The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nourrit, F.
Right arrow Articles by Cumano, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nourrit, F.
Right arrow Articles by Cumano, A.
The Journal of Immunology, 1998, 160: 4254-4261.
Copyright © 1998 by The American Association of Immunologists

Extensive Junctional Diversity of Ig Heavy Chain Rearrangements Generated in the Progeny of Single Fetal Multipotent Hematopoietic Cells in the Absence of Selection1

Françoise Nourrit2,{dagger}, Noëlle Doyen{dagger}, Philippe Kourilsky*, François Rougeon{dagger} and Ana Cumano3,*

* Unité de Biologie Moléculaire du Gène and {dagger} Unité de Génétique et Biochimie du Développement, Département d’Immunologie, Institut Pasteur, Paris, France


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We analyzed the progeny of individual multipotent hemopoietic cells, derived from the para-aortic splanchopleura, the earliest identified source of lymphocyte precursors in pre-liver mouse embryos. Single precursors were expanded in an in vitro culture system that permits both commitment and differentiation of B cell precursors. We show that from one single multipotent progenitor we could obtain large numbers of B cell precursors that rearrange the Ig heavy chain genes and generate a repertoire as diverse as that observed in adult populations. N region additions are present at V(D)J junctions, showing that terminal deoxynucleotidyl transferase expression has been switched on and is not, consequently, an intrinsic property of adult stem cells. Throughout the culture period, cells show a majority of DJ vs V(D)J rearrangements and a ratio of 2:1 of nonproductive to productive V(D)J rearrangements, which is close to the expected frequency in the absence of selection. In addition, counterselection for D-J rearrangements in reading frame 2 is observed in V(D)J joints, and allelic exclusion was consistently observed. We conclude that of the three events associated with heavy chain rearrangement, two of them, namely allelic exclusion and counterselection of cells in which the D segment is in reading frame 2, are intrinsic to the cell, while selection of productive heavy chain rearrangements is induced in the bone marrow environment.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Blymphocytes are produced in the bone marrow of adult mice from multipotent hemopoietic stem cells. Most B cell precursors rearrange the Ig heavy chain locus following an ordered sequence of events in which a D segment joins to a J segment on both chromosomes, followed by a variable (V) gene joining to the D-JH (1). During D to JH and V to D-JH joining, nucleotides can be excised from both ends of the coding strands by exonuclease activity, and other nucleotides can be inserted (2), such as P nucleotides (3) and N nucleotides added by terminal deoxynucleotidyl transferase (TdT)4 (4, 5, 6, 7, 8, 9). N nucleotides are rare in V(D)J junctions from fetal and newborn mice, but constitute a major component of the diversity of Igs and TCRs from adults (10, 11, 12, 13, 14, 15, 16). This dissimilarity is due to the differential expression of TdT during development, because in mice TdT transcripts are not found until the first week after birth (17, 18). The regulation of TdT expression could involve external signals from the microenvironment or reflect the differentiation of several waves of lymphoid precursors.

As a result of in-frame V(D)J rearrangement (1/3), only 55% of all cells that start the recombination process will be able to express an Ig heavy chain. Once a productive rearrangement has occurred, the protein is thought to be expressed on the cell surface associated with {lambda}5 and V-preB, delivering the signal that stops further rearrangement in the heavy chain locus and thus ensuring allelic exclusion (19, 20, 21). B cell precursors that do not succeed in making a productive rearrangement are presumably eliminated in the bone marrow by an as yet unknown mechanism.

The role of the environment in the process of B cell differentiation has not been fully defined (22). A culture system has been developed (23) that allows B cell precursors to undergo commitment and rearrangement in vitro without being submitted to the same environmental constraints as the cells that develop in vivo. Recently, we identified multipotent hemopoietic cells in pre-liver embryos, located in the para-aortic splanchnopleura (24, 25). When cultured under the appropriate conditions, single micromanipulated cells can generate lymphocytes as well as myeloid cells, being thus multipotent precursors. From single cells, we could derive large numbers of B lineage cells that differentiate into Ig-secreting plasma cells upon LPS stimulation (24).

In this study, we followed the evolution of B lineage cells generated from individual multipotent precursors over a 5-wk culture period. We analyzed Ig heavy chain rearrangements, allowing a global evaluation of the complexity of V-D-J joints obtained in vitro, and we investigated the fate of cells undergoing nonproductive rearrangements.

We observed that the progeny of one single hemopoietic precursor exhibits a complexity of rearrangements similar to total bone marrow cells; nevertheless, as the culture progressed, an increased oligoclonality was seen. Among the sequences analyzed, some exhibit N additions in numbers close to adult bone marrow, indicating that the lack of fetal expression of TdT is not an intrinsic property of the stem cell. Finally, our results show that while both allelic exclusion and selection for cells with productive rearrangements are dependent on the expression of an Ig heavy chain, the first is intrinsic to the cell, while the second seems to be environmentally determined.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture

Fetal livers and para-aortic splanchnopleuras were obtained from timed mating of C57BL/6 or C57BL/6xBALB/c F1 mice (day of plug = day 0) as previously described (24). B220-positive cells (B220+) were isolated from fetal liver by a panning procedure using anti-B220 Abs (14.8) as described previously (23). The positive population was seeded at 2 to 3 x 105 cells/well in 24-well plates and grown over adherent layers of irradiated (2000 rads) S17 fibroblasts (20,000–50,000 per well) in 2 ml of Opti-MEM (Life Technologies, Cergy Pontoise, France) supplemented with 10% FCS, 5 x 10-5 2-ME, and 100 U/ml recombinant IL-7. For the single-cell experiment, cells were isolated and seeded by micromanipulation onto 96-well plates, then cultured as previously described (24).

