|
|
||||||||


*
Thomas E. Starzl Transplantation Institute and Departments of Surgery,
Pediatrics, and
Molecular Genetics and Biochemistry, University of Pittsburgh, PA 15213
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Leukocyte microchimerism can be augmented in organ allograft recipients
if they are infused perioperatively with either unmodified donor BM
cells (11, 12) or mobilized donor stem cells (13), and maintained on
conventional immunosuppressive therapy. An alternative/additional
approach to the manipulation of microchimerism is the use of
hemopoietic growth factors to induce the mobilization of cells in graft
recipients. These factors include granulocyte-macrophage CSF,
granulocyte (G)-CSF, c-kit ligand, IL-7, IL-8, IL-12, and
macrophage-inhibitory protein-1
family members. Flt-3 ligand (FL) is
a recently cloned hemopoietic cytokine (14, 15), with potent ability to
stimulate the growth and mobilization of stem and progenitor cells
(16). It is a type I transmembrane protein with size and structural
similarity to CSF-1 (macrophage-CSF) and c-kit ligand, and
exists as both membrane-bound and soluble forms. FL is expressed on a
wide variety of cells and tissues, as opposed to its receptor flt-3, a
receptor type III tyrosine kinase, that is restricted to hemopoietic
stem and progenitor cells (17, 18). FL synergizes with a wide range of
CSFs and ILs (G-CSF, c-kit ligand, IL-3, IL-6, and IL-11) in
vitro to promote colony growth of primitive progenitor cells (19).
Although it augments multiple leukocyte lineages in vivo, FL
dramatically and selectively increases the numbers of DC in both
lymphoid and nonlymphoid tissues (20, 21, 22, 23). It has also been shown
recently to exert significant antitumor activity in mice (24).
In this study, we examined the effects of a short course of FL on microchimerism and antidonor immune reactivity in normal and tacrolimus-treated allogeneic BM recipients. A much more striking increase in donor cells was observed in the spleens of mice given FL + tacrolimus compared with those receiving tacrolimus alone. In heart allograft recipients, donor BM alone or BM + FL for 7 days significantly reduced median heart graft survival compared with normal controls. BM + short-term tacrolimus therapy, however, prolonged graft survival well beyond that observed with tacrolimus alone. When FL was added to the combination of BM + tacrolimus, the beneficial effect of donor cells was lost. These findings indicate that, after withdrawal of immunosuppression, heart graft recipients with markedly augmented numbers of potential allostimulatory donor APC exhibit enhanced antidonor reactivity. They also caution against the potential risks of uncontrolled immunologic imbalance between donor and host that may occur following in vivo use of potent hematologic growth factors.
| Materials and Methods |
|---|
|
|
|---|
Male C57BL/10J (B10; H2b; IAb) and C3H/HeJ (C3H; H2k; IEk) mice, 8 to 12 wk of age, were purchased from The Jackson Laboratory (Bar Harbor, ME). They were housed in the specific pathogen-free facility of University of Pittsburgh Medical Center (Pittsburgh, PA), and provided with Purina rodent chow (Ralston Purina, St. Louis, MO) and tap water ad libitum.
Allogeneic bone marrow (BM) transplantation
B10 mice were used as donors and C3H mice as recipients. C3H recipients (three per group) were injected via the lateral tail vein with 50 x 106 freshly isolated B10 BM cells. In addition, animals received Chinese hamster ovary cell-derived human rFL (Immunex, Seattle, WA) at 10 µg/mouse/day i.p., in low endotoxin PBS, or no cytokine, with or without tacrolimus, for 7 consecutive days (days 06) posttransplantation. Tacrolimus (formerly FK 506) was obtained from Fujisawa Pharmaceutical (Osaka, Japan), and injected i.m. at 2 mg/kg/day from days 0 to 6. Control animals received BM alone with no further treatment. On day 7, animals were killed. Spleens and BM cells were harvested from each mouse, pooled in treatment groups, and processed for molecular, immunohistochemical, and in vitro functional analyses.
Heterotopic heart transplantation
Donor cardiectomy was performed on unsexed B10 neonates within 24 h of birth. The hearts were implanted into the left dorsal ear pinna of normal adult male C3H mice (25).
