The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vaishnaw, A. K.
Right arrow Articles by Morley, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vaishnaw, A. K.
Right arrow Articles by Morley, B. J.
The Journal of Immunology, 1998, 160: 4353-4360.
Copyright © 1998 by The American Association of Immunologists

Regulation of Transcription of the TATA-less Human Complement Component C4 Gene1

Akshay K. Vaishnaw2,3, Tracey J. Mitchell2, S. Jane Rose, Mark J. Walport and Bernard J. Morley4

Rheumatology Section, Division of Medicine, Imperial College School of Medicine, London, U.K.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The 5'-sequences flanking the human complement component C4 genes (C4A and C4B) have been analyzed for their ability to direct expression of a reporter gene in cell lines that constitutively express or do not express C4. No difference in the level of reporter gene expression was detected in cells transfected with C4A- or C4B-specific constructs. A series of reporter constructs containing progressively truncated C4 promoter fragments transfected into the hepatocyte Hep G2 cell line, identified the sequence contained within the region -178 to -39 as that associated with maximal reporter gene expression. This region contains consensus binding motifs for nuclear factor 1 (-110 to -97), Sp1 (-57 to -49), and three basic helix-loop-helix (-137 to -132, -98 to -93, and -78 to -73)-like transcription factors. Electromobility shift assays and DNase I footprinting analysis showed specific DNA-protein interactions of the C4 promoter at the nuclear factor 1, two E box (-98 to -93 and -78 to -73), and Sp1 binding domains. Site-directed mutagenesis of the Sp1 binding site resulted in total abrogation of reporter gene expression and mutation of the E box (-78 to -73) resulted in a 8-fold reduction in expression. We conclude that the Sp1 binding site at position -57 to -49 is critical for accurately initiated, basal transcription of C4.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The fourth component of the complement system plays a pivotal role in the activation of the classical and recently described mannan-binding lectin (1) pathways as a constituent of the C3 convertase. Two C4 isotypes have been described in humans (C4A and C4B). These share >99% nucleotide identity (2, 3), and both generate C4b upon activation. C4b derived from C4A has been shown to opsonize protein-containing immune complexes more efficiently than that derived from C4B (4). This may explain the high prevalence of C4A null alleles in SLE patients (5), where failure to opsonize immune complexes in the periphery could lead to deposition and inflammation (reviewed in 6 . It also raises the possibility that subtle defects in the regulation of C4 expression may have pathogenic relevance.

C4 is encoded by tandemly duplicated loci, located in the MHC class III region (7, 8). The nonhomologous duplication event that resulted in formation of these tandem loci also involved regions upstream of the genes (9). An equivalent duplication is seen in the mouse H-2 region, giving rise to the C4 isotypes, C4 and C4-sex-limited protein (10). There is significant identity of the sequence (>76%) up to position -150 between the human and mouse C4 promoter regions, and both share common consensus binding motifs for potential regulatory elements. Both human and murine C4 genes belong to an expanding group, transcribed by RNA polymerase II, which lack consensus TATA and CCAAT boxes. In the mouse, three sequence motifs, an initiator element (-1 to +12), an E box (-75 to -70), and a nuclear factor 1 (NF-1)5 (-112 to -87) binding site have been shown to be functionally important in directing high level, accurately initiated C4 expression (11, 12). These sites are conserved in the human, but to date there are no data regarding their role in the regulation of human C4 expression. We have previously demonstrated tissue-specific DNase I-hypersensitive sites immediately 5' of the C4A and C4B cap sites (13), suggesting that this region contains key transcriptional elements. A similar DNase I-hypersensitive site has also been identified in the mouse C4 promoter (14) which is consistent with functional data that have localized the transcription factor binding sites to the 5'-flanking regions within 150 bp of the transcription start site.

The liver is the main source of serum C4, and this is reflected in the high level of C4 mRNA and protein expression by the human hepatoma cell line Hep G2 (15, 16). Additional cell types that synthesize and secrete C4 include PBMC (17), glomerular epithelial cells (18), proximal tubular cells of the kidney (19), fibroblasts (20), and synoviocytes (21). During the acute phase response, serum concentration of C4 increases by ~50%. This is predominantly mediated by IFN-{gamma}, which is the only cytokine to induce C4 expression in Hep G2 cells (16), Il-1, Il-6, and TNF-{alpha} having no effect (16, 22, 23). We have previously shown that in Hep G2 cells the major effector mechanism by which IFN-{gamma} up-regulates C4 expression is through stabilization of C4 mRNA (24).

To define the cis-acting elements necessary for high level tissue-specific expression of human C4, we have determined the capacity of progressively truncated C4 promoter fragments to drive expression of a reporter gene in two cell lines, Hep G2 (hepatocyte) and HeLa (epithelial) cells. In vitro DNA-protein interactions were studied using DNase I footprinting and electromobility shift assays (EMSA). We now report that maximal promoter activity is associated with a compact fragment (-126 to +62) that contains consensus binding motifs for NF-1 (-110 to -93), two E boxes (-98 to -93 and -78 to -73), and Sp1 (-57 to -49). Moreover, our data also demonstrate that the presence of the Sp1 binding site is critical for C4 expression.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture

Cultured cell lines were obtained from the European Collection of Animal Cell Cultures (Wiltshire, U.K.). All reagents were supplied by Life Technologies (Paisley, Scotland) unless otherwise noted. Hep G2 cells were cultured in DMEM supplemented with 15% FCS, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U/ml penicillin, and 100 µg/ml streptomycin. K562 and HeLa cells were grown in RPMI supplemented with 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin.

C4-ß globin reporter constructs

A promoterless ß globin fragment was amplified using the PCR from a plasmid, pNß1.1 (25), containing the entire ß-globin gene. Primers Y1 (ggactctgcagGTGTTCACTAGCAACCTC, +22 to +39) and Y3 (ccatactgcagAATGCACTGACCTCCCAC, +1670 to +1653) were used to amplify a 1650-bp amplicon that spanned the ß-globin gene (primer sequence complementary to the ß-globin gene is in upper case), including 29 bp of the 5'-untranslated region and terminating 64 bp downstream of the polyadenylation site. This fragment was cloned via PstI restriction sites in the primer sequence into the plasmid pBluescript SK+ (Stratagene, Cambridge, U.K.). This reporter construct was termed pß.

C4 5'-flanking regions were generated using the PCR from cosmids containing the C4 genes, as described previously (13). A series of seven 5' primers, progressively closer to the C4 cap site and a common 3' primer termed C4.25 (AGCAGCCTCATGGCTGGAGG) corresponding to position +62 to +43 downstream of the C4 cap site were used. Primers OSG1.2 and G11.2 are upstream of the C4 duplication breakpoint at -1525 (9) and amplify C4B- and C4A-specific fragments, respectively; other primers hybridize to sequences common to both genes. PCR amplicons were cloned into the SmaI site of pß immediately upstream of the ß-globin gene. The seven pß4 reporter constructs were termed pßC4B (OSG1.2, TTGCCACTATCTGGACAAGGC, -1805 to -1784), pßC4A (G11.2, TGGCTAGCTGTGCCTGGAGC, -1558 to -1539), pß4.8 (C4.8, CTTCAGGAACCCTCCTCCGC, -1043 to -1024), pß4.4 (C4.4, GGTTATTTCTGGGCCAAGATTCAG, -178 to -155), pß4.3 (C4.3, GGTGCCCCCACCACTCTGGGC, -126 to -106), pß4.2 (C4.2, TGTCACGTGGTTTCCCAGC, -81 to -63), and pß4.1 (C4.1, AGGTCCAGAGTCAACTCTGCC, -39 to -19); the 5' oligonucleotide primer location with respect to the C4 cap site (26) is given in parentheses. Constructs were sequenced (fmol cycle sequencing kit, Promega, Southampton, U.K.) using a combination of 32P-end-labeled C4 primers and B2, a ß-globin specific primer (CAGGTGCACCATGGTGTCTGTTTG, +62 to +39). The distance between the authentic C4 cap site in pß4 reporter constructs and the 5' end of the sequence complementary to B2 was 112 bp.

Three reporter constructs were generated containing mutagenized binding sites for Sp1 (-57 to -49), the E box at position -78 to -73, and both these domains, designated pßSp1mut, pßEmut, and pßEGmut, respectively. All three mutant constructs spanned positions -81 to +62 and were amplified in a PCR using a forward primer that introduced multiple mismatches (bold and underlined) in the transcription factor consensus binding motifs Sp1mut (TGTCACGTGGTTTCCCAGCTTAGCTTGTATCGTGGAGGAGCAGG (-81 to -37)) and Emut (TGTCACGAAGTTTCCCAGC (-81 to -63)), respectively. The reverse primer in the PCR was C4.25 (shown above). The construct containing both a mutagenized Sp1 and an E box was generated using the Emut primer (-81 to -63) with pßSp1mut as template DNA in a PCR. The presence of mutations in the transcription factor consensus binding motifs was verified by sequencing, performed as described above. A control construct Hß, which expresses human ß-globin (a gift from Dr. N. Proudfoot, University of Oxford) was used for cotransfection. Hß is driven by the viral SV40 enhancer, contains the entire ß-globin gene (HpaI-PstI fragment) including upstream sequences, and has the same 3' end as the ß-globin gene in pß (27).

Transient transfections and primer extension analysis

Hep G2 cells were transfected by the calcium phosphate method (28). Cells (2 x 106) were transfected with 6 µg each of the test and control constructs. A 10% glycerol shock was performed for 1 min 6 h posttransfection. HeLa cells were transfected by electroporation using a Cell Ject apparatus (Flowgen, Lichfield Staffordshire, U.K.). Cells (5 x 106 /9-cm plate) were transfected with 20 µg of each test construct and 20 µg of control (Hß) plasmid DNA. Optimal electroporation parameters for HeLa cells were determined experimentally as 250 V and 1500 µF. All cells were cultured for 48 h posttransfection in complete medium, before harvesting total cellular RNA.

Total RNA was isolated from transfected cells by the guanidinium isothiocyanate method (29). Primer extension analysis was performed on 20 µg of total RNA using the Primer Extension System (Promega) according to the manufacturer’s instructions. In the reverse transcriptase reaction, 0.1 pmol of end-labeled ([{gamma}-32P]ATP) primer B2 (see above), which is complementary to the 5' end of ß-globin mRNA (+62 to +39), was used. Primer annealing was conducted at 60°C. Reactions were analyzed on 8% denaturing polyacrylamide gels. Gels were dried, and autoradiography was performed at -70°C for 24 to 48 h. Relative levels of transcription were determined by scanning autoradiographs using an Appligene Image Analysis system (Appligene, Durham, U.K.), and band densitometry performed using National Institutes of Health (Bethesda, MD) Image 1.52 software. Levels of transcription were corrected for transfection efficiency by normalizing values against those for the control plasmid, Hß.

Nuclear extracts, EMSA, and DNase I footprinting

Nuclei were prepared from subconfluent cells by detergent lysis. HeLa and K562 cells were lysed in 20 mM Tris (pH 8.0), 20 mM NaCl, 0.5% Nonidet P-40, 2 µg/ml leupeptin, 2 µg/ml pepstatin A, 1 mM DTT, 0.5 mM PMSF; Hep G2 cells were lysed in the same buffer containing 15% sucrose. The nuclei were resuspended in high salt buffer (0.45 M KCl buffer C; (30)) to extract nuclear proteins. Extracts were dialyzed against 0.1 M KCl dialysis buffer (30), and the protein concentration was determined using a kit based on the Bradford dye-binding procedure (Bio-Rad Laboratories, Hemel, Hertfordshire, U.K.).

Six probes specific for the human C4 gene, for use in EMSAs, were generated using the PCR. These probes were identical with the C4 promoter fragments used in the constructs pß4.4, pß4.2, pß4.1, pßSp1mut, pßEmut, and pßEGmut, termed P4, P2, P1, Sp1mut, Emut, and EGmut, respectively, and were amplified using the primers described above. Primers were end-labeled using polynucleotide kinase with [{gamma}-32P]ATP, before use in the PCR. After phenol/chloroform extraction of the PCR amplicons, probe concentrations were determined by agarose gel electrophoresis. Binding reactions contained 1 to 2 ng of DNA probe (2 x 104 cpm) and 5 to 10 µg of nuclear extract in a 25-µl reaction containing 2 µg of poly(dI-dC) · poly (dI-dC) double-stranded DNA (Pharmacia Biotech, Milton Keynes, U.K.) in 45 mM KCl, 11 mM HEPES (pH 7.6), 5 mM spermidine, 1 mM MgCl2, 1 mM DTT, 2.5 mM PMSF, 0.1 mM EDTA. Reactions contained a 10- to 50-fold excess of specific or nonspecific competitor, as indicated. Double-stranded consensus Sp1 and NF-1 oligonucleotides were purchased (Promega). A double-stranded oligonucleotide termed PIIA corresponding to position -81 to -58 in the C4 gene (TGTCACGTGGTTTCCCAGCTTAGC) was prepared as a cold competitor for the E box consensus domain at positions -78 to -73. Binding reactions were performed on ice for 30 min and analyzed on 6% nondenaturing polyacrylamide gels. Electrophoresis was conducted in 0.5x (25 mM Tris (pH 8.5), 190 mM glycine, 1 mM EDTA buffer) at 4°C. Gels were dried, and autoradiography was conducted at -70°C overnight.