Flow cytometry analysis

Single-cell suspensions were stained with phycoerythrin-labeled anti-B220 (PharMingen, CA), FITC-labeled anti-µ (Jackson ImmunoResearch, West Grove, PA), and biotin-labeled anti-CD43 (PharMingen, San Diego, CA), followed by a second step of streptavidin-TriColor (Tebu, Le Perray-en- Yvelines, France). Dead cells were eliminated from the analysis by propidium iodide exclusion. Fluorescence was measured with a FACScan flow cytometer (Becton Dickinson, Sunnyvale, CA) using the CellQuest software.

RT-PCR for semiquantitative analysis of TdT

At different time points of culture, flow cytometry analysis was performed with anti-B220-phycoerythrin and anti IgM-FITC Abs, and 106 cells were recovered for RNA preparation. Total RNAs were extracted from the cells as described (26). First-strand cDNAs synthesis were performed with 2.5 µg of RNA primed with 0.5 µg oligo(dT) using 200 U of MMuLV reverse transcriptase. cDNAs were amplified by PCR using, for TdT amplification, primers SL5' (GAAGGCCATCCGTGTAGATC) and SL3' (GGTTCAATGTAGTCCAGTCC); or for hypoxanthine phosphoribosyltransferase (HPRT) amplification, HPRT5' (GTAATGATCAGTCAACGGGGGAC) and HPRT3' (CCAGCAAGCTTGCAACCTTAACCA). HPRT dosage is used to normalize differences in reverse reaction efficacy or in cDNA input between the samples. PCR reactions were performed in 50-µl volume containing 5 µl of cDNA sample, 1x PCR buffer, 100 µM of each of four deoxynucleotides triphosphates, 0.5 µM of each sense and antisense primers, and 1.25 U of Taq polymerase. Amplifications consisted of a denaturing step, 2 min at 94°C, followed by cycles (26, 27, 28, 29, 30) each consisting of 15 s at 94°C, 30 s at 55°C (TdT) or 59°C (HPRT), and 30 s at 72°C. Five microliters of the PCR product was separated on 1.5% agarose gel electrophoresis and detected by Southern blot analysis using internal oligonucleotides as probes: HPRT int., 5'-TGGTTAAGCAGTACAGCCCC-3', and TdT int., 5'-ATGATGCTGGACAACCACGCCC-3'; which reveals both of the TdT isoforms (27) amplified in this PCR assay. The signals obtained were then quantified by scanning the filters on a phosphorimager.

CDR3 length analysis with immunoscope

The repertoire analysis of Ig heavy chain has been described in detail elsewhere (28, 29). In brief, PCR amplifications were performed with a sense primer specific for each of the variable gene families; and an antisense primer specific for either the IgM constant region or the intron region 3' of JH4 was used for cDNA or DNA amplification, respectively. A run-off elongation on the amplification product was then performed with a fluorescent primer specific for JH4 and the product analyzed in an automated DNA sequencer (Applied Biosystems, Foster City, CA). A software (immunoscope; 28 converts the bands detected on the gel into peaks for which the length and intensity are known. Equivalent amounts of DNA corresponding to B220+ cells were used in all experiments. For the semiquantitative analysis of rearrangements, a variant of this technique was used. Briefly, equivalent amounts of DNA were amplified for 22, 25, and 28 cycles with different pairs of primers. The intensities of peaks detected were added and ratios calculated under nonsaturating conditions of amplification.

Cloning and sequencing

J558-JH4 amplification products were purified by electroelution and cloned into pCRII using a TA cloning kit (Invitrogen, San Diego, CA), and recombinant clones were sequenced using the T7 sequencing kit (Pharmacia, Uppsala, Sweden). All of the sequences obtained derived from independently rearranged clones.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Progression analysis of differentiating B cell precursors in vitro

We isolated multipotent hemopoietic precursors from day 9 embryos. These precursors, located in the para-aortic splanchnopleura, were micromanipulated as individual cells and cultured as previously described (24).

We followed by flow cytometry analysis the B lineage cells obtained from these precursors. Figure 1Go shows the patterns of B220/IgM staining of the progeny of one of six representative multipotent hemopoietic precursors. The first B220+ cells are detected around day 12 of culture. By day 19, >80% of the cells express the B220 marker and the first B cells, able to respond to LPS stimulation and secrete Ig (30), are seen. Between day 19 and day 35 to 40 of culture, IgM+ cells can be detected, representing 2 to 3% of total cells, with a maximum of 20 to 30% between days 20 and 25. The low level of IgM+ cells observed at most time points is probably due to the nonresponsiveness of mature B cells to IL-7, so that IgM+ cells readily die. We assume that this level remains constant, as differentiation is continuously occurring. Indeed, throughout the whole experiment, cells proliferated with a mean division time of 16 h, and the majority expressed B220 and CD43 (data not shown) indicating that most cells in culture are from the pro-B cell type (31). The highest proportion of IgM+ cells, detected around days 20 to 25 in all cultures surveyed, indicates a synchronization of the differentiating precursors, with numbers decreasing thereafter.