Following transplantation, the mice were assigned randomly to six groups. They received either no further treatment, donor BM alone (as described above), tacrolimus alone (2 mg/kg/day i.p.; days 013), or in addition to donor BM, FL (10 µg/day; days 06), tacrolimus, or both agents. Pilot studies had shown that a 13-day course of tacrolimus (2 mg/kg/day) gave an approximate doubling of graft survival time that was considered optimal for testing the additional effects of BM and FL. The heart grafts were monitored for contractile activity on a daily basis, by a blinded observer using a stereomicroscope. In the B10 to C3H strain combination, heartbeat is generally detected by 8 days posttransplant. Rejection was determined as cessation of heartbeat for 2 consecutive days, and was confirmed histologically. Three animals from each group were sacrificed on day 15 posttransplant, and spleen cell suspensions were prepared for in vitro functional analyses.
Detection of donor DNA by PCR
DNA was extracted from freshly isolated BM cells of both normal B10 and C3H mice, and from C3H mice 7 days after B10 BM transplantation, with or without treatment with FL and/or tacrolimus. The forward and reverse oligonucleotide primers for the detection of donor MHC class II allele-specific DNA (IAb) in C3H recipients were CCACCTTGCAGTCATAAATG and AGTTTGGCCAATTGGCAAGC, respectively. The primers were designed to distinguish donor DNA from recipient DNA, and yielded no visible PCR product of 700 bp with the recipient DNA template under ethidium bromide fluorescence. One-microgram aliquots of DNA were amplified for 25 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s in buffer consisting of 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2, 0.2 mM deoxynucleotides, 0.1% gelatin, 0.2 µM primers, and 2.5 U Taq polymerase (Perkin-Elmer, Norwalk, CT). The products were separated in a 1% agarose gel containing ethidium bromide. The intensity of the fluorescence was compared with standards consisting of serial dilutions of normal B10 DNA into normal C3H DNA.
Immunohistochemical analyses
Diced samples of freshly isolated spleens were placed in embedding medium (Tissue-Tek OCT Compound; Miles, Elkhart, IN), snap frozen in liquid nitrogen, and stored at -80°C until further use. Cryostat sections (8 µm) were cut, mounted onto slides, air dried at room temperature, and stained using the avidin-biotin-peroxidase complex (ABC) procedure. Sections were fixed in ethanol and incubated with biotinylated mouse IgG2a anti-I-Ab mAb for 1 h at room temperature. Following three 5-min washes in PBS, the slides were incubated with ABC complex (Boehringer Mannheim, Indianapolis, IN) for 30 min. The color reaction was developed using a peroxidase chromagen kit (diaminobenzidine (DAB); Sigma Chemical, St. Louis, MO). Sections were counterstained lightly with hematoxylin. Controls included sections stained using an isotype-matched irrelevant mAb. The number of donor MHC class II+ cells was determined independently by two blinded observers. Twenty to twenty-five high power fields/section (there were three sections/mouse, three mice/group) were counted using an ocular grid. The results are expressed as mean number of I-Ab+ cells ± 1 SD per high power field.
Mixed leukocyte reactions
Recipient splenocytes were T cell enriched by passage through a nylon wool column (26), and set up as responders (2 x 105 cells/well) with graded concentrations of irradiated (20 Gy) donor splenocytes in RPMI 1640 (Life Technologies, Grand Island, NY) complete medium, containing 10% heat-inactivated FBS (Life Technologies), 2 mM L-glutamine, 50 U/ml penicillin and streptomycin, and 2 mM nonessential amino acids, for 72 h at 37°C, 5% CO2. Sixteen to eighteen hours before the end of the culture period, individual wells were pulse labeled with 1 µCi [3H]thymidine. The plates were harvested, and the amount of radioisotope incorporated into the cells was determined using a beta scintillation counter. Results are expressed as mean cpm ± 1 SD. Data presented are from representative experiments performed at least three times.