Five probes for footprinting were prepared by isolating the intact C4 promoter fragments (NotI-PstI restriction fragments) from the plasmids pß4.4, pß4.2, pßSp1mut, pßEmut, and pßEGmut. These fragments were subcloned into pBS SK+ (Promega). Restriction sites in the pBS SK+ polylinker were used to generate C4 fragments with a 5' overhang at one end suitable for an end-fill labeling reaction. For reverse strand labeling, plasmids were digested with NotI/PstI; for forward strand labeling, plasmids were digested with Eco0291/SstI. The restricted C4 fragments were gel purified, and 10 pmol of each were used in a labeling reaction with [{alpha}-32P]dCTP using Moloney murine leukemia virus reverse transcriptase (Life Technologies) to end-fill the 5' overhang generated by Eco0291 or NotI. Probes were labeled to a sp. act. of ~1 x 105 cpm/10 fmol. "A + G ladders" were prepared as size markers, and DNase I footprinting assays were performed as described (31) with crude nuclear extracts, prepared as described above.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
In a previous study, we mapped DNase I-hypersensitive sites around the C4 gene loci including regions proximal and distal to the C4 promoters (13). A single DNase I-hypersensitive site was identified, for each of the C4 genes, located within 500 bp upstream of the cap sites, only in a cell line expressing C4 (Hep G2). No other hypersensitive sites were identified downstream or within the body of the gene. The investigation reported here has therefore concentrated on the region containing this hypersensitive site and extended the original findings by functionally characterizing the cis-acting sequences regulating the C4 promoter.

Promoter efficiency of the C4 5'-flanking region

A series of fusion genes consisting of progressively truncated C4 5'-flanking sequences linked to a ß-globin reporter gene (see Materials and Methods) were constructed to identify the functional consensus binding motifs regulating transcription of the C4 gene in the hepatocyte cell line, Hep G2 (Fig. 1Go). The 3' end of the C4 sequence in all the constructs was +62, and the 5' end was variable. The longest constructs, specific for C4B and C4A, extended -1805 and -1668 upstream of the C4 cap site, respectively. Each pß4 test construct was cotransfected with the control plasmid Hß (see Materials and Methods) by calcium phosphate precipitation. Transcription of Hß and pß4 constructs resulted in cDNA extension products of 62 and 112 nucleotides, respectively. These data confirmed that the majority of the transcripts for both test and control constructs were being initiated from the previously documented endogenous cap sites for C4 (26) and ß-globin (32). Transient transfections and primer extension analysis were performed in duplicate in four independent experiments.



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 1. Design of pß C4 reporter and Hß control constructs. The C4 5'-flanking regions used in each construct are indicated. All fragments have a common 3' end (position +62 in the C4 gene), which was cloned into an SmaI site immediately upstream of a promoterless ß-globin reporter gene. Hß contains the entire human ß-globin gene (HpaI-PstI fragment), driven by an SV40 enhancer. Primer extension analysis, using a ß-globin-specific primer (P) was used to determine levels of ß-globin expression. The length of the cDNAs generated from the test and control constructs (bold dashed line) were 112 and 62 bases, respectively. The cap site for the constructs is indicated by an arrow. The test and control constructs are not drawn to scale.

 
Levels of transcription from reporter and control constructs were evaluated by scanning densitometry of the 112- and 62-bp bands. Densitometric values of the control plasmid (Hß) were used as an internal control to normalize for variations in transfection efficiency. The effect of C4 5' truncation on reporter gene expression, relative to the level of transcription determined from the full-length C4 fragment (-1558 to +62) in construct pßC4A, is summarized in Table IGo. No significant difference in transcriptional efficiencies of the C4A (pßC4A) and C4B (pßC4B) promoter regions was observed. Maximal promoter efficiency was associated with two constructs pß4.4 (-178 to +62) and pß4.3 (-126 to +62) with mean relative promoter efficiencies (± SE) of 1.9 ± 0.09 and 1.9 ± 0.12, respectively. These data are also indicative of the presence of a negative regulatory element within the region -178 to -1043, as the mean promoter efficiency of construct pß4.8 was 0.9 ± 0.04 compared with 1.9 ± 0.09 for pß4.4. Deletion of sequence from -126 to -81 (pß4.2) reduced transcription of ß-globin (0.8 ± 0.04). Total abrogation of gene transcription occurred with the construct pß4.1 (-39 to +62), demonstrating that the sequence from -81 to -39 is essential for promoter function and directs 42% of maximal transcriptional activity.


View this table:
[in this window]
[in a new window]
  		Table I. Mean promoter efficiencies of the C4 reporter constructs1

 
DNA-protein interactions of the C4 promoter

To complement the promoter function analyses described above, we determined nuclear DNA-protein interactions of the C4 5'-flanking regions using EMSAs (see Materials and Methods). Three probes were generated, termed P4 (-178 to +62), P2 (-81 to +62), and P1 (-39 to +62) as described (see Materials and Methods). A SIGNAL SCAN search for transcription factor consensus motifs (33) was conducted on the C4 5'-flanking sequence associated with maximal expression (up to position -178). This identified putative binding domains for several factors (illustrated in Fig. 2GoA) including NF-1 (-110 to -97), Sp1 (-57 to -49), and three E box binding sites termed 5' E box (-137 to -132), middle E box (-98 to -93), and 3' E box (-78 to -73).



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 2. A, The promoter sequence of human C4 illustrating the positions of the putative DNA binding sites (boxed and in bold) discussed in the text and the limits of the reporter constructs (arrowed with the construct name). M-E box is the middle E box. B, EMSA using wild-type probe P2 (lanes 1, 2, 4, 5, 8, and 9) and probe P2 with a mutated Sp1 (Sp1mut) or 3' E box (Emut). Lane 1, no extract. Lanes 2 to 11 contain the denoted probe with a Hep G2 cell nuclear extract. Lanes 2, 5, and 9, probe P2 with no competition. Lanes 4 and 8, probe P2 competed with double-stranded consensus oligonucleotide specific for Sp1. Lanes 3 and 10, probe Sp1mut with no competition. Lane 11, probe Sp1mut with a specific 3' E box competitor. Lane 6, probe Emut with no competition. Lane 7, probe Emut with a specific Sp1 competitor. P2A, P2B, P2C1, and P2C2, denoted on the left, refer to the specific complexes formed. P2C2 refers to the complex remaining after complexes binding to Sp1 are removed, either by competition or by the use of a mutant probe. All additional bands are due to either nonspecific interactions or degradation products and were not reproducible between experiments.

 
In agreement with the data from the transient transfection analysis of construct pß4.1 (see Table IGo), probe P1 containing the same C4 promoter sequence (-39 to +62) did not form any DNA-protein complexes in EMSAs (data not shown). When probe P2 was used in EMSAs with nuclear protein extracts from Hep G2 cells, and in the absence of any competitor, three distinct complexes were observed (shown in Fig. 2GoB, lanes 2, 5, and 9). These binding complexes were termed P2A, P2B, and P2C. The addition of excess unlabeled probe P2 to the binding reactions effectively competed all DNA-protein interactions, whereas a nonspecific competitor in the form of EGmut (P2 with mutated Sp1 and E box binding sites) had no effect on complex formation (data not shown). Using a combination of specific competitors and the mutant P2 probes (i.e., Sp1mut and Emut), it was possible to demonstrate that the three electromobility shifts with probe P2 were due to specific interactions with factors binding to the Sp1 (-57 to -49) and 3' E box (-78 to -73) consensus binding sites (Fig. 2GoB, lanes 3 to 11). The addition of the excess unlabeled Sp1 oligonucleotide abrogated the binding of P2 with factors corresponding to P2A and P2B, whereas P2C was altered but not abolished (Fig. 2GoB, lanes 4 and 8). These data were supported using Sp1mut as probe (Fig. 2GoB, lanes 3 and 10). This suggested that P2C represented more than one DNA-protein complex. The complex remaining after Sp1 competition was termed P2C2. When the Emut probe was used, there was no obvious alteration in complex formation (Fig. 2GoB, lane 6). However, when the E box and Sp1 competitors were used with Sp1mut and Emut probes, respectively, all DNA-protein complexes were effectively competed (Fig. 2GoB, lanes 7 and 11). It is possible that Sp1 binding masks the effect of E box competition or there is competition for access to binding sites. DNase I footprinting analysis (see below) was used to address this issue.

Probe P4 bound factors present in crude nuclear protein extracts from Hep G2 cells, in addition to Sp1 and the E box binding factor. These were specifically competed away using a 50-fold molar excess of unlabeled double-stranded consensus oligonucleotide specific for NF-1 (data not shown). These data suggest a positive role for the NF-1 site at positions -110 to -97, which is supported by the enhanced levels of transcription directed by the reporter construct (pß4.4) containing this site (see Table IGo).

DNase I footprinting analysis (see Materials and Methods) was used to confirm the data obtained from transient transfection analyses and EMSAs and to determine whether binding to the 3' E box and Sp1 sites occurred simultaneously. End-labeled probes corresponding to pß4.4 (P4), pß4.2 (P2), pßSp1mut, pßEmut, and pßEGmut were used to define the position of the binding sites occupied by nuclear protein extracts from Hep G2 cells. P4 contains the consensus binding motifs for NF-1 (-110 to -97), Sp1 (-57 to -49), and three E box binding sites: the 5' E box (-137 to -132), middle E box (-98 to -93), and 3' E box (-78 to -73). Footprint analysis showed strong binding at the NF-1, middle E box, 3' E box, and Sp1 binding sites (see Fig. 3Go). The 5' E box binding motif was not associated with a footprint. The promoter region associated with pß4.2 and containing the Sp1 and 3' E box consensus binding motifs confirmed that both these sites were associated with strong footprints (shown in Fig. 3Go) and occupancy of the sites occurred simultaneously. In addition, a strong footprint was present at the extreme 3' end of the probe in the region +35 and beyond. Since the transient transfection analyses demonstrated that this region was not functional, further characterization of this footprint was not pursued.



View larger version (54K):
[in this window]
[in a new window]
  		FIGURE 3. In vitro footprints of the region -178 to +62 (probe P4) of the C4 gene. The DNase I-treated probe is shown in the absence (-) (lanes 1 and 5) and in the presence of increasing amounts of an Hep G2 nuclear extract (lanes 2–4). A Maxim-Gilbert A + G ladder (lane 6) serves as a size marker. Protein binding sites are shown on the left and are denoted as open boxes.

 
An Sp1 binding site at position -57 to -49 is essential for minimal C4 promoter activity

The data from the transient transfection analyses and the EMSAs led us to suggest that C4 promoter activity for the region -81 to +62 was achieved entirely through binding to the Sp1 and 3' E box consensus motifs. To test this hypothesis, we prepared C4/ß-globin reporter constructs containing mutagenized Sp1 and 3' E box consensus binding domains (see Materials and Methods). These chimeric genes were tested by transient transfection into Hep G2 cells. Primer extension analysis of the RNA harvested from the transfected cells was used to determine the levels of ß-globin RNA transcribed by the constructs. The experiment was performed in duplicate on four independent occasions. A representative example of such an experiment is shown in Figure 4Go, and the derived densitometric data from these experiments are shown in Table IGo. Comparison of the transcription efficiencies of the three mutant constructs pßSp1mut, pßEmut, and pßEGmut (all positions -81 to +62) with the wild-type promoter fragment (pß4.2) showed that the Sp1 binding site was critical for minimal promoter activity given that no reporter gene expression was detected from the constructs that contained a mutated Sp1 binding site (pßSp1mut and pßEGmut). Mutation of the E box alone (pßEmut), led to a considerably reduced transcription efficiency (0.1 ± 0.04) when compared with pß4.2, supporting a major role for a member of the basic helix-loop-helix (bHLH) family of DNA-binding proteins in hepatic regulation of the human C4 gene. Results consistent with these observations were obtained when the probes containing the same mutated binding sites were used in EMSAs (shown in Fig. 2GoB). No footprints associated with Sp1 and/or E box binding were observed when these sites were mutated (data not shown). Furthermore, Sp1 binding was apparent in the absence of 3' E box binding using the probe Emut, and the converse was true when the Sp1mut probe was used. Thus, the data clearly show that both Sp1 and 3' E box transcription factors are able to activate their respective binding sites independently of each other, but both bind simultaneously to provide maximum transcriptional activity.



View larger version (103K):
[in this window]
[in a new window]
  		FIGURE 4. Transcription efficiencies of the C4 promoter fragments. Primer extension analysis of ß-globin RNA derived from transiently transfected Hep G2 cells. C4 and Hß control cDNA transcripts are 112 and 62 bases, respectively. HinfI-digested {phi}X174 DNA is included (lanes 1 and 8) as size makers, denoted on the left in bp. Mock transfected Hep G2 cell RNA (lane 2) shows nonspecific primer extension products. Reporter constructs containing the wild-type C4 promoter fragments pß4.4 (-178 to +62) and pß4.2 (-81 to +62) are shown in lanes 5 and 4,respectively. Constructs pßSp1mut (lane 3), pßEmut (lane 6), and pßEGmut (lane 7) contain mutagenized consensus binding motifs for Sp1, 3' E box, and Sp1 + 3' E box, respectively, located in the promoter fragment -81 to +62. Transcription efficiencies were determined by densitometric analysis of the specific cDNA transcripts (see Table IGo).

 
The -81 to +62 promoter region contains the elements necessary for tissue-specific expression of C4

We next attempted to address the issue of tissue-specific expression of C4. Two additional cell lines, HeLa and K562, were used for this analysis. Northern blot analysis of total RNA derived from these cell lines showed that Hep G2 cells express abundant amounts of C4 mRNA, but no mRNA was detected in either HeLa or K562 cells (data not shown). Reporter constructs and control plasmid Hß were transiently transfected into HeLa cells by electroporation (see Materials and Methods). These experiments were performed in duplicate on three occasions. In contrast to the data obtained when the same experiments were performed in Hep G2 cells, reporter gene expression from the test constructs was not detected in the HeLa cell line, while levels of expression of the control plasmid Hß in HeLa cells were similar to those observed in Hep G2 cells (data not shown). These data therefore suggest that the C4 reporter construct, pß4.2, which in Hep G2 cells confers promoter activity, also contains the sequence(s) necessary to direct tissue-specific expression of C4. This led us to examine the possibility that the specificity of DNA-protein interactions with probe P2 may be different when EMSAs and DNase I footprinting assays were performed using crude nuclear protein extracts prepared from HeLa and K562 cells. Surprisingly, the complexes formed with probe P2 and the mutant probes using extracts from these nonexpressing cell lines appeared to be identical with those seen with Hep G2 cell extracts (Fig. 5Go). This was confirmed by the DNase I footprint analysis (data not shown). The binding sites associated with Sp1 and 3' E box using Hep G2 nuclear extracts were very similar when nuclear extracts from K562 and HeLa cell lines were used. In summary, despite observing a tissue-specific pattern of expression of the C4 reporter constructs in transient transfection analysis, we were unable to demonstrate any differences in actual binding of nuclear proteins derived from those cell lines that did or did not express C4.



View larger version (82K):
[in this window]
[in a new window]
  		FIGURE 5. EMSAs with probe P2 using nuclear extracts derived from Hep G2 cells (H), HeLa cells (HL), or K562 cells (K). Lanes 1 to 3 contain no competitors. Lanes 4 to 9 contain double-stranded consensus oligonucleotides as competitors for the Sp1 binding site (Sp1) and the 3' E box (E). Protein-DNA complex formation is denoted on the left as P2A, P2B, P2C1, and P2C2. All additional bands are due to either nonspecific interactions or degradation products and were not reproducible between experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We have used a combination of transient transfection studies and DNA-protein binding assays to define the promoter elements that regulate transcription of the human C4 gene. The hepatocyte cell line, Hep G2, has been shown to express high levels of C4A and C4B mRNA (15) and is therefore the cell line of choice as a model in vitro system for studying C4 regulation. In this study, Hep G2 cells were transfected with reporter constructs containing between 39 bp and 1.8 kb of the C4 5'-flanking region. Variations in the level of expression of C4A and C4B genes have been reported in human synovial macrophages, in the early monocytic cell line U937, and in Hep G2 cells (21). Transient transfection into Hep G2 cells of the C4A (pßC4A) and C4B (pßC4B) reporter constructs detected no significant difference in promoter efficiency (Table IGo). This is consistent with data from our previous study in which we reported that DNase I-hypersensitive sites associated with the C4A and C4B genes are identical (13). It therefore appears unlikely that the variation in the levels of expression of C4A and C4B is due to transcriptional differences. We have recently shown that up-regulation of C4 expression by IFN-{gamma} is a posttranscriptional event achieved by mRNA stabilization (24). Since the C4A and C4B mRNAs differ in the length of their 3'-untranslated region, it is possible that posttranscriptional differences in processing may account for tissue variations in C4A and C4B expression.

We found that maximal reporter gene expression was associated with the region up to position -126 of the C4 cap site (no change in activity up to -178). These data are supported by Tee et al. (34), who examined the regulation of the XA gene and identified powerful liver-specific sequences located within the first 84 bp upstream of the C4B cap site. This region downstream of -126 contains potential binding sites for ubiquitously expressed transcription factors of the bHLH family, NF-1 and Sp1. DNase I footprinting analysis (Fig. 3Go) showed a strong footprint in the region corresponding to the NF-1 binding site, and the data also suggested that the middle E box which overlaps the NF-1 binding site is occupied. The likelihood that the NF-1 consensus motif is functional in the human C4 promoter is also supported by our indirect evidence that a consensus NF-1 oligonucleotide was effective at competing away a DNA-protein complex formed in an EMSA (data not shown). Furthermore, increased reporter gene expression was associated with constructs pß4.4/pß4.3 (Table IGo) containing the NF-1 consensus binding motif. In the mouse C4 promoter, the NF-1 binding domain is conserved and has been shown to bind an NF-1-like factor, while double-stranded oligomers encompassing the NF-1 region specifically inhibited the mouse C4 promoter in vitro (12).

