| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
and Not Th1/Th2 Imbalance1
Departments of
*
Immunology and
Molecular & Experimental Medicine, The Scripps Research Institute, La Jolla, CA 92037; and
Department of Health and Environment, Molecular and Immunological Pathology, Linköping University, Linköping, Sweden
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
gene knockout mice were studied for
susceptibility to the prototypic Th2-mediated mercury-induced
autoimmunity. A predominant Th2-type response following
HgCl2 treatment of wild-type B10.S mice was confirmed
by the findings of a significant increase in splenic IL-4 and
hypergammaglobulinemia primarily of the IgG1 isotype, without an
increase in IFN- levels. Paradoxically, IL-4-deficient mice
developed the characteristic anti-nucleolar autoantibodies and
tissue deposition of immune complexes, while IFN--deficient mice had
very low autoantibody levels and essentially normal immunohistology.
Studies to define defects in Ab responses of IFN--deficient mice,
using the T-dependent Ag (4-hydroxy-3-nitrophenyl)acetyl, revealed an
attenuated IgG response to low and to a lesser extent high doses of
(4-hydroxy-3-nitrophenyl)acetyl-hemocyanin, but maintenance of affinity
maturation. These results indicate that Th1/Th2 imbalance does not
directly play a role in susceptibility to mercury-induced autoimmunity,
and suggest that the dependence on Th1-type responses in certain
autoimmune diseases is due to the requirement for IFN- for Ab
production to weakly antigenic self molecules. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-2,
and TNF-ß; express surface IL-12Rß (3, 4); and are considered to
promote cellular immune responses. In contrast, Th2 cells produce IL-4,
IL-5, IL-6, IL-10, and IL-13; express the IL-4-related GATA-3
transcription factor (5), IFN-Rß (6), and the CCR3 chemokine
receptor (7); and are thought to promote humoral immune responses.
Because of their functional dichotomy, dominance of one or the other Th
type in an immune reaction has been postulated to result in either a
predominantly cellular (Th1-mediated) or predominantly Ab
(Th2-mediated) response. Although in most instances immune responses
most likely involve both Th types, shifts toward mainly Th1- or
Th2-type responses have been documented in vitro (1) and in vivo (8, 9), and a number of factors that promote either Th1 or Th2 responses
have been identified (10, 11). Such skewing of the type of Th response
has been shown to play important roles in resistance to certain
infections, in transplantation rejection, and in susceptibility to
autoimmunity (8, 12, 13, 14). One of the autoimmune models in which Th1/Th2 imbalance has long been considered to play a critical role is HgCl2-induced autoimmunity (HgIA)3 (15, 16). Clinical features of this disease, which follow nonlethal exposure to various forms of mercury, are similar to spontaneous systemic lupus erythematosus and include lymphoproliferation, hypergammaglobulinemia, autoantibody production, and immune complex-mediated tissue injury (reviewed in 17 . Other similarities are the requirements for T cells (18) and for CD40/CD40 ligand and B7/CD28 costimulatory molecule interactions to generate autoantibodies (19). HgIA susceptibility is also strikingly influenced by the MHC with particular class II haplotypes determining autoantibody specificity and disease severity (20).
Considerable evidence suggests that HgIA is mediated by the Th2 subset.
Murine HgIA is associated with increases of predominantly IL-4 and
IL-10, with only small early increases in IFN- and IL-2 (15, 19, 21, 22, 23). HgCl2-induced polyclonal activation of B cells
results in hypergammaglobulinemia, primarily of the Th2-related IgG1
and IgE isotypes (15). Studies based on IL-4 and IFN- cytokine
profiles have suggested that Th2-type responses promote HgIA, while
Th1-type responses are inhibitory (22, 24, 25). Treatment of
susceptible rats with Ab to the Th1-type subset (OX22+)
before administration of HgCl2 leads to exacerbation of the
autoimmune syndrome (26). Simultaneous administration of
HgCl2 protects against the induction of Th1-mediated
autoimmune diseases, such as experimental autoimmune uveoretinitis (27)
and experimental allergic encephalomyelitis, presumably by promoting
Th2-type responses (28). Finally, in the susceptible BN rat, induction
of HgIA can be suppressed by anti-self MHC class II T cells that
are of the Th1 type (29). Despite these findings, other studies using
more direct approaches have been unable to demonstrate a critical role
for Th2 cells. Treatment of HgCl2-treated animals with
anti-IL-4 mAb suppressed total IgE levels and IgG1 isotype
anti-nucleolar Abs (ANoA), but not total IgG ANoA titers (21).
rIFN- therapy was not protective against ANoA production or
glomerular immune complexes (30), and anti-IFN- treatment only
transiently and marginally augmented proteinuria in young mice (25).
Although there may be technical explanations for the lack of response
to these interventions, these findings nonetheless question the current
paradigm that Th2 promotes and Th1 suppresses HgIA.
In contrast to the findings in HgIA, recent studies have indicated that
spontaneous systemic autoimmunity is highly dependent on Th1 cytokines.
In vivo cytokine profiles in the lupus-prone MRL-lpr and
BXSB strains showed increase in the Th1 cytokine, IFN- (31). Greater
increases in the IgG2a and IgG3 (Th1-mediated) than IgG1 isotypes
(Th2-mediated) were observed in susceptible MRL-lpr and
MRL.Yaa compared with less susceptible MRL-+/+ and
MRL-lpr-ll (long-lived substrain of
MRL-lpr) strains (32). Treatment with IFN-
accelerates disease, whereas anti-IFN- or soluble IFN-R
treatment prevented systemic autoimmune disease (33, 34), and IL-4
transgenic lupus-prone (NZW x C57BL/6.Yaa)F1 mice
have attenuated disease (35). MRL-lpr mice deficient of
IFN- (36) or IFN-R (37) by homologous recombinant gene knockout
had lower IgG2a and IgG3 autoantibodies associated with less end organ
disease. These studies clearly support a primary role for Th1-type
responses in systemic autoimmunity. However, the situation may be more
complex since MRL-lpr mice homozygous for the IL-4 gene
knockout had levels of IgG2a and IgG3 isotypes and autoantibodies
comparable with wild-type MRL-lpr mice, but had reduced
glomerulonephritis (36).
To more directly study the roles of the Th2 and Th1 subsets in HgIA,
mice with deletions of IL-4 or IFN- genes were examined for disease
susceptibility. In contrast to what would be predicted, IL-4 gene
knockout mice were as susceptible to HgIA as wild-type mice, whereas
IFN--deficient mice were resistant to HgIA, at the level of
autoantibody production. These findings suggest that IFN-, rather
than an imbalance of Th1 and Th2, is important for susceptibility to
autoimmunity.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Breeding and maintenance of mice with targeted disruption of the
IFN- gene (IFN--/-, 38 or the IL-4 gene
(IL-4-/-, 39 were performed under
specific-pathogen-free conditions at The Scripps Research Institute
Animal Facility (La Jolla, CA). H-2s haplotype knockout
mice were generated by first backcrossing homozygous knockout mice
(H-2b haplotype) for two generations to B10.SeCD1
(H-2s) mice. The (IFN--/- x
B10.S)F1 x B10.S and (IL-4-/- x
B10.S)F1 x B10.S N2 offspring were then typed for
H-2s and the appropriate disrupted gene. Mice, both
homozygous for H-2s and heterozygous for the recombinant
knockout gene (
1/4 of mice), were then intercrossed to generate the
+/+, +/-, and -/- mice. H-2 typing was performed by PCR of genomic
DNA using the D17 Mit16 primers (Research Genetics, Huntsville, AL)
that are polymorphic for H-2b and H-2s
haplotypes. IFN- and IL-4 wild-type and knockout genes were typed by
PCR of genomic DNA (35 cycles of 94°C/20 s, 60°C/30 s, 72°C/90
s). Two pairs of primers were used for typing IFN-, one detecting
the undisrupted second exon (sense, AGAAGTAAGTGGAAGGGCCCAGAAG;
antisense, AGGGAAACTGGGAGAGGAGAAATAT; 200 bp) and the
other the neomycin gene (sense, TTGAACAAGATGGATTGCACGCAGG;
antisense,
GCCTGGCGCGAGCCCCTGATGCTCT; 400
bp). A single pair of primers was used for typing IL-4 (sense,
CTGCCAGCATTGCATTGTTA; antisense, ATGGTGCCAGATAGGTACTT; wild-type
200 bp, and knockout 1 kb).
Mercury treatment
Six- to eight-week-old mice were injected twice per week for 4 wk, or as indicated, s.c. with 40 µg HgCl2 in 100 µl PBS, as previously described (40). Controls received PBS alone.
Serology
Anti-nuclear Ab. Indirect immunofluorescence was performed on sera, as previously described (40). Briefly, monolayers of HEp-2 cells on slides (Bion Enterprises, Park Ridge, IL) were incubated with serial twofold dilutions of mouse serum starting from 1/100, followed by a 1/100 dilution of FITC-conjugated goat anti-mouse IgG + IgM Abs (Caltag Laboratories, Burlingame, CA). Anti-nuclear Ab patterns and titers were assessed under blinded conditions. Anti-chromatin Abs were measured by ELISA, as previously described (41, 42).
Ig levels.
Serum IgG and IgG1 levels were quantitated, as previously described
(43). ELISA plates were coated with 200 µl of 2 µg/ml goat
anti-mouse 
Ab (Caltag) diluted in PBS and incubated overnight
at 4°C. Plates were postcoated for 1 h with 0.1% gelatin in
PBS, followed by washing with PBS/0.05% Tween-20. A total of 200 µl
of diluted sera was incubated in duplicates while shaking for 2.5
h, followed by washing three times with PBS/0.05% Tween-20. A standard
curve was generated by serial dilutions of 400 to 3.125 ng/ml of
polyclonal mouse reference sera (The Binding Site, Birmingham, U.K.).
Horseradish peroxidase-conjugated goat anti-mouse IgG or IgG1 Abs
(Caltag) were diluted 1/5000 or 1/6000, respectively, in anti-Ig
diluent and incubated while shaking for 90 min. Following washing three
times with PBS/0.05% Tween and washing four times with PBS, substrate
solution was added and OD 405 nm was measured. Serum IgG2a levels were
similarly quantitated with the following modifications. Plates were
coated with rat anti-mouse Ig (PharMingen, San Diego, CA), and
reagents that detected both the a and b allotypes of IgG2a were used
throughout the assay, since some mice had the IgHa
allotype from 129 strain (ES cell derived). The horseradish
peroxidase-conjugated rat anti-mouse IgG2a (PharMingen) Ab was
diluted 1/1000. Standard curves were generated by serial dilutions of
purified mouse IgG2a of both allotypes (PharMingen). IgG, IgG1, and
IgG2a concentrations were extrapolated from their standard curves.
Anti-(4-hydroxy-3 nitrophenyl)acetyl (NP) Ab response
Mice were immunized i.p. with 100 µl of PBS containing varying
amounts of ALUM-precipitated NP-conjugated hemocyanin
(Limulus polyphemus; Sigma, St. Louis, MO) (20:1
ratio). ELISA using BSA and NP-conjugated BSA at ratios of 20:1 and
2.5:1 were used as substrates to assess NP-specific Ab levels and
affinity maturation. Briefly, 100 µl of Ag at 2 µg/ml in PBS was
incubated overnight at 4°C. After washing, wells were blocked with
200 µl of gelatin for 1.5 h, washed with PBS/Tween-20, then
incubated with serum diluted 1/300 in diluent buffer for 1.5 h.
After washing, 100 µl of horseradish peroxidase-conjugated Ab (goat
anti-mouse IgM at 1/3,000 dilution or goat anti-Ig
chain at
1/25,000 dilution; Southern Biotechnology, Birmingham, AL) was then
added, and after 1 h, wells were washed and incubated with
substrate, as described above for IgG quantitation. Positive and
negative control sera were used to standardize assays, and the
NP-specific responses were obtained after subtracting for responses to
BSA (<0.005 OD over background).
Immunoprecipitation
Immunoprecipitation was performed, as previously described (40), using in vitro translated mouse fibrillarin (44). Briefly, 100 µl of protein A-Sepharose CL4B beads were incubated with 5 µl of serum in 500 µl of NET2 + F buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 5 mM EDTA, 0.02% NaN3, 0.5% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS) for 1 h at 4°C, then washed and incubated for 1.5 h with 10 µl of radiolabeled translation product in 1 ml of NET2 + F buffer. Beads were then washed, resuspended in 2x sample loading buffer, and boiled. Supernatants were electrophoresed on polyacrylamide gels, and precipitates were identified by autoradiography.
Immunohistology
Sections of kidney and spleen were stained for direct immunofluorescence, as previously described (45). Briefly, 4-µm cryostat sections were ethanol fixed and incubated with serial dilutions of FITC-conjugated goat anti-mouse IgG Abs (Southern Biotechnology). The endpoint titer of the glomerular deposits was defined as the highest dilution of Ab at which a specific fluorescence could be detected. Positive immunofluorescence with titers less than 1:40 were considered background. Vessel wall IgG deposits were graded on a 0 to 4+ scale. Slides were examined under blinded conditions.
Cytokine competitive RT-PCR
The procedure to determine IL-4, IFN-, and
hypoxanthine-guanine phosphoribosyltransferase (HPRT) mRNA levels by a
competitive RT-PCR assay has been previously described (31). This
approach quantitates the amount of cDNA through the use of an internal
competitor standard of slightly different size than the cDNA.
Quantitation is obtained by coamplifying cDNA with known amounts of the
competitor standard in single reaction tubes and then comparing the PCR
signals of the cDNA and the internal standard. Briefly, 2 µg of total
cellular splenic RNA was reverse transcribed to generate cDNA. Aliquots
containing a set amount of cDNA, specific primers, and serial dilutions
of the competitor plasmid were subjected to PCR. The primer sequences,
PCR conditions, and the competitor plasmid containing internal
standards for 14 cytokine or control sequences, including IL-4,
IFN-, and HPRT, have been described in detail (31). Products were
run on 2% agarose gels, stained with ethidium bromide, and quantitated
using a digital video imaging system (Eagle Eye II; Stratagene, La
Jolla, CA). Quantity of mRNA was calculated by linear regression
analysis and expressed relative to HPRT levels using the formula:
1000 x [(quantity of IL-4 or IFN-)/(quantity of HPRT)].
Statistics
Data were analyzed by the unpaired two-tailed t test or Mann-Whitney U test (StatView; Abacus Concepts, Berkeley, CA). Differences were considered statistically significant at p < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In vivo IL-4 and IFN- production in spleens of autoimmune-prone
B10.S mice treated with the typical regimen of HgCl2
for 4 wk was compared with those of PBS-injected controls using a
competitive RT-PCR assay (31). Splenic IL-4 expression in
HgCl2-treated mice was nearly four times higher than in PBS
controls (10.9 ± 1.9 vs 2.8 ± 0.9, p =
0.003; 8 mice in each group), whereas mean IFN- levels, although
higher in HgCl2-treated animals, did not reach statistical
significance because of considerable individual variability (40.8
± 36.1 vs 19.2 ± 5, p > 0.05; 8 mice in each
group). These findings along with previous reports (19, 46) support the
contention that IL-4 and, therefore, Th2 cells play an important role
in the generation of autoimmunity in this model.
HgCl2 treatment of IL-4-/- mice
To directly examine the role of IL-4 and Th2 cells in this disease, H-2s mice deficient in IL-4 by homologous recombinant gene knockout (IL-4-/-) (39) were examined for HgIA. Three types of IL-4 mice, including wild-type (IL-4+/+), heterozygous knockout (IL-4+/-), and homozygous knockout (IL-4-/-), were treated for 4 wk with either the standard HgCl2 regimen or PBS.
As shown in Table I
, prebleed total IgG
levels were similar in all three IL-4 groups, whereas very low IgG1 and
slightly higher IgG2a levels were observed in the IL-4-/-
mice compared with the IL-4+/+ and IL-4+/-
groups, similar to findings in the original knockout strain (39).
Following treatment with HgCl2, all three groups had
increases in total, IgG1, and IgG2a Ig levels (Table I); however, the
IgG1 levels of IL-4-deficient mice remained substantially below the
wild-type and heterozygous mice (52 ± 8 vs 1233 ± 218
µg/ml, p < 0.001, and 1561 ± 437 µg/ml,
p < 0.01, respectively), and IgG2a levels were higher
in the IL-4-/- group compared with wild-type mice
(410 ± 102 vs 157 ± 34 µg/ml, p =
0.01).
|
). Furthermore, similar levels of ANoA
were observed with no significant differences in the percentage of
animals positive for ANoA (83, 100, and 100% for +/+, +/-, and -/-
mice, respectively) or in the mean ANoA titers (816 ± 314,
1298 ± 342, and 813 ± 151 for +/+, +/-, and -/- mice,
respectively). Immunoprecipitation analysis also showed that the ANoA
response in IL-4-/- mice was directed against fibrillarin
(data not shown). No significant differences in anti-chromatin Ab
levels were found among the HgCl2-treated groups
(1.051 ± 0.304, 1.752 ± 0.417, and 1.189 ± 0.334 for
+/+, +/-, and -/- mice, respectively, p >
0.05).
|
). Moreover, the increases were
similar in all HgCl2-treated groups, although
IL-4+/- mice appeared to have slightly worse disease.
This, however, did not reach statistical significance. Thus,
IL-4-deficient mice appear to be not only susceptible to HgIA, but to
have no decrease in disease severity.
|
-/- mice
The role of IFN- (Th1-type responses) in HgIA was similarly
studied using three groups of IFN- mice: wild-type
(IFN-+/+) and heterozygous
(IFN-+/-) or homozygous (IFN--/-)
knockout mice. When total IgG and IgG1 and IgG2a isotypes were
examined, there was variability in prebled and postbled levels among
individual mice, possibly due in part to differences in background
genes (Table IV). Nevertheless, higher
IgG1 levels were seen in the HgCl2- compared with
PBS-treated groups for IFN-+/+ and
IFN-+/- mice (711 ± 87 vs 264 ± 32 µg/ml,
and 1033 ± 117 vs 452 ± 54 µg/ml, p <
0.02). Between the IFN--/- HgCl2- and
PBS-treated groups, however, there was no difference, despite
comparable levels of IgG1 in HgCl2-treated
IFN--/- (787 ± 137 µg/ml) and
IFN-+/+ mice (above). This was due to the higher IgG1
levels in the PBS-treated group (593 ± 114 µg/ml,
p > 0.05) (Table IV). IgG2a levels were decreased in
the HgCl2-treated knockout groups (171 ± 46,
52 ± 14, and 21 ± 4 µg/ml for +/+, +/-, and -/-
groups, respectively; p < 0.02 for +/+ vs -/-
groups).
|
was found to have a profound effect on Ab responses to both
nucleolar and chromatin Ags (Table V).
Following HgCl2 treatment, ANoA Abs were detected in 93%
of IFN-+/+, 75% of IFN-+/-, and none of
the IFN--/- mice. The levels of ANoA (=1+
intensity) correlated with the number of functional IFN- genes
(773 ± 314, 73 ± 28, and 0 inverse titers for +/+, +/-,
and -/- groups, respectively; r = 0.47,
p = 0.03). A similar gene dose response was observed
for anti-chromatin Ab production (1.027 ± 0.305, 0.147
± 0.065, and 0.044 ± 0.019 for +/+, +/-, and -/- groups,
respectively). Autoantibodies were not completely absent in
IFN--/- animals, however, as two of eight such mice
injected with HgCl2 had trace, but definite, ANoA at a
serum dilution of 1/40.
|
-/- group and decreased in the
IFN-+/- compared with wild-type mice
(p < 0.05 for IFN-+/+ vs
IFN--/- or IFN-+/- groups; Table VI). Thus, IFN- is required for the
development of HgIA and appears to play a major role at the level of
autoantibody production.
|
-/- mice at low immunizing doses
The decreased response to two different autoantigens (nucleolar
and chromatin) along with the normal immunopathology suggests that
IFN--deficient mice are unable to generate a significant
autoantibody response. Indeed, the overall lack of response argues that
self Ags may possess specific properties that differentiate them from
foreign Ags. This possibility is supported by several studies showing
essentially normal Ab responses of IFN--deficient mice to nonself
Ags and infectious agents, other than a shift away from IgG2a and IgG3
isotypes (47, 48). However, decreased Ab response has been observed in
some cases (49), suggesting that an attenuated response may not be
unique to self Ags. To examine this possibility, we compared the
response of wild-type and IFN--/- mice with
different doses of the foreign T-dependent hapten, NP. The capacity for
affinity maturation was also determined, since this is an important
characteristic of some anti-nuclear Abs (50).
The IgM response to NP was similar in the wild-type and knockout mice
for a given immunizing dose (Fig. 1,
A and B). The IgG primary response for
IFN--/- mice immunized with high doses (100 µg) was
slightly lower compared with IFN-+/+ mice at day 9
(780 ± 138 vs 1179 ± 81 for the NP-20 substrate,
p < 0.05); however, 15-day and secondary responses to
NP were similar (p > 0.05; Fig. 1, D and E). Contrastingly, immunization with
low doses of NP-hemocyanin (1 and 5 µg) resulted in lower secondary
(28-day) IgG responses in IFN--/- mice
(p < 0.05 for 1 µg and 5 µg doses; Fig. 1, D and E).
|
+/+ and
IFN--/- mice for all three doses
(p > 0.05; Fig. 1
F). No
difference was also observed in the affinity maturation of IgM Abs
between the IFN- groups (+/+, +/-, and -/-) for the three doses
of NP-hemocyanin (p > 0.05; Fig. 1C). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
is
important for optimal in vivo IgG Ab responses to low doses of Ag.
Although the systemic autoimmunity induced by HgCl2
has been considered to be a prototypic Th2-mediated disease, by using
IL-4- and IFN--deficient mice, we clearly show that this is not the
case. While this seems paradoxical, given HgIA is a humoral immune
mediated disease associated with increases in Th2-type cytokines and
IgG isotype responses, nonetheless, other autoantibody-mediated
diseases, including spontaneous lupus (36, 37, 51) and experimental
myasthenia gravis (52), were also recently found to be IFN-
dependent. Thus, without exception, humoral mediated autoimmune
diseases have been found to be Th1 dependent, regardless of whether
cytokine and IgG isotypes in diseased animals are of predominantly Th2
(this study) or Th1 (spontaneous lupus) type.
Based on these findings, we propose that the balance between Th1-
and Th2-type responses does not directly contribute to autoimmune
susceptibility. Indeed, the observations suggest that the findings in
IFN--deficient mice are not due to Th1/Th2 predominance per se, but
to the requirement for IFN- to activate the immune system to respond
to poorly antigenic determinants, including both self and nonself Ags.
That IL-4-/- mice (Th1 predominance) did not show more
severe disease than wild-type mice (Th2 predominance) is consistent
with this possibility. Thus, the requirement for IFN- may be applied
to both cellular (as has been described for the lymphocytic
choriomeningitis virus model of insulin-dependent diabetes mellitus;
53 and humoral mediated (this study and Refs. 36, 37, and 52)
autoimmune diseases. Moreover, as there appears to be a dose
relationship between disease susceptibility and the number of
functional IFN- genes, different levels of IFN- appear to
directly contribute to disease susceptibility. This is supported by the
recent report by Balomenos et al. (51), showing 55% IFN- mRNA
levels and attenuated disease in IFN-+/-MRL-lpr mice. Immunization with high doses of Ag and a
strong adjuvant could be expected to bypass the requirement for
IFN-. Indeed, several experimentally induced cell-mediated models of
autoimmunity such as experimental allergic encephalomyelitis (54),
experimental autoimmune uveoretinitis (55), and collagen-induced
arthritis (56, 57) can be produced in IFN--deficient mice.
Similarly, a strong genetic predisposition may lower the susceptibility
threshold sufficiently to overcome the requirement for IFN-, as
suggested by the finding that IFN--deficient nonobese diabetic mice
develop insulin-dependent diabetes (58).
It can be argued that the induction of HgIA in IL-4 gene knockout mice
may possibly be due in part to duplication or compensation of Th2
function. Although this cannot be ruled out, it would appear unlikely,
since studies have established that IL-4-/- mice have
little to no Th2 cell activity, as evidenced by the lack of expression
of other Th2 cytokines in T cells and a skewed Ig isotype profile
showing increased IgG2a and very low IgG1 and IgE serum levels (39, 59). Furthermore, in vitro studies have indicated that IL-4 is
essential for the generation of the Th2 lineage (60, 61). Studies to
look at GATA-3 expression and surface expression of CCR3 and the
IFN-R ß2 subunit might be used to confirm a decrease
of Th2 cells. Moreover, recently developed conditional gene knockout
techniques (62) that permit deletions of genes or cell types at
specific times might provide a means to resolve this issue.
Nevertheless, the IL-4 knockout would seem to represent the extreme end
of the spectrum in terms of Th1/Th2 imbalance, and the induction of
disease in IL-4-/- mice, but absence in
IFN--/- mice, strongly argues against a Th2 cell
dependence of HgIA.
Recently, other exceptions to the Th1/Th2 paradigm in addition to this study and those discussed above for autoimmune responses have been reported, including studies of infections with intracellular pathogens, parasites and virus (63), and transplantation rejection (64, 65). Based on these findings, it is evident that the importance of a particular Th subset cannot be inferred by simple association and that the role of Th subtypes in immune processes is in most instances more complex than simple functional dichotomy. Thus, although the concept of Th1/Th2 has provided a useful and simple model for defining T cell regulation and function, delineation of the specific cytokines and cell types critical for the particular immune response is in most instances, such as in this study, more likely to be relevant than attempting to categorize responses as Th1 or Th2 (63).
Genetic (42) as well as Ig and TCR transgenic (66, 67) studies indicate
susceptibility to autoimmune disease is a multistep process with
several stages or checkpoints. The necessity for IFN- for
autoantibody production defines a checkpoint at the initiation of the
autoimmune response with the potential to discriminate self and nonself
recognition. As such, the IFN- knockout autoimmune model may be
useful for defining characteristics of self Ags and requirements for
self Ag reactivity. Moreover, since IFN- is a highly pleiotropic
cytokine with immune modulating, inflammation-promoting, and
cell-regulatory properties, further definition of the specific
autoimmune pathways that require IFN- may reveal specific
therapeutic interventions that do not block effective responses to
infectious agents.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Dwight H. Kono, Department of Immunology-IMM3, The Scripps Research Institute, 10550 N. Torrey Pines Road, La Jolla, CA 92037. E-mail address:
3 Abbreviations used in this paper: HgIA, mercury-induced autoimmunity; ANoA, anti-nucleolar Ab; HPRT, hypoxanthine-guanine phosphoribosyltransferase; NP, (4-hydroxy-3-nitrophenyl)acetyl.
Received for publication December 30, 1997. Accepted for publication March 5, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
receptor ß chain and the prevention of interferon- signaling in Th1 cells. Science 269:245.. Cell. Immunol. 162:131.[Medline]
(IFN-). Clin. Exp. Immunol. 109:149.[Medline]
mRNA in the lymph nodes of lupus-prone mice. Mol. Immunol. 32:495.[Medline]
receptor inhibits the onset of glomerulonephritis. Eur. J. Immunol. 25:6.[Medline]
and interleukin-4 in murine lupus. J. Clin. Invest. 99:1936.[Medline]
is essential for the development of autoimmune glomerulonephritis in MRL/Ipr mice. J. Immunol. 158:5484.[Abstract]
genes. Science 259:1739. receptor. Science 259:1742. gene. J. Exp. Med. 178:1725. receptor-deficient mice generate antiviral Th1-characteristic cytokine profiles but altered antibody responses. J. Immunol. 153:2029.[Abstract]
is required for lupus-like disease and lymphoaccumulation in MRL-lpr mice. J. Clin. Invest. 101:364.[Medline]
(IFN-) is necessary for the genesis of acetylcholine receptor-induced clinical experimental autoimmune Myasthenia gravis in mice. J. Exp. Med. 186:385. gene are susceptible to the induction of experimental autoimmune encephalomyelitis (EAE). J. Immunol. 156:5.[Abstract]
-deficient mice develop experimental autoimmune uveitis in the context of a deviant effector response. J. Immunol. 158:5997.[Abstract]
receptors. J. Immunol. 158:5501.[Abstract]
receptor-deficient mice. J. Immunol. 158:5507.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  S. Fagoonee, C. Caorsi, M. Giovarelli, M. Stoltenberg, L. Silengo, F. Altruda, G. Camussi, E. Tolosano, and B. Bussolati Lack of Plasma Protein Hemopexin Dampens Mercury-Induced Autoimmune Response in Mice J. Immunol., August 1, 2008; 181(3): 1937 - 1947. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Sancho-Shimizu, R. Khan, S. Mostowy, L. Lariviere, R. Wilkinson, N. Riendeau, M. Behr, and D. Malo Molecular Genetic Analysis of Two Loci (Ity2 and Ity3) Involved in the Host Response to Infection With Salmonella Typhimurium Using Congenic Mice and Expression Profiling Genetics, October 1, 2007; 177(2): 1125 - 1139. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Agrawal, P. Kaushal, S. Agrawal, S. Gollapudi, and S. Gupta Thimerosal induces TH2 responses via influencing cytokine secretion by human dendritic cells J. Leukoc. Biol., February 1, 2007; 81(2): 474 - 482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. S. Vinay, J. D. Kim, and B. S. Kwon Amelioration of Mercury-Induced Autoimmunity by 4-1BB J. Immunol., October 15, 2006; 177(8): 5708 - 5717. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zheng, S. Gallucci, J. P. Gaughan, J. A. Gross, and M. Monestier A Role for B Cell-Activating Factor of the TNF Family in Chemically Induced Autoimmunity J. Immunol., November 1, 2005; 175(9): 6163 - 6168. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. K. Haraldsson, N. G. dela Paz, J. G. Kuan, G. S. Gilkeson, A. N. Theofilopoulos, and D. H. Kono Autoimmune Alterations Induced by the New Zealand Black Lbw2 Locus in BWF1 Mice J. Immunol., April 15, 2005; 174(8): 5065 - 5073. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. M. Pollard, M. Arnush, P. Hultman, and D. H. Kono Costimulation Requirements of Induced Murine Systemic Autoimmune Disease J. Immunol., November 1, 2004; 173(9): 5880 - 5887. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zheng and M. Monestier Inhibitory Signal Override Increases Susceptibility to Mercury-Induced Autoimmunity J. Immunol., August 1, 2003; 171(3): 1596 - 1601. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Chen, T. Rockel, G. Steinweger, P. Hemmerich, J. Risch, and A. von Mikecz Subcellular Recruitment of Fibrillarin to Nucleoplasmic Proteasomes: Implications for Processing of a Nucleolar Autoantigen Mol. Biol. Cell, October 1, 2002; 13(10): 3576 - 3587. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. B. Sass, D. T. Haselow, and E. K. Silbergeld Methylmercury-Induced Decrement in Neuronal Migration May Involve Cytokine-Dependent Mechanisms: A Novel Method to Assess Neuronal Movement in Vitro Toxicol. Sci., September 1, 2001; 63(1): 74 - 81. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. H. Kono, M. S. Park, A. Szydlik, K. M. Haraldsson, J. D. Kuan, D. L. Pearson, P. Hultman, and K. M. Pollard Resistance to Xenobiotic-Induced Autoimmunity Maps to Chromosome 1 J. Immunol., August 15, 2001; 167(4): 2396 - 2403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. M. Pollard, D. L. Pearson, M. Bluthner, and E. M. Tan Proteolytic Cleavage of a Self-Antigen Following Xenobiotic-Induced Cell Death Produces a Fragment with Novel Immunogenic Properties J. Immunol., August 15, 2000; 165(4): 2263 - 2270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. P. Waalkes, D. A. Fox, J. C. States, S. R. Patierno, and M. J. McCabe Jr. Metals and Disorders of Cell Accumulation: Modulation of Apoptosis and Cell Proliferation Toxicol. Sci., August 1, 2000; 56(2): 255 - 261. [Full Text] [PDF]
|
|
|
|
|
|
D. H. Kono, D. Balomenos, M. S. Park, and A. N. Theofilopoulos Development of Lupus in BXSB Mice Is Independent of IL-4 J. Immunol., January 1, 2000; 164(1): 38 - 42. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. H. Ring, Z. Dai, S. Saleem, F. K. Baddoura, and F. G. Lakkis Increased Susceptibility to Immunologically Mediated Glomerulonephritis in IFN-{gamma}-Deficient Mice J. Immunol., August 15, 1999; 163(4): 2243 - 2248. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Matsui, J. D. Ahlers, A. O. Vortmeyer, M. Terabe, T. Tsukui, D. P. Carbone, L. A. Liotta, and J. A. Berzofsky A Model for CD8+ CTL Tumor Immunosurveillance and Regulation of Tumor Escape by CD4 T Cells Through an Effect on Quality of CTL J. Immunol., July 1, 1999; 163(1): 184 - 193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Whitekus, R. P. Santini, A. J. Rosenspire, and M. J. McCabe Jr. Protection Against CD95-Mediated Apoptosis by Inorganic Mercury in Jurkat T Cells J. Immunol., June 15, 1999; 162(12): 7162 - 7170. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Jiang and G. Moller IL-2 may be a limiting factor precluding lymphocytes from genetically resistant mice from responding to HgCl2 Int. Immunol., May 1, 1999; 11(5): 627 - 633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Balasa, C. Deng, J. Lee, P. Christadoss, and N. Sarvetnick The Th2 Cytokine IL-4 Is Not Required for the Progression of Antibody-Dependent Autoimmune Myasthenia Gravis J. Immunol., September 15, 1998; 161(6): 2856 - 2862. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