View larger version (54K):
[in this window]
[in a new window]
  		FIGURE 1. Flow cytometry profiles of the progeny of clone 15. Cells isolated at day 12, 19, 22, and 32 of culture were stained with anti-B220 PE (FL2-H) and anti-IgM FITC (FL1-H). The percentages of B220+/sIgM- and B220+/sIgM+ cells in the lymphocyte population defined by a FSC/SSC gate are shown.

 
Individual multipotent precursors that rearrange the Ig heavy chain in vitro can generate a diverse repertoire

We followed the pattern of heavy chain variable gene rearrangement from the progeny of six independent multipotent cells growing in the presence of IL-7 and stromal cells. Due to the multipotent nature of the precursor that was isolated, commitment to the B lineage and all D-JH and V-D-JH rearrangements necessarily occurred in vitro.

To analyze the Ig heavy chain rearrangement, the first step was a PCR amplification using a 5' V gene-specific primer together with a 3' primer specific for the µ constant region for cDNA amplification (28) or a 3' primer specific for the intron downstream of the JH4 gene for DNA amplification (29). The fluorescent run-off products covering the CDR3 region were then separated on a sequencing gel. Figure 2Go shows the CDR3 size spectrum of the V(D)J rearrangement obtained with cDNA isolated from sIg- bone marrow cells amplified with a V region primer specific for the J558 family. The pattern seen with any diverse population of cells is that of a normal size distribution represented by the gaussian-shaped curve. cDNA and DNA were isolated from the progeny of the six individual precursors at three different time points. The profiles of VH-D-JH rearrangement in the cDNA from one of these precursors, isolated at day 15, 22, and 32 of culture, are shown in Figure 2Go. A complex pattern of diversity was observed for all samples analyzed, showing that a wide variety of heavy chain rearrangement is achieved in vitro by the progeny of a single precursor. At day 15 and 22, the diversity obtained with cDNA was comparable with that resulting from equivalent numbers of bone marrow cells. Nevertheless, the mean of CDR3 size distribution is evolving throughout the culture period. A diverse pattern was also obtained with other V gene primers used (VQ52 and V7183, data not shown).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 2. Shown are the profiles generated by the immunoscope software of the PCRs performed in samples of DNA (left panel) and cDNA (right panel). Samples of sIg- bone marrow cells were analyzed along with cells isolated at three different time points during the development of the progeny of one multipotent para-aortic splanchnopleura-derived precursor (designated clone 15). The first time point analyzed was at day 15 of culture, and subsequently samples were isolated at day 22 and 32. The PCR reaction was performed with the variable gene family specific J558 primer and either a constant region-specific primer or a primer hybridizing with the JH4 3' intron region in cDNA or DNA analysis, respectively. x-axis: size of the run-off product in base pairs; y-axis: intensity of the detected band on the gel shown in arbitrary units. In both panels featuring BM the relative intensities corresponding to the size of the different CDR3 rearrangements are figured.

 
By day 32 of culture, the same precursor population was tested again. The pattern that was previously diverse had changed drastically. We observed fewer major peaks having an irregular distribution. The expression pattern was now consistent with an oligoclonal population and was observed in both cDNA and DNA samples. After 40 to 50 days in culture, cells could no longer respond to LPS, although they continued to grow in the presence of IL-7 (data not shown), indicating that no more B cells were being generated.

We conclude that in the progeny of single multipotent cells in vitro, B cell precursors undergo Ig gene rearrangements, and a fraction of them differentiate, in a time-regulated manner, into IgM+ cells. Longer time periods in culture induce increasing oligoclonality in their pattern of V(D)J rearrangements, and after 4 wk the cell population is no longer representative of the initial rearrangements observed.

TdT expression in fetus derived B cell precursors

It has been shown that TdT "switch-on" can occur in fetal T cell precursors, depending on environmental cues. Here, we observe that TdT expression can be equally switched on in B cell precursors generated in vitro, starting with multipotent precursors from pre-liver embryos, as well as with committed B cell precursors from fetal liver. The multipotent nature of the splanchnopleura precursors implies that they do not express TdT ex vivo. As shown in Figure 3GoA, TdT was also not detectable in fetal liver at day 12 or day 15 of gestation, even in an enriched population of B cell precursors, whereas it was readily detected in adult bone marrow containing an identical percentage of B cell precursors. However, TdT mRNA was detected in B cell precursors of fetal liver origin from day 12 and day 15 after 4 days of culture and in the progeny of cells isolated from splanchnopleura analyzed at day 22 of culture (Fig. 3GoA).



View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 3. A, RT-PCR analysis of TdT and HPRT gene expression in B cell precursors from in adult bone marrow and in B220+-enriched cells isolated from fetal organs at day 9, 12, and 15 of development (D9, D12, D15) and set in culture for several days. The cDNAs derived from these samples were used at the same dilution as templates for TdT and HPRT amplification (30 cycles). The asterisk (*) indicates the progeny of a single cell isolated from the para-aortic splanchnopleura. The percentage of B220+ cells as measured by FACS analysis is reported under each lane. B, Determination of the ratio between TdT and HPRT in B220+-enriched cells isolated from day 14 fetal liver after 4 and 8 days of culture, from day 9 splanchnopleura after 22 days of culture, and in adult bone marrow cells; PCR was performed as described in Figure 1GoA using 26 (a lanes), 28 (b lanes), and 30 cycles (c lanes) for each sample to ensure that the amplification was within a linear range for both TdT and HPRT. TdT/HPRT ratios, determined by phosphorimager quantification, are presented in arbitrary units and normalized to 100% of B220+ cells; they correspond to the average of the values obtained at 26, 28, and 30 cycles for each sample. The experiments were performed twice.

 
By a semiquantitative PCR assay, the level of TdT present, after several days of culture, in B precursors from fetal liver at day 14 of development and from para-aortic splanchnopleura was compared with that from adult bone marrow (Fig. 3GoB). We observed a fourfold increase of TdT mRNA level in fetal liver precursors between 4 and 8 days of culture (Fig. 3GoB). The amount of TdT mRNA in precursors developed in vitro is lower than the level detected in adult bone marrow when normalized for the representation of B220+ cells. This weak expression is nevertheless sufficient to add N regions at the rearranged V(D)J junctions in B cell precursors originating from the para-aortic splanchnopleura. The profiles obtained in cDNA of cultured cells show a shift in the mean of CDR3 size distribution from day 15 to day 22 of about three amino acids (Fig. 2Go), suggesting that TdT expression also increases upon culture of the splanchnopleura precursors. Nevertheless, as expected, at day 22, the mean of the gaussian distribution is still one to two amino acids shorter than the mean obtained for adult bone marrow.

The presence of TdT in cultured cells is confirmed by sequence analysis (Fig. 4Go), since for two individual clones from splanchnopleural origin we were able to find 36 and 57% of sequences containing N additions, with a mean of four additions per junction. It is interesting to note that a substantially higher number of N sequences are observed in the V-D than in the D-J joints (Fig. 4Go). These results are consistent with a gradual increase in TdT levels during culture of splanchnopleura-derived B cell precursors. An up-regulation of TdT following culture of fetal B cell precursors is also suggested by the presence of N regions in V(D)J junctions from day 12 fetal liver cells after 10 days of culture (32).



View larger version (46K):
[in this window]
[in a new window]
  		FIGURE 4. Sequences of the CDR3 region isolated from the progeny of two multipotent precursors. The PCR products obtained with the J558/JH4 primers, shown in Figure 2Go, were cloned and sequenced. Clone 15 and 16 correspond to the progeny of two independent multipotent precursors. Bone marrow depleted of sIg+ cells was processed the same way, as a control. No repeated sequences were found.

 
Altogether, these results indicate that the differential expression of TdT in fetal vs adult life is not an intrinsic property of the hemopoietic precursors, but seems to depend on environmental cues.

Cells undergoing nonproductive heavy chain rearrangements are maintained in vitro

The immunoscope images obtained for DNA and cDNA PCR analysis isolated from bone marrow depleted of sIg+ were indistinguishable (Fig. 2Go). As previously reported, we found a minority of the peaks of intermediate length corresponding to nonproductive rearrangements. This result is consistent with the notion that most sIg- bone marrow cells have undergone selection for the expression of a productive rearrangement (33).

The DNA profiles seen in DNA isolated from the progeny of multipotent cells at day 15 and 22 of culture (Fig. 2Go), although diverse, are drastically different from those seen for bone marrow, and peaks at all lengths of CDR3 are observed indicating the presence of a majority of out-of-frame rearrangements. We could never detect any nonproductive rearrangement at the cDNA level, which shows that these transcripts are probably unstable. These results show that cells with productive rearrangements are not favored under our culture conditions.

It is interesting that once in vitro-developed B cells are mature and respond to LPS, they can express only the heavy chain product of one of the chromosomes; in other words, they can accomplish allelic exclusion (30).

A semiquantitative PCR analysis performed in DNA samples after 10 and 21 days of culture indicates that the ratio of productive to nonproductive rearrangements, when the J558 VH gene primer is used, is kept constant during this period of time and is about 10-fold lower than in adult spleen (Table IGo). Using the same semiquantitative PCR approach, we calculated the ratio of DJ/V(D)J rearrangements in cells that develop in culture: as shown in Table IGo, the representation of DJ rearrangements is 5-fold higher than in splenic B cells, which indicates an enhanced proportion of pro-B cells in the cultured population.


View this table:
[in this window]
[in a new window]
  		Table I. Ratio of VDJ/DJ rearrangementsa

 
To ensure that the intermediate-size peaks correspond to nonproductive rearrangements, we cloned and sequenced the DNA PCR products of two populations of cells that rearranged in vitro and compared them to sIg- bone marrow-derived sequences amplified and cloned under the same conditions. Figure 4Go shows the CDR3 region of these sequences. Among all sequenced clones, we never found any repeated sequences. While in bone marrow we could detect ~70% of productive heavy chain rearrangements, in the cell populations developed in culture we found a minority (26–37%) of productive rearrangements. As predicted, counterselection for D regions in reading frame 2 (RF2) is observed, suggesting that cells expressing the Dµ protein are arrested in the D-J configuration. Actually, sequence analysis of D-JH rearrangements shows an identical representation of all reading frames, namely, 32% RF1, 36% RF2, and 32% RF3 for clone 15 and 23% RF1, 32% RF2, and 36% RF3 for clone 16 (data not shown). A similar analysis (33) done at the single-cell level in pro-B cells isolated from the bone marrow gave the same results.

These results confirmed the global PCR analysis and indicate that, in contrast to what is observed in vivo, B cell precursors in vitro express a ratio of productive to nonproductive rearrangements close to the expected frequency in the absence of selection (1:2).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The location of the embryonic origin of hemopoietic cells has long been a matter of debate. Recently, we and others (25, 34, 35) have identified a site in the mouse embryo proper that harbors the first detectable multipotent hemopoietic precursors. This site is called the para-aortic splanchnopleura. We have previously shown that single micromanipulated cells, isolated from the para-aortic splanchnopleura at day 9 of gestation, that can generate lymphocytes in vitro can also generate multiple myeloid cells and are therefore multipotent (24). As a consequence, lymphocyte commitment and differentiation occur in vitro. S17 stromal cells supplemented with IL-7 and c-kit ligand fulfill the requirements for B lymphocyte precursors expansion and differentiation into B cells that can respond to LPS and differentiate into plasma cells.

We have observed that from one single multipotent progenitor we could generate in vitro large numbers of B cell precursors that rearrange heavy chain genes with a large pattern of diversity, evolving during the time course of culture. After 15 days of culture, the mean of CDR3 size distribution was shorter than that of normal bone marrow, reflecting the reduced junctional diversity observed in fetal V(D)J joints in which N regions are lacking. Surprisingly, at day 22 of culture, the mean of the CDR3 size distribution is increased due to the appearance of N nucleotides additions, yet in a reduced proportion compared with bone marrow. It was noticeable that the number of N regions per junction was about sixfold higher in V-D than in D-J joints. As no such discrepancy was recorded in the same V(D)J joints from bone marrow, this difference could be explained by a lower TdT expression level during D-J rearrangement in cultured cells, rather than by differential accessibility between gene segments.

It has been proposed that external signals from the microenvironment of the developing thymus might provoke a switching on of TdT gene expression (36, 37, 38), or alternatively, that several waves of precursors harboring different potentials in the capacity to add N nucleotides sequentially colonize the lymphopoietic organs (39, 40). Induction of TdT is known to occur upon culture of neonatal thymocytes (41, 42), and N region diversity has also been shown in rearranged TCR genes in fetal thymus organ culture (36). Moreover, in adult SCID mice reconstituted with fetal liver precursors, N nucleotides are present in TCR rearrangements. In this article, we show that TdT expression occurs upon culture of fetal B precursors corresponding to different stages of the ontogeny of the immune system: from the earliest detected source of hemopoietic stem cells (day 9) to the committed B cell precursor in fetal liver (day 15). Altogether, these data suggest that, as their T cell counterparts, fetal B cell precursors have the potentiality to express TdT and are not consistent with the existence of different waves of precursors colonizing fetal liver vs bone marrow. The data support the idea that TdT expression is dependent on environmental cues, which could either induce up-regulation of TdT gene expression or gradually change the property of the stem cell lineage.

As time in culture increased, the polyclonal pattern of rearrangements became oligoclonal irrespective of whether DNA or cDNA was analyzed. Consequently, long periods of in vitro culture bias the rearrangement pattern of these samples. Our interpretation of the data is based on the fact that cells that can make a productive rearrangement at the heavy chain locus can probably progress into B cells, which are short lived under these culture conditions. The flow cytometry analysis supports this hypothesis, since we consistently detected in all clones a maximum rate of differentiation into B cells at around day 20 that quickly decreased, showing that cells cannot survive for long and that most cells differentiate synchronously. This apparent synchronization has been previously noticed in fetal liver cells (43).

Assuming a limited degree of self-renewability of the multipotent precursor, cells with VH-D-JH rearrangements will become rare and will consequently generate an oligoclonal pattern. Finally, a majority of cells that make D-JH rearrangements only will dominate the cultures, as previously reported (44) (A.C., unpublished observations). Abelson-transformed pre-B cell lines have been shown to loose expression of the RAG genes with time. Whether or not the same phenomenon is present in primary cells, it is clear that the predominance of cells at D-JH stage can only be explained by a reduction in the capacity to further rearrange the Ig loci (44). In addition, cells with the D region in RF2 will stop further rearrangement due to the production of Dµ protein. These phenomena could also explain why LPS responsiveness is lost with time in culture.

Surprisingly, DNA isolated from the culture samples generated a pattern of rearrangement different from bone marrow, and out-of-frame rearrangements outnumbered in-frame rearrangements. Sequence analysis of cloned DNA rearrangements confirmed, at all time points tested, that a minority of rearrangements (30%) are in-frame as compared with 70% in the bone marrow sample that we used as a control. This result shows that, in vitro, cells that make nonproductive rearrangements are maintained and constitute a large proportion of the population.

