|
|
||||||||
3' Enhancer Drives Active and Untemplated Somatic Hypermutation of a
1 Transgene1

Departments of
*
Molecular Biophysics and Biochemistry and
Genetics, Yale University, New Haven, CT 06520
| Abstract |
|---|
|
|
|---|
light chain gene. We have studied somatic hypermutation of a
rearranged
1 transgene under the control of either a
2-4 or
3' enhancer. The mutations in the transgenes
were analyzed by sequencing DNA amplified from hypermutating Peyers
patch B cells. The results indicate that the
3' enhancer can drive
active hypermutation of a
1 transgene in Peyers patch
cells. The
1 transgene under analysis carried two marked
V
2 genes immediately upstream that could serve as
sequence donors in possible gene conversion events. There was no
evidence of sequence transfer to the hypermutated
1
gene, suggesting that gene conversion is not a major mechanism for
somatic hypermutation in mice. | Introduction |
|---|
|
|
|---|
The underlying mechanism of somatic hypermutation is still a mystery (reviewed in 1012). Hypermutation of Ig genes in chicken (13, 14), rabbit (15), and cattle (16) depends on a templated mutational process, or gene conversion. In sheep, hypermutation is nontemplated (17). The considerable similarities between templated and nontemplated processes of mutation (18) have prompted us (10, 19) and others (20) to present models for how diversification initiated by very similar events could lead to either templated or nontemplated mutation. Whether gene conversion plays a role in the hypermutation of murine Ig genes is controversial. It was recently reported that gene-conversion-like events occurred frequently in a murine heavy chain transgene carrying highly homologous templates that could serve as sequence donors (21), raising the possibility that proximity of donors might determine whether hypermutation involves gene conversion or other pathways.
Cis-elements are necessary to target rearranged Ig genes for
somatic hypermutation (22). The best-studied examples are
light
chain genes, where research on transgenic mice has shown that the
intron enhancer and 3' enhancer are both required for somatic
hypermutation (reviewed in 9, 11; see also 22, 23). The promoter (24)
and intron enhancer (25) appear to be important for hypermutation of
the heavy chain genes, but the role of the 3' enhancer is not
established at this locus (23, 26, 27).
Endogenous
genes undergo very active hypermutation. The level of
mutation of an endogenous
1 gene is as high as 33
mutations/kb in splenic B cells of hyperimmunized mice (28), and 18
mutations/kb in Peyers patch B cells of unimmunized mice (29).
However, active hypermutation of a
1 transgene has not
been documented. Previous work from our laboratory showed that a heavy
chain promoter and a heavy chain intron enhancer could drive expression
of a rearranged
1 transgene, but that the expressed
transgene did not hypermutate, despite the fact that the heavy chain
genes in the same cells hypermutated at normal levels (30). Recently,
Klotz and Storb reported that a rearranged
2 transgene
carrying the
2-4 enhancer underwent mutation in Peyers
patch B cells (31). However, the level of mutation observed in those
experiments was only 0.35 mutations/kb (31), barely above the PCR error
level and about 48-fold below the mutation level for endogenous
1 genes in Peyers patches (29).
We have generated transgene constructs that allow us to analyze
activation of hypermutation of a rearranged
1 gene by
the
and
light chain 3' enhancers, and at the same time assay
the contribution of gene conversion to somatic hypermutation in mice.
The constructs carried V
2 regions marked with
restriction site polymorphisms upstream of a rearranged
V
1-J
1-C
1 region (Fig. 1
). In the LZ14 construct, the
3'
enhancer (E
3')5 was cloned
at a site 2.2 kb downstream of the C
1 region; and in the
LZ15 construct, the 3' enhancer from the
2-4 region
(E
2-4) was cloned at this site. Transgenic lines
carrying the LZ14 (
1-E
3') and LZ15
(
1-E
2-4) constructs were established, and
the transgenes were shown to be expressed in B cells. Transgenic
1 regions were PCR amplified from Peyers patch B
cells, cloned, and sequenced. We found that the E
2-4
enhancer supported active somatic hypermutation of the
1-E
2-4 transgene construct: the level of
mutation within the V
1-J
1 region was 3.8
mutations/kb. In contrast, there was no evidence of hypermutation in
mice carrying the
1-E
3' construct, showing that, at
least in this one transgenic line, E
3' did not support
hypermutation. The observed spectrum of mutation in the
1-E
2-4 mice was consistent with mutation
resulting from hypermutation, but we found no evidence that
hypermutation was templated by the adjacent V
2
regions. We conclude that a rearranged
1 transgene can
undergo active hypermutation, and that gene conversion is not a major
mechanism for somatic hypermutation of the murine Ig loci.
|
| Materials and Methods |
|---|
|
|
|---|
The
1 transgenes (Fig. 1
) were modified from
the
1 transgene construct described by
Hengstschläger et al. (30). The rearranged V
1
region is derived from the murine B cell line, J558L. To facilitate
transgene identification and analysis, the promoter and leader
sequences of this
1 gene were replaced with those of the
heavy chain variable region of the VH186.2 gene (32, 33); a
T to C nucleotide substitution at the
J
1-C
1 junction serves as another marker
for the transgene. Two promoterless V
2 fragments, each
marked with distinct restriction site polymorphisms, were cloned
upstream of the rearranged
1 gene to provide templates
for possible gene conversion events. The heavy chain intron enhancer
carried by the original construct was deleted, and either the
3'
enhancer (E
3') or the
2-4 3' enhancer
(E
2-4) was inserted 2.2 kb downstream of
C
1, resulting in constructs LZ14 and LZ15, respectively.
E
3' was excised from the V
41 clone (34; a generous gift of W.
Garrard, University of Texas at Houston, Houston, TX) with
XhoI and EcoRI, and inserted at the corresponding
sites of pBluescript (Stratagene, La Jolla, CA). The SmaI
site of the resulting plasmid was converted to a SalI site
by linker ligation, and E
3' excised by
XhoI-SalI digestion and cloned into the
SalI site 2.2 kb downstream of the C
1 region
to create pLZ14. E
2-4 was amplified from BALB/c genomic
DNA using specific primers with XhoI and SalI
sites at the 5' ends, digested with these two restriction enzymes, and
inserted at the same SalI site to create pLZ15. The
transgene cassettes (8.9 and 8.3 kb, for pLZ14 and pLZ15, respectively)
were released from the vector by digestion with NotI and
SalI and microinjected into (C57BL/6 x SJL)
F1 x F1-fertilized eggs at the Transgenic
Mouse Unit of the Department of Comparative Medicine, Yale University
School of Medicine, New Haven, CT. Transgenic mice were identified by
PCR analysis using tail DNA as a template (see below).
Flow cytometry
Hypermutating B cells avidly bind PNA (peanut agglutinin) and
can therefore be enriched by FACS separation of the
B220+PNAhigh and
B220+PNAlow populations (35, 36). To prepare
cell suspensions for FACS analysis, Peyers patches were collected
from two 3-mo-old mice that had been raised in microisolators and
transferred to ordinary mouse housing 10 days before sacrifice. Tissue
was disaggregated by grinding with frosted glass slides in RPMI 1640
medium containing 5% FBS, cells washed twice with PBS, suspended in
PBS at a concentration of 107 cells/ml, and stained with
fluorescence-labeled Abs for 30 min on ice. FITC-labeled PNA (FITC-PNA,
EY Laboratory, San Mateo, CA) was used at a final concentration of 50
µg/ml; phycoerythrin (PE)-labeled anti-mouse B220/CD45R
(PharMingen, San Diego, CA) at 1.3 µg/ml; and PE-labeled
goat-anti-mouse
(Southern Biotechnology Associates, Birmingham,
AL) at 10 µg/ml. After staining, cells were washed twice with PBS and
then suspended in RPMI 1640 medium containing 5% FBS. Cell sorting was
performed using FACS-Vantage (Becton Dickinson, San Jose, CA).
For analysis of
1 transgene expression in vivo, spleen
cells from individual unimmunized mice were stained with the PE-labeled
goat anti-mouse
Ab, and the percentage of
+
cells was obtained through FACS analysis of 104 cells.
Primers for PCR and sequencing
Vector primers used for sequencing were T7
(TCACTATAGGGCGAATTGGG) and SP6 (CGATTTAGGTGACACTATAG). Primers
designed specifically for
1 transgene amplification
and sequencing are shown below, and their positions on the transgene
are diagrammed in Figure 1
. 7282, GGAATTCGGGTGACTGATGGCGAAG; 14260,
AACCGAGCTCCAGGTGTTCCT; LF2, CAGTTACGGAGCACACAG; LR2,
GTAGAAATCAGTGATCGTAC; LF3, GACCTCACCATGGGATGGAGC; LR3,
ACAGGGTGACTGATGGCGAAG; LF4, CAATGCGCATCTTGTCTC; LR4,
TCACCCAAATCTATGCC; LF7, TCTCATGGAGAAGGAAAACC.
PCR, cloning, and sequencing
Genomic DNA was prepared from mouse tail or FACS-sorted cells
(37). The
1 transgene was amplified using AmpliTaq
DNA polymerase (Perkin-Elmer, Norwalk, CT) in a TwinBlock System
Easycycler (Ericomp, San Diego, CA). To identify mice carrying the
transgene, tail DNA (approximately 60 ng) from each 3-wk-old mouse was
amplified by PCR in a 12-µl reaction containing 400 nM each of
primers 14260 and 7282, 3 mM MgCl2, 330 nM
deoxynucleotide triphosphates (dNTPs), and 0.4 U of AmpliTaq
polymerase. PCR was performed for 30 cycles at 94°C for 45 s,
58°C for 1 min, and 72°C for 1 min, with an initial denaturation at
94°C for 4 min and a final extension at 72°C for 7 min. The PCR
products were then subjected to electrophoresis in a 1.2% agarose gel.
A prominent 1.2-kb band was diagnostic of the
1
transgene.
To amplify the
1 transgene, DNA extracted from
FACS-sorted B cells was subjected to two rounds of PCR amplification.
The first round of PCR was performed in a 50 µl reaction containing
100 nM each of primers LF2 and LR2, 3 mM MgCl2, 300 nM
dNTPs, 3 U of AmpliTaq polymerase, and
10 ng of DNA. The thermal
cycles were: 1 cycle at 95°C for 2 min, 52°C for 4 min, 72°C for
2 min; 34 cycles at 94°C for 45 sec, 52°C for 1 min, 72°C for 2
min; and 1 cycle at 72°C for 7 min. The product of the first round
PCR was diluted 50-fold into a 50-µl reaction containing 200 nM each
of primers LF3 and LR3, 3 mM MgCl2, 300 nM dNTPs and 3 U of
AmpliTaq polymerase, and further amplified by a second round of PCR (1
cycle at 94°C for 3 min; 35 cycles at 94°C for 45 sec, 62°C for 1
min, 72°C for 2 min; and 1 cycle at 72°C for 7 min). The final PCR
products were separated on a 1.2% agarose gel, and the 1.6-kb
1 transgene DNA was recovered from the gel slice and
cloned into either the pGEM-T vector or the SmaI site of the
pBluescript KS vector. The V
1-J
1 region
and a portion of the J
1-C
1 intron were
sequenced using cloned DNA as template and transgene primers LF4 and
14260; in some cases, vector primers T7 and SP6 were also used.
Sequencing was performed using Sequenase 2.0 (USB, Cleveland, OH). In
most cases, the region sequenced was 428-bp long and included the
entire V
1-J
1 region and 100 bp from the
J
1-C
1 intron.
We established lines carrying the LZ14 (LZ14-53) and LZ15 transgenes
(LZ15-90) (Fig. 1
). Quantitative PCR and Southern blot analysis of tail
DNA from these mice revealed that LZ14-53 mice carried a single copy of
the transgene, while LZ15-90 mice carried six to eight copies. To
identify any mutations in germ-line DNA that might complicate
subsequent analysis of hypermutation, the transgenes were PCR amplified
from tail DNA, cloned, and 10 to 20 clones were sequenced for each
line. Mutations found in the tail DNA clones were compared with those
in PNAhigh and PNAlow clones, and the number of
transgene copies that carried the germ-line mutation(s) was estimated.
This analysis revealed that, in the LZ15-90 mice, one copy of the LZ15
transgene contained two mutations in the second codon of CDR2
(GGT to AAT), and another copy contained a G
to A transition mutation at position 45 of the
J
1-C
1 intron. These mutations were
excluded from future analysis. No germ-line mutations were evident in
the LZ14-53 line.
PCR error level
AmpliTaq DNA polymerase is a modified version of Taq
DNA polymerase, a low-fidelity polymerase (38). Significant levels of
PCR errors were expected after 70 cycles of amplification with
AmpliTaq, and it was essential to determine the PCR error level under
these conditions. We did this by amplifying, cloning, and sequencing
1 transgenes as described above. Using pLZ15 plasmid DNA
as template, 34 mutations were identified in 19 kb sequenced (1.8
mutations/kb). Using tail DNA as template, 14 mutations were identified
in a total of 8.4 kb sequenced (1.7 mutations/kb). Using DNA from
LZ14-53 Peyers patch PNAlow B cells as template, 18
mutations were identified in 12.7 kb sequenced (1.4 mutations/kb; see
Table I
). The average PCR error level is
therefore calculated to be 66 mutations/40.1 kb = 1.6
mutations/kb.
|
| Results |
|---|
|
|
|---|
As transcription may be a prerequisite to somatic hypermutation,
it was important to establish that the transgenes were expressed in B
cells. We have previously shown that
1 transgene
expression is reflected by the number of
+ B cells in
transgenics compared with their nontransgenic littermates (39). We
therefore assayed the fraction of splenic lymphocytes that expressed
light chain by sorting cells following staining with anti-
Abs. Background expression was determined by analysis of nontransgenic
littermates and subtracted from the data. In young (24-day-old) mice of
the single copy line, LZ14-53, an average of 4% of splenic cells were
+; this percentage increased to about 9% when the mice
were 5 mo old. In the LZ15-90 line, an average of 22% splenic
lymphocytes were
+ in young mice (24 days old), and this
percentage did not increase significantly as the mice aged. We conclude
that the
1 transgenes were actively expressed in both
LZ14-53 and LZ15-90 mice.
The
3' enhancer did not activate efficient hypermutation of the
1 transgene in LZ14-53 transgenic mice
The LZ14-53 transgenic line carries a rearranged
1 transgene and the E
3' enhancer (Fig. 1
). The
1 transgene was PCR amplified, cloned, and sequenced
from B220+PNAhigh and
B220+PNAlow Peyers patch cells from this
line. In a total of 17,280 sequenced bases, 27 mutations were
identified in 39 clones derived from PNAhigh cell DNA. We
calculate the mutation level to be 1.6 mutations/kb over the entire
region sequenced, and 1.7 mutations/kb in the
V
1-J
1 region (see Table I
). These numbers
are indistinguishable from either the mutation levels observed in
clones derived from DNA from PNAlow cells from the same
mice (1.4 mutations/kb overall and 1.7 mutations/kb in the
V
1-J
1 region; see Table I
), or the
estimated PCR error level (1.6 mutations/kb; see Materials and
Methods). Only 5 of 39 clones (13%) contained more than
one mutation (Fig. 2
), and no clonally
related mutations were identified. These data indicate that most or all
of the observed single base changes were probably PCR errors, and the
1-E
3' transgene did not undergo active hypermutation
in the LZ14-53 mice.
|
2-4 enhancer efficiently activates
hypermutation of the
1 transgene
The LZ15-90 transgenic line carries a rearranged
1 transgene and the
2-4 enhancer.
Sequence analysis of transgene DNA from Peyers patch
B220+PNAhigh cells of this line identified 69
mutations in a total of 19,372 sequenced bases. The level of mutation
is therefore approximately 3.6 mutations/kb within the entire sequenced
region and 5.4 mutations/kb in the V
1-J
1
region (Table I
). Mutations were also observed within the leader and
leader intron regions at a level of 3.6 mutations/kb (20 mutations in
5.6 kb sequenced; data not shown).
Figure 3
shows the mutations identified
in clones from the Peyers patch B220+PNAhigh
cells of this line of transgenic mice. For simplicity, only the 14
clones that contained two or more mutations are included in this
figure. Another 15 clones contained one or no mutations, and these were
included in the calculation of mutation levels but are not shown in the
figure. Among 20 clones amplified from
B220+PNAlow cells from this same line, 20
mutations were found in 9,580 bases sequenced, representing an apparent
mutation level of 2.4 mutations/kb overall and 2.3 mutations/kb in
V
1-J
1 the region (Table I
). Only 4 of
these 20 clones contained more than one mutation (data not shown). The
mutation level is therefore considerably lower in clones derived from
PNAlow cells.
|
1-J
1 region in LZ15-90 mice is the
highest level of mutation reported for a
transgene. It is
significantly higher than both the estimated PCR error level of 1.6
mutations/kb and the mutation level in PNAlow clones from
the same mice. Furthermore, the fraction of clones from
PNAhigh cells of LZ15-90 mice that contained at least 2
mutations was 48%, while among clones from PNAlow cells
this fraction was only 20% (Fig. 4
1 transgene underwent
active hypermutation in Peyers patch cells of LZ15-90 mice.
|
1-E
2-4 transgene in Peyers patch
cells resembles that of endogenous genes
Figure 5
diagrams the overall
pattern of mutation of the
1-E
2-4
transgene in PNAhigh Peyers patch cells of LZ15-90 mice.
Mutations were evident in the leader and leader intron, peaked within
CDR1, and decreased downstream. This is a typical pattern of somatic
hypermutation, similar to that observed in endogenous genes (4). The
boundary of somatic hypermutation appears to be somewhere in the
J
1-C
1 intron. Although a few mutations
were evident near the C
1 region, the low level and type
of mutation suggested that these were PCR errors. The intronic boundary
for somatic hypermutation of the transgene is similar to that observed
in endogenous
and heavy chain genes (5). There were no clear
mutational hot spots in the
1 transgenes, although
mutations clustered somewhat in CDR1. We found no signs of any
mutational hot spots in the J
1-C
1 intron,
which contrasts with one previous report (29).
|
1-E
2-4 transgenes underwent
active somatic hypermutation in Peyers patch cells of LZ15-90
mice.
|
1 transgene is not the result
of gene conversion
The V
1 transgene construct carried two marked
V
2 segments upstream of the rearranged V
1
region (Fig. 1
) as potential sequence donors for gene conversion
events. The polymorphisms in these V
2 segments,
V
2B and V
2X, are shown in Figures 2
and 3
. The hallmark of diversification by gene conversion is the presence
of regions of sequence shared between donor and recipient. Examination
of Figures 2
and 3
shows that only a single mutation matched a
polymorphism in the V
2 sequences, an A to G transition
mutation within CDR-2 in clone 15/17 (Fig. 3
). We conclude that gene
conversion did not play a significant role in the hypermutation
process.
| Discussion |
|---|
|
|
|---|
2-4 3' enhancer can
target a rearranged
1 transgene for active somatic
hypermutation in murine Peyers patch B cells. A number of
observations support the conclusion that this transgene underwent
active and regulated hypermutation. The mutation level was considerably
higher in PNAhigh cells than in PNAlow cells.
Mutations were mostly base substitutions with a few single base
deletions. Mutations were targeted to the
V
1-J
1 region (Fig. 5
1 regions in eight PNAhigh clones could be
classified into two clonally related groups (Fig. 6
That enhancers actively regulate transgene hypermutation was first
shown by Betz et al. (22). In an analysis of
transgene
hypermutation in Peyers patch B cells, they observed the highest
level of mutation in a transgene that carried both the
intron
(E
i) and E
3' enhancers, and lower levels in constructs lacking
either E
i or E
3' (22, 35). (Table II
summarizes mutation levels of these
and several other transgene constructs.) The mutation level of the
-E
i-E
3' transgene was 12 mutations/kb. In comparison, the
mutation level of the
1-E
2-4 transgene we
have studied is 3.8 mutations/kb (corrected for PCR error; see Table II
). There is therefore a threefold difference between the
hypermutation levels of the
1-E
2-4
transgene and the
-E
i-E
3' transgene. The
constructs that
lacked either E
i or E
3 mutated at significantly lower levels (see
Table II
). Mutation of both the
1-E
2-4
transgene and the
transgenes summarized in Table II
was analyzed in
Peyers patch B cells from unimmunized mice. Differences in mutation
levels therefore do not reflect differences between cell types or
immunization protocols, and instead probably reflect differences
between the constructs themselves.
|
1 gene in Peyers
patch B cells has been reported to be approximately 18 mutations/kb
(29). This is about 4.5-fold higher than the level of mutation we
observed in our analysis of the
1-E
2-4
transgene. This difference suggests that an important (but not
absolutely essential) regulatory element or elements may be absent from
the transgene construct. In support of this possibility, we note that,
as discussed above, two different regulatory elements from the
locus have been shown to activate transgene hypermutation, and deletion
of either diminished hypermutation (22, 35). The endogenous
2-4 3' enhancer is located 15.5 kb downstream from the
C
4 region (41), and there may be an additional
regulatory element that stimulates hypermutation located either
upstream or downstream of it. If there is an additional regulatory
element for hypermutation at the
locus, its inclusion might augment
transgene hypermutation.
Site of integration is well known to affect transgene expression, and
it is possible that integration site may also affect hypermutation. In
support of the possible effect of transgene position on hypermutation,
we have shown that a
1- E
2-4 transgene
hypermutated actively; but when Klotz and Storb (31) analyzed
hypermutation of a very similar
2 transgene carrying the
E
2-4 enhancer, they observed a much lower level of
hypermutation (0.35 mutations/kb, corrected for PCR error; see Table II
). Position effects are a plausible explanation for the difference
between our results and theirs.
Our laboratory has previously assayed hypermutation of a
1 transgene regulated by the heavy chain intron
enhancer, Eµ (30). We found that, although the transgene was actively
expressed, the mutation level was less than 0.2 mutations/kb (no
mutations in 4279 bp of V regions sequence from 13 hybridomas). We
interpreted this as evidence that this transgenic construct did not
hypermutate in this line at levels significantly above
background. Klotz and Storb also analyzed hypermutation of a
2 transgene carrying the Eµ intron enhancer, and
reported a level of 0.55 mutations/kb in Peyers patches (31), about
6-fold lower than the
1-E
2-4 transgene we
have analyzed and 21-fold lower than those observed for the actively
hypermutating
transgenes (22, 35). Both our own data (30) and the
data presented by Klotz and Storb (31) argue that, if the Eµ intron
enhancer does support hypermutation, it is at a very low level.
However, Eµ has been reported to contribute significantly to
hypermutation of a cognate transgene (27). This raises the interesting
possibility that distinct factors may activate hypermutation at the
different Ig loci, and that hypermutation depends on the presence of a
cognate enhancer.
We also analyzed hypermutation in one line carrying a
1-E
3' transgene. The mutation level was not
significantly above the background due to PCR error. As data on
hypermutation of the
1-E
3' transgene represent only a
single transgenic line, it would be premature to conclude that the
E
3' enhancer cannot activate transgene hypermutation. Analysis of
additional
1-E
3' transgenic lines should provide
additional insight into the question of whether hypermutation does
require a cognate enhancer.
The
light chain transgenes we have studied were designed to analyze
the potential contribution of gene conversion to somatic hypermutation.
They carried two marked V
2 regions just upstream of the
rearranged V
1 region to serve as sequence donors in
possible gene conversions. If these V
2 regions had been
templates for gene conversion, the polymorphisms in the
V
2 regions would have been transferred to the rearranged
V
1. Although the
1-E
2-4
construct hypermutated actively, it showed no evidence of gene
conversion, despite the proximity of potential homologous donors. In
contrast to these observations, Xu and Selsing have reported that gene
conversion-like events contributed to hypermutation of a heavy chain
transgene that carried homologous VH region sequences (21).
The differences between our results and those of Xu and Selsing (21)
may be due to differences between the constructs examined. One
possibility that has not been addressed is that V region replacement
may have occurred in the constructs examined by Xu and Selsing (21).
Analysis of additional constructs may clarify this issue.
| Acknowledgments |
|---|
41 clone, and Rocco Carbone for his
help with FACS analysis. | Footnotes |
|---|
2 Present address: Lisa Zhao, Alexion Pharmaceuticals, Inc., New Haven, CT 06511. ![]()
3 Present address: Sathish Subbaiah, Health Science and Technology, Harvard Medical School, 260 Longwood Avenue, MEC 213, Boston, MA 02115. ![]()
4 Address correspondence and reprint requests to Dr. Nancy Maizels, Department of Molecular Biophysics and Biochemistry, Yale University, 266 Whitney Avenue, New Haven, CT 06520-8114. ![]()
5 Abbreviations used in this paper: E
3',
3' enhancer; E
2-4,
2-4 3' enhancer; Eµ, heavy chain intron enhancer; PNA, peanut agglutinin; dNTPs, deoxynucleoside triphosphates; PE, phycoerythrin. ![]()
Received for publication November 10, 1997. Accepted for publication February 26, 1998.
| References |
|---|
|
|
|---|
1 kb from V(D)J gene. J. Exp. Med. 172:1717.
gene: critical role for the intron enhancer/matrix attachment region. Cell 72:239.
chains: a segment of the major intron hypermutates as much as the complementarity determining regions. Proc. Natl. Acad. Sci. USA 91:12614.
1 transgene under the control of a heavy chain promoter and enhancer does not undergo somatic hypermutation. Eur. J. Immunol. 24:1649.[Medline]
2 transgene under the control of the
enhancer or the heavy chain intron enhancer. J. Immunol. 157:4458.[Abstract]
gene expression after stable integration. I. Role of the intronic MAR and enhancer in plasmacytoma cells. J. Biol. Chem. 264:21183.
light-chain transgenes. Proc. Natl. Acad. Sci. USA 90:9862.
1 transgenic mice depends on transgene copy number and diminishes with down-regulation of transgene transcripts. Eur. J. Immunol. 25:187.[Medline]
1 light chain. Proc. Natl. Acad. Sci. USA 88:7933.This article has been cited by other articles:
![]() |
K. Malecek, J. Brandman, J. E. Brodsky, Y. Ohta, M. F. Flajnik, and E. Hsu Somatic Hypermutation and Junctional Diversification at Ig Heavy Chain Loci in the Nurse Shark J. Immunol., December 15, 2005; 175(12): 8105 - 8115. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. D'Avirro, D. Truong, B. Xu, and E. Selsing Sequence Transfers between Variable Regions in a Mouse Antibody Transgene Can Occur by Gene Conversion J. Immunol., December 15, 2005; 175(12): 8133 - 8137. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-F. Tsai, N. D'Avirro, and E. Selsing Gene conversion-like sequence transfers in a mouse antibody transgene: antigen selection allows sensitive detection of V region interactions based on homology Int. Immunol., January 1, 2002; 14(1): 55 - 64. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Kong and N. Maizels DNA Breaks in Hypermutating Immunoglobulin Genes: Evidence for a Break-and-Repair Pathway of Somatic Hypermutation Genetics, May 1, 2001; 158(1): 369 - 378. [Abstract] [Full Text] |
||||
![]() |
Q. Kong and N. Maizels Breaksite batch mapping, a rapid method for assay and identification of DNA breaksites in mammalian cells Nucleic Acids Res., March 15, 2001; 29(6): e33 - e33. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |