, J. S. Neves, A. L. Radke, and P. F. Weller Human eosinophils constitutively express multiple Th1, Th2, and immunoregulatory cytokines that are secreted rapidly and differentially J. Leukoc. Biol., January 1, 2009; 85(1): 117 - 123. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Voskas, Y. Babichev, L. S. Ling, J. Alami, Y. Shaked, R. S. Kerbel, B. Ciruna, and D. J. Dumont An eosinophil immune response characterizes the inflammatory skin disease observed in Tie-2 transgenic mice J. Leukoc. Biol., July 1, 2008; 84(1): 59 - 67. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Moqbel and J. J. Coughlin Differential Secretion of Cytokines Sci. Signal., June 6, 2006; 2006(338): pe26 - pe26. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Yamanaka, R. Clark, R. Dowgiert, D. Hurwitz, M. Shibata, B. E. Rich, K. Hirahara, D. A. Jones, S. Eapen, H. Mizutani, et al. Expression of Interleukin-18 and Caspase-1 in Cutaneous T-Cell Lymphoma Clin. Cancer Res., January 15, 2006; 12(2): 376 - 382. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Odemuyiwa, A. Ghahary, Y. Li, L. Puttagunta, J. E. Lee, S. Musat-Marcu, A. Ghahary, and R. Moqbel Cutting Edge: Human Eosinophils Regulate T Cell Subset Selection through Indoleamine 2,3-Dioxygenase J. Immunol., November 15, 2004; 173(10): 5909 - 5913. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Schmid-Grendelmeier, F. Altznauer, B. Fischer, C. Bizer, A. Straumann, G. Menz, K. Blaser, B. Wuthrich, and H.-U. Simon Eosinophils Express Functional IL-13 in Eosinophilic Inflammatory Diseases J. Immunol., July 15, 2002; 169(2): 1021 - 1027. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bandeira-Melo, K. Sugiyama, L. J. Woods, M. Phoofolo, D. M. Center, W. W. Cruikshank, and P. F. Weller IL-16 Promotes Leukotriene C4 and IL-4 Release from Human Eosinophils via CD4- and Autocrine CCR3-Chemokine-Mediated Signaling J. Immunol., May 1, 2002; 168(9): 4756 - 4763. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yagi, H. Nagai, Y. Iigo, T. Akimoto, T. Arai, and M. Kubo Development of Atopic Dermatitis-Like Skin Lesions in STAT6-Deficient NC/Nga Mice J. Immunol., February 15, 2002; 168(4): 2020 - 2027. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. MacKenzie, J. Mattes, L. A. Dent, and P. S. Foster Eosinophils Promote Allergic Disease of the Lung by Regulating CD4+ Th2 Lymphocyte Function J. Immunol., September 15, 2001; 167(6): 3146 - 3155. [Abstract] [Full Text] [PDF] |
||||
![]() |
M J Plummeridge, L Armstrong, M A Birchall, and A B Millar Reduced production of interleukin 12 by interferon gamma primed alveolar macrophages from atopic asthmatic subjects Thorax, October 1, 2000; 55(10): 842 - 847. [Abstract] [Full Text] |
||||
![]() |
R. Bheekha-Escura, D. W. MacGlashan Jr, J. M. Langdon, and S. M. MacDonald Human recombinant histamine-releasing factor activates human eosinophils and the eosinophilic cell line, AML14-3D10 Blood, September 15, 2000; 96(6): 2191 - 2198. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Al-Qaoud, E. Pearlman, T. Hartung, J. Klukowski, B. Fleischer, and A. Hoerauf A new mechanism for IL-5-dependent helminth control: neutrophil accumulation and neutrophil-mediated worm encapsulation in murine filariasis are abolished in the absence of IL-5 Int. Immunol., June 1, 2000; 12(6): 899 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. O. MAGNAN, L. G. MÉLY, C. A. CAMILLA, M. M. BADIER, F. A. MONTERO-JULIAN, C. M. GUILLOT, B. B. CASANO, S. J. PRATO, V. FERT, P. BONGRAND, et al. Assessment of the Th1/Th2 Paradigm in Whole Blood in Atopy and Asthma . Increased IFN-gamma -producing CD8+ T Cells in Asthma Am. J. Respir. Crit. Care Med., June 1, 2000; 161(6): 1790 - 1796. [Abstract] [Full Text] |
||||
![]() |
G. C. de Gast, H.-J. Klümpen, F. A. Vyth-Dreese, M.-J. Kersten, N. C. V. Verra, J. Sein, D. Batchelor, W. J. Nooijen, and J. H. Schornagel Phase I Trial of Combined Immunotherapy with Subcutaneous Granulocyte Macrophage Colony-stimulating Factor, Low-Dose Interleukin 2, and Interferon {{alpha}} in Progressive Metastatic Melanoma and Renal Cell Carcinoma Clin. Cancer Res., April 1, 2000; 6(4): 1267 - 1272. [Abstract] [Full Text] |
||||
![]() |
N. A. Lee and J. J. Lee The Macroimportance of the Pulmonary Immune Microenvironment Am. J. Respir. Cell Mol. Biol., September 1, 1999; 21(3): 298 - 302. [Full Text] |
||||
![]() |
G. Woerly, N. Roger, S. Loiseau, D. Dombrowicz, A. Capron, and M. Capron Expression of CD28 and CD86 by Human Eosinophils and Role in the Secretion of Type 1 Cytokines (Interleukin 2 and Interferon {gamma}): Inhibition by Immunoglobulin A Complexes J. Exp. Med., August 16, 1999; 190(4): 487 - 496. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Giembycz and M. A. Lindsay Pharmacology of the Eosinophil Pharmacol. Rev., June 1, 1999; 51(2): 213 - 340. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |