The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kono, D. H.
Right arrow Articles by Pollard, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kono, D. H.
Right arrow Articles by Pollard, K. M.
The Journal of Immunology, 1998, 161: 234-240.
Copyright © 1998 by The American Association of Immunologists

The Prototypic Th2 Autoimmunity Induced by Mercury Is Dependent on IFN-{gamma} and Not Th1/Th2 Imbalance1

Dwight H. Kono2,*, Dimitri Balomenos*, Deborah L. Pearson{dagger}, Miyo S. Park*, Bernhard Hildebrandt{dagger}, Per Hultman{ddagger} and K. Michael Pollard{dagger}

Departments of * Immunology and {dagger} Molecular & Experimental Medicine, The Scripps Research Institute, La Jolla, CA 92037; and {ddagger} Department of Health and Environment, Molecular and Immunological Pathology, Linköping University, Linköping, Sweden


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Imbalances of Th1- and Th2-type responses have been postulated to be a predisposing factor for both humoral and cellular mediated autoimmune diseases. To further define their roles in systemic autoimmunity, IL-4 and IFN-{gamma} gene knockout mice were studied for susceptibility to the prototypic Th2-mediated mercury-induced autoimmunity. A predominant Th2-type response following HgCl2 treatment of wild-type B10.S mice was confirmed by the findings of a significant increase in splenic IL-4 and hypergammaglobulinemia primarily of the IgG1 isotype, without an increase in IFN-{gamma} levels. Paradoxically, IL-4-deficient mice developed the characteristic anti-nucleolar autoantibodies and tissue deposition of immune complexes, while IFN-{gamma}-deficient mice had very low autoantibody levels and essentially normal immunohistology. Studies to define defects in Ab responses of IFN-{gamma}-deficient mice, using the T-dependent Ag (4-hydroxy-3-nitrophenyl)acetyl, revealed an attenuated IgG response to low and to a lesser extent high doses of (4-hydroxy-3-nitrophenyl)acetyl-hemocyanin, but maintenance of affinity maturation. These results indicate that Th1/Th2 imbalance does not directly play a role in susceptibility to mercury-induced autoimmunity, and suggest that the dependence on Th1-type responses in certain autoimmune diseases is due to the requirement for IFN-{gamma} for Ab production to weakly antigenic self molecules.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Following activation, CD4+ T cells become polarized into two main Th cell types, designated Th1 and Th2 (1, 2). Th1 cells produce IFN-{gamma}, IL-2, and TNF-ß; express surface IL-12Rß (3, 4); and are considered to promote cellular immune responses. In contrast, Th2 cells produce IL-4, IL-5, IL-6, IL-10, and IL-13; express the IL-4-related GATA-3 transcription factor (5), IFN-{gamma}Rß (6), and the CCR3 chemokine receptor (7); and are thought to promote humoral immune responses. Because of their functional dichotomy, dominance of one or the other Th type in an immune reaction has been postulated to result in either a predominantly cellular (Th1-mediated) or predominantly Ab (Th2-mediated) response. Although in most instances immune responses most likely involve both Th types, shifts toward mainly Th1- or Th2-type responses have been documented in vitro (1) and in vivo (8, 9), and a number of factors that promote either Th1 or Th2 responses have been identified (10, 11). Such skewing of the type of Th response has been shown to play important roles in resistance to certain infections, in transplantation rejection, and in susceptibility to autoimmunity (8, 12, 13, 14).

One of the autoimmune models in which Th1/Th2 imbalance has long been considered to play a critical role is HgCl2-induced autoimmunity (HgIA)3 (15, 16). Clinical features of this disease, which follow nonlethal exposure to various forms of mercury, are similar to spontaneous systemic lupus erythematosus and include lymphoproliferation, hypergammaglobulinemia, autoantibody production, and immune complex-mediated tissue injury (reviewed in 17 . Other similarities are the requirements for T cells (18) and for CD40/CD40 ligand and B7/CD28 costimulatory molecule interactions to generate autoantibodies (19). HgIA susceptibility is also strikingly influenced by the MHC with particular class II haplotypes determining autoantibody specificity and disease severity (20).

Considerable evidence suggests that HgIA is mediated by the Th2 subset. Murine HgIA is associated with increases of predominantly IL-4 and IL-10, with only small early increases in IFN-{gamma} and IL-2 (15, 19, 21, 22, 23). HgCl2-induced polyclonal activation of B cells results in hypergammaglobulinemia, primarily of the Th2-related IgG1 and IgE isotypes (15). Studies based on IL-4 and IFN-{gamma} cytokine profiles have suggested that Th2-type responses promote HgIA, while Th1-type responses are inhibitory (22, 24, 25). Treatment of susceptible rats with Ab to the Th1-type subset (OX22+) before administration of HgCl2 leads to exacerbation of the autoimmune syndrome (26). Simultaneous administration of HgCl2 protects against the induction of Th1-mediated autoimmune diseases, such as experimental autoimmune uveoretinitis (27) and experimental allergic encephalomyelitis, presumably by promoting Th2-type responses (28). Finally, in the susceptible BN rat, induction of HgIA can be suppressed by anti-self MHC class II T cells that are of the Th1 type (29). Despite these findings, other studies using more direct approaches have been unable to demonstrate a critical role for Th2 cells. Treatment of HgCl2-treated animals with anti-IL-4 mAb suppressed total IgE levels and IgG1 isotype anti-nucleolar Abs (ANoA), but not total IgG ANoA titers (21). rIFN-{gamma} therapy was not protective against ANoA production or glomerular immune complexes (30), and anti-IFN-{gamma} treatment only transiently and marginally augmented proteinuria in young mice (25). Although there may be technical explanations for the lack of response to these interventions, these findings nonetheless question the current paradigm that Th2 promotes and Th1 suppresses HgIA.

In contrast to the findings in HgIA, recent studies have indicated that spontaneous systemic autoimmunity is highly dependent on Th1 cytokines. In vivo cytokine profiles in the lupus-prone MRL-lpr and BXSB strains showed increase in the Th1 cytokine, IFN-{gamma} (31). Greater increases in the IgG2a and IgG3 (Th1-mediated) than IgG1 isotypes (Th2-mediated) were observed in susceptible MRL-lpr and MRL.Yaa compared with less susceptible MRL-+/+ and MRL-lpr-ll (long-lived substrain of MRL-lpr) strains (32). Treatment with IFN-{gamma} accelerates disease, whereas anti-IFN-{gamma} or soluble IFN-{gamma}R treatment prevented systemic autoimmune disease (33, 34), and IL-4 transgenic lupus-prone (NZW x C57BL/6.Yaa)F1 mice have attenuated disease (35). MRL-lpr mice deficient of IFN-{gamma} (36) or IFN-{gamma}R (37) by homologous recombinant gene knockout had lower IgG2a and IgG3 autoantibodies associated with less end organ disease. These studies clearly support a primary role for Th1-type responses in systemic autoimmunity. However, the situation may be more complex since MRL-lpr mice homozygous for the IL-4 gene knockout had levels of IgG2a and IgG3 isotypes and autoantibodies comparable with wild-type MRL-lpr mice, but had reduced glomerulonephritis (36).

To more directly study the roles of the Th2 and Th1 subsets in HgIA, mice with deletions of IL-4 or IFN-{gamma} genes were examined for disease susceptibility. In contrast to what would be predicted, IL-4 gene knockout mice were as susceptible to HgIA as wild-type mice, whereas IFN-{gamma}-deficient mice were resistant to HgIA, at the level of autoantibody production. These findings suggest that IFN-{gamma}, rather than an imbalance of Th1 and Th2, is important for susceptibility to autoimmunity.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

Breeding and maintenance of mice with targeted disruption of the IFN-{gamma} gene (IFN-{gamma}-/-, 38 or the IL-4 gene (IL-4-/-, 39 were performed under specific-pathogen-free conditions at The Scripps Research Institute Animal Facility (La Jolla, CA). H-2s haplotype knockout mice were generated by first backcrossing homozygous knockout mice (H-2b haplotype) for two generations to B10.SeCD1 (H-2s) mice. The (IFN-{gamma}-/- x B10.S)F1 x B10.S and (IL-4-/- x B10.S)F1 x B10.S N2 offspring were then typed for H-2s and the appropriate disrupted gene. Mice, both homozygous for H-2s and heterozygous for the recombinant knockout gene (~1/4 of mice), were then intercrossed to generate the +/+, +/-, and -/- mice. H-2 typing was performed by PCR of genomic DNA using the D17 Mit16 primers (Research Genetics, Huntsville, AL) that are polymorphic for H-2b and H-2s haplotypes. IFN-{gamma} and IL-4 wild-type and knockout genes were typed by PCR of genomic DNA (35 cycles of 94°C/20 s, 60°C/30 s, 72°C/90 s). Two pairs of primers were used for typing IFN-{gamma}, one detecting the undisrupted second exon (sense, AGAAGTAAGTGGAAGGGCCCAGAAG; antisense, AGGGAAACTGGGAGAGGAGAAATAT; ~200 bp) and the other the neomycin gene (sense, TTGAACAAGATGGATTGCACGCAGG; antisense, GCCTGGCGCGAGCCCCTGATGCTCT; ~400 bp). A single pair of primers was used for typing IL-4 (sense, CTGCCAGCATTGCATTGTTA; antisense, ATGGTGCCAGATAGGTACTT; wild-type ~200 bp, and knockout ~1 kb).

Mercury treatment

Six- to eight-week-old mice were injected twice per week for 4 wk, or as indicated, s.c. with 40 µg HgCl2 in 100 µl PBS, as previously described (40). Controls received PBS alone.

Serology

Anti-nuclear Ab. Indirect immunofluorescence was performed on sera, as previously described (40). Briefly, monolayers of HEp-2 cells on slides (Bion Enterprises, Park Ridge, IL) were incubated with serial twofold dilutions of mouse serum starting from 1/100, followed by a 1/100 dilution of FITC-conjugated goat anti-mouse IgG + IgM Abs (Caltag Laboratories, Burlingame, CA). Anti-nuclear Ab patterns and titers were assessed under blinded conditions. Anti-chromatin Abs were measured by ELISA, as previously described (41, 42).

Ig levels. Serum IgG and IgG1 levels were quantitated, as previously described (43). ELISA plates were coated with 200 µl of 2 µg/ml goat anti-mouse {kappa} Ab (Caltag) diluted in PBS and incubated overnight at 4°C. Plates were postcoated for 1 h with 0.1% gelatin in PBS, followed by washing with PBS/0.05% Tween-20. A total of 200 µl of diluted sera was incubated in duplicates while shaking for 2.5 h, followed by washing three times with PBS/0.05% Tween-20. A standard curve was generated by serial dilutions of 400 to 3.125 ng/ml of polyclonal mouse reference sera (The Binding Site, Birmingham, U.K.). Horseradish peroxidase-conjugated goat anti-mouse IgG or IgG1 Abs (Caltag) were diluted 1/5000 or 1/6000, respectively, in anti-Ig diluent and incubated while shaking for 90 min. Following washing three times with PBS/0.05% Tween and washing four times with PBS, substrate solution was added and OD 405 nm was measured. Serum IgG2a levels were similarly quantitated with the following modifications. Plates were coated with rat anti-mouse Ig {kappa} (PharMingen, San Diego, CA), and reagents that detected both the a and b allotypes of IgG2a were used throughout the assay, since some mice had the IgHa allotype from 129 strain (ES cell derived). The horseradish peroxidase-conjugated rat anti-mouse IgG2a (PharMingen) Ab was diluted 1/1000. Standard curves were generated by serial dilutions of purified mouse IgG2a of both allotypes (PharMingen). IgG, IgG1, and IgG2a concentrations were extrapolated from their standard curves.

Anti-(4-hydroxy-3 nitrophenyl)acetyl (NP) Ab response

Mice were immunized i.p. with 100 µl of PBS containing varying amounts of ALUM-precipitated NP-conjugated hemocyanin (Limulus polyphemus; Sigma, St. Louis, MO) (20:1 ratio). ELISA using BSA and NP-conjugated BSA at ratios of 20:1 and 2.5:1 were used as substrates to assess NP-specific Ab levels and affinity maturation. Briefly, 100 µl of Ag at 2 µg/ml in PBS was incubated overnight at 4°C. After washing, wells were blocked with 200 µl of gelatin for 1.5 h, washed with PBS/Tween-20, then incubated with serum diluted 1/300 in diluent buffer for 1.5 h. After washing, 100 µl of horseradish peroxidase-conjugated Ab (goat anti-mouse IgM at 1/3,000 dilution or goat anti-Ig{lambda} chain at 1/25,000 dilution; Southern Biotechnology, Birmingham, AL) was then added, and after 1 h, wells were washed and incubated with substrate, as described above for IgG quantitation. Positive and negative control sera were used to standardize assays, and the NP-specific responses were obtained after subtracting for responses to BSA (<0.005 OD over background).

Immunoprecipitation

Immunoprecipitation was performed, as previously described (40), using in vitro translated mouse fibrillarin (44). Briefly, 100 µl of protein A-Sepharose CL4B beads were incubated with 5 µl of serum in 500 µl of NET2 + F buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 5 mM EDTA, 0.02% NaN3, 0.5% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS) for 1 h at 4°C, then washed and incubated for 1.5 h with 10 µl of radiolabeled translation product in 1 ml of NET2 + F buffer. Beads were then washed, resuspended in 2x sample loading buffer, and boiled. Supernatants were electrophoresed on polyacrylamide gels, and precipitates were identified by autoradiography.

Immunohistology

Sections of kidney and spleen were stained for direct immunofluorescence, as previously described (45). Briefly, 4-µm cryostat sections were ethanol fixed and incubated with serial dilutions of FITC-conjugated goat anti-mouse IgG Abs (Southern Biotechnology). The endpoint titer of the glomerular deposits was defined as the highest dilution of Ab at which a specific fluorescence could be detected. Positive immunofluorescence with titers less than 1:40 were considered background. Vessel wall IgG deposits were graded on a 0 to 4+ scale. Slides were examined under blinded conditions.

Cytokine competitive RT-PCR

The procedure to determine IL-4, IFN-{gamma}, and hypoxanthine-guanine phosphoribosyltransferase (HPRT) mRNA levels by a competitive RT-PCR assay has been previously described (31). This approach quantitates the amount of cDNA through the use of an internal competitor standard of slightly different size than the cDNA. Quantitation is obtained by coamplifying cDNA with known amounts of the competitor standard in single reaction tubes and then comparing the PCR signals of the cDNA and the internal standard. Briefly, 2 µg of total cellular splenic RNA was reverse transcribed to generate cDNA. Aliquots containing a set amount of cDNA, specific primers, and serial dilutions of the competitor plasmid were subjected to PCR. The primer sequences, PCR conditions, and the competitor plasmid containing internal standards for 14 cytokine or control sequences, including IL-4, IFN-{gamma}, and HPRT, have been described in detail (31). Products were run on 2% agarose gels, stained with ethidium bromide, and quantitated using a digital video imaging system (Eagle Eye II; Stratagene, La Jolla, CA). Quantity of mRNA was calculated by linear regression analysis and expressed relative to HPRT levels using the formula: 1000 x [(quantity of IL-4 or IFN-{gamma})/(quantity of HPRT)].

Statistics

Data were analyzed by the unpaired two-tailed t test or Mann-Whitney U test (StatView; Abacus Concepts, Berkeley, CA). Differences were considered statistically significant at p < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-4 is increased in HgCl2-induced autoimmunity

In vivo IL-4 and IFN-{gamma} production in spleens of autoimmune-prone B10.S mice treated with the typical regimen of HgCl2 for 4 wk was compared with those of PBS-injected controls using a competitive RT-PCR assay (31). Splenic IL-4 expression in HgCl2-treated mice was nearly four times higher than in PBS controls (10.9 ± 1.9 vs 2.8 ± 0.9, p = 0.003; 8 mice in each group), whereas mean IFN-{gamma} levels, although higher in HgCl2-treated animals, did not reach statistical significance because of considerable individual variability (40.8 ± 36.1 vs 19.2 ± 5, p > 0.05; 8 mice in each group). These findings along with previous reports (19, 46) support the contention that IL-4 and, therefore, Th2 cells play an important role in the generation of autoimmunity in this model.

HgCl2 treatment of IL-4-/- mice

To directly examine the role of IL-4 and Th2 cells in this disease, H-2s mice deficient in IL-4 by homologous recombinant gene knockout (IL-4-/-) (39) were examined for HgIA. Three types of IL-4 mice, including wild-type (IL-4+/+), heterozygous knockout (IL-4+/-), and homozygous knockout (IL-4-/-), were treated for 4 wk with either the standard HgCl2 regimen or PBS.

As shown in Table IGo, prebleed total IgG levels were similar in all three IL-4 groups, whereas very low IgG1 and slightly higher IgG2a levels were observed in the IL-4-/- mice compared with the IL-4+/+ and IL-4+/- groups, similar to findings in the original knockout strain (39). Following treatment with HgCl2, all three groups had increases in total, IgG1, and IgG2a Ig levels (Table IGo); however, the IgG1 levels of IL-4-deficient mice remained substantially below the wild-type and heterozygous mice (52 ± 8 vs 1233 ± 218 µg/ml, p < 0.001, and 1561 ± 437 µg/ml, p < 0.01, respectively), and IgG2a levels were higher in the IL-4-/- group compared with wild-type mice (410 ± 102 vs 157 ± 34 µg/ml, p = 0.01).


View this table:
[in this window]
[in a new window]
 
Table I. Total serum IgG, IgG1, and IgG2a levels in HgCl2-treated IL-4-deficient mice1

 
Following HgCl2 treatment, all groups had increased levels of ANoA (p < 0.001) and anti-chromatin Abs (p < 0.05) (Table IIGo). Furthermore, similar levels of ANoA were observed with no significant differences in the percentage of animals positive for ANoA (83, 100, and 100% for +/+, +/-, and -/- mice, respectively) or in the mean ANoA titers (816 ± 314, 1298 ± 342, and 813 ± 151 for +/+, +/-, and -/- mice, respectively). Immunoprecipitation analysis also showed that the ANoA response in IL-4-/- mice was directed against fibrillarin (data not shown). No significant differences in anti-chromatin Ab levels were found among the HgCl2-treated groups (1.051 ± 0.304, 1.752 ± 0.417, and 1.189 ± 0.334 for +/+, +/-, and -/- mice, respectively, p > 0.05).


View this table:
[in this window]
[in a new window]
 
Table II. Autoantibody levels in HgCl2-treated IL-4-deficient mice

 
Immunohistologic examination revealed that all HgCl2-treated groups had increases in IgG and C3 deposits in glomeruli and splenic vessels compared with PBS controls (Table IIIGo). Moreover, the increases were similar in all HgCl2-treated groups, although IL-4+/- mice appeared to have slightly worse disease. This, however, did not reach statistical significance. Thus, IL-4-deficient mice appear to be not only susceptible to HgIA, but to have no decrease in disease severity.


View this table:
[in this window]
[in a new window]
 
Table III. Immunopathology of HgCL2-treated IL-4-deficient mice1

 
HgCl2 treatment of IFN-{gamma}-/- mice

The role of IFN-{gamma} (Th1-type responses) in HgIA was similarly studied using three groups of IFN-{gamma} mice: wild-type (IFN-{gamma}+/+) and heterozygous (IFN-{gamma}+/-) or homozygous (IFN-{gamma}-/-) knockout mice. When total IgG and IgG1 and IgG2a isotypes were examined, there was variability in prebled and postbled levels among individual mice, possibly due in part to differences in background genes (Table IVGo). Nevertheless, higher IgG1 levels were seen in the HgCl2- compared with PBS-treated groups for IFN-{gamma}+/+ and IFN-{gamma}+/- mice (711 ± 87 vs 264 ± 32 µg/ml, and 1033 ± 117 vs 452 ± 54 µg/ml, p < 0.02). Between the IFN-{gamma}-/- HgCl2- and PBS-treated groups, however, there was no difference, despite comparable levels of IgG1 in HgCl2-treated IFN-{gamma}-/- (787 ± 137 µg/ml) and IFN-{gamma}+/+ mice (above). This was due to the higher IgG1 levels in the PBS-treated group (593 ± 114 µg/ml, p > 0.05) (Table IVGo). IgG2a levels were decreased in the HgCl2-treated knockout groups (171 ± 46, 52 ± 14, and 21 ± 4 µg/ml for +/+, +/-, and -/- groups, respectively; p < 0.02 for +/+ vs -/- groups).


View this table:
[in this window]
[in a new window]
 
Table IV. Total IgG, IgG1, and IgG2a levels in HgCl2-treated IFN-{gamma}-deficient mice

 
IFN-{gamma} was found to have a profound effect on Ab responses to both nucleolar and chromatin Ags (Table VGo). Following HgCl2 treatment, ANoA Abs were detected in 93% of IFN-{gamma}+/+, 75% of IFN-{gamma}+/-, and none of the IFN-{gamma}-/- mice. The levels of ANoA (=1+ intensity) correlated with the number of functional IFN-{gamma} genes (773 ± 314, 73 ± 28, and 0 inverse titers for +/+, +/-, and -/- groups, respectively; r = 0.47, p = 0.03). A similar gene dose response was observed for anti-chromatin Ab production (1.027 ± 0.305, 0.147 ± 0.065, and 0.044 ± 0.019 for +/+, +/-, and -/- groups, respectively). Autoantibodies were not completely absent in IFN-{gamma}-/- animals, however, as two of eight such mice injected with HgCl2 had trace, but definite, ANoA at a serum dilution of 1/40.


View this table:
[in this window]
[in a new window]
 
Table V. Autoantibody levels in HgCl2-treated IFN-{gamma}-deficient mice

 
IgG and C3 deposits in the kidney glomeruli and splenic vessels after HgCl2 exposure were essentially absent in the IFN-{gamma}-/- group and decreased in the IFN-{gamma}+/- compared with wild-type mice (p < 0.05 for IFN-{gamma}+/+ vs IFN-{gamma}-/- or IFN-{gamma}+/- groups; Table VIGo). Thus, IFN-{gamma} is required for the development of HgIA and appears to play a major role at the level of autoantibody production.


View this table:
[in this window]
[in a new window]
 
Table VI. Immunopathology of HgCl2-treated IFN-{gamma}-deficient mice

 
T-dependent NP-hapten response is decreased in IFN-{gamma}-/- mice at low immunizing doses

The decreased response to two different autoantigens (nucleolar and chromatin) along with the normal immunopathology suggests that IFN-{gamma}-deficient mice are unable to generate a significant autoantibody response. Indeed, the overall lack of response argues that self Ags may possess specific properties that differentiate them from foreign Ags. This possibility is supported by several studies showing essentially normal Ab responses of IFN-{gamma}-deficient mice to nonself Ags and infectious agents, other than a shift away from IgG2a and IgG3 isotypes (47, 48). However, decreased Ab response has been observed in some cases (49), suggesting that an attenuated response may not be unique to self Ags. To examine this possibility, we compared the response of wild-type and IFN-{gamma}-/- mice with different doses of the foreign T-dependent hapten, NP. The capacity for affinity maturation was also determined, since this is an important characteristic of some anti-nuclear Abs (50).

The IgM response to NP was similar in the wild-type and knockout mice for a given immunizing dose (Fig. 1Go, A and B). The IgG primary response for IFN-{gamma}-/- mice immunized with high doses (100 µg) was slightly lower compared with IFN-{gamma}+/+ mice at day 9 (780 ± 138 vs 1179 ± 81 for the NP-20 substrate, p < 0.05); however, 15-day and secondary responses to NP were similar (p > 0.05; Fig. 1Go, D and E). Contrastingly, immunization with low doses of NP-hemocyanin (1 and 5 µg) resulted in lower secondary (28-day) IgG responses in IFN-{gamma}-/- mice (p < 0.05 for 1 µg and 5 µg doses; Fig. 1Go, D and E).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 1. IgM and total Ig response of IFN-{gamma} wild-type and knockout mice to NP. Mice were immunized i.p. with 100, 5, or 1 µg of NP conjugated to hemocyanin (20:1 ratio) in PBS on days 0 and 21. Sera were obtained on days 3, 9, 15, and 28, and analyzed by ELISA for hapten-specific IgM and total Ig ({lambda}-chain) Abs to high (20:1, NP-20) and low (2.5:1, NP-2.5) density NP conjugated to BSA. A, IgM anti-NP-20; B, IgM anti-NP-2.5; C, IgM NP-2.5:NP-20 ratio; D, {lambda}-chain anti-NP-20; E, {lambda}-chain anti-NP-2.5; and F, {lambda}-chain NP-2.5:NP-20 ratio.

 
In contrast to the above differences in IgG response to high and low doses of NP-hemocyanin, affinity maturation (NP-2.5/NP-20 ratio) of the IgG anti-NP response was similar for IFN-{gamma}+/+ and IFN-{gamma}-/- mice for all three doses (p > 0.05; Fig. 1GoF). No difference was also observed in the affinity maturation of IgM Abs between the IFN-{gamma} groups (+/+, +/-, and -/-) for the three doses of NP-hemocyanin (p > 0.05; Fig. 1GoC).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The two major findings in this study are that HgIA is dependent on Th1-type, but not Th2-type cytokine responses, and that IFN-{gamma} is important for optimal in vivo IgG Ab responses to low doses of Ag. Although the systemic autoimmunity induced by HgCl2 has been considered to be a prototypic Th2-mediated disease, by using IL-4- and IFN-{gamma}-deficient mice, we clearly show that this is not the case. While this seems paradoxical, given HgIA is a humoral immune mediated disease associated with increases in Th2-type cytokines and IgG isotype responses, nonetheless, other autoantibody-mediated diseases, including spontaneous lupus (36, 37, 51) and experimental myasthenia gravis (52), were also recently found to be IFN-{gamma} dependent. Thus, without exception, humoral mediated autoimmune diseases have been found to be Th1 dependent, regardless of whether cytokine and IgG isotypes in diseased animals are of predominantly Th2 (this study) or Th1 (spontaneous lupus) type.

Based on these findings, we propose that the balance between Th1- and Th2-type responses does not directly contribute to autoimmune susceptibility. Indeed, the observations suggest that the findings in IFN-{gamma}-deficient mice are not due to Th1/Th2 predominance per se, but to the requirement for IFN-{gamma} to activate the immune system to respond to poorly antigenic determinants, including both self and nonself Ags. That IL-4-/- mice (Th1 predominance) did not show more severe disease than wild-type mice (Th2 predominance) is consistent with this possibility. Thus, the requirement for IFN-{gamma} may be applied to both cellular (as has been described for the lymphocytic choriomeningitis virus model of insulin-dependent diabetes mellitus; 53 and humoral mediated (this study and Refs. 36, 37, and 52) autoimmune diseases. Moreover, as there appears to be a dose relationship between disease susceptibility and the number of functional IFN-{gamma} genes, different levels of IFN-{gamma} appear to directly contribute to disease susceptibility. This is supported by the recent report by Balomenos et al. (51), showing ~55% IFN-{gamma} mRNA levels and attenuated disease in IFN-{gamma}+/-MRL-lpr mice. Immunization with high doses of Ag and a strong adjuvant could be expected to bypass the requirement for IFN-{gamma}. Indeed, several experimentally induced cell-mediated models of autoimmunity such as experimental allergic encephalomyelitis (54), experimental autoimmune uveoretinitis (55), and collagen-induced arthritis (56, 57) can be produced in IFN-{gamma}-deficient mice. Similarly, a strong genetic predisposition may lower the susceptibility threshold sufficiently to overcome the requirement for IFN-{gamma}, as suggested by the finding that IFN-{gamma}-deficient nonobese diabetic mice develop insulin-dependent diabetes (58).

It can be argued that the induction of HgIA in IL-4 gene knockout mice may possibly be due in part to duplication or compensation of Th2 function. Although this cannot be ruled out, it would appear unlikely, since studies have established that IL-4-/- mice have little to no Th2 cell activity, as evidenced by the lack of expression of other Th2 cytokines in T cells and a skewed Ig isotype profile showing increased IgG2a and very low IgG1 and IgE serum levels (39, 59). Furthermore, in vitro studies have indicated that IL-4 is essential for the generation of the Th2 lineage (60, 61). Studies to look at GATA-3 expression and surface expression of CCR3 and the IFN-{gamma}R ß2 subunit might be used to confirm a decrease of Th2 cells. Moreover, recently developed conditional gene knockout techniques (62) that permit deletions of genes or cell types at specific times might provide a means to resolve this issue. Nevertheless, the IL-4 knockout would seem to represent the extreme end of the spectrum in terms of Th1/Th2 imbalance, and the induction of disease in IL-4-/- mice, but absence in IFN-{gamma}-/- mice, strongly argues against a Th2 cell dependence of HgIA.

Recently, other exceptions to the Th1/Th2 paradigm in addition to this study and those discussed above for autoimmune responses have been reported, including studies of infections with intracellular pathogens, parasites and virus (63), and transplantation rejection (64, 65). Based on these findings, it is evident that the importance of a particular Th subset cannot be inferred by simple association and that the role of Th subtypes in immune processes is in most instances more complex than simple functional dichotomy. Thus, although the concept of Th1/Th2 has provided a useful and simple model for defining T cell regulation and function, delineation of the specific cytokines and cell types critical for the particular immune response is in most instances, such as in this study, more likely to be relevant than attempting to categorize responses as Th1 or Th2 (63).

Genetic (42) as well as Ig and TCR transgenic (66, 67) studies indicate susceptibility to autoimmune disease is a multistep process with several stages or checkpoints. The necessity for IFN-{gamma} for autoantibody production defines a checkpoint at the initiation of the autoimmune response with the potential to discriminate self and nonself recognition. As such, the IFN-{gamma} knockout autoimmune model may be useful for defining characteristics of self Ags and requirements for self Ag reactivity. Moreover, since IFN-{gamma} is a highly pleiotropic cytokine with immune modulating, inflammation-promoting, and cell-regulatory properties, further definition of the specific autoimmune pathways that require IFN-{gamma} may reveal specific therapeutic interventions that do not block effective responses to infectious agents.


    Acknowledgments
 
We thank Maoxiim Urista for technical assistance.


    Footnotes
 
1 This is The Scripps Research Institute Publication 11244-IMM. This work was supported in part by National Institutes of Health Grants AR42242, ES08666, ES07511, and ES08080, and a grant from Swedish Medical Research Council (Project 09453). Back

2 Address correspondence and reprint requests to Dr. Dwight H. Kono, Department of Immunology-IMM3, The Scripps Research Institute, 10550 N. Torrey Pines Road, La Jolla, CA 92037. E-mail address: Back

3 Abbreviations used in this paper: HgIA, mercury-induced autoimmunity; ANoA, anti-nucleolar Ab; HPRT, hypoxanthine-guanine phosphoribosyltransferase; NP, (4-hydroxy-3-nitrophenyl)acetyl. Back

Received for publication December 30, 1997. Accepted for publication March 5, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mosmann, T. R., H. Cherwinski, M. W. Bond, M. A. Giedlin, R. L. Coffman. 1986. Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 136:2348.[Abstract]
  2. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
  3. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.[Abstract/Free Full Text]
  4. Szabo, S. J., A. S. Dighe, U. Gubler, K. M. Murphy. 1997. Regulation of the interleukin (IL)-12R ß 2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185:817.[Abstract/Free Full Text]
  5. Zheng, W., R. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89:587.[Medline]
  6. Pernis, A., S. Gupta, K. J. Gollob, E. Garfein, R. L. Coffman, C. Schindler, P. Rothman. 1995. Lack of interferon-{gamma} receptor ß chain and the prevention of interferon-{gamma} signaling in Th1 cells. Science 269:245.[Abstract/Free Full Text]
  7. Sallusto, F., C. R. Mackay, A. Lanzavecchia. 1997. Selective expression of the eotaxin receptor CCR3 by human helper 2 cells. Science 277:2005.[Abstract/Free Full Text]
  8. Reiner, S. L., R. M. Locksley. 1995. The regulation of immunity to Leishmania major. Annu. Rev. Immunol. 13:151.[Medline]
  9. Gorham, J. D., M. L. Guler, R. G. Steen, A. J. Mackey, M. J. Daly, K. Frederick, W. F. Dietrich, K. M. Murphy. 1996. Genetic mapping of a murine locus controlling development of T helper 1/T helper 2 type responses. Proc. Natl. Acad. Sci. USA 93:12467.[Abstract/Free Full Text]
  10. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635.[Medline]
  11. Bottomly, K., S. L. Constant. 1997. Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annu. Rev. Immunol. 15:297.[Medline]
  12. Romagnani, S.. 1996. Short analytical review: TH1 and TH2 in human diseases. Clin. Immunol. Immunopathol. 80:225.[Medline]
  13. Charlton, B., K. J. Lafferty. 1995. The Th1/Th2 balance in autoimmunity. Curr. Opin. Immunol. 7:793.[Medline]
  14. Kroemer, G., F. Hirsch, A. Gonzalez-Garcia, C. Martinez. 1996. Differential involvement of Th1 and Th2 cytokines in autoimmune diseases. Autoimmunity 24:25.[Medline]
  15. Goldman, M., P. Druet, E. Gleichmann. 1991. TH2 cells in systemic autoimmunity: insights from allogeneic diseases and chemically-induced autoimmunity. Immunol. Today 12:223.[Medline]
  16. Mathieson, P. W.. 1995. Mercury: god of Th2 cells?. Clin. Exp. Immunol. 102:229.[Medline]
  17. Pollard, K. M., P. Hultman. 1997. Effects of mercury on the immune system. A. Sigel, and H. Sigel, eds. Metal Ions in Biological Systems 421. Marcel Dekker, Inc, New York.
  18. Pelletier, L., R. Pasquier, J. Rossert, M. C. Vial, C. Mandet, P. Druet. 1988. Autoreactive T cells in mercury-induced autoimmunity: ability to induce the autoimmune disease. J. Immunol. 140:750.[Abstract]
  19. Biancone, L., G. Andres, H. Ahn, A. Lim, C. Dai, R. Noelle, H. Yagita, C. DeMartino, I. Stamenkovic. 1996. Distinct regulatory roles of lymphocyte costimulatory pathways on T helper type 2-mediated autoimmune disease. J. Exp. Med. 183:1473.[Abstract/Free Full Text]
  20. Hultman, P., L. J. Bell, S. Enestrom, K. M. Pollard. 1993. Murine susceptibility to mercury. II. Autoantibody profiles and renal immune deposits in hybrid, backcross, and H-2d congenic mice. Clin. Immunol. Immunopathol. 68:9.[Medline]
  21. Ochel, M., H. W. Vohr, C. Pfeiffer, E. Gleichmann. 1991. IL-4 is required for the IgE and IgG1 increase and IgG1 autoantibody formation in mice treated with mercuric chloride. J. Immunol. 146:3006.[Abstract]
  22. Prigent, P., A. Saoudi, C. Pannetier, P. Graber, J. Y. Bonnefoy, P. Druet, F. Hirsch. 1995. Mercuric chloride, a chemical responsible for T helper cell (Th)2-mediated autoimmunity in brown Norway rats, directly triggers T cells to produce interleukin-4. J. Clin. Invest. 96:1484.
  23. Gillespie, K. M., A. Saoudi, J. Kuhn, C. J. Whittle, P. Druet, B. Blanche, P. W. Mathieson. 1996. Th1/Th2 cytokine gene expression after mercuric chloride in susceptible and resistant rat strains. Eur. J. Immunol. 26:2388.[Medline]
  24. Castedo, M., L. Pelletier, R. Pasquier, P. Druet. 1994. Improvement of TH1 functions during the regulation phase of mercury disease in brown Norway rats. Scand. J. Immunol. 39:144.[Medline]
  25. Van der Meide, P. H., R. J. Groenestein, M. C. de Labie, J. Aten, J. J. Weening. 1995. Susceptibility to mercuric chloride-induced glomerulonephritis is age-dependent: study of the role of IFN-{gamma}. Cell. Immunol. 162:131.[Medline]
  26. Mathieson, P. W., S. Thiru, D. B. Oliveira. 1993. Regulatory role of OX22high T cells in mercury-induced autoimmunity in the brown Norway rat. J. Exp. Med. 177:1309.[Abstract/Free Full Text]
  27. Saoudi, A., J. Kuhn, K. Huygen, Y. de Kozak, T. Velu, M. Goldman, P. Druet, B. Bellon. 1993. TH2 activated cells prevent experimental autoimmune uveoretinitis, a TH1-dependent autoimmune disease. Eur. J. Immunol. 23:3096.[Medline]
  28. Levine, S., A. Saltzman. 1989. Suppression of experimental allergic encephalomyelitis in rats by mercuric chloride. Chem. Biol. Interact. 69:17.[Medline]
  29. Druet, P., L. Pelletier. 1996. Th2 and Th1 autoreactive anti-class II cell lines in the rat suppress or induce autoimmunity. J. Autoimmun. 9:221.[Medline]
  30. Doth, M., M. Fricke, F. Nicoletti, G. Garotta, M.-L. Van Velthuysen, J. A. Bruijn, E. Gleichmann. 1997. Genetic differences in immune reactivity to mercuric chloride (HgCl2): immunosuppression of H-2d mice is mediated by interferon-{gamma} (IFN-{gamma}). Clin. Exp. Immunol. 109:149.[Medline]
  31. Prud’homme, G. J., D. H. Kono, A. N. Theofilopoulos. 1995. Quantitative polymerase chain reaction analysis reveals marked overexpression of interleukin-1 beta, interleukin-1 and interferon-{gamma} mRNA in the lymph nodes of lupus-prone mice. Mol. Immunol. 32:495.[Medline]
  32. Takahashi, S., L. Fossati, I. Iwamoto, J. Merino, R. Motta, T. Kobayakawa, S. Izui. 1996. Imbalance towards Th1 predominance is associated with acceleration of lupus-like autoimmune syndrome in MRL mice. J. Clin. Invest. 97:1597.[Medline]
  33. Jacob, C. O., P. H. van der Meide, H. O. McDevitt. 1987. In vivo treatment of (NZB x NZW)F1 lupus-like nephritis with monoclonal antibody to gamma interferon. J. Exp. Med. 166:198.
  34. Ozmen, L., D. Roman, M. Fountoulakis, G. Schmid, B. Ryffel, G. Garotta. 1995. Experimental therapy of systemic lupus erythematosus: the treatment of NZB/W mice with mouse soluble interferon-{gamma} receptor inhibits the onset of glomerulonephritis. Eur. J. Immunol. 25:6.[Medline]
  35. Santiago, M., L. Fossati, C. Jacquiet, W. Muller, S. Izui, L. Reininger. 1997. Interleukin-4 protects against a genetically linked lupus-like autoimmune syndrome. J. Exp. Med. 185:65.[Abstract/Free Full Text]
  36. Peng, S. L., J. Moslehi, J. Craft. 1997. Roles of interferon-{gamma} and interleukin-4 in murine lupus. J. Clin. Invest. 99:1936.[Medline]
  37. Haas, C., B. Ryffel, H. M. Le. 1997. IFN-{gamma} is essential for the development of autoimmune glomerulonephritis in MRL/Ipr mice. J. Immunol. 158:5484.[Abstract]
  38. Dalton, D. K., S. Pitts-Meek, S. Keshav, I. S. Figari, A. Bradley, T. A. Stewart. 1993. Multiple defects of immune cell function in mice with disrupted interferon-{gamma} genes. Science 259:1739.[Abstract/Free Full Text]
  39. Kuhn, R., K. Rajewsky, W. Muller. 1991. Generation and analysis of interleukin-4 deficient mice. Science 254:707.[Abstract/Free Full Text]
  40. Takeuchi, K., S. J. Turley, E. M. Tan, K. M. Pollard. 1995. Analysis of the autoantibody response to fibrillarin in human disease and murine models of autoimmunity. J. Immunol. 154:961.[Abstract]
  41. Burlingame, R. W., R. L. Rubin, R. S. Balderas, A. N. Theofilopoulos. 1993. The genesis and evolution of anti-chromatin autoantibodies in murine lupus implicates T-dependent immunization with self antigen. J. Clin. Invest. 91:1687.
  42. Kono, D. H., R. W. Burlingame, D. G. Owens, A. Kuramochi, R. S. Balderas, D. Balomenos, A. N. Theofilopoulos. 1994. Lupus susceptibility loci in New Zealand mice. Proc. Natl. Acad. Sci. USA 91:10168.[Abstract/Free Full Text]
  43. Bell, S. A., M. V. Hobbs, R. L. Rubin. 1992. Isotype-restricted hyperimmunity in a murine model of the toxic oil syndrome. J. Immunol. 148:3369.[Abstract]
  44. Turley, S. J., E. M. Tan, K. M. Pollard. 1993. Molecular cloning and sequence analysis of U3 snoRNA-associated mouse fibrillarin. Biochim. Biophys. Acta 1216:119.[Medline]
  45. Hultman, P., S. Enestrom. 1992. Dose-response studies in murine mercury-induced autoimmunity and immune-complex disease. Toxicol. Appl. Pharmacol. 113:199.[Medline]
  46. Van Vliet, E., M. Uhrberg, C. Stein, E. Gleichmann. 1993. MHC control of IL-4-dependent enhancement of B cell Ia expression and Ig class switching in mice treated with mercuric chloride. Int. Arch. Allergy Immunol. 101:392.[Medline]
  47. Huang, S., W. Hendricks, A. Althage, S. Hemmi, H. Bluethmann, R. Kamijo, J. Vilcek, R. M. Zinkernagel. 1993. Immune response in mice that lack the interferon-{gamma} receptor. Science 259:1742.[Abstract/Free Full Text]
  48. Graham, M. D., D. K. Dalton, D. Giltinan, V. L. Braciale, T. A. Stewart, T. J. Braciale. 1993. Response to influenza infection in mice with a targeted disruption in the interferon-{gamma} gene. J. Exp. Med. 178:1725.[Abstract/Free Full Text]
  49. Schijns, V. E., B. L. Haagmans, E. O. Rijke, S. Huang, M. Aguet, M. C. Horzinek. 1994. IFN-{gamma} receptor-deficient mice generate antiviral Th1-characteristic cytokine profiles but altered antibody responses. J. Immunol. 153:2029.[Abstract]
  50. Marion, T. N., D. M. Tillman, N. T. Jou, R. J. Hill. 1992. Selection of immunoglobulin variable regions in autoimmunity to DNA. Immunol. Rev. 128:123.[Medline]
  51. Balomenos, D., R. Rumold, A. N. Theofilopoulos. 1998. Interferon-{gamma} is required for lupus-like disease and lymphoaccumulation in MRL-lpr mice. J. Clin. Invest. 101:364.[Medline]
  52. Balasa, B., C. Deng, J. Lee, L. M. Bradley, D. K. Dalton, P. Christadoss, N. Sarvetnick. 1997. Interferon {gamma} (IFN-{gamma}) is necessary for the genesis of acetylcholine receptor-induced clinical experimental autoimmune Myasthenia gravis in mice. J. Exp. Med. 186:385.[Abstract/Free Full Text]
  53. Von Herrath, M. G., M. B. A. Oldstone. 1997. Interferon-gamma is essential for destruction of ß cells and development of insulin-dependent diabetes mellitus. J. Exp. Med. 185:531.[Abstract/Free Full Text]
  54. Ferber, I. A., S. Brocke, C. Taylor-Edwards, W. Ridgway, C. Dinisco, L. Steinman, D. Dalton, C. G. Fathmann. 1996. Mice with a disrupted IFN-{gamma} gene are susceptible to the induction of experimental autoimmune encephalomyelitis (EAE). J. Immunol. 156:5.[Abstract]
  55. Jones, L. S., L. V. Rizzo, R. K. Agarwal, T. K. Tarrant, C. C. Chan, B. Wiggert, R. R. Caspi. 1997. IFN-{gamma}-deficient mice develop experimental autoimmune uveitis in the context of a deviant effector response. J. Immunol. 158:5997.[Abstract]
  56. Manoury-Schwartz, B., G. Chiocchia, N. Bessis, O. Abehsira-Amar, F. Batteux, S. Muller, S. Huang, M. C. Boissier, C. Fournier. 1997. High susceptibility to collagen-induced arthritis in mice lacking IFN-{gamma} receptors. J. Immunol. 158:5501.[Abstract]
  57. Vermeire, K., H. Heremans, M. Vandeputte, S. Huang, A. Billiau, P. Matthys. 1997. Accelerated collagen-induced arthritis in IFN-{gamma} receptor-deficient mice. J. Immunol. 158:5507.[Abstract]
  58. Hultgren, B., X. Huang, N. Dybdal, T. A. Stewart. 1996. Genetic absence of gamma-interferon delays but does not prevent diabetes in NOD mice. Diabetes 45:812.[Abstract]
  59. Kopf, M., G. LeGros, M. Bachmann, M. C. Lamers, H. Bluethmann, G. Kohler. 1993. Disruption of the murine IL-4 gene blocks Th2 cytokine responses. Nature 362:245.[Medline]
  60. Le Gros, G., S. Z. Ben-Sasson, R. Seder, F. D. Finkelman, W. E. Paul. 1990. Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro: IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells. J. Exp. Med. 172:921.[Abstract/Free Full Text]
  61. Swain, S. L., A. D. Weinberg, M. English, G. Huston. 1990. IL-4 directs the development of Th2-like helper effectors. J. Immunol. 145:3796.[Abstract]
  62. Kuhn, R., F. Schwenk. 1997. Advances in gene targeting methods. Curr. Opin. Immunol. 9:183.[Medline]
  63. Allen, J. E., R. M. Maizels. 1997. Th1-Th2: reliable paradigm or dangerous dogma?. Immunol. Today 18:387.[Medline]
  64. Strom, T. B., P. Roy-Chaudhury, R. Manfro, X. X. Zheng, P. W. Nickerson, K. Wood, A. Bushell. 1996. The Th1/Th2 paradigm and the allograft response. Curr. Opin. Immunol. 8:688.[Medline]
  65. Piccotti, J. R., S. Y. Chan, A. M. VanBuskirk, E. J. Eichwald, D. K. Bishop. 1997. Are Th2 helper T lymphocytes beneficial, deleterious, or irrelevant in promoting allograft survival?. Transplantation 63:619.[Medline]
  66. Goodnow, C. C., J. G. Cyster, S. B. Hartley, S. E. Bell, M. P. Cooke, J. I. Healy, S. Akkaraju, J. C. Rathmell, S. L. Pogue, K. P. Shokat. 1995. Self-tolerance checkpoints in B lymphocyte development. Adv. Immunol. 59:279.[Medline]
  67. Andre, I., A. Gonzalez, B. Wang, J. Katz, C. Benoist, D. Mathis. 1996. Checkpoints in the progression of autoimmune disease: lessons from diabetes models. Proc. Natl. Acad. Sci. USA 93:2260.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S. Fagoonee, C. Caorsi, M. Giovarelli, M. Stoltenberg, L. Silengo, F. Altruda, G. Camussi, E. Tolosano, and B. Bussolati
Lack of Plasma Protein Hemopexin Dampens Mercury-Induced Autoimmune Response in Mice
J. Immunol., August 1, 2008; 181(3): 1937 - 1947.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
V. Sancho-Shimizu, R. Khan, S. Mostowy, L. Lariviere, R. Wilkinson, N. Riendeau, M. Behr, and D. Malo
Molecular Genetic Analysis of Two Loci (Ity2 and Ity3) Involved in the Host Response to Infection With Salmonella Typhimurium Using Congenic Mice and Expression Profiling
Genetics, October 1, 2007; 177(2): 1125 - 1139.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Agrawal, P. Kaushal, S. Agrawal, S. Gollapudi, and S. Gupta
Thimerosal induces TH2 responses via influencing cytokine secretion by human dendritic cells
J. Leukoc. Biol., February 1, 2007; 81(2): 474 - 482.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. S. Vinay, J. D. Kim, and B. S. Kwon
Amelioration of Mercury-Induced Autoimmunity by 4-1BB
J. Immunol., October 15, 2006; 177(8): 5708 - 5717.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Zheng, S. Gallucci, J. P. Gaughan, J. A. Gross, and M. Monestier
A Role for B Cell-Activating Factor of the TNF Family in Chemically Induced Autoimmunity
J. Immunol., November 1, 2005; 175(9): 6163 - 6168.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. K. Haraldsson, N. G. dela Paz, J. G. Kuan, G. S. Gilkeson, A. N. Theofilopoulos, and D. H. Kono
Autoimmune Alterations Induced by the New Zealand Black Lbw2 Locus in BWF1 Mice
J. Immunol., April 15, 2005; 174(8): 5065 - 5073.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. M. Pollard, M. Arnush, P. Hultman, and D. H. Kono
Costimulation Requirements of Induced Murine Systemic Autoimmune Disease
J. Immunol., November 1, 2004; 173(9): 5880 - 5887.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Zheng and M. Monestier
Inhibitory Signal Override Increases Susceptibility to Mercury-Induced Autoimmunity
J. Immunol., August 1, 2003; 171(3): 1596 - 1601.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Chen, T. Rockel, G. Steinweger, P. Hemmerich, J. Risch, and A. von Mikecz
Subcellular Recruitment of Fibrillarin to Nucleoplasmic Proteasomes: Implications for Processing of a Nucleolar Autoantigen
Mol. Biol. Cell, October 1, 2002; 13(10): 3576 - 3587.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. B. Sass, D. T. Haselow, and E. K. Silbergeld
Methylmercury-Induced Decrement in Neuronal Migration May Involve Cytokine-Dependent Mechanisms: A Novel Method to Assess Neuronal Movement in Vitro
Toxicol. Sci., September 1, 2001; 63(1): 74 - 81.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. H. Kono, M. S. Park, A. Szydlik, K. M. Haraldsson, J. D. Kuan, D. L. Pearson, P. Hultman, and K. M. Pollard
Resistance to Xenobiotic-Induced Autoimmunity Maps to Chromosome 1
J. Immunol., August 15, 2001; 167(4): 2396 - 2403.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. M. Pollard, D. L. Pearson, M. Bluthner, and E. M. Tan
Proteolytic Cleavage of a Self-Antigen Following Xenobiotic-Induced Cell Death Produces a Fragment with Novel Immunogenic Properties
J. Immunol., August 15, 2000; 165(4): 2263 - 2270.
[Abstract] [Full Text] [PDF]


Home page