CTL assay
Recipient splenic T cells were restimulated in vitro for 4 days
with
-irradiated (20 Gy) donor strain splenocytes before use as
effectors. The EL-4 (H2b) lymphoma cell line (TIB39;
American Type Culture Collection (ATCC), Rockville, MD) was used as a
source of allogeneic target cells. The P815 (H2d) mouse
mastocytoma cell line (TIB64; ATCC) and the R1.1 (H2k)
lymphoma cell line (TIB42; ATCC) were used as third party (specificity
control) and syngeneic targets, respectively. The target cells were
labeled with 100 µCi Na251CrO4
(DuPont/NEN, Boston, MA), washed, and plated at a concentration of
5 x 103 cells/well in 96-well, round-bottom culture
plates (Corning, Corning, NY). Serial, twofold dilutions of effector
cells were added to give E:T ratios of 100:1, 50:1, 25:1, and 12.5:1,
in a total volume of 200 µl/well. Following 4-h incubation at 37°C
in 5% CO2, specific 51Cr release was
determined. The supernatant was recovered from each well using a
supernatant collection system (Skatron, Sterling, VA). Maximum
51Cr release was determined by osmotic lysis of the cells.
Percentage of cytotoxicity was calculated using the formula: percentage
of cytotoxicity = 100 x (experimental cpm -
spontaneous cpm/maximum cpm - spontaneous cpm). Results are
expressed as mean ± 1 SD of percentage of 51Cr
release in triplicate cultures.
Statistics
Statistical analyses were performed using the nonparametric Mann-Whitney U test or Students t test, as appropriate.
| Results |
|---|
|
|
|---|
C3H mice were given 50 x 106 freshly
isolated unmodified B10 BM cells, and injected for 7 consecutive days
(days 06) with FL or tacrolimus alone, or FL + tacrolimus. On
day 7, spleens from the FL-treated animals were considerably enlarged,
and the mean weight was greater than twice that of mice given BM alone
(Table I
). A 2.7-fold increase in the
absolute number of nucleated spleen cells compared with BM treatment
alone was also observed after 7 days of FL administration. Tacrolimus
did not significantly affect spleen weights or cell numbers, whether or
not FL was given concomitantly to the allogeneic BM recipients.
|
We next investigated the influence of FL on donor leukocyte
chimerism by examining levels of donor DNA (MHC class II
(I-Ab)) in the BM of the four groups of allogeneic BM
recipients using semiquantitative PCR. Donor DNA was detected only in
the two groups of animals treated with tacrolimus (Fig. 1
). The level of donor DNA in the BM of
the FL + tacrolimus-treated group was consistently higher compared
with that of mice given tacrolimus alone. This indicated that FL alone
did not promote chimerism, but that in tacrolimus-immunosuppressed
allogeneic BM recipients, FL enhanced microchimerism within the
recipient BM. Four additional groups of identically treated mice (three
animals per group) showed no evidence of donor MHC class II DNA in the
BM when examined 4 wk after donor BM infusion (data not shown). This
indicated that the chimerism observed in each of the tacrolimus-treated
groups did not persist in detectable amounts for more than 3 wk
following the withdrawal of immunosuppression.
|
Cryostat sections of spleens from the four groups of allogeneic BM
recipients were assessed for the presence of donor MHC class
II+ (I-Ab+) cells by immunohistochemical
staining. Normal C3H and B10 mouse spleen samples were included as
negative and positive controls, respectively. In normal B10 positive
controls, the expected distribution of I-Ab+ cells was
observed (Fig. 2
A),
whereas in normal C3H spleens no I-Ab+ cells were detected
(Fig. 2
B). The numbers of positive cells detected in
each experimental group are shown in Table II
. Animals treated with FL alone
exhibited very few positive cells as was found in control (untreated)
BM recipients (Fig. 2
, C and D). On the
other hand, tacrolimus alone led to a substantial, 60-fold increase in
donor-positive cells compared with untreated controls (Fig. 2
, E and F). These I-Ab+ donor
cells were present mainly in the periarteriolar lymphatic sheaths
(PALS) (Fig. 2
E). The highest incidence of MHC donor
class II+ cells was found in the tissues of BM recipients
treated with both FL and tacrolimus (Fig. 2
, G and
H). These cells, found in both the PALS and red pulp,
exhibited typical DC characteristics, including prominent cytoplasmic
processes that interdigitated with numerous host cells (Fig. 2
H). An eightfold increase in donor class
II+ cells was seen in the latter group when compared with
animals treated with BM + tacrolimus. When compared with untreated
control BM recipients, however, the increase was almost 500-fold (Table II
). The findings clearly indicate that treatment of allogeneic BM
recipients with FL and tacrolimus dramatically augments donor leukocyte
microchimerism.
|
|
Splenic T cells from B10 BM-injected C3H mice treated with FL or
tacrolimus or both agents, then sacrificed 7 days posttransplant, were
used as responders in one-way 3-day MLRs. To a fixed number of the
recipients (C3H) T cells, variable numbers of
-irradiated normal
allogeneic (B10) stimulator splenocytes were added, and the
proliferative responses determined. As shown in Figure 3
, BM transplantation alone markedly
augmented secondary responsiveness to donor alloantigens, after
presumed primary stimulation in vivo, when compared with that of normal
C3H controls. Animals given FL in addition to BM exhibited a further
significant increase (p < 0.01) in host
antidonor proliferative responses. In contrast, T cells from BM
recipients treated with tacrolimus, or FL + tacrolimus responded
poorly to donor alloantigen over the range of stimulator:responder cell
ratios tested. From these results, it can be concluded that FL
treatment alone augments the antidonor responsiveness of allogeneic BM
recipients. Tacrolimus, on the other hand, abolishes these responses,
both in mice given BM alone and those given BM +
FL.
|
The cytotoxic potential of splenic T cells from untreated normal
controls and variously treated allogeneic BM recipients (7 days
posttransplant) was tested after a 4-day period of (re)stimulation in
vitro. When compared with normal control C3H effectors, splenocytes
from animals given either BM alone or BM + FL exhibited
significantly higher ex vivo donor-specific CTL activity over a range
of E:T ratios (Fig. 4
). Splenic T cells
from BM recipients given tacrolimus alone or FL + tacrolimus,
however, generated comparatively weak CTL responses to donor. Of these,
the cytotoxic activity in the FL-treated group was significantly higher
(p < 0.01 at E:T ratios of 25:1 and higher).
Minimal lysis of third party (H2d) target cells (P815) was
observed in all of the treatment groups (Fig. 4
), confirming that the
CTL responses generated were donor specific.
|
We next examined the impact of donor BM cells, FL, and tacrolimus
on organ allograft survival. Median graft survival time (MST) in normal
C3H recipients of B10 hearts was 10 days. Administration of unmodified
donor BM alone to normal heart allograft recipients at the time of
organ transplant resulted in accelerated heart graft rejection
(heartbeat was not detected in any recipients), and rejection was
confirmed histologically. Similarly, failure of all heart grafts to
beat was observed in animals treated with both BM and FL. Tacrolimus
alone (days 013), however, prolonged graft MST from 10 to 22 days.
Heart graft survival was further enhanced to 42 days in hosts that
received perioperative donor BM infusion and the 13-day course of
tacrolimus immunosuppression (Fig. 5
).
Animals treated with BM, FL, and tacrolimus had significantly higher
(p < 0.01) graft MST when compared with
untreated control heart graft recipients, but significantly lower
(p < 0.01) graft MST when compared with the
BM + tacrolimus treatment group. Overall, these data show that,
when administered with donor BM either in the absence or presence of a
2-wk course of immunosuppression, FL treatment resulted in exacerbation
of organ allograft rejection.
|
Splenic T cells from the various treatment groups of
heart-transplanted animals were set up in MLR assays as well as in
lymphocytotoxicity tests on day 15 posttransplantation to evaluate
antidonor immunologic responses. This time point was chosen, as it was
3 to 7 days before graft MST in the FL + tacrolimus- and
tacrolimus-treated animals that subsequently rejected their heart
grafts. Both MLR (Fig. 6
) and CTL
responses (Fig. 7
) revealed augmentation
of secondary antidonor reactivity after presumed primary stimulation in
heart graft recipients given donor BM alone or BM + FL compared
with heart transplant controls that received no treatment. Splenic T
cells from BM- or BM + FL-treated animals were the most active
mediators of antidonor MLR responses (Fig. 6
). While splenic T cells
from heart graft recipients treated with or without BM responded to
donor alloantigen effectively, cotreatment of the mice with tacrolimus
rendered them unresponsive at the time of assay. Similar results were
observed when responder splenic T cells from the various treatment
groups were set up on day 15 in CTL assays (Fig. 7
). Thus, treatment
with BM alone or BM + FL significantly augmented antidonor
responses ex vivo. However, administration of tacrolimus markedly
reduced antidonor CTL reactivity compared with that observed with cells
from BM alone or BM + FL-treated groups. In summary, treatment
resulting in accelerated rejection of heart grafts (BM alone or BM
+ FL) was accompanied by the most potent antidonor proliferative and
cytotoxic activities in vitro. These responses, however, could be
markedly attenuated by administration of tacrolimus.
|
|
| Discussion |
|---|
|
|
|---|
A potential chimerism-enhancing strategy used in BM transplantation is the use of hemopoietic growth factors. These factors comprise G-CSF and granulocyte-macrophage CSF, together with other cytokines that act at earlier points in the hemopoietic cascade, such as IL-3, c-kit ligand, and the recently cloned potent stem/progenitor cell-mobilizing factor FL. Recent human studies suggest that infusion of G-CSF-mobilized donor blood-derived hemopoietic stem cells can augment microchimerism in liver allograft recipients (13). We therefore hypothesized that, in conventionally immunosuppressed organ allograft recipients, donor leukocyte microchimerism and possibly graft survival might be promoted by coadministering FL, together with unmodified donor BM cells. A further consideration was the recently reported capacity of FL to strikingly and selectively augment DC populations in vivo (20, 21).
DC have been revealed as a prominent leukocyte population in the donor cell chimerism observed in organ transplant recipients (1, 2, 5, 6). Moreover, donor-derived DC progenitors can be propagated from the BM of spontaneously tolerant liver allograft recipients, but not from hosts that reject heart allografts from the same donor strain (7). Such DC progenitors infused systemically populate and persist in allogeneic lymphoid tissues (28), recapitulating the fate of donor-derived cells following orthotopic liver transplantation (5, 29). DC have been postulated to be involved in the process of tolerance induction both in long-surviving allograft recipients (1, 2, 9), and in the establishment of self-tolerance within central (30) and peripheral lymphoid tissue (31, 32). This contrasts with the conventional view of (myeloid) DC in secondary lymphoid tissue as potent inducers of immune responses via naive T cell activation and proliferation (8). In particular, immature DC progenitors or costimulatory molecule-deficient DC, which are associated with an Ag-processing rather than an Ag-presenting role, have been found to induce alloantigen-specific T cell unresponsiveness in vitro (33), and to prolong cardiac (34) or pancreatic islet allograft survival (35). There is also evidence that a population of freshly isolated mouse lymphoid (CD8+) DC (36), or in vitro generated myeloid DC (37), both of which express Fas ligand (CD95 ligand), is capable of killing activated CD4+ allogeneic T cells in vitro via Fas-Fas ligand interactions. This putative capacity of DC to regulate allogeneic T cell responses and the demonstrated potential of DC for tolerance induction (reviewed in 9 have raised the possibility that manipulation of DC numbers, phenotype, and function with FL (20) might allow further evaluation of the role of these cells in determining the outcome of organ transplantation.
In this study, FL was highly effective in augmenting numbers of donor-derived, MHC class II+ cells, most resembling DC, in the lymphoid tissue of tacrolimus-immunosuppressed BM recipients. In heart transplant recipients, however, the induction of a high level of donor class II+ cells by administration of donor BM + FL under cover of tacrolimus administration was associated, following tacrolimus withdrawal, with faster graft rejection than in animals given BM + tacrolimus alone. This finding indicates that once immunosuppression is withdrawn, relatively large numbers of the donor-derived, potentially potent APC promote resistance to donor alloantigens. This is consistent with the finding that donor pretreatment with FL prevents spontaneous liver transplant tolerance in mice and accelerates cardiac allograft rejection in untreated recipients (22). In this study, we found that FL administration to normal recipients augmented host responses to donor alloantigens, as evidenced by enhanced ex vivo MLR and CTL activity, effects that were inhibited during and shortly after concomitant treatment with tacrolimus.
Whereas FL has the capacity to augment multiple leukocyte lineages, its most pronounced effects in vivo are on cells of the DC series (20, 21, 22, 23). The potent ability of FL to dramatically augment functional DC in normal mice (20), and its capacity to induce experimental tumor regression and antitumor immune responses (24) are consistent with the present findings of FL-augmented antidonor alloimmune reactivity. Clearly, amplification of the numbers of functional donor DC in recipient tissue, together with presumed parallel effects on host APC and indirect alloantigen presentation (not evaluated in the present study) could strongly predispose to antidonor T cell reactivity once effective immunosuppression is removed. In the clinical context, however, systemic immunosuppressive therapy of graft rejection is continued on an indefinite basis. Thus, the long-term fate and function of FL-augmented donor-derived cells, including stem cells, in chronically immunosuppressed individuals, are worthy of investigation. As predicted by the two-way paradigm of transplantation tolerance (3), persistence of donor cells under these latter circumstances could lead eventually to mutual donor-host unresponsiveness with reduced dependency on immunosuppressive drug therapy, and perhaps its eventual withdrawal. The model described herein provides a basis for addressing this question, and for further evaluation of the role of growth factor-augmented donor cells in modifying antidonor immune reactivity.
The results show that dramatic increases in donor hemopoietic cells, in particular DC, lead to augmented antidonor proliferative and CTL activities and allograft rejection once short-term immunosuppressive therapy is withdrawn. In most rodent models, the ability to demonstrate antidonor reactivity ex vivo in stable tolerance (e.g., split tolerance in murine liver allograft recipients (38)) suggests that the underlying tolerogenic mechanism may be an active, rather than a passive, phenomenon. Even though chimerism and tolerance occur spontaneously in certain organ allograft models, immunosuppressive therapy is required in most other situations (including human organ transplantation) to prevent the recipient immune cell populations from overwhelming those of the donor. The result of such an immune imbalance is graft rejection. It has been emphasized as a therapeutic principle that efforts to augment donor chimerism clinically with either adjunct donor BM cells or by administration of hemopoietic growth factors is predictably unsafe, unless it is done under immune suppression that affects both cell populations equally (39). The present finding reinforces the importance of adhering to such principles in designing therapeutic protocols.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Angus W. Thomson, W1544 Biomedical Science Tower, University of Pittsburgh Medical Center, 200 Lothrop Street, Pittsburgh, PA 15213. ![]()
3 Abbreviations used in this paper: DC, dendritic cell; ABC, avidin-biotin-peroxidase complex; BM, bone marrow; FL, flt-3 ligand; G-CSF, granulocyte colony-stimulating factor; MST, median graft survival time; PALS, periarteriolar lymphatic sheaths. ![]()
Received for publication October 14, 1997. Accepted for publication December 10, 1997.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Eto, H. Hackstein, K. Kaneko, K. Nomoto, and A. W. Thomson Promotion of Skin Graft Tolerance Across MHC Barriers by Mobilization of Dendritic Cells in Donor Hemopoietic Cell Infusions J. Immunol., September 1, 2002; 169(5): 2390 - 2396. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Teshima, P. Reddy, K. P. Lowler, M. A. KuKuruga, C. Liu, K. R. Cooke, and J. L. M. Ferrara Flt3 ligand therapy for recipients of allogeneic bone marrow transplants expands host CD8alpha + dendritic cells and reduces experimental acute graft-versus-host disease Blood, March 1, 2002; 99(5): 1825 - 1832. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shimizu, S.-i. Fujii, K. Fujimoto, K. Kawa, A. Yamada, and F. Kawano Tacrolimus (FK506) treatment of CD34+ hematopoietic progenitor cells promote the development of dendritic cells that drive CD4+ T cells toward Th2 responses J. Leukoc. Biol., November 1, 2000; 68(5): 633 - 640. [Abstract] [Full Text] |
||||
![]() |
A. E. Morelli, M. A. Antonysamy, T. Takayama, H. Hackstein, Z. Chen, S. Qian, N. B. Zurowski, and A. W. Thomson Microchimerism, Donor Dendritic Cells, and Alloimmune Reactivity in Recipients of Flt3 Ligand-Mobilized Hemopoietic Cells: Modulation by Tacrolimus J. Immunol., July 1, 2000; 165(1): 226 - 237. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |