HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kong, Q. Articles by Maizels, N. Search for Related Content PubMed PubMed Citation Articles by Kong, Q. Articles by Maizels, N.

A 3' Enhancer Drives Active and Untemplated Somatic Hypermutation of a ₁ Transgene¹

Qingzhong Kong^*, Lisa Zhao^2,*, Sathish Subbaiah^3,* and Nancy Maizels^4,*,

Departments of ^* Molecular Biophysics and Biochemistry and Genetics, Yale University, New Haven, CT 06520

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Somatic hypermutation is a highly regulated process that targets mutations to the rearranged Ig genes. Little is known about the cis-elements required for somatic hypermutation of the light chain gene. We have studied somatic hypermutation of a rearranged ₁ transgene under the control of either a _2-4 or 3' enhancer. The mutations in the transgenes were analyzed by sequencing DNA amplified from hypermutating Peyer’s patch B cells. The results indicate that the 3' enhancer can drive active hypermutation of a ₁ transgene in Peyer’s patch cells. The ₁ transgene under analysis carried two marked V₂ genes immediately upstream that could serve as sequence donors in possible gene conversion events. There was no evidence of sequence transfer to the hypermutated ₁ gene, suggesting that gene conversion is not a major mechanism for somatic hypermutation in mice.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Somatic hypermutation is a regulated mutational process that introduces base substitutions into the rearranged and expressed Ig genes. In the mammalian immune response, hypermutation occurs after stimulation with Ag. It takes place in germinal centers, specialized microenvironments that are populated by Ag-activated B cells and where mutation is coupled with selection for cells that produce high affinity Abs (1, 2, 3). As a result of somatic hypermutation and selection, Ab affinity for Ag increases as much as 50-fold. The mutations introduced are mainly single base changes, and the rate of mutation is estimated to be about 1 mutation per kb per generation (4). Somatic hypermutation is targeted to a region of 1 to 2 kb in length between the promoter and intron enhancer/matrix attachment region of rearranged Ig genes (5). Hot spots for hypermutation have been identified in several reports (6, 7, 8, 9).

The underlying mechanism of somatic hypermutation is still a mystery (reviewed in 10–12). Hypermutation of Ig genes in chicken (13, 14), rabbit (15), and cattle (16) depends on a templated mutational process, or gene conversion. In sheep, hypermutation is nontemplated (17). The considerable similarities between templated and nontemplated processes of mutation (18) have prompted us (10, 19) and others (20) to present models for how diversification initiated by very similar events could lead to either templated or nontemplated mutation. Whether gene conversion plays a role in the hypermutation of murine Ig genes is controversial. It was recently reported that gene-conversion-like events occurred frequently in a murine heavy chain transgene carrying highly homologous templates that could serve as sequence donors (21), raising the possibility that proximity of donors might determine whether hypermutation involves gene conversion or other pathways.

Cis-elements are necessary to target rearranged Ig genes for somatic hypermutation (22). The best-studied examples are light chain genes, where research on transgenic mice has shown that the intron enhancer and 3' enhancer are both required for somatic hypermutation (reviewed in 9, 11; see also 22, 23). The promoter (24) and intron enhancer (25) appear to be important for hypermutation of the heavy chain genes, but the role of the 3' enhancer is not established at this locus (23, 26, 27).

Endogenous genes undergo very active hypermutation. The level of mutation of an endogenous ₁ gene is as high as 33 mutations/kb in splenic B cells of hyperimmunized mice (28), and 18 mutations/kb in Peyer’s patch B cells of unimmunized mice (29). However, active hypermutation of a ₁ transgene has not been documented. Previous work from our laboratory showed that a heavy chain promoter and a heavy chain intron enhancer could drive expression of a rearranged ₁ transgene, but that the expressed transgene did not hypermutate, despite the fact that the heavy chain genes in the same cells hypermutated at normal levels (30). Recently, Klotz and Storb reported that a rearranged ₂ transgene carrying the _2-4 enhancer underwent mutation in Peyer’s patch B cells (31). However, the level of mutation observed in those experiments was only 0.35 mutations/kb (31), barely above the PCR error level and about 48-fold below the mutation level for endogenous ₁ genes in Peyer’s patches (29).

We have generated transgene constructs that allow us to analyze activation of hypermutation of a rearranged ₁ gene by the and light chain 3' enhancers, and at the same time assay the contribution of gene conversion to somatic hypermutation in mice. The constructs carried V₂ regions marked with restriction site polymorphisms upstream of a rearranged V₁-J₁-C₁ region (Fig. 1). In the LZ14 construct, the 3' enhancer (E3')⁵ was cloned at a site 2.2 kb downstream of the C₁ region; and in the LZ15 construct, the 3' enhancer from the _2-4 region (E_2-4) was cloned at this site. Transgenic lines carrying the LZ14 (₁-E3') and LZ15 (₁-E_2-4) constructs were established, and the transgenes were shown to be expressed in B cells. Transgenic ₁ regions were PCR amplified from Peyer’s patch B cells, cloned, and sequenced. We found that the E_2-4 enhancer supported active somatic hypermutation of the ₁-E_2-4 transgene construct: the level of mutation within the V₁-J₁ region was 3.8 mutations/kb. In contrast, there was no evidence of hypermutation in mice carrying the ₁-E3' construct, showing that, at least in this one transgenic line, E3' did not support hypermutation. The observed spectrum of mutation in the ₁-E_2-4 mice was consistent with mutation resulting from hypermutation, but we found no evidence that hypermutation was templated by the adjacent V₂ regions. We conclude that a rearranged ₁ transgene can undergo active hypermutation, and that gene conversion is not a major mechanism for somatic hypermutation of the murine Ig loci.

View larger version (19K): [in this window] [in a new window]   FIGURE 1. The LZ14 and LZ15 1 transgenes. The two constructs are shown in the top two lines, and the region amplified for sequence analysis and the corresponding PCR and sequencing primers are shown below. Differentially shaded boxes, circles, and ovals represent specific elements of the constructs: the heavy chain promoter, PH; the heavy chain leader, LH; the rearranged 1 variable region, V1-J1; and the 1 constant region, C1. Two V2 segments, marked with distinct restriction site polymorphisms, were cloned upstream of the rearranged 1 gene to serve as templates for possible gene conversion events. Sequence polymorphisms in the marked V2 segments are shown in Figures 2 and 3. A kanamycin resistance gene (kanr) separated the V2 regions. The transgenes carried either the 3' enhancer (E3' in LZ14) or the 2-4 3' enhancer (E2-4 in LZ15) downstream of the C1 region.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

The ₁ transgenes (Fig. 1) were modified from the ₁ transgene construct described by Hengstschläger et al. (30). The rearranged V₁ region is derived from the murine B cell line, J558L. To facilitate transgene identification and analysis, the promoter and leader sequences of this ₁ gene were replaced with those of the heavy chain variable region of the V_H186.2 gene (32, 33); a T to C nucleotide substitution at the J₁-C₁ junction serves as another marker for the transgene. Two promoterless V₂ fragments, each marked with distinct restriction site polymorphisms, were cloned upstream of the rearranged ₁ gene to provide templates for possible gene conversion events. The heavy chain intron enhancer carried by the original construct was deleted, and either the 3' enhancer (E₃') or the _2-4 3' enhancer (E_2-4) was inserted 2.2 kb downstream of C₁, resulting in constructs LZ14 and LZ15, respectively. E3' was excised from the V41 clone (34; a generous gift of W. Garrard, University of Texas at Houston, Houston, TX) with XhoI and EcoRI, and inserted at the corresponding sites of pBluescript (Stratagene, La Jolla, CA). The SmaI site of the resulting plasmid was converted to a SalI site by linker ligation, and E3' excised by XhoI-SalI digestion and cloned into the SalI site 2.2 kb downstream of the C₁ region to create pLZ14. E_2-4 was amplified from BALB/c genomic DNA using specific primers with XhoI and SalI sites at the 5' ends, digested with these two restriction enzymes, and inserted at the same SalI site to create pLZ15. The transgene cassettes (8.9 and 8.3 kb, for pLZ14 and pLZ15, respectively) were released from the vector by digestion with NotI and SalI and microinjected into (C57BL/6 x SJL) F₁ x F₁-fertilized eggs at the Transgenic Mouse Unit of the Department of Comparative Medicine, Yale University School of Medicine, New Haven, CT. Transgenic mice were identified by PCR analysis using tail DNA as a template (see below).

Flow cytometry

Hypermutating B cells avidly bind PNA (peanut agglutinin) and can therefore be enriched by FACS separation of the B220⁺PNA^high and B220⁺PNA^low populations (35, 36). To prepare cell suspensions for FACS analysis, Peyer’s patches were collected from two 3-mo-old mice that had been raised in microisolators and transferred to ordinary mouse housing 10 days before sacrifice. Tissue was disaggregated by grinding with frosted glass slides in RPMI 1640 medium containing 5% FBS, cells washed twice with PBS, suspended in PBS at a concentration of 10⁷ cells/ml, and stained with fluorescence-labeled Abs for 30 min on ice. FITC-labeled PNA (FITC-PNA, EY Laboratory, San Mateo, CA) was used at a final concentration of 50 µg/ml; phycoerythrin (PE)-labeled anti-mouse B220/CD45R (PharMingen, San Diego, CA) at 1.3 µg/ml; and PE-labeled goat-anti-mouse (Southern Biotechnology Associates, Birmingham, AL) at 10 µg/ml. After staining, cells were washed twice with PBS and then suspended in RPMI 1640 medium containing 5% FBS. Cell sorting was performed using FACS-Vantage (Becton Dickinson, San Jose, CA).

For analysis of ₁ transgene expression in vivo, spleen cells from individual unimmunized mice were stained with the PE-labeled goat anti-mouse Ab, and the percentage of ⁺ cells was obtained through FACS analysis of 10⁴ cells.

Primers for PCR and sequencing

Vector primers used for sequencing were T7 (TCACTATAGGGCGAATTGGG) and SP6 (CGATTTAGGTGACACTATAG). Primers designed specifically for ₁ transgene amplification and sequencing are shown below, and their positions on the transgene are diagrammed in Figure 1. 7282, GGAATTCGGGTGACTGATGGCGAAG; 14260, AACCGAGCTCCAGGTGTTCCT; LF2, CAGTTACGGAGCACACAG; LR2, GTAGAAATCAGTGATCGTAC; LF3, GACCTCACCATGGGATGGAGC; LR3, ACAGGGTGACTGATGGCGAAG; LF4, CAATGCGCATCTTGTCTC; LR4, TCACCCAAATCTATGCC; LF7, TCTCATGGAGAAGGAAAACC.

PCR, cloning, and sequencing

Genomic DNA was prepared from mouse tail or FACS-sorted cells (37). The ₁ transgene was amplified using AmpliTaq DNA polymerase (Perkin-Elmer, Norwalk, CT) in a TwinBlock System Easycycler (Ericomp, San Diego, CA). To identify mice carrying the transgene, tail DNA (approximately 60 ng) from each 3-wk-old mouse was amplified by PCR in a 12-µl reaction containing 400 nM each of primers 14260 and 7282, 3 mM MgCl₂, 330 nM deoxynucleotide triphosphates (dNTPs), and 0.4 U of AmpliTaq polymerase. PCR was performed for 30 cycles at 94°C for 45 s, 58°C for 1 min, and 72°C for 1 min, with an initial denaturation at 94°C for 4 min and a final extension at 72°C for 7 min. The PCR products were then subjected to electrophoresis in a 1.2% agarose gel. A prominent 1.2-kb band was diagnostic of the ₁ transgene.

To amplify the ₁ transgene, DNA extracted from FACS-sorted B cells was subjected to two rounds of PCR amplification. The first round of PCR was performed in a 50 µl reaction containing 100 nM each of primers LF2 and LR2, 3 mM MgCl₂, 300 nM dNTPs, 3 U of AmpliTaq polymerase, and 10 ng of DNA. The thermal cycles were: 1 cycle at 95°C for 2 min, 52°C for 4 min, 72°C for 2 min; 34 cycles at 94°C for 45 sec, 52°C for 1 min, 72°C for 2 min; and 1 cycle at 72°C for 7 min. The product of the first round PCR was diluted 50-fold into a 50-µl reaction containing 200 nM each of primers LF3 and LR3, 3 mM MgCl₂, 300 nM dNTPs and 3 U of AmpliTaq polymerase, and further amplified by a second round of PCR (1 cycle at 94°C for 3 min; 35 cycles at 94°C for 45 sec, 62°C for 1 min, 72°C for 2 min; and 1 cycle at 72°C for 7 min). The final PCR products were separated on a 1.2% agarose gel, and the 1.6-kb ₁ transgene DNA was recovered from the gel slice and cloned into either the pGEM-T vector or the SmaI site of the pBluescript KS vector. The V₁-J₁ region and a portion of the J₁-C₁ intron were sequenced using cloned DNA as template and transgene primers LF4 and 14260; in some cases, vector primers T7 and SP6 were also used. Sequencing was performed using Sequenase 2.0 (USB, Cleveland, OH). In most cases, the region sequenced was 428-bp long and included the entire V₁-J₁ region and 100 bp from the J₁-C₁ intron.

We established lines carrying the LZ14 (LZ14-53) and LZ15 transgenes (LZ15-90) (Fig. 1). Quantitative PCR and Southern blot analysis of tail DNA from these mice revealed that LZ14-53 mice carried a single copy of the transgene, while LZ15-90 mice carried six to eight copies. To identify any mutations in germ-line DNA that might complicate subsequent analysis of hypermutation, the transgenes were PCR amplified from tail DNA, cloned, and 10 to 20 clones were sequenced for each line. Mutations found in the tail DNA clones were compared with those in PNA^high and PNA^low clones, and the number of transgene copies that carried the germ-line mutation(s) was estimated. This analysis revealed that, in the LZ15-90 mice, one copy of the LZ15 transgene contained two mutations in the second codon of CDR2 (GGT to AAT), and another copy contained a G to A transition mutation at position 45 of the J₁-C₁ intron. These mutations were excluded from future analysis. No germ-line mutations were evident in the LZ14-53 line.

PCR error level

AmpliTaq DNA polymerase is a modified version of Taq DNA polymerase, a low-fidelity polymerase (38). Significant levels of PCR errors were expected after 70 cycles of amplification with AmpliTaq, and it was essential to determine the PCR error level under these conditions. We did this by amplifying, cloning, and sequencing ₁ transgenes as described above. Using pLZ15 plasmid DNA as template, 34 mutations were identified in 19 kb sequenced (1.8 mutations/kb). Using tail DNA as template, 14 mutations were identified in a total of 8.4 kb sequenced (1.7 mutations/kb). Using DNA from LZ14-53 Peyer’s patch PNA^low B cells as template, 18 mutations were identified in 12.7 kb sequenced (1.4 mutations/kb; see Table I). The average PCR error level is therefore calculated to be 66 mutations/40.1 kb = 1.6 mutations/kb.

View this table: [in this window] [in a new window]   Table I. Mutation frequencies in the 1 transgenes1

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

As transcription may be a prerequisite to somatic hypermutation, it was important to establish that the transgenes were expressed in B cells. We have previously shown that ₁ transgene expression is reflected by the number of ⁺ B cells in transgenics compared with their nontransgenic littermates (39). We therefore assayed the fraction of splenic lymphocytes that expressed light chain by sorting cells following staining with anti- Abs. Background expression was determined by analysis of nontransgenic littermates and subtracted from the data. In young (24-day-old) mice of the single copy line, LZ14-53, an average of 4% of splenic cells were ⁺; this percentage increased to about 9% when the mice were 5 mo old. In the LZ15-90 line, an average of 22% splenic lymphocytes were ⁺ in young mice (24 days old), and this percentage did not increase significantly as the mice aged. We conclude that the ₁ transgenes were actively expressed in both LZ14-53 and LZ15-90 mice.

The 3' enhancer did not activate efficient hypermutation of the ₁ transgene in LZ14-53 transgenic mice

The LZ14-53 transgenic line carries a rearranged ₁ transgene and the E3' enhancer (Fig. 1). The ₁ transgene was PCR amplified, cloned, and sequenced from B220⁺PNA^high and B220⁺PNA^low Peyer’s patch cells from this line. In a total of 17,280 sequenced bases, 27 mutations were identified in 39 clones derived from PNA^high cell DNA. We calculate the mutation level to be 1.6 mutations/kb over the entire region sequenced, and 1.7 mutations/kb in the V₁-J₁ region (see Table I). These numbers are indistinguishable from either the mutation levels observed in clones derived from DNA from PNA^low cells from the same mice (1.4 mutations/kb overall and 1.7 mutations/kb in the V₁-J₁ region; see Table I), or the estimated PCR error level (1.6 mutations/kb; see Materials and Methods). Only 5 of 39 clones (13%) contained more than one mutation (Fig. 2), and no clonally related mutations were identified. These data indicate that most or all of the observed single base changes were probably PCR errors, and the ₁-E3' transgene did not undergo active hypermutation in the LZ14-53 mice.

View larger version (24K): [in this window] [in a new window]   FIGURE 2. Mutations in transgenes from line LZ14-53 (1-E3') PNAhigh Peyer’s patch B cells. A, Mutations in the V1-J1 region. B, Mutations in the J1-C1 intron. The sequence in the top line is of the unmutated transgenic V1-J1 region (A) or J1-C1 region (B); codons at which the two marked V2 fragments, V2B and V2X differ from the transgenic V1 region are shown below. The figure shows mutated sites in the 5 clones that contained two or more mutations; the 34 sequenced clones that contained one or no mutations are not shown. The three CDRs and the J1 region are underlined. Codon numbering is according to the system of Hengstschläger et al. (30), and the J1-C1 intron numbering according to the system of Motoyama et al. (42). Germline mutations were excluded, as described in the text. Dashes indicate identity, asterisks indicate deletions. The prefix "14/" in each clone number denotes that these clones were from the LZ14-53 line.

The _2-4 enhancer efficiently activates hypermutation of the ₁ transgene

The LZ15-90 transgenic line carries a rearranged ₁ transgene and the _2-4 enhancer. Sequence analysis of transgene DNA from Peyer’s patch B220⁺PNA^high cells of this line identified 69 mutations in a total of 19,372 sequenced bases. The level of mutation is therefore approximately 3.6 mutations/kb within the entire sequenced region and 5.4 mutations/kb in the V₁-J₁ region (Table I). Mutations were also observed within the leader and leader intron regions at a level of 3.6 mutations/kb (20 mutations in 5.6 kb sequenced; data not shown).

Figure 3 shows the mutations identified in clones from the Peyer’s patch B220⁺PNA^high cells of this line of transgenic mice. For simplicity, only the 14 clones that contained two or more mutations are included in this figure. Another 15 clones contained one or no mutations, and these were included in the calculation of mutation levels but are not shown in the figure. Among 20 clones amplified from B220⁺PNA^low cells from this same line, 20 mutations were found in 9,580 bases sequenced, representing an apparent mutation level of 2.4 mutations/kb overall and 2.3 mutations/kb in V₁-J₁ the region (Table I). Only 4 of these 20 clones contained more than one mutation (data not shown). The mutation level is therefore considerably lower in clones derived from PNA^low cells.

View larger version (48K): [in this window] [in a new window]   FIGURE 3. Mutations in transgenes from line LZ15-90 (1-E2-4) PNAhigh Peyer’s patch B cells. A, Mutations in the V1-J1 region. B, Mutations in the J1-C1 intron. The 14 clones with two or more mutations are included in the figure; 15 additional clones carrying one or no mutations are not shown. The prefix "15/" in each clone number denotes that these clones were from LZ15-90 mice. Other notations are as in Figure 2.

View larger version (23K): [in this window] [in a new window]   FIGURE 4. Frequency distribution of clones with respect to the number of mutations they carry. The number in each section of the circle denotes the number of mutations in a single clone, and the area of the section is proportional to the percentage of clones with that number of mutations.

The pattern of mutation of the ₁-E_2-4 transgene in Peyer’s patch cells resembles that of endogenous genes

Figure 5 diagrams the overall pattern of mutation of the ₁-E_2-4 transgene in PNA^high Peyer’s patch cells of LZ15-90 mice. Mutations were evident in the leader and leader intron, peaked within CDR1, and decreased downstream. This is a typical pattern of somatic hypermutation, similar to that observed in endogenous genes (4). The boundary of somatic hypermutation appears to be somewhere in the J₁-C₁ intron. Although a few mutations were evident near the C₁ region, the low level and type of mutation suggested that these were PCR errors. The intronic boundary for somatic hypermutation of the transgene is similar to that observed in endogenous and heavy chain genes (5). There were no clear mutational hot spots in the ₁ transgenes, although mutations clustered somewhat in CDR1. We found no signs of any mutational hot spots in the J₁-C₁ intron, which contrasts with one previous report (29).

View larger version (36K): [in this window] [in a new window]   FIGURE 5. Distribution of mutations within the 1-E2-4 transgene in PNAhigh Peyer’s patch cells. Mutation frequency (%) at each base is plotted against its position along the 1 transgene; data summarized are from Peyer’s patch PNAhigh cells from LZ15-90 mice. The regions corresponding to the leader, leader intron, three CDRs, and J1-C1 intron are shaded. Positions 752 to 1470 in the J1-C1 intron were not sequenced.

View larger version (26K): [in this window] [in a new window]   FIGURE 6. Common mutations define clonal relationships. A, Sequences of two groups of PCR clones from Peyer’s patch PNAhigh cells of LZ15-90 mice that appear to be clonally related. Only mutated sites are shown. Intron sequences and numbering are italicized. The leader codons are numbered with the last codon in the leader as "-1" and counting upstream. The leader intron sequence is numbered with the first base in the intron as 1. The VJ region codons are numbered as in Figure 2. The J-C intron sequences are numbered according to the germ-line 1 sequence in Reference 42, with the first base in the intron as number 1. Other notations are as in Figure 2. B, Diagram of the genealogic relationships in two groups of clones. Clone numbers are circled in the diagrams. An open circle denotes a presumed progenitor clone. The genealogic relationship within the group on the right is built on the assumption that the A to G transition mutation in codon 82 existed in the immediate progenitor to clones 15/23 and 15/24, but it was lost in clone 15/24. While 15/28 shares a single mutation with each group, to satisfy considerations of parsimony it is included in the group on the left because inclusion in the group on the right greatly complicates that genealogy.

Mutation of the ₁ transgene is not the result of gene conversion

The V₁ transgene construct carried two marked V₂ segments upstream of the rearranged V₁ region (Fig. 1) as potential sequence donors for gene conversion events. The polymorphisms in these V₂ segments, V₂B and V₂X, are shown in Figures 2 and 3. The hallmark of diversification by gene conversion is the presence of regions of sequence shared between donor and recipient. Examination of Figures 2 and 3 shows that only a single mutation matched a polymorphism in the V₂ sequences, an A to G transition mutation within CDR-2 in clone 15/17 (Fig. 3). We conclude that gene conversion did not play a significant role in the hypermutation process.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
We have shown that the _2-4 3' enhancer can target a rearranged ₁ transgene for active somatic hypermutation in murine Peyer’s patch B cells. A number of observations support the conclusion that this transgene underwent active and regulated hypermutation. The mutation level was considerably higher in PNA^high cells than in PNA^low cells. Mutations were mostly base substitutions with a few single base deletions. Mutations were targeted to the V₁-J₁ region (Fig. 5). Mutated V₁ regions in eight PNA^high clones could be classified into two clonally related groups (Fig. 6). No obvious strand bias was evident, nor did specific sequences appear to be hot spots for hypermutation.

That enhancers actively regulate transgene hypermutation was first shown by Betz et al. (22). In an analysis of transgene hypermutation in Peyer’s patch B cells, they observed the highest level of mutation in a transgene that carried both the intron (Ei) and E3' enhancers, and lower levels in constructs lacking either Ei or E3' (22, 35). (Table II summarizes mutation levels of these and several other transgene constructs.) The mutation level of the -Ei-E3' transgene was 12 mutations/kb. In comparison, the mutation level of the ₁-E_2-4 transgene we have studied is 3.8 mutations/kb (corrected for PCR error; see Table II). There is therefore a threefold difference between the hypermutation levels of the ₁-E_2-4 transgene and the -Ei-E3' transgene. The constructs that lacked either Ei or E3 mutated at significantly lower levels (see Table II). Mutation of both the ₁-E_2-4 transgene and the transgenes summarized in Table II was analyzed in Peyer’s patch B cells from unimmunized mice. Differences in mutation levels therefore do not reflect differences between cell types or immunization protocols, and instead probably reflect differences between the constructs themselves.

View this table: [in this window] [in a new window]   Table II. Mutation levels in and transgenes

Site of integration is well known to affect transgene expression, and it is possible that integration site may also affect hypermutation. In support of the possible effect of transgene position on hypermutation, we have shown that a ₁- E_2-4 transgene hypermutated actively; but when Klotz and Storb (31) analyzed hypermutation of a very similar ₂ transgene carrying the E_2-4 enhancer, they observed a much lower level of hypermutation (0.35 mutations/kb, corrected for PCR error; see Table II). Position effects are a plausible explanation for the difference between our results and theirs.

Our laboratory has previously assayed hypermutation of a ₁ transgene regulated by the heavy chain intron enhancer, Eµ (30). We found that, although the transgene was actively expressed, the mutation level was less than 0.2 mutations/kb (no mutations in 4279 bp of V regions sequence from 13 hybridomas). We interpreted this as evidence that this transgenic construct did not hypermutate in this line at levels significantly above background. Klotz and Storb also analyzed hypermutation of a ₂ transgene carrying the Eµ intron enhancer, and reported a level of 0.55 mutations/kb in Peyer’s patches (31), about 6-fold lower than the ₁-E_2-4 transgene we have analyzed and 21-fold lower than those observed for the actively hypermutating transgenes (22, 35). Both our own data (30) and the data presented by Klotz and Storb (31) argue that, if the Eµ intron enhancer does support hypermutation, it is at a very low level. However, Eµ has been reported to contribute significantly to hypermutation of a cognate transgene (27). This raises the interesting possibility that distinct factors may activate hypermutation at the different Ig loci, and that hypermutation depends on the presence of a cognate enhancer.

We also analyzed hypermutation in one line carrying a ₁-E3' transgene. The mutation level was not significantly above the background due to PCR error. As data on hypermutation of the ₁-E3' transgene represent only a single transgenic line, it would be premature to conclude that the E3' enhancer cannot activate transgene hypermutation. Analysis of additional ₁-E3' transgenic lines should provide additional insight into the question of whether hypermutation does require a cognate enhancer.

The light chain transgenes we have studied were designed to analyze the potential contribution of gene conversion to somatic hypermutation. They carried two marked V₂ regions just upstream of the rearranged V₁ region to serve as sequence donors in possible gene conversions. If these V₂ regions had been templates for gene conversion, the polymorphisms in the V₂ regions would have been transferred to the rearranged V₁. Although the ₁-E_2-4 construct hypermutated actively, it showed no evidence of gene conversion, despite the proximity of potential homologous donors. In contrast to these observations, Xu and Selsing have reported that gene conversion-like events contributed to hypermutation of a heavy chain transgene that carried homologous V_H region sequences (21). The differences between our results and those of Xu and Selsing (21) may be due to differences between the constructs examined. One possibility that has not been addressed is that V region replacement may have occurred in the constructs examined by Xu and Selsing (21). Analysis of additional constructs may clarify this issue.

	Acknowledgments

 
We thank Dr. W. Garrard, University of Texas at Houston, for his generous gift of the V41 clone, and Rocco Carbone for his help with FACS analysis.

	Footnotes

 
¹ This work was supported by National Institutes of Health Grant R01GM41712 to N.M.

² Present address: Lisa Zhao, Alexion Pharmaceuticals, Inc., New Haven, CT 06511.

³ Present address: Sathish Subbaiah, Health Science and Technology, Harvard Medical School, 260 Longwood Avenue, MEC 213, Boston, MA 02115.

⁴ Address correspondence and reprint requests to Dr. Nancy Maizels, Department of Molecular Biophysics and Biochemistry, Yale University, 266 Whitney Avenue, New Haven, CT 06520-8114.

⁵ Abbreviations used in this paper: E3', 3' enhancer; E_2-4, _2-4 3' enhancer; Eµ, heavy chain intron enhancer; PNA, peanut agglutinin; dNTPs, deoxynucleoside triphosphates; PE, phycoerythrin.

Received for publication November 10, 1997. Accepted for publication February 26, 1998.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. George, J., L. Claflin. 1992. Selection of B cell clones and memory B cells. Semin. Immunol. 4:11.[Medline]
2. Jacob, J., G. Kelsoe, K. Rajewsky, U. Weiss. 1991. Intraclonal generation of antibody mutants in germinal centers. Nature 354:389.[Medline]
3. Gray, D., H. Skarvall, Y.-J. Liu, I. C. M. MacLennan, T. Leanderson. 1990. Hypermutation and memory B cells: the role of germinal centers. E. J. Steele, ed. Somatic Hypermutation in V-Regions 83. CRC Press, Boca Raton, FL.
4. Gearhart, P. J., N. S. Levy. 1991. Kinetics and molecular model for somatic mutation in immunoglobulin variable genes. E. J. Steele, ed. Somatic Hypermutation in V-Regions 29. CRC Press, Boca Raton, FL.
5. Lebecque, S. G., P. J. Gearhart. 1990. Boundaries of somatic mutation in rearranged immunoglobulin genes: 5' boundary is near the promoter, and 3' boundary is 1 kb from V(D)J gene. J. Exp. Med. 172:1717.[Abstract/Free Full Text]
6. Betz, A. G., C. Rada, R. Pannell, C. Milstein, M. S. Neuberger. 1993. Passenger transgenes reveal intrinsic specificity of the antibody hypermutation mechanism: clustering, polarity, and specific hotspots. Proc. Natl. Acad. Sci. USA 90:2385.[Abstract/Free Full Text]
7. Betz, A. G., M. S. Neuberger, C. Milstein. 1993. Discriminating intrinsic and antigen-selected mutational hotspots in immunoglobulin V regions. Immunol. Today 14:405.[Medline]
8. Rogozin, I. B., N. A. Kolchanov. 1992. Somatic hypermutagenesis in immunoglobulin genes. II. Influence of neighbouring base sequences on mutagenesis. Biochem. Biophys. Acta 1171:11.[Medline]
9. Jolly, C. J., S. D. Wagner, C. Rada, N. Klix, C. Milstein, M. S. Neuberger. 1996. The targeting of somatic hypermutation. Semin. Immunol. 8:159.[Medline]
10. Kong, Q., R. S. Harris, N. Maizels. 1998. Recombination-based mechanisms for somatic hypermutation. Immunol. Rev. 162:67.[Medline]
11. Storb, U., A. Peters, E. Klotz, B. Rogerson, Jr J. Hackett. 1996. The mechanism of somatic hypermutation studied with transgenic and transfected target genes. Semin. Immunol. 8:131.[Medline]
12. Steele, E. J., H. S. Rothenfluh, R. V. Blanden. 1997. Mechanism of antigen-driven somatic hypermutation of rearranged immunoglobulin V(D)J genes in the mouse. Immunol. Cell Biol. 75:82.[Medline]
13. Reynaud, C. A., V. Anquez, H. Grimal, J. C. Weill. 1987. A hyperconversion mechanism generates the chicken light chain preimmune repertoire. Cell 48:379.[Medline]
14. Thompson, C. B., P. E. Neiman. 1987. Somatic diversification of the chicken immunoglobulin light chain gene is limited to the rearranged variable gene segment. Cell 48:369.[Medline]
15. Becker, R. S., K. L. Knight. 1990. Somatic diversification of immunoglobulin heavy chain VDJ genes: evidence from somatic gene conversion in rabbits. Cell 63:987.[Medline]
16. Parng, C.-L., S. Hansal, R. A. Goldsby, B. A. Osborne. 1996. Gene conversion contributes to Ig light chain diversity in cattle. J. Immunol. 157:5478.[Abstract]
17. Reynaud, C. A., C. R. Mackay, R. G. Muller, J. C. Weill. 1991. Somatic generation of diversity in a mammalian primary lymphoid organ: the sheep ileal Peyer’s patches. Cell 64:995.[Medline]
18. Maizels, N.. 1989. Might gene conversion be the mechanism of somatic hypermutation of mammalian immunoglobulin genes?. Trends Genet. 5:4.[Medline]
19. Maizels, N.. 1995. Somatic hypermutation: how many mechanisms diversify V region sequences?. Cell 83:9.[Medline]
20. Weill, J.-C., C.-A. Reynaud. 1996. Rearrangement/hypermutation/gene conversion: when, where and why?. Immunol. Today 17:92.[Medline]
21. Xu, B., E. Selsing. 1994. Analysis of sequence transfers resembling gene conversion in a mouse antibody transgene. Science 265:1590.[Abstract/Free Full Text]
22. Betz, A. G., C. Milstein, A. Gonzalez-Fernandez, R. Pannell, T. Larson, M. S. Neuberger. 1994. Elements regulating somatic hypermutation of an immunoglobulin gene: critical role for the intron enhancer/matrix attachment region. Cell 72:239.
23. Tumas-Brundage, K., K. A. Vora, A. M. Giusti, T. Manser. 1996. Characterization of the cis-acting elements required for somatic hypermutation of murine antibody V genes using conventional transgenic and transgene homologous recombination approaches. Semin. Immunol. 8:131.
24. Tumas-Brundage, K., T. Manser. 1997. The transcriptional promoter regulates hypermutation of the antibody heavy chain locus. J. Exp. Med. 185:239.[Abstract/Free Full Text]
25. Johnston, J. M., S. R. Ihyer, R. S. Smith, K. F. Tai, T. Farmer, S. J. Korsmeyer, N. L. Nadon, W. L. Carroll. 1996. Analysis of hypermutation in immunoglobulin heavy chain passenger transgenes. Eur. J. Immunol. 26:1058.[Medline]
26. Tumas-Brundage, K. M., K. A. Vora, T. Manser. 1997. Evaluation of the role of the 3' alpha heavy chain enhancer [3'alpha E(hs1, 2)] in V_H gene somatic hypermutation. Mol. Immunol. 34:367.[Medline]
27. Bachl, J., M. Wabl. 1996. Enhancers of hypermutation. Immunogenetics 45:59.[Medline]
28. Motoyama, N., T. Miwa, Y. Suzuki, H. Okada, T. Azuma. 1994. Comparison of somatic mutation frequency among immunoglobulin genes. J. Exp. Med. 179:395.[Abstract/Free Full Text]
29. Gonzalez-Fernandez, A., S. K. Gupta, R. Pannell, M. S. Neuberger, C. Milstein. 1994. Somatic mutation of immunoglobulin chains: a segment of the major intron hypermutates as much as the complementarity determining regions. Proc. Natl. Acad. Sci. USA 91:12614.[Abstract/Free Full Text]
30. Hengstschläger, M., M. Williams, N. Maizels. 1994. A 1 transgene under the control of a heavy chain promoter and enhancer does not undergo somatic hypermutation. Eur. J. Immunol. 24:1649.[Medline]
31. Klotz, E. L., U. Storb. 1996. Somatic hypermutation of a ₂ transgene under the control of the enhancer or the heavy chain intron enhancer. J. Immunol. 157:4458.[Abstract]
32. Krawinkel, U., G. Zoebelein, A. L. M. Bothwell. 1986. Palindromic sequences are associated with sites of DNA breakage during gene conversion. Nucleic Acids Res. 14:3871.[Abstract/Free Full Text]
33. Leung, H., N. Maizels. 1992. Transcriptional regulatory elements stimulate recombination in extrachromosomal substrates carrying immunoglobulin switch-region sequence. Proc. Natl. Acad. Sci. USA 89:4154.[Abstract/Free Full Text]
34. Blasquez, V., M. Xu, S. C. Moses, W. T. Garrard. 1989. Immunoglobulin gene expression after stable integration. I. Role of the intronic MAR and enhancer in plasmacytoma cells. J. Biol. Chem. 264:21183.[Abstract/Free Full Text]
35. Gonzalez-Fernandez, A., C. Milstein. 1993. Analysis of somatic hypermutation in mouse Peyer’s patches using immunoglobulin light-chain transgenes. Proc. Natl. Acad. Sci. USA 90:9862.[Abstract/Free Full Text]
36. Rogerson, B. J.. 1995. Somatic hypermutation of V_HS107 genes is not associated with gene conversion among family members. Int. Immunol. 7:1225.[Abstract/Free Full Text]
37. Hogan, B., F. Constantini, E. Lacy. 1986. An alternative protocol for isolat- ing high-molecular-weight DNA from mouse tails. Manipulating the Mouse Embryo: A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
38. Jacob, J., J. Przylepa, C. Miller, G. Kelsoe. 1993. In situ studies of the primary immune response to (4-hydroxyl-3-nitrophenyl)acetyl. III. The kinetics of V region mutation and selection in germinal center B cells. J. Exp. Med. 178:1293.[Abstract/Free Full Text]
39. Hengstschläger, M., N. Maizels. 1995. Isotype exclusion in 1 transgenic mice depends on transgene copy number and diminishes with down-regulation of transgene transcripts. Eur. J. Immunol. 25:187.[Medline]
40. Kocks, C., K. Rajewsky. 1988. Stepwise intraclonal maturation of antibody affinity through somatic hypermutation. Proc. Natl. Acad. Sci. USA 85:8206.[Abstract/Free Full Text]
41. Hagman, J., C. M. Rudin, D. Haasch, D. Chaplin, U. Storb. 1990. A novel enhancer in the immunoglobulin lambda locus is duplicated and functionally independent of NF kappa B. Genes Dev. 4:978.[Abstract/Free Full Text]
42. Motoyama, N., O. Hidechika, A. Takachika. 1991. Somatic mutation in the constant regions of mouse 1 light chain. Proc. Natl. Acad. Sci. USA 88:7933.[Abstract/Free Full Text]

This article has been cited by other articles:

				K. Malecek, J. Brandman, J. E. Brodsky, Y. Ohta, M. F. Flajnik, and E. Hsu Somatic Hypermutation and Junctional Diversification at Ig Heavy Chain Loci in the Nurse Shark J. Immunol., December 15, 2005; 175(12): 8105 - 8115. [Abstract] [Full Text] [PDF]

				N. D'Avirro, D. Truong, B. Xu, and E. Selsing Sequence Transfers between Variable Regions in a Mouse Antibody Transgene Can Occur by Gene Conversion J. Immunol., December 15, 2005; 175(12): 8133 - 8137. [Abstract] [Full Text] [PDF]

				H.-F. Tsai, N. D'Avirro, and E. Selsing Gene conversion-like sequence transfers in a mouse antibody transgene: antigen selection allows sensitive detection of V region interactions based on homology Int. Immunol., January 1, 2002; 14(1): 55 - 64. [Abstract] [Full Text] [PDF]

				Q. Kong and N. Maizels DNA Breaks in Hypermutating Immunoglobulin Genes: Evidence for a Break-and-Repair Pathway of Somatic Hypermutation Genetics, May 1, 2001; 158(1): 369 - 378. [Abstract] [Full Text]

				Q. Kong and N. Maizels Breaksite batch mapping, a rapid method for assay and identification of DNA breaksites in mammalian cells Nucleic Acids Res., March 15, 2001; 29(6): e33 - e33. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kong, Q. Articles by Maizels, N. Search for Related Content PubMed PubMed Citation Articles by Kong, Q. Articles by Maizels, N.