We could explain these data as a result of limited survival in vitro of cells that make a productive rearrangement, leading to the accumulation of CD43+ cells. If accumulation of CD43+ cells is likely to occur with time, it can hardly be the only explanation for our observations. The predominance of out-of-frame rearrangements is seen early in the culture (day 15) before the first IgM+ B cells are detected. In vitro precursors can advance into later stages of differentiation and still respond to IL-7 (a part of fraction D in the Hardy nomenclature (31) or pre-B I in the Melchers nomenclature (45). If selection of cells undergoing productive rearrangements would be as efficient in culture as in vivo, we were expecting to find ratios of P/NP (productive/nonproductive) rearrangements close to those in bone marrow. The constant predominance of out-of-frame rearrangements argues for the absence of positive selection in culture.

Sequence analysis of D-JH rearrangements shows equivalent proportions of all reading frames in the dominant population of precursor cells at the D-JH stage, consistent with previous observations (33). In contrast, in V(D)J rearrangements, a counterselection for D-JH in RF2 is seen both in our test DNA as well as in bone marrow. According to the current view, cells with the D region in RF2 will stop further rearrangement in the heavy chain locus, due to the production of Dµ protein. Assuming that the mechanism leading to counterselection of cells that express D-J in RF2 is the same that mediates allelic exclusion, we infer that allelic exclusion operates normally in vitro. Although in the present report allelic exclusion has not been directly tested, our previously published data demonstrate that B cells are allelically excluded in vitro. We have previously shown that cells generated in culture from IghaxIghb precursors from pre-liver embryos in response to LPS secrete the product of only one chromosome (30).

We conclude from the three major functions of the expression of a pre-B cell receptor, namely allelic exclusion, counterselection for cells expressing the Dµ protein, and selection for cells that made productive V(D)J rearrangements, that the first two, but not the third, are efficiently achieved in vitro. Counterselection for nonproductive rearrangement is therefore not an intrinsic phenomenon but rather is environmentally induced. We could envisage several possibilities as to the nature of this environmental influence. A ligand(s) external to the pre-B cell receptor and absent in our cultures could be the required signal inducing the expansion of pre-B cells after successful heavy chain rearrangement. Alternatively, differential survival thresholds in B-lineage cells could account for the expansion and survival of pre-B receptor-expressing cells. Different levels of bcl-2 expression have indeed been reported at different stages of B cell development, which in situations of limiting growth factor availability might also account for differential cell survival. The experiments reported here could provide an assay system to identify these environmental stimuli required for progression of B-lineage cells.


   Acknowledgments
 
We acknowledge the help of Isabelle Godin in the isolation of splanchnopleura regions of day 9 embryos, Sylvie Darche, and Sylvie Delassus for help in the PCR experiments, and Michèle Goodhart for critical reading of the manuscript.


   Footnotes
 
1 This work was supported by Institut National de la Santé et de la Recherche Médicale (Unité 277), Centre National de la Recherche Scientifique (Unité de Recherche Associée 1960), Institut Pasteur, and grants from the Association pour la Recherche sur le Cancer. Back

2 Supported by a fellowship from the French Ministère de la Recherche et de la Technologie. Back

3 Address correspondence and reprint requests to Dr. Ana Cumano, Unité de Biologie Moléculaire du Gène, Département d’Immunologie, Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris Cedex 15, France. E-mail address: Back

4 Abbreviations used in this paper: TdT, terminal deoxynucleotidyl transferase; HPRT, hypoxanthine phosphoribosyltransferase; sIg, surface Ig; CDR, complementarity-determining region; RF, reading frame. Back

Received for publication October 15, 1997. Accepted for publication January 5, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Alt, F. W., N. Rosenberg, S. Lewis, E. Thomas, D. Baltimore. 1981. Organization and reorganization of immunoglobulin genes in A-Mulv transformed cells: rearrangement of heavy but not light chain genes. Cell 27:381.[Medline]
  2. Lewis, S., A. Gifford, D. Baltimore. 1985. DNA elements are asymetrically joined during the site-specific recombination of kappa immunoglobulin genes. Science 228:677.[Abstract/Free Full Text]
  3. Lafaille, J. J., A. DeCloux, M. Bonneville, Y. Takagaki, S. Tonegawa. 1989. Junctional sequences of T cell receptor {gamma}{delta} genes: implications for {gamma}{delta} T cell lineages and for a novel intermediate of V(D)J joining. Cell 59:859.[Medline]
  4. Alt, F. W., D. Baltimore. 1982. Joining of immunoglobulin heavy chain gene segments: implications from a chromosome with evidence of three D-JH fusions. Proc. Natl. Acad. Sci. USA 79:4118.[Abstract/Free Full Text]
  5. Desiderio, S. V., G. D. Yancopoulos, M. Paskind, E. Thomas, M. A. Boss, N. Landau, F. W. Alt, D. Baltimore. 1984. Insertion of N regions into heavy-chain genes is correlated with expression of terminal deoxytransferase in B cells. Nature 311:752.[Medline]
  6. Landau, N. R., D. G. Schatz, M. Rosa, D. Baltimore. 1987. Increased frequency of N region insertion in a murine pre-B-cell line infected with a terminal deoxynucleotidyl transferase retroviral expression vector. Mol. Cell. Biol. 7:3237.[Abstract/Free Full Text]
  7. Kallenbach, S., N. Doyen, M. Fanton d’Andon, F. Rougeon. 1992. Three lymphoid specific factors account for all junctional diversity characteristic of somatic assembly of T-cell receptor and immunoglobulin genes. Proc. Natl. Acad. Sci. USA 89:2799.[Abstract/Free Full Text]
  8. Gilfillan, S., A. Dierich, M. Lemeur, C. Benoist, D. Mathis. 1993. Mice lacking TdT: mature animals with an immature lymphocyte repertoire. Science 261:1175.[Abstract/Free Full Text]
  9. Komori, T., A. Okada, V. Stewart, F. W. Alt. 1993. Lack of N regions in antigen receptor variable region genes of TdT deficient lymphocytes. Science 261:1171.[Abstract/Free Full Text]
  10. Elliott, J. F., E. P. Rock, P. A. Patten, M. M. Davis, Y. H. Chien. 1988. The adult T-cell receptor {delta}-chain is diverse and distinct from that of fetal thymocytes. Nature 331:627.[Medline]
  11. Carlsson, L., D. Holmberg. 1990. Genetic basis of the neonatal antibody repertoire: germline V-gene expression and limited N-region diversity. Int. Immunol. 2:639.[Abstract/Free Full Text]
  12. Feeney, A. J.. 1990. Lack of N regions in fetal and neonatal mouse immunoglobulin V-D-J junctional sequences. J. Exp. Med. 172:1377.[Abstract/Free Full Text]
  13. Gu, H., I. Förster, K. Rajewsky. 1990. Sequence homologies, N sequence insertion and JH gene utilization in VHDJH joining: implications for the joining mechanism and the ontogenetic timing of Ly1 B cell and B-CLL progenitor generation. EMBO J. 9:2133.[Medline]
  14. Meek, K.. 1990. Analysis of junctional diversity during B lymphocyte development. Science 250:820.[Abstract/Free Full Text]
  15. Feeney, A. J.. 1991. Junctional sequences of fetal T cell receptor ß chains have few N regions. J. Exp. Med. 174:115.[Abstract/Free Full Text]
  16. Bogue, M., S. Candéias, C. Benoist, D. Mathis. 1991. A special repertoire of {alpha}:ß T cells in neonatal mice. EMBO J. 10:3647.[Medline]
  17. Bogue, M., S. Gilfillan, C. Benoist, D. Mathis. 1992. Regulation of N-region diversity in antigen receptors through thymocyte differentiation and thymus ontogeny. Proc. Natl. Acad. Sci. USA 89:11011.[Abstract/Free Full Text]
  18. Li, Y.-S., K. Hayakawa, R. R. Hardy. 1993. The regulated expression of B lineage associated genes during B cell differentiation in bone marrow and fetal liver. J. Exp. Med. 178:951.[Abstract/Free Full Text]
  19. Tsubata, T., M. Reth. 1990. The products of pre-B specific gene ({lambda}5 and VPreB) and the immunoglobulin µ chain form a complex that is transported onto cell surface. J. Exp. Med. 172:973.[Abstract/Free Full Text]
  20. Karasuyama, H., A. Kudo, F. Melchers. 1990. The protein encoded by the VpreB and {lambda}5 preB cell-specific genes can associate with each other and with µ heavy chain. J. Exp. Med. 172:969.[Abstract/Free Full Text]
  21. Kitamura, D., A. Kudo, S. Schaal, W. Muller, F. Melchers, K. Rajewsky. 1992. A critical role for {lambda}5 protein in B cell development. Cell 69:823.[Medline]
  22. Kincade, P. W., G. Lee, C. E. Pietrangeli, S. I. Hayashi, J. M. Gimble. 1989. Cells and molecules that regulate B lymphopoiesis in bone marrow. Annu. Rev. Immunol. 7:111.[Medline]
  23. Cumano, A., K. Dorshkind, S. Gillis, C. J. Paige. 1990. The influence of S17 stromal cells and interleukin 7 on B cell development. Eur. J. Immunol. 20:2183.[Medline]
  24. Godin, L., F. Dieterlen-Lièvre, A. Cumano. 1995. Emergence of multipotent hemopoietic cells in the yolk sac and in the paraaortic splanchnopleura in mouse embryos, beginning at 8.5 days postcoitum. Proc. Natl. Acad. Sci. USA 92:773.[Abstract/Free Full Text]
  25. Muller, A., A. Medvinsky, J. Strouboulis, F. Grosveld, D. E. . 1994. Development of hematopoietic stem cell activity in the mouse embryo. Immunity 1:291.[Medline]
  26. Chomczynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  27. Bentolila, L. A., M. Fanton d’Andon, Q. T. Nguyen, O. Martinez, F. Rougeon, N. Doyen. 1995. The two isoforms of mouse terminal deoxynucleotidyl transferase differ in both the ability to add N regions and subcellular localization. EMBO J. 14:4221.[Medline]
  28. Pannetier, C., M. Cochet, S. Darche, A. Casrouge, M. Zöller, P. Kourilsky. 1993. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor ß chains vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA 90:4319.[Abstract/Free Full Text]
  29. Delassus, S., A. Gey, S. Darche, A. Cumano, C. Roth, P. Kourilsky. 1995. PCR-based analysis of the murine immunoglobulin heavy-chain repertoire. J. Immunol. Methods 184:219.[Medline]
  30. Cumano, A., C. Furlonger, C. J. Paige. 1993. Differentiation and characterization of B-cell precursors detected in the yolk sac and embryo body of embryos beginning at the 10–12 somite stage. Proc. Natl. Acad. Sci. USA 90:6429.[Abstract/Free Full Text]
  31. Hardy, R. R., C. E. Carmack, S. A. Shinton, J. D. Kemp, K. Hayakawa. 1991. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173:1213.[Abstract/Free Full Text]
  32. Marshall, A. J., C. Paige, G. E. Wu. 1997. VH repertoire maturation during B cell development in vitro. J. Immunol. 158:4282.[Abstract]
  33. Ehlich, A., V. Martin, W. Müller, K. Rajewsky. 1994. Analysis of the B-cell progenitor compartment at the level of single cells. Curr. Biol. 4:573.[Medline]
  34. Cumano, A., F. Dierterlen-Lièvre, I. Godin. 1996. Lymphoid potential, probed before circulation in mouse, is restricted to caudal intraembryonic splanchnopleura. Cell 86:907.[Medline]
  35. Medvinsky, A., E. Dzierzak. 1996. Definitive hematopoiesis is autonomously initiated by the AGM region. Cell 86:897.[Medline]
  36. Larché, M., S. D. Rencher, J. L. Hurwitz. 1992. Environmental influence on T cell receptor {alpha} gene rearrangement and expression in vitro. Eur. J. Immunol. 22:2733.[Medline]
  37. Bogue, M., H. Mossmann, U. Stauffer, C. Benoist, D. Mathis. 1993. The level of N-region diversity is not pre-ordained in the stem cell. Eur. J. Immunol. 23:1185.[Medline]
  38. Matsuzaki, G., M. Ogimoto, Y. Yoshikai, R. Seki, K. Nomoto. 1993. Extensive N nucleotide addition in junctional region of T cell receptor V{gamma}5 genes rearranged in fetal liver-derived thymocytes in radiation chimera mice. Eur. J. Immunol. 23:3345.[Medline]
  39. Ikuta, K., I. L. Weissman. 1991. The junctional modifications of a T cell receptor {gamma} chain are determined at the level of thymic precursors. J. Exp. Med. 174:1279.[Abstract/Free Full Text]
  40. Komagata, Y., I. L. Weissman, K. Ikuta. 1996. Heterogeneity of N insertion capacity in fetal hematopoietic stem cells. Int. Immunol. 8:837.[Abstract/Free Full Text]
  41. Rothenberg, E., D. Triglia. 1983. Clonal proliferation unlinked to terminal deoxynucleotidyl transferase synthesis in thymocytes of young mice. J. Immunol. 130:1627.[Abstract]
  42. Appasamy, P. M., Y. Weng, T. W. Kenniston, A. B. Deleo, L. Tang. 1995. Expression of diverse and functional TCR {gamma} and Ig heavy chain transcripts in fetal liver cells cultured with interleukin 7. Mol. Immunol. 32:805.[Medline]
  43. Strasser, A., A. Rolink, F. Melchers. 1974. One synchronous wave of B cell development in mouse fetal liver changes at day 16 of gestation from dependence to independence of a stromal cell environment. J. Exp. Med. 170:1973.[Abstract/Free Full Text]
  44. Rolink, A., A. Kudo, H. Karasuyama, Y. Kituchi, F. Melchers. 1991. Long term proliferating early pre-B cell lines and clones with the potential to develop to surface Ig-positive, mitogen reactive B cells in vitro and in vivo. EMBO. J. 10:327.[Medline]
  45. Rolink, A., F. Melchers. 1991. Molecular and cellular origins of B lymphocyte diversity. Cell 66:1081.[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
M. M. Souto-Carneiro, G. P. Sims, H. Girschik, J. Lee, and P. E. Lipsky
Developmental Changes in the Human Heavy Chain CDR3
J. Immunol., December 1, 2005; 175(11): 7425 - 7436.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
E. A. Whitcomb, B. B. Haines, A. P. Parmelee, A. M. Pearlman, and P. H. Brodeur
Germline Structure and Differential Utilization of Igha and Ighb VH10 Genes
J. Immunol., February 1, 1999; 162(3): 1541 - 1550.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
X.-X. Zeng, H. Zhang, R. R. Hardy, and R. Wasserman
The Fetal Origin of B-Precursor Leukemia in the Eľ-ret Mouse
Blood, November 15, 1998; 92(10): 3529 - 3536.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Sun, C. Hayward, R. Shinde, R. Christenson, S. P. Ford, and J. E. Butler
Antibody Repertoire Development in Fetal and Neonatal Piglets. I. Four VH Genes Account for 80 Percent of VH Usage During 84 Days of Fetal Life
J. Immunol., November 1, 1998; 161(9): 5070 - 5078.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nourrit, F.
Right arrow Articles by Cumano, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nourrit, F.
Right arrow Articles by Cumano, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS