| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
CUTTING EDGE |
B and c-Jun N-Terminal Kinase1
*
Cytokine Research Section, Department of Molecular Oncology, The University of Texas M.D. Anderson Cancer Center, Houston, TX 77030;
Human Genome Sciences, Inc., Rockville, MD 20850;
Division of Immunobiology, The National Institute for Biological Standards and Control, South Mimms, U.K.; and
§
Department of Cell and Molecular Biology, Northwestern University Medical School, Chicago, IL 60611
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and c-Jun
N-terminal kinase). The predicted amino acid sequence of TRANK was
highly homologous to that of the thiol-specific antioxidant proteins.
Unlike these proteins, however, TRANK had a putative secretory signal
polypeptide and was found to be secreted by cells. TRANK was expressed
in most tissues and cell lines, and the gene that encodes it was mapped
to chromosome Xp21–22.1. TRANK activated NF-B and induced the
degradation of the inhibitory subunit of NF-B. In addition, TRANK
up-regulated the expression of NF-B-dependent gene products, ICAM-1,
and inducible nitric oxide synthase. TRANK also activated c-Jun
N-terminal kinase and induced the proliferation of normal human
foreskin fibroblasts. Its homology with antioxidant proteins, wide
distribution in tissues, and ability to activate NF-B and c-Jun
N-terminal kinase suggest that TRANK plays an important role in
inflammation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To find the antioxidant protein that may be secreted by the cells, we
compared the expressed sequence tag database with the signal sequences
and the NKEF sequence. This resulted in the identification of a novel
gene whose product was named TRANK based on its sequence homology to
thioredoxin peroxidase (the product of the nkef-B gene) and
its ability to activate NF-B and c-Jun N-terminal kinase (JNK).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
TRANK was identified by a systematic comparison of the signal peptide and NKEF sequence homology with the expressed sequence tag database (Human Genome Sciences, Rockville, MD) and by functional screening assays (6, 7, 8). The sequence encoding the putative natural TRANK protein (aa 32–271) was amplified employing standard PCR techniques using the following primers: 5'NcoI, CGCCCATGGCTGGAGCTGTGCAGGG and 3'HindIII, CGCAAGCTTCAATTCAGTTTATCGAAATACTTCAGC. The amplified fragment was subsequently purified, digested with NcoI and HindIII, and cloned in a pQE60 Escherichia coli expression vector. The cloning, expression, and confirmation of the cloned sequence were performed using standard procedures. The chromosomal localization of the TRANK gene was performed as described previously (9).
The protein was purified using (NH4)2SO4 and polyethylene glycol precipitation followed by anion exchange chromatography performed on an HQ50 column (Poros CM20; PerSeptive Biosystems, Hertfordshire, U.K.). The purified protein migrated as a single band by SDS-PAGE, and the N-terminal aa sequence demonstrated that >95% of the purified TRANK contained the expected N-terminal sequence (MAGAVQ). Endotoxin levels assayed by the amebocyte lysate test (BioWhittaker, Walkersville, MD) proved to be <16.5 endotoxin U/mg protein.
Northern blot analysis
Two filters containing 
2 µg of poly(A)+
RNA per lane from various human tissues (Clontech, Palo Alto, CA) were
probed with [32P]-labeled TRANK cDNA. The RNA from a
selected panel of human cell lines was also probed according to a
similar method.
Immunoprecipitation and Western blot analysis of TRANK
HL-60 and Jurkat cells (2 x 107) were grown in culture for 24 h. Conditioned media (10 ml) and cell lysate (2.25 ml) were subsequently immunoprecipitated and analyzed by Western blot using anti-TRANK polyclonal antisera with rTRANK (100 ng) as a control. Blotting and detection were performed as described in the protocol for the enhanced chemiluminescence Western blotting kit (Boehringer Mannheim, Arlington Heights, IL).
Electrophoretic mobility shift assays (EMSAs)
NF-B activation was analyzed by electrophoretic mobility
shift assay as described previously (10).
Western blot analysis of inhibitory subunit of NF-B (IB
)
Cytoplasmic extracts of U-937 cells that had been treated for
different lengths of time with TRANK were used to examine IB
degradation by Western blot analysis as described previously
(11).
NF-B luciferase assay
In the NF-B luciferase assay, a consensus NF-B element was
cloned into the pSEAP-Basic vector (Clontech). A stable Jurkat cell
line (Jurkat/NF-B-SEAP) that showed good activation in response to
TNF was used in the assay. Test samples were added to
Jurkat/NF-B-SEAP cells, and the alkaline phosphatase activity was
measured at 405 nm after 72 h.
Determination of ICAM-1 expression
ICAM-1 expression was induced in the EAhy926 hybrid cell line (human vascular endothelial cell line x human A549 lung carcinoma cell line) and in the U-138 MG human umbilical vein endothelial cell line as described previously (12). The levels of induced ICAM-1 were measured by ELISA using a mAb to human ICAM-1 (CD54) (Camfolio; Becton Dickinson, Oxford, U.K.).
Measurement of inducible nitric oxide synthase (iNOS) and nitrite
Rat cortical astrocyte cultures were treated with various concentrations of TRANK for 12 h, RNA was isolated, and iNOS mRNA levels were measured by slot blot analysis as described previously (13). The levels of the stable nitric oxide metabolite, nitrite, were measured in the conditioned medium of TRANK-treated cells (48 h) after any nitrate had been converted into nitrite with nitrate reductase and NADPH at 37°C for 1 h (13).
JNK assay
The JNK assay was performed according to the method that was developed in our laboratory and recently described (14).
Proliferation assays
The effect of TRANK on the proliferation of human diploid foreskin fibroblasts was examined as described previously (15). Fibroblasts (5000/0.1 ml) were cultured with different concentrations of TRANK for 72 h at 37°C in 96-well plates, and proliferation was examined by the tritiated thymidine uptake method.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We identified, cloned, and expressed a new protein called TRANK.
This protein exhibits significant sequence homology to several
antioxidant proteins, including NKEF-A, NKEF-B (thioredoxin
peroxidase), proliferation-associated gene product, and murine
erythroleukemia-related 5 (see Refs. 2 and 5) (Fig. 1
A). Specifically, the
nucleotide sequence of TRANK cDNA was 58% and 56% identical to that
of NKEF-A and NKEF-B, respectively. The deduced aa sequence showed a
66% and 68% homology to that of NKEF-A and NKEF-B, respectively (see
Fig. 1A). Unlike NKEF-A and NKEF-B, however, TRANK
had a putative N-terminal secretory signal sequence. The results of the
Western blot analysis of the conditioned media suggested that TRANK is
indeed secreted from Jurkat and HL-60 cells (Fig. 1B).
|
A) was amplified using standard PCR techniques and
then cloned and expressed in E. coli; the recombinant
protein was subsequently purified. SDS-PAGE analysis of TRANK showed a
single band at around 30 kDa. The size of rTRANK appeared to be
slightly greater than the natural protein, which could be due to the
difference in cleavage site at the amino terminal. Tissue distribution of TRANK and its production in different human cell lines
The gene that encodes for human TRANK was mapped to human
chromosome Xp21–22.1. Northern blot analysis showed that TRANK was
highly expressed in the testis, ovary, heart, liver, skeletal muscle,
and pancreas. Moderate expression was seen in the spleen, thymus,
prostrate, small intestine, colon, placenta, and lung, while low
expression was seen in peripheral blood leukocytes and the brain (Fig. 2A). Almost all types
of cells among human tumor cell lines transcribed TRANK mRNA. However,
T cells (Jurkat), kidney cells (A-293), endothelial cells (VE 11), and
Chang liver cells showed relatively high expression (Fig. 2B).
|
B
Treating human myeloid U-937 cells with TRANK for 30 min revealed
a dose-dependent activation of NF-B by EMSA (Fig. 3A). The gel shift band
was specific, as it could be competed out with an unlabeled
oligonucleotide and was supershifted by anti-p50 or anti-p65 Ab
only (Fig. 3B) indicating that it is composed of p50
and p65 subunits (16). To rule out the possibility that the activity
observed was not the result of a contaminant, TRANK was inactivated
either by treatment with 1% trypsin or by heat denaturation (100°C
for 10 min) (Fig. 3C). Both treatments abolished
TRANK-induced NF-B activity, indicating that a protein is
responsible for its activation. We also pretreated TRANK with
polyclonal Abs to the protein. This blocked NF-B activation (Fig. 3D), thereby indicating that the effect is specific.
TRANK activated NF-B in a time-dependent manner, reaching a peak by
4 h and declining thereafter (Fig. 3E). The
degradation of IB in cells treated with TRANK for different
lengths of time was also examined using Western blot analysis. The
analysis showed that IB started to degrade at 3 h, had
almost completely degraded by 4 h, and began to be resynthesized
at 8 h (Fig. 3F). We also examined the effect of
TRANK on NF-B-dependent luciferase gene transcription. The
results shown in Figure 3G reveal that TRANK induced an
approximately sevenfold increase in luciferase activity. Similar to
NF-B activation, heat-denaturing TRANK significantly abolished its
ability to induce luciferase activity (Fig. 3G).
|
Because the expression of iNOS and ICAM-1 can be regulated by
NF-B (17, 18), we examined the effect of TRANK on the expression of
these molecules. Treating rat astrocyte cultures with TRANK resulted in
a stimulation of iNOS mRNA levels (Fig. 4A) and a
dose-dependent increase in nitrite accumulation (Fig. 4B). TRANK also stimulated ICAM-1 expression in
EAhy926 cells in a dose-dependent manner (Fig. 4C),
and polyclonal antiserum to TRANK partially neutralized the
TRANK-mediated enhancement of ICAM-1 expression (data not shown).
|
Although TRANK was found to have no cytotoxic effect on most
cells, it did induce the proliferation of normal human diploid
fibroblasts in a dose-dependent manner (Fig. 4D). A
more than threefold increase in fibroblast proliferation over the
untreated control was observed. This finding indicated that TRANK is a
growth factor for normal human fibroblast cells.
TRANK activates JNK
The activation of JNK is another early event that is initiated by
many other stress stimuli, including cytokines, via reactive oxygen
species. Treating U-937 cells with TRANK led to an increase in JNK
activity in a time-dependent fashion; this activity peaked at 120 min
(8.5-fold increase) and gradually declined thereafter (Fig. 4E).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and JNK,
induce ICAM-1 and iNOS expression, and stimulate the proliferation of
normal human fibroblasts (see 14 . Recently, it has been shown
that transfecting cells with the thioredoxin peroxidase gene
(nkef-B) can block apoptosis (19).
Similarly, the overexpression of another thioredoxin peroxidase gene,
A0E372, blocked the activation of NF-B and the
degradation of IB that were induced by TNF and phorbol ester (2),
consistent with the antioxidant properties of this gene product. (1).
However, these results differ from ours in that TRANK induces NF-B
and JNK and consequently may play a role in the induction rather than
the inhibition of inflammation.
Our results also suggest that there are specific receptors through
which TRANK interacts with cells. Thioredoxin (also called adult T cell
leukemia-derived factor), an antioxidant protein, blocks TNF-mediated
cytotoxicity when exposed to U-937 cells from outside (20) and inhibits
PMA-induced NF-B activation in HeLa cells (21). Although the
inhibitory effect of thioredoxin occurred at concentrations similar to
that used with TRANK in our studies (21), thioredoxin did not activate
NF-B. Even though thioredoxin was identified more than 10 years ago,
no thioredoxin receptor has yet been identified. How thioredoxin is
taken up by cells is therefore completely unknown. Like thioredoxin,
TRANK is also a secreted protein. The wide tissue distribution of
TRANK, its secretion by cells, and its ability to activate NF-B and
JNK and induce fibroblast proliferation together suggest that it plays
an important role in inflammation.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Bharat B. Aggarwal, Cytokine Research Section, Department of Molecular Oncology, The University of Texas M.D. Anderson Cancer Center, Houston, TX 77030. E-mail address:
3 Abbreviations used in this paper: NKEF, NK enhancing factor; JNK, c-Jun N-terminal kinase; TRANK, thioredoxin peroxidase-related activator of NF-B and c-Jun N-terminal kinase; iNOS, inducible nitric oxide synthase; IB, inhibitory subunit of NF-B; aa, amino acid; EMSA, electrophoretic mobility shift assay.
Received for publication March 20, 1998. Accepted for publication April 27, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B activation. J. Biol. Chem. 272:30952.B activation induced by tumor necrosis factor requires membrane-associated components: comparison with pathway activated by ceramide. J. Biol. Chem. 269:25369.B activation, and c-Jun kinase activation. J. Immunol. 160:3152.B signal transduction pathway. Proc. Natl. Acad. Sci. USA 91:11527.B/Rel in induction of nitric oxide synthase. J. Biol. Chem. 269:4705. is mediated by the nuclear factor-B heterodimers p65/p65 and p65/c-Rel in the absence of p50. Cell Growth Differ. 8:335.[Abstract]
B. Methods Enzymol. 252:253.[Medline]
This article has been cited by other articles:
|
|
 |
|
  D. Aguilar, L. Skrabanek, S. S. Gross, B. Oliva, and F. Campagne Beyond tissueInfo: functional prediction using tissue expression profile similarity searches Nucleic Acids Res., June 1, 2008; 36(11): 3728 - 3737. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Y. Chan, W.-J. Qian, D. L. Diamond, T. Liu, M. A. Gritsenko, M. E. Monroe, D. G. Camp II, R. D. Smith, and M. G. Katze Quantitative Analysis of Human Immunodeficiency Virus Type 1-Infected CD4+ Cell Proteome: Dysregulated Cell Cycle Progression and Nuclear Transport Coincide with Robust Virus Production J. Virol., July 15, 2007; 81(14): 7571 - 7583. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-M. Wong, Y. Zhou, R. W. M. Ng, H.-f. Kung, and D.-Y. Jin Cooperation of Yeast Peroxiredoxins Tsa1p and Tsa2p in the Cellular Defense against Oxidative and Nitrosative Stress J. Biol. Chem., February 8, 2002; 277(7): 5385 - 5394. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Ross, V. J. Findlay, P. Malakasi, and B. A. Morgan Thioredoxin Peroxidase Is Required for the Transcriptional Response to Oxidative Stress in Budding Yeast Mol. Biol. Cell, August 1, 2000; 11(8): 2631 - 2642. [Abstract] [Full Text]
|
|
|
|
|
|
S. P. Lee, Y. S. Hwang, Y. J. Kim, K.-S. Kwon, H. J. Kim, K. Kim, and H. Z. Chae Cyclophilin A Binds to Peroxiredoxins and Activates Its Peroxidase Activity J. Biol. Chem., August 3, 2001; 276(32): 29826 - 29832. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