Our data also demonstrated that 42% of C4 promoter activity is still retained when the sequence from -126 to -81 (containing the NF-1 and middle E box binding domains) is deleted (Table IGo). However, no reporter gene expression or DNA-protein interactions were associated with the promoter fragment containing the sequence from -39 to +62. This strongly suggests that the Sp1 and 3' E box binding sites are the only functional elements that effect C4 transcriptional activity within this compact region. These data contrast with the murine data (12) where no role for Sp1 has been identified. This could reflect the differing methodologies used or may be genuine differences between the human and murine promoters. The 3' E box has the structure (-78) CACGTG (-73) which is a characteristic binding site for a large family of the class B subset of bHLH proteins. This motif is also conserved in the mouse and rat C4 promoters. In the mouse, this bHLH binding domain has been shown, along with other consensus binding motifs, to be essential for maximal promoter activity. A novel E box activator termed E-C4 has been isolated from rat liver that binds this domain in the murine promoter (35). This factor is distinct from, but appears to be closely related to, upstream stimulatory factors (USF) originally characterized from HeLa cell nuclear extracts (36).

These experiments led us to define the region containing the Sp1 binding site (up to position -57) as the minimal human C4 promoter. This region lacks orthodox TATA and CCAAT boxes. This raises important questions regarding C4 transcriptional start site selection and promoter activation because for the majority of tissue-specific eukaryotic genes, this follows nucleation of the TATA box with basal transcriptional machinery (reviewed in 37 . Certain genes appear to lack a TATA box in the orthodox -30 position but either possess cryptic sequences (38), which may localize TATA box binding proteins, or have displaced TATA boxes. In the case of C4, a cryptic TATA box immediately upstream of the cap site seems unlikely, since the construct pß4.1 was unable to direct any reporter gene expression. The evidence presented here identifies the Sp1 binding site at position -57 to -49 as the critical element for initiating gene transcription which is in common with a number of other recently studied TATA-less tissue-specific promoters (39, 40, 41, 42). Recognition of such TATA-less promoters has led to the investigation and delineation of novel promoter mechanisms (reviewed in 37 . Smale and Baltimore (43) have explored the hypothesis that Sp1 binding sites may function as surrogate TATA motifs where the initial localization of Sp1 leads to recruitment of the TATA box-binding proteins (TBP) through Sp1-TBP interactions (44). This suggestion has been supported by functional studies of tissue-specific TATA-less promoters (39, 40, 41, 42). In almost all cases, an Sp1 consensus binding motif, located ~50 bp upstream of the cap site, was critical to promoter function with respect to both level and accuracy of transcription. Indeed a survey of all known eukaryotic promoters determined that the peak location of Sp1 binding sites was at -50 (45) as for C4.

Our data also suggest that the C4 promoter fragment from position -81 to +62 contains the necessary elements to confer tissue-specific C4 expression. Transfection of HeLa cells, which do not express C4, with the C4 reporter constructs failed to demonstrate any detectable reporter gene expression. These data suggest that either the Sp1 or the 3' E box, or indeed an association between the factors binding these elements, may confer tissue specificity. There is well-documented evidence illustrating the existence of a family of proteins able to bind the Sp1 consensus binding motif (46, 47, 48), and it has been suggested that a complex interaction of several factors at this site may be involved in tissue-specific gene expression. Similar interactions between ubiquitously expressed class A bHLH proteins and tissue-specific class B bHLH factors have also been reported (49, 50, 51) to confer tissue-specific gene expression. Although the promoter fragment (-81 to +62) confers tissue-specific expression, functional analysis using EMSAs and DNase I footprinting demonstrated that the Sp1 and 3' E box binding sites bound specific Sp1 and E box binding proteins in nuclear extracts derived from both HeLa and K562 cell lines (Fig. 5Go). This is perhaps not surprising because factors capable of binding these consensus motifs are ubiquitously expressed. In supershift assays using three different Abs to USF-1 and USF-2, all were found to interact with E box binding proteins bound to probe P2, which were present in all three nuclear extracts (HeLa, K562, and Hep G2) examined (T. J. Mitchell, S. J. Rose, and B. J. Morley, unpublished observations). Findings similar to those reported here have been observed in the promoter of the MUC1 gene which codes for mucin and which is expressed mainly at the apical surface of glandular epithelial cells. Analysis of the 5' sequences flanking the human MUC1 gene has demonstrated both Sp1 and E box binding factors to be involved in positive regulation of MUC1 in cell types that express mucin and in transcriptional repression of the gene in cell lines that do not express mucin (52, 53). Further work will be required to elucidate whether tissue specificity of human C4 transcription is due to restricted expression of specific E box- and/or Sp1-regulatory proteins or whether other proteins are involved.


   Footnotes
 
1 This work was funded by the Arthritis and Rheumatism Council (U.K.). A.K.V. was the recipient of a Medical Research Council (U.K.) Clinical Training Fellowship. Back

2 These authors contributed equally to this work. Back

3 Present address: Hospital for Special Surgery, Cornell University Medical College, 535 East 70 Street, New York, NY 10021. Back

4 Address correspondence and reprint requests to Dr. Bernard J. Morley, Rheumatology Section, Division of Medicine, Imperial College of Science, Technology and Medicine, Hammersmith Hospital, Du Cane Road, London, W12 0NN, U.K. Back

5 Abbreviations used in this paper: NF-1, nuclear factor 1; bHLH, basic helix-loop-helix; EMSA, electrophoretic mobility shift assay; USF, upstream stimulatory factor; TBP, TATA box-binding proteins. Back

Received for publication October 27, 1997. Accepted for publication January 7, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Thiel, S., T. Vorup-Jensen, C. M. Stover, W. Schwaeble, S. B. Laursen, K. Poulsen, A. C. Willis, P. Eggleton, S. Hansen, U. Holmskov, K. B. M. Reid, J. C. Jensenius. 1997. A second serine protease associated with mannan-binding lectin that activates complement. Nature 386:506.[Medline]
  2. Belt, K., M. C. Carroll, R. R. Porter. 1984. The structural basis of the multiple forms of human complement component C4. Cell 36:907.[Medline]
  3. Yu, C. Y., K. T. Belt, C. M. Giles, R. D. Campbell, R. R. Porter. 1986. Structural basis of the polymorphism of human complement components C4A and C4B: gene size, reactivity and antigenicity. EMBO J. 5:2477.[Medline]
  4. Campbell, R. D., A. W. Dodds, R. R. Porter. 1980. The binding of human complement component C4 to antibody-antigen aggregates. Biochem J. 189:67.[Medline]
  5. Arnett, F. C., J. D. Reveille. 1992. Genetics of systemic lupus erythematosus. Rheum. Dis. Clin. North Am. 8:865.
  6. Morgan, B. P., M. J. Walport. 1991. Complement deficiency and disease. Immunol. Today 12:301.[Medline]
  7. O’Neill, G. J., S. Y. Yang, B. Dupont. 1978. Two HLA-linked loci controlling the fourth component of human complement. Proc. Natl. Acad. Sci. USA 75:5165.[Abstract/Free Full Text]
  8. Carroll, M. C., R. D. Campbell, D. R. Bentley, R. R. Porter. 1984. A molecular map of the human major histocompatibility complex class III region linking complement genes C4, C2 and factor B. Nature 307:237.[Medline]
  9. Gitelman, S. E., J. Bristow, W. L. Miller. 1992. Mechanism and consequences of the duplication of the human C4/P450c21/gene X locus. Mol. Cell. Biol. 9:3269.
  10. Chaplin, D. D., D. E. Woods, A. S. Whitehead, G. Goldberger, H. R. Colten, J. G. Seidman. 1983. Molecular map of the murine S region. Proc. Natl. Acad. Sci. USA 80:6947.[Abstract/Free Full Text]
  11. Miyagoe, Y., E. Georgatsou, N. Varin-Blank, T. Meo. 1993. The androgen-dependent C4-Slp gene is driven by a constitutively competent promoter. Proc. Natl. Acad. Sci. USA 90:5786.[Abstract/Free Full Text]
  12. Miyagoe, Y., M. D. Galibert, E. Georgatsou, G. Fourel, T. Meo. 1994. Promoter elements of the mouse complement genes critical for transcription activation and start site selection. J. Biol. Chem. 269:8268.[Abstract/Free Full Text]
  13. Vaishnaw, A. K., R. Hargreaves, R. D. Campbell, B. J. Morley, M. J. Walport. 1995. DNase I hypersensitivity mapping and promoter polymorphism analysis of human C4. Immunogenetics 41:354.[Medline]
  14. Hemenway, C., D. M. Robins. 1987. DNase I-hypersensitive sites associated with expression and hormonal regulation of mouse C4 and Slp genes. Proc. Natl. Acad. Sci. USA 84:4816.[Abstract/Free Full Text]
  15. Morris, K. M., D. P. Aden, B. B. Knowles, H. R. Colten. 1982. Complement biosynthesis by human hepatoma cell line Hep G2. J. Clin. Invest. 70:906.
  16. Miura, N., H. L. Prentice, P. M. Schneider, D. H. Perlmutter. 1987. Synthesis and regulation of the two human complement C4 genes in stable transfected mouse fibroblasts. J. Biol. Chem. 262:7298.[Abstract/Free Full Text]
  17. Kulics, J., H. R. Colten, D. H. Perlmutter. 1990. Counter-regulatory effects of interferon-gamma and endotoxin on expression of the human C4 genes. J. Clin. Invest. 85:943.
  18. Zhou, W., R. D. Campbell, J. Martin, S. H. Sacks. 1993. Interferon-gamma regulation of C4 gene expression in cultured glomerular epithelial cells. Eur. J. Immunol. 23:2477.[Medline]
  19. Seelen, M. A., R. A. Brooimans, F. J. van der Woude, L. A. van Es, M. R. Daha. 1993. IFN-{gamma} mediates stimulation of complement C4 biosynthesis in human proximal tubular epithelial cells. Kidney Int. 44:50.[Medline]
  20. Kulics, J., A. Circolo, R. C. Strunk, H. R. Colten. 1994. Regulation of synthesis of complement component C4 in human fibroblasts: cell- and gene-specific effects of cytokines and lipopolysaccharide. Immunology 8:509.
  21. Falus, A., J. Kramer, E. Walcz, Z. Varga, J. Setalo, K. Jobst, T. Lakatos, K. Meretey. 1989. Unequal expression of complement C4A and C4B genes in rheumatoid synovial cells, human monocytoid and hepatoma-derived cell lines. Immunology 68:133.[Medline]
  22. Perlmutter, D. H., C. A. Dinarello, P. I. Punsal, H. R. Colten. 1986. Cachectin/tumour necrosis factor regulates hepatic acute-phase gene expression. J. Clin. Invest. 78:1349.
  23. Perlmutter, D. H., G. Goldberger, C. A. Dinarello, S. B. Mizel, H. R. Colten. 1986. Regulation of class III major histocompatibility complex gene products by interleukin-1. Science 232:850.[Abstract/Free Full Text]
  24. Mitchell, T. J., M. Naughton, P. Norsworthy, K. A. Davies, M. J. Walport, B. J. Morley. 1996. IFN-{gamma} up-regulates expression of the complement components C3 and C4 by stabilization of mRNA. J. Immunol. 156:4429.[Abstract]
  25. Morley, B. J., C. A. Abbott, W. G. Wood. 1991. The regulation of human fetal and adult globin genes in MEL cells. Blood 78:1355.[Abstract/Free Full Text]
  26. Belt, K. T., C. Y. Yu, M. C. Carroll, R. R. Porter. 1985. Polymorphism of human complement component C4. Immunogenetics 21:173.[Medline]
  27. Proudfoot, N. J., B. A. Lee, J. Monks. 1992. Multiple Sp1 binding sites confer enhancer-independent, replication-activated transcription of HIV-1 and globin gene promoters. New Biol. 4:369.[Medline]
  28. Graham, F. L., A. J. van der Eb. 1973. A new technique for the assay of infectivity of adenovirus 5 DNA. Virology 52:456.[Medline]
  29. Chomczynski, P., N. Sacchi. 1987. Single step method of RNA isolation by guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  30. Dignam, J. D., R. M. Lebovitz, R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
  31. Hurst, H. C. 1991. In Methods in Molecular Biology. M. Collins, ed. Humana Press, New York, 8:141.
  32. Lawn, R. M., A. Efstratiadis, C. O’Connell, T. Maniatis. 1980. The nucleotide sequence of the human beta-globin gene. Cell 21:647.[Medline]
  33. Prestridge, D. S.. 1991. SIGNAL SCAN: a computer program that scans DNA sequences for eukaryotic transcriptional elements. Comput. Appl. Biosci. 7:203.[Abstract/Free Full Text]
  34. Tee, M. K., A. A. Thomson, J. Bristow, W. L. Miller. 1995. Sequences promoting the transcription of the human XA gene overlapping P450c21A correctly predict the presence of a novel, adrenal specific, truncated form of tenascin-X. Genomics 28:171.[Medline]
  35. Galibert, M. D., Y. Miyagoe, T. Meo. 1993. E-box activator of the C4 promoter is related to but distinct from the transcription factor upstream stimulating factor. J. Immunol. 151:6099.[Abstract]
  36. Sawadogo, M., M. V. van Dyke, P. D. Gregor, R. G. Roeder. 1988. Multiple forms of the human gene-specific transcription factor USF-1: complete purification and identification of USF from HeLa nuclei. J. Biol. Chem. 263:11985.[Abstract/Free Full Text]
  37. Hernandez, N.. 1993. TBP, a universal eukaryotic transcription factor?. Genes Dev. 7:1291.[Free Full Text]
  38. Dusing, M. R., D. A. Wiginton. 1994. Sp1 is essential for both enhancer mediated and basal activation of the TATA-less human adenosine deaminase promoter. Nucleic Acids Res. 22:669.[Abstract/Free Full Text]
  39. Travis, A., J. Hagman, R. Grosschedl. 1991. Heterogeneously initiated transcription from the pre-B- and B-cell-specific mb-1 promoter: analysis of the requirement for upstream factor binding site sequences. Mol. Cell. Biol. 11:5756.[Abstract/Free Full Text]
  40. Faber, P. W., H. C. J. van Rooiji, H. J. Schipper, A. O. Brinkmann, J. Trapman. 1993. Two different, overlapping pathways of transcription initiation are active on the TATA-less human androgen receptor promoter: the role of Sp1. J. Biol. Chem. 268:9296.[Abstract/Free Full Text]
  41. Kollmar, R., K. A. Sukow, S. K. Sponagle, P. J. Farnham. 1994. Start site selection at the TATA-less carbamoyl phosphate synthase (glutamine-hydrolyzing)/aspartate carbamoyl/dihydroorotase promoter. J. Biol. Chem. 269:2252.[Abstract/Free Full Text]
  42. Boam, D. S., I. Davidson, P. Chambon. 1995. A TATA-less promoter containing binding sites for ubiquitous transcription factors mediates cell type-specific regulation of the gene for transcription enhancer factor-1 (TEF-1). J. Biol. Chem. 270:19487.[Abstract/Free Full Text]
  43. Smale, S. T., D. Baltimore. 1989. The "initiator" as a control element. Cell 57:103.[Medline]
  44. O’Shea-Greenfield, A., S. T. Smale. 1992. Roles of TATA and initiator elements in determining the start site location and direction of RNA polymerase II transcription. J. Biol. Chem. 267:1391.[Abstract/Free Full Text]
  45. Bucher, P.. 1990. Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J. Mol. Biol. 212:563.[Medline]
  46. Kingsley, C., A. Winoto. 1992. Cloning of GT box-binding proteins: a novel Sp1 multigene family regulating T-cell receptor gene expression. Mol. Cell. Biol. 12:4251.[Abstract/Free Full Text]
  47. Hagen, G., S. Müller, M. Beato, G. Suske. 1992. Cloning by recognition site screening of two novel GT box binding proteins: a family of Sp1 related genes. Nucleic Acids Res. 20:5519.[Abstract/Free Full Text]
  48. Sogawa, K., H. Imataka, Y. Yamasaki, H. Kusume, H. Abe, Y. Fujii-Kuriyama. 1993. cDNA cloning and transcriptional properties of a novel GC box-binding protein, BTEB2. Nucleic Acids Res. 21:1527.[Abstract/Free Full Text]
  49. Hsu, H. L., J. T. Cheng, Q. Chen, R. Baer. 1991. Enhancer-binding activity of the tal-1 oncoprotein in association with the E47/E12 helix-loop-helix proteins. Mol. Cell. Biol. 11:3037.[Abstract/Free Full Text]
  50. Shich, S. Y., M. J. Tsai. 1991. Cell-specific and ubiquitous factors are responsible for the enhancer activity of the rat insulin II gene. J. Biol. Chem. 266:16707.
  51. Rashbass, J., M. V. Taylor, J. B. Gurdon. 1992. The DNA-binding protein E12 co-operates with XMyoD in the activation of muscle-specific gene expression in Xenopus embryos. EMBO J. 11:2981.[Medline]
  52. Kovarik, A., N. Peat, D. Wilson, S. J. Gendler, J. Taylor-Papadimitriou. 1993. Analysis of the tissue-specific promoter of the MUC1 gene. J. Biol. Chem. 268:9917.[Abstract/Free Full Text]
  53. Kovarik, A., P. J. Lu, N. Peat, J. Morris, J. Taylor-Papadimitriou. 1996. Two GC boxes (Sp1 sites) are involved in regulation of the activity of the epithelium-specific MUC1 promoter. J. Biol. Chem. 271:18140.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
C. Roos, R. Dressel, B. Schmidt, E. Gunther, and L. Walter
The Rat Expresses Two Complement Factor C4 Proteins, but Only One Isotype Is Expressed in the Liver
J. Immunol., January 15, 2005; 174(2): 970 - 975.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. Ulgiati, L. S. Subrata, and L. J. Abraham
The Role of Sp Family Members, Basic Krupple-Like Factor, and E Box Factors in the Basal and IFN-{gamma} Regulated Expression of the Human Complement C4 Promoter
J. Immunol., January 1, 2000; 164(1): 300 - 307.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H.-C. Liu, J.-T. Shen, L. B. Augustin, J. L. Ko, and H. H. Loh
Transcriptional Regulation of Mouse delta -Opioid Receptor Gene
J. Biol. Chem., August 13, 1999; 274(33): 23617 - 23626.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vaishnaw, A. K.
Right arrow Articles by Morley, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vaishnaw, A. K.
Right arrow Articles by Morley, B. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS