The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Antonysamy, M. A.
Right arrow Articles by Thomson, A. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Antonysamy, M. A.
Right arrow Articles by Thomson, A. W.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Bone Marrow Transplantation
*Heart Transplantation
The Journal of Immunology, 1998, 160: 4106-4113.
Copyright © 1998 by The American Association of Immunologists

Flt-3 Ligand Increases Microchimerism But Can Prevent the Therapeutic Effect of Donor Bone Marrow in Transiently Immunosuppressed Cardiac Allograft Recipients1

Mary A. Antonysamy*, Raymond J. Steptoe*, Ajai Khanna*, William A. Rudert{dagger}, Vladimir M. Subbotin* and Angus W. Thomson2,*,{ddagger}

* Thomas E. Starzl Transplantation Institute and Departments of Surgery, {dagger} Pediatrics, and {ddagger} Molecular Genetics and Biochemistry, University of Pittsburgh, PA 15213


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
C3H (H2k) mice received 50 x 106 B10 (H2b) bone marrow (BM) cells either alone or with flt-3 ligand (FL) (10 µg/day), tacrolimus (2 mg/kg/day), or both agents for 7 days. Donor MHC class II+ (IAb+) cells were quantitated in spleens by immunohistochemical analysis, and donor class II DNA detected in BM by PCR. Donor cells were rare in the BM alone and BM + FL groups, whereas there was a substantial increase in chimerism in the BM + tacrolimus group. Addition of FL to BM + tacrolimus led to a further eightfold increase in donor cells and enhanced donor DNA compared with the BM + tacrolimus group. This increase in donor cells was almost 500-fold compared with BM alone. C3H recipients of B10 heart allografts given perioperative B10 BM and tacrolimus (days 0–13) exhibited a markedly extended median graft survival time (MST, 42 days) compared with those given tacrolimus alone (MST, 22 days). Addition of FL (10 µg/day; 7 days) to BM + tacrolimus prevented the beneficial effect of donor BM (MST, 18 days). BM alone or BM + FL resulted in uniform early heart graft failure (MST < 8 days). Functional studies revealed maximal antidonor MLR and CTL activities in the BM- and BM + FL-treated groups, with minimal activity in the tacrolimus-treated groups. Thus, dramatic growth factor-induced increases in chimerism achieved under cover of immunosuppression may result in augmented antidonor T cell reactivity and reduced graft survival after immunosuppressive drug withdrawal. With FL, this may reflect striking augmentation of immunostimulatory dendritic cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The presence of donor hemopoietic cells in recipient tissues following the transplantation of organ allografts has been postulated as a necessary prerequisite for the induction of donor-specific tolerance (1, 2, 3). There is also evidence that expansion of chimerism may be important for the maintenance of tolerance in animals following challenge with donor-specific allografts (4). Although the natural microchimerism observed in organ graft recipients is multilineage, donor-derived dendritic cells (DC)3 consistently represent a prominent subset (1, 2, 5, 6), and can be propagated from the bone marrow (BM) of spontaneously tolerant recipients (7). The widespread migration and survival of these donor-derived APC and their precursors, which have potential to activate (8) or suppress immune reactivity (9, 10), may be an important factor in the regulation of host antigraft immune responses and tolerance induction.

Leukocyte microchimerism can be augmented in organ allograft recipients if they are infused perioperatively with either unmodified donor BM cells (11, 12) or mobilized donor stem cells (13), and maintained on conventional immunosuppressive therapy. An alternative/additional approach to the manipulation of microchimerism is the use of hemopoietic growth factors to induce the mobilization of cells in graft recipients. These factors include granulocyte-macrophage CSF, granulocyte (G)-CSF, c-kit ligand, IL-7, IL-8, IL-12, and macrophage-inhibitory protein-1{alpha} family members. Flt-3 ligand (FL) is a recently cloned hemopoietic cytokine (14, 15), with potent ability to stimulate the growth and mobilization of stem and progenitor cells (16). It is a type I transmembrane protein with size and structural similarity to CSF-1 (macrophage-CSF) and c-kit ligand, and exists as both membrane-bound and soluble forms. FL is expressed on a wide variety of cells and tissues, as opposed to its receptor flt-3, a receptor type III tyrosine kinase, that is restricted to hemopoietic stem and progenitor cells (17, 18). FL synergizes with a wide range of CSFs and ILs (G-CSF, c-kit ligand, IL-3, IL-6, and IL-11) in vitro to promote colony growth of primitive progenitor cells (19). Although it augments multiple leukocyte lineages in vivo, FL dramatically and selectively increases the numbers of DC in both lymphoid and nonlymphoid tissues (20, 21, 22, 23). It has also been shown recently to exert significant antitumor activity in mice (24).

In this study, we examined the effects of a short course of FL on microchimerism and antidonor immune reactivity in normal and tacrolimus-treated allogeneic BM recipients. A much more striking increase in donor cells was observed in the spleens of mice given FL + tacrolimus compared with those receiving tacrolimus alone. In heart allograft recipients, donor BM alone or BM + FL for 7 days significantly reduced median heart graft survival compared with normal controls. BM + short-term tacrolimus therapy, however, prolonged graft survival well beyond that observed with tacrolimus alone. When FL was added to the combination of BM + tacrolimus, the beneficial effect of donor cells was lost. These findings indicate that, after withdrawal of immunosuppression, heart graft recipients with markedly augmented numbers of potential allostimulatory donor APC exhibit enhanced antidonor reactivity. They also caution against the potential risks of uncontrolled immunologic imbalance between donor and host that may occur following in vivo use of potent hematologic growth factors.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

Male C57BL/10J (B10; H2b; IAb) and C3H/HeJ (C3H; H2k; IEk) mice, 8 to 12 wk of age, were purchased from The Jackson Laboratory (Bar Harbor, ME). They were housed in the specific pathogen-free facility of University of Pittsburgh Medical Center (Pittsburgh, PA), and provided with Purina rodent chow (Ralston Purina, St. Louis, MO) and tap water ad libitum.

Allogeneic bone marrow (BM) transplantation

B10 mice were used as donors and C3H mice as recipients. C3H recipients (three per group) were injected via the lateral tail vein with 50 x 106 freshly isolated B10 BM cells. In addition, animals received Chinese hamster ovary cell-derived human rFL (Immunex, Seattle, WA) at 10 µg/mouse/day i.p., in low endotoxin PBS, or no cytokine, with or without tacrolimus, for 7 consecutive days (days 0–6) posttransplantation. Tacrolimus (formerly FK 506) was obtained from Fujisawa Pharmaceutical (Osaka, Japan), and injected i.m. at 2 mg/kg/day from days 0 to 6. Control animals received BM alone with no further treatment. On day 7, animals were killed. Spleens and BM cells were harvested from each mouse, pooled in treatment groups, and processed for molecular, immunohistochemical, and in vitro functional analyses.

Heterotopic heart transplantation

Donor cardiectomy was performed on unsexed B10 neonates within 24 h of birth. The hearts were implanted into the left dorsal ear pinna of normal adult male C3H mice (25).

Following transplantation, the mice were assigned randomly to six groups. They received either no further treatment, donor BM alone (as described above), tacrolimus alone (2 mg/kg/day i.p.; days 0–13), or in addition to donor BM, FL (10 µg/day; days 0–6), tacrolimus, or both agents. Pilot studies had shown that a 13-day course of tacrolimus (2 mg/kg/day) gave an approximate doubling of graft survival time that was considered optimal for testing the additional effects of BM and FL. The heart grafts were monitored for contractile activity on a daily basis, by a blinded observer using a stereomicroscope. In the B10 to C3H strain combination, heartbeat is generally detected by 8 days posttransplant. Rejection was determined as cessation of heartbeat for 2 consecutive days, and was confirmed histologically. Three animals from each group were sacrificed on day 15 posttransplant, and spleen cell suspensions were prepared for in vitro functional analyses.

Detection of donor DNA by PCR

DNA was extracted from freshly isolated BM cells of both normal B10 and C3H mice, and from C3H mice 7 days after B10 BM transplantation, with or without treatment with FL and/or tacrolimus. The forward and reverse oligonucleotide primers for the detection of donor MHC class II allele-specific DNA (IAb) in C3H recipients were CCACCTTGCAGTCATAAATG and AGTTTGGCCAATTGGCAAGC, respectively. The primers were designed to distinguish donor DNA from recipient DNA, and yielded no visible PCR product of 700 bp with the recipient DNA template under ethidium bromide fluorescence. One-microgram aliquots of DNA were amplified for 25 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s in buffer consisting of 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2, 0.2 mM deoxynucleotides, 0.1% gelatin, 0.2 µM primers, and 2.5 U Taq polymerase (Perkin-Elmer, Norwalk, CT). The products were separated in a 1% agarose gel containing ethidium bromide. The intensity of the fluorescence was compared with standards consisting of serial dilutions of normal B10 DNA into normal C3H DNA.

Immunohistochemical analyses

Diced samples of freshly isolated spleens were placed in embedding medium (Tissue-Tek OCT Compound; Miles, Elkhart, IN), snap frozen in liquid nitrogen, and stored at -80°C until further use. Cryostat sections (8 µm) were cut, mounted onto slides, air dried at room temperature, and stained using the avidin-biotin-peroxidase complex (ABC) procedure. Sections were fixed in ethanol and incubated with biotinylated mouse IgG2a anti-I-Ab mAb for 1 h at room temperature. Following three 5-min washes in PBS, the slides were incubated with ABC complex (Boehringer Mannheim, Indianapolis, IN) for 30 min. The color reaction was developed using a peroxidase chromagen kit (diaminobenzidine (DAB); Sigma Chemical, St. Louis, MO). Sections were counterstained lightly with hematoxylin. Controls included sections stained using an isotype-matched irrelevant mAb. The number of donor MHC class II+ cells was determined independently by two blinded observers. Twenty to twenty-five high power fields/section (there were three sections/mouse, three mice/group) were counted using an ocular grid. The results are expressed as mean number of I-Ab+ cells ± 1 SD per high power field.

Mixed leukocyte reactions

Recipient splenocytes were T cell enriched by passage through a nylon wool column (26), and set up as responders (2 x 105 cells/well) with graded concentrations of irradiated (20 Gy) donor splenocytes in RPMI 1640 (Life Technologies, Grand Island, NY) complete medium, containing 10% heat-inactivated FBS (Life Technologies), 2 mM L-glutamine, 50 U/ml penicillin and streptomycin, and 2 mM nonessential amino acids, for 72 h at 37°C, 5% CO2. Sixteen to eighteen hours before the end of the culture period, individual wells were pulse labeled with 1 µCi [3H]thymidine. The plates were harvested, and the amount of radioisotope incorporated into the cells was determined using a beta scintillation counter. Results are expressed as mean cpm ± 1 SD. Data presented are from representative experiments performed at least three times.

CTL assay

Recipient splenic T cells were restimulated in vitro for 4 days with {gamma}-irradiated (20 Gy) donor strain splenocytes before use as effectors. The EL-4 (H2b) lymphoma cell line (TIB39; American Type Culture Collection (ATCC), Rockville, MD) was used as a source of allogeneic target cells. The P815 (H2d) mouse mastocytoma cell line (TIB64; ATCC) and the R1.1 (H2k) lymphoma cell line (TIB42; ATCC) were used as third party (specificity control) and syngeneic targets, respectively. The target cells were labeled with 100 µCi Na251CrO4 (DuPont/NEN, Boston, MA), washed, and plated at a concentration of 5 x 103 cells/well in 96-well, round-bottom culture plates (Corning, Corning, NY). Serial, twofold dilutions of effector cells were added to give E:T ratios of 100:1, 50:1, 25:1, and 12.5:1, in a total volume of 200 µl/well. Following 4-h incubation at 37°C in 5% CO2, specific 51Cr release was determined. The supernatant was recovered from each well using a supernatant collection system (Skatron, Sterling, VA). Maximum 51Cr release was determined by osmotic lysis of the cells. Percentage of cytotoxicity was calculated using the formula: percentage of cytotoxicity = 100 x (experimental cpm - spontaneous cpm/maximum cpm - spontaneous cpm). Results are expressed as mean ± 1 SD of percentage of 51Cr release in triplicate cultures.

Statistics

Statistical analyses were performed using the nonparametric Mann-Whitney U test or Student’s t test, as appropriate.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Influence of FL and tacrolimus on spleen cellularity in allogeneic BM recipients

C3H mice were given 50 x 106 freshly isolated unmodified B10 BM cells, and injected for 7 consecutive days (days 0–6) with FL or tacrolimus alone, or FL + tacrolimus. On day 7, spleens from the FL-treated animals were considerably enlarged, and the mean weight was greater than twice that of mice given BM alone (Table IGo). A 2.7-fold increase in the absolute number of nucleated spleen cells compared with BM treatment alone was also observed after 7 days of FL administration. Tacrolimus did not significantly affect spleen weights or cell numbers, whether or not FL was given concomitantly to the allogeneic BM recipients.


View this table:
[in this window]
[in a new window]
 
Table I. Increase in spleen weight and cellularity in FL-treated allogeneic BM recipientsa

 
Effects of FL either alone or in combination with tacrolimus on levels of donor MHC class II (I-Ab) DNA in allogeneic BM recipients

We next investigated the influence of FL on donor leukocyte chimerism by examining levels of donor DNA (MHC class II (I-Ab)) in the BM of the four groups of allogeneic BM recipients using semiquantitative PCR. Donor DNA was detected only in the two groups of animals treated with tacrolimus (Fig. 1Go). The level of donor DNA in the BM of the FL + tacrolimus-treated group was consistently higher compared with that of mice given tacrolimus alone. This indicated that FL alone did not promote chimerism, but that in tacrolimus-immunosuppressed allogeneic BM recipients, FL enhanced microchimerism within the recipient BM. Four additional groups of identically treated mice (three animals per group) showed no evidence of donor MHC class II DNA in the BM when examined 4 wk after donor BM infusion (data not shown). This indicated that the chimerism observed in each of the tacrolimus-treated groups did not persist in detectable amounts for more than 3 wk following the withdrawal of immunosuppression.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 1. Detection of donor DNA (MHC class II; IAb) determined by PCR in the bone marrow of C3H (IEk) recipients 7 days after transplantation of 50 x 106 B10 BM cells. Groups of three C3H mice received either no treatment, FL (10 µg/day; days 0–6), FK (tacrolimus; 2 mg/kg/day; days 0–6), or a combination of FL and FK. The lower panel shows a titration of normal B10 DNA into normal C3H DNA.

 
The influence of FL and tacrolimus on the incidence of donor MHC class II+ cells in allogeneic BM recipients

Cryostat sections of spleens from the four groups of allogeneic BM recipients were assessed for the presence of donor MHC class II+ (I-Ab+) cells by immunohistochemical staining. Normal C3H and B10 mouse spleen samples were included as negative and positive controls, respectively. In normal B10 positive controls, the expected distribution of I-Ab+ cells was observed (Fig. 2GoA), whereas in normal C3H spleens no I-Ab+ cells were detected (Fig. 2GoB). The numbers of positive cells detected in each experimental group are shown in Table IIGo. Animals treated with FL alone exhibited very few positive cells as was found in control (untreated) BM recipients (Fig. 2Go, C and D). On the other hand, tacrolimus alone led to a substantial, 60-fold increase in donor-positive cells compared with untreated controls (Fig. 2Go, E and F). These I-Ab+ donor cells were present mainly in the periarteriolar lymphatic sheaths (PALS) (Fig. 2GoE). The highest incidence of MHC donor class II+ cells was found in the tissues of BM recipients treated with both FL and tacrolimus (Fig. 2Go, G and H). These cells, found in both the PALS and red pulp, exhibited typical DC characteristics, including prominent cytoplasmic processes that interdigitated with numerous host cells (Fig. 2GoH). An eightfold increase in donor class II+ cells was seen in the latter group when compared with animals treated with BM + tacrolimus. When compared with untreated control BM recipients, however, the increase was almost 500-fold (Table IIGo). The findings clearly indicate that treatment of allogeneic BM recipients with FL and tacrolimus dramatically augments donor leukocyte microchimerism.



View larger version (129K):
[in this window]
[in a new window]
 
FIGURE 2. Detection of donor MHC class II+ (IAb+) cells in spleens of C3H recipients of 50 x 106 B10 BM cells 7 days after transplantation. Positive (A) (normal B10) and negative (B) (normal C3H) spleen controls; C, B10 BM alone showing a single positive cell (arrow) adjacent to an arteriole; D, B10 BM + FL; E, B10 BM + tacrolimus, low power, donor cells are restricted largely to PALS; F, B10 BM + tacrolimus, high power, note DC-like morphology of positive cells; G, B10 BM + tacrolimus + FL, low power, numerous donor cells are evident in red pulp and PALS; H, B10 BM + tacrolimus + FL, high power, note extensive interdigitation between donor DC and host cells. ABC peroxidase; counterstained with hematoxylin. Magnifications: A, B, E, and G, x100; C, D, F, and H, x1200.

 

View this table:
[in this window]
[in a new window]
 
Table II. Influence of BM, FL, and tacrolimus on the incidence of donor MHC class II+ cells in spleens of allogeneic BM recipientsa

 
Influence of FL and tacrolimus on antidonor proliferative responses of T Cells from allogeneic BM recipients

Splenic T cells from B10 BM-injected C3H mice treated with FL or tacrolimus or both agents, then sacrificed 7 days posttransplant, were used as responders in one-way 3-day MLRs. To a fixed number of the recipients’ (C3H) T cells, variable numbers of {gamma}-irradiated normal allogeneic (B10) stimulator splenocytes were added, and the proliferative responses determined. As shown in Figure 3Go, BM transplantation alone markedly augmented secondary responsiveness to donor alloantigens, after presumed primary stimulation in vivo, when compared with that of normal C3H controls. Animals given FL in addition to BM exhibited a further significant increase (p < 0.01) in host antidonor proliferative responses. In contrast, T cells from BM recipients treated with tacrolimus, or FL + tacrolimus responded poorly to donor alloantigen over the range of stimulator:responder cell ratios tested. From these results, it can be concluded that FL treatment alone augments the antidonor responsiveness of allogeneic BM recipients. Tacrolimus, on the other hand, abolishes these responses, both in mice given BM alone and those given BM + FL.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 3. Three-day MLR responses of splenic T cells from groups of three C3H recipients of B10 BM cells, 7 days after transplantation. Stimulator cells were donor bulk splenocytes. The BM recipients were untreated or treated (days 0–6) with FL, tacrolimus, or FL + tacrolimus, as described in Materials and Methods. Results are means ± 1 SD and are representative of two separate experiments.

 
The influence of FL and tacrolimus on the generation of antidonor CTL responses in allogeneic BM recipients

The cytotoxic potential of splenic T cells from untreated normal controls and variously treated allogeneic BM recipients (7 days posttransplant) was tested after a 4-day period of (re)stimulation in vitro. When compared with normal control C3H effectors, splenocytes from animals given either BM alone or BM + FL exhibited significantly higher ex vivo donor-specific CTL activity over a range of E:T ratios (Fig. 4Go). Splenic T cells from BM recipients given tacrolimus alone or FL + tacrolimus, however, generated comparatively weak CTL responses to donor. Of these, the cytotoxic activity in the FL-treated group was significantly higher (p < 0.01 at E:T ratios of 25:1 and higher). Minimal lysis of third party (H2d) target cells (P815) was observed in all of the treatment groups (Fig. 4Go), confirming that the CTL responses generated were donor specific.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 4. CTL responses of splenic T cells from normal C3H mice and groups of three C3H recipients of B10 BM cells isolated 7 days after transplantation. Responder cells were (re)stimulated with donor bulk splenocytes for 4 days. Specific lysis of allogeneic (EL4; H2b) and third party (P815; H2d) targets is shown on the left and right, respectively. The BM recipients were untreated or treated (days 0–6) with FL, tacrolimus, or FL + tacrolimus, as described in Materials and Methods. Results are means ± 1 SD and are representative of two separate experiments.

 
The effect of donor BM, FL, and tacrolimus on heart allograft survival

We next examined the impact of donor BM cells, FL, and tacrolimus on organ allograft survival. Median graft survival time (MST) in normal C3H recipients of B10 hearts was 10 days. Administration of unmodified donor BM alone to normal heart allograft recipients at the time of organ transplant resulted in accelerated heart graft rejection (heartbeat was not detected in any recipients), and rejection was confirmed histologically. Similarly, failure of all heart grafts to beat was observed in animals treated with both BM and FL. Tacrolimus alone (days 0–13), however, prolonged graft MST from 10 to 22 days. Heart graft survival was further enhanced to 42 days in hosts that received perioperative donor BM infusion and the 13-day course of tacrolimus immunosuppression (Fig. 5Go). Animals treated with BM, FL, and tacrolimus had significantly higher (p < 0.01) graft MST when compared with untreated control heart graft recipients, but significantly lower (p < 0.01) graft MST when compared with the BM + tacrolimus treatment group. Overall, these data show that, when administered with donor BM either in the absence or presence of a 2-wk course of immunosuppression, FL treatment resulted in exacerbation of organ allograft rejection.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 5. Actuarial survival curves of B10 cardiac allografts in C3H recipients that received either no treatment, tacrolimus (2 mg/kg/day; days 0–13), donor BM (50 x 106 unmodified cells i.v.) + tacrolimus, or donor BM + FL (10 µg/day; days 0–6) + tacrolimus. No heart-beating grafts were observed in the groups treated with donor BM alone, or donor BM + FL (for further details, see Results).

 
Ex vivo antidonor responses of splenocytes from heart allograft recipients treated with BM, FL, and tacrolimus

Splenic T cells from the various treatment groups of heart-transplanted animals were set up in MLR assays as well as in lymphocytotoxicity tests on day 15 posttransplantation to evaluate antidonor immunologic responses. This time point was chosen, as it was 3 to 7 days before graft MST in the FL + tacrolimus- and tacrolimus-treated animals that subsequently rejected their heart grafts. Both MLR (Fig. 6Go) and CTL responses (Fig. 7Go) revealed augmentation of secondary antidonor reactivity after presumed primary stimulation in heart graft recipients given donor BM alone or BM + FL compared with heart transplant controls that received no treatment. Splenic T cells from BM- or BM + FL-treated animals were the most active mediators of antidonor MLR responses (Fig. 6Go). While splenic T cells from heart graft recipients treated with or without BM responded to donor alloantigen effectively, cotreatment of the mice with tacrolimus rendered them unresponsive at the time of assay. Similar results were observed when responder splenic T cells from the various treatment groups were set up on day 15 in CTL assays (Fig. 7Go). Thus, treatment with BM alone or BM + FL significantly augmented antidonor responses ex vivo. However, administration of tacrolimus markedly reduced antidonor CTL reactivity compared with that observed with cells from BM alone or BM + FL-treated groups. In summary, treatment resulting in accelerated rejection of heart grafts (BM alone or BM + FL) was accompanied by the most potent antidonor proliferative and cytotoxic activities in vitro. These responses, however, could be markedly attenuated by administration of tacrolimus.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 6. Three-day MLR responses of splenic T cells from groups of three C3H recipients of B10 hearts and BM cells 15 days after transplantation. Stimulator cells were donor bulk splenocytes. The heart graft recipients were either untreated, given B10 BM alone, or B10 BM together with either FL (10 µg/day; days 0–6), tacrolimus (2 mg/kg/day; days 0–13), or a combination of both agents. Results are mean ± 1 SD and are representative of two separate experiments.

 


View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 7. CTL responses of splenic T cells from normal C3H mice, and groups of three C3H recipients of B10 hearts and BM-isolated cells 15 days after transplantation. Responder cells were (re)stimulated with bulk donor splenocytes for 4 days. Specific lysis of allogeneic (EL4; H2b) and third party (P815; H2d) targets is shown on the left and right, respectively. The heart graft recipients were either untreated, given B10 BM alone, or B10 BM together with either FL (days 0–6), tacrolimus (days 0–13), or a combination of both agents. Results are mean ± 1 SD and are representative of two separate experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Efforts to improve the outcome of organ transplantation have focused both on identifying those factors in the donor and recipient that adversely affect organ allograft survival, and on promoting mechanisms that may predispose to the induction of long-lasting, donor-specific unresponsiveness. Recently, it has been proposed that donor-derived, multilineage hemopoietic cell microchimerism is an essential prerequisite for tolerance induction in organ allograft recipients (1, 2). In an effort to augment the natural microchimerism that occurs following organ transplantation, adjunctive perioperative donor BM infusion has been undertaken in conventionally immunosuppressed human organ transplant recipients (11, 12). It has been reported that in humans, high dose donor BM infusions can enhance liver allograft survival (27). In the present study, infusion of unmodified donor BM cells (50 x 106) at the time of cardiac transplantation was found to significantly prolong graft survival in tacrolimus-immunosuppressed mice, although all hearts were rejected eventually after tacrolimus withdrawal.

A potential chimerism-enhancing strategy used in BM transplantation is the use of hemopoietic growth factors. These factors comprise G-CSF and granulocyte-macrophage CSF, together with other cytokines that act at earlier points in the hemopoietic cascade, such as IL-3, c-kit ligand, and the recently cloned potent stem/progenitor cell-mobilizing factor FL. Recent human studies suggest that infusion of G-CSF-mobilized donor blood-derived hemopoietic stem cells can augment microchimerism in liver allograft recipients (13). We therefore hypothesized that, in conventionally immunosuppressed organ allograft recipients, donor leukocyte microchimerism and possibly graft survival might be promoted by coadministering FL, together with unmodified donor BM cells. A further consideration was the recently reported capacity of FL to strikingly and selectively augment DC populations in vivo (20, 21).

DC have been revealed as a prominent leukocyte population in the donor cell chimerism observed in organ transplant recipients (1, 2, 5, 6). Moreover, donor-derived DC progenitors can be propagated from the BM of spontaneously tolerant liver allograft recipients, but not from hosts that reject heart allografts from the same donor strain (7). Such DC progenitors infused systemically populate and persist in allogeneic lymphoid tissues (28), recapitulating the fate of donor-derived cells following orthotopic liver transplantation (5, 29). DC have been postulated to be involved in the process of tolerance induction both in long-surviving allograft recipients (1, 2, 9), and in the establishment of self-tolerance within central (30) and peripheral lymphoid tissue (31, 32). This contrasts with the conventional view of (myeloid) DC in secondary lymphoid tissue as potent inducers of immune responses via naive T cell activation and proliferation (8). In particular, immature DC progenitors or costimulatory molecule-deficient DC, which are associated with an Ag-processing rather than an Ag-presenting role, have been found to induce alloantigen-specific T cell unresponsiveness in vitro (33), and to prolong cardiac (34) or pancreatic islet allograft survival (35). There is also evidence that a population of freshly isolated mouse lymphoid (CD8+) DC (36), or in vitro generated myeloid DC (37), both of which express Fas ligand (CD95 ligand), is capable of killing activated CD4+ allogeneic T cells in vitro via Fas-Fas ligand interactions. This putative capacity of DC to regulate allogeneic T cell responses and the demonstrated potential of DC for tolerance induction (reviewed in 9 have raised the possibility that manipulation of DC numbers, phenotype, and function with FL (20) might allow further evaluation of the role of these cells in determining the outcome of organ transplantation.

In this study, FL was highly effective in augmenting numbers of donor-derived, MHC class II+ cells, most resembling DC, in the lymphoid tissue of tacrolimus-immunosuppressed BM recipients. In heart transplant recipients, however, the induction of a high level of donor class II+ cells by administration of donor BM + FL under cover of tacrolimus administration was associated, following tacrolimus withdrawal, with faster graft rejection than in animals given BM + tacrolimus alone. This finding indicates that once immunosuppression is withdrawn, relatively large numbers of the donor-derived, potentially potent APC promote resistance to donor alloantigens. This is consistent with the finding that donor pretreatment with FL prevents spontaneous liver transplant tolerance in mice and accelerates cardiac allograft rejection in untreated recipients (22). In this study, we found that FL administration to normal recipients augmented host responses to donor alloantigens, as evidenced by enhanced ex vivo MLR and CTL activity, effects that were inhibited during and shortly after concomitant treatment with tacrolimus.

Whereas FL has the capacity to augment multiple leukocyte lineages, its most pronounced effects in vivo are on cells of the DC series (20, 21, 22, 23). The potent ability of FL to dramatically augment functional DC in normal mice (20), and its capacity to induce experimental tumor regression and antitumor immune responses (24) are consistent with the present findings of FL-augmented antidonor alloimmune reactivity. Clearly, amplification of the numbers of functional donor DC in recipient tissue, together with presumed parallel effects on host APC and indirect alloantigen presentation (not evaluated in the present study) could strongly predispose to antidonor T cell reactivity once effective immunosuppression is removed. In the clinical context, however, systemic immunosuppressive therapy of graft rejection is continued on an indefinite basis. Thus, the long-term fate and function of FL-augmented donor-derived cells, including stem cells, in chronically immunosuppressed individuals, are worthy of investigation. As predicted by the two-way paradigm of transplantation tolerance (3), persistence of donor cells under these latter circumstances could lead eventually to mutual donor-host unresponsiveness with reduced dependency on immunosuppressive drug therapy, and perhaps its eventual withdrawal. The model described herein provides a basis for addressing this question, and for further evaluation of the role of growth factor-augmented donor cells in modifying antidonor immune reactivity.

The results show that dramatic increases in donor hemopoietic cells, in particular DC, lead to augmented antidonor proliferative and CTL activities and allograft rejection once short-term immunosuppressive therapy is withdrawn. In most rodent models, the ability to demonstrate antidonor reactivity ex vivo in stable tolerance (e.g., split tolerance in murine liver allograft recipients (38)) suggests that the underlying tolerogenic mechanism may be an active, rather than a passive, phenomenon. Even though chimerism and tolerance occur spontaneously in certain organ allograft models, immunosuppressive therapy is required in most other situations (including human organ transplantation) to prevent the recipient immune cell populations from overwhelming those of the donor. The result of such an immune imbalance is graft rejection. It has been emphasized as a therapeutic principle that efforts to augment donor chimerism clinically with either adjunct donor BM cells or by administration of hemopoietic growth factors is predictably unsafe, unless it is done under immune suppression that affects both cell populations equally (39). The present finding reinforces the importance of adhering to such principles in designing therapeutic protocols.


    Acknowledgments
 
We thank the Immunex Research and Development Corporation for provision of Flt-3 ligand. We are grateful to Dr. Wei Li for expert technical support, to Mr. William Irish for statistical analyses, and to Ms. Shelly L. Conklin and Ms. Nancy Fecondo for secretarial support.


    Footnotes
 
1 This work was supported in part by National Institutes of Health Project Grants DK 49745 and AI 141011 (to A.W.T.). Back

2 Address correspondence and reprint requests to Dr. Angus W. Thomson, W1544 Biomedical Science Tower, University of Pittsburgh Medical Center, 200 Lothrop Street, Pittsburgh, PA 15213. Back

3 Abbreviations used in this paper: DC, dendritic cell; ABC, avidin-biotin-peroxidase complex; BM, bone marrow; FL, flt-3 ligand; G-CSF, granulocyte colony-stimulating factor; MST, median graft survival time; PALS, periarteriolar lymphatic sheaths. Back

Received for publication October 14, 1997. Accepted for publication December 10, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Starzl, T. E., A. J. Demetris, N. Murase, S. Ildstad, C. Ricordi, M. Trucco. 1992. Cell migration, chimerism, and graft acceptance. Lancet 339:1579.[Medline]
  2. Starzl, T. E., A. J. Demetris, M. Trucco, N. Murase, C. Ricordi, S. Ildstad, H. Ramos, S. Tod, A. Tzakis, J. J. Fung, M. Nalesnik, A. Zeevi, W. A. Rudert, M. Kocova. 1993. Cell migration and chimerism after whole organ transplantation: the basis of graft acceptance. Hepatology 17:1127.[Medline]
  3. Starzl, T. E., A. J. Demetris, N. Murase, M. Trucco, A. W. Thomson, A. S. Rao. 1996. The lost chord: microchimerism and allograft survival. Immunol. Today 17:577.[Medline]
  4. Alard, P., J. A. Matriano, S. Socarras, M. A. Ortega, J. W. Streilein. 1995. Detection of donor-derived cells by polymerase chain reaction in neonatally tolerant mice: microchimerism fails to predict tolerance. Transplantation 60:1125.[Medline]
  5. Qian, S., A. J. Demetris, N. Murase, A. S. Rao, J. J. Fung, T. E. Starzl. 1994. Murine liver allograft transplantation: tolerance and donor cell chimerism. Hepatology 19:916.[Medline]
  6. Demetris, A. J., N. Murase, S. Fujisaki, J. J. Fung, A. S. Rao, T. E. Starzl. 1993. Hematolymphoid cell trafficking, microchimerism, and GVHD reactions after liver, bone marrow, and heart transplantation. Transplant. Proc. 25:3337.[Medline]
  7. Lu, L., W. A. Rudert, S. Qian, D. McCaslin, F. Fu, A. S. Rao, M. Trucco, J. J. Fung, T. E. Starzl, A. W. Thomson. 1995. Growth of donor-derived dendritic cells from the bone marrow of liver allograft recipients in response to granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 182:379.[Abstract/Free Full Text]
  8. Steinman, R. M.. 1991. The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9:271.[Medline]
  9. Thomson, A. W., L. Lu, N. Murase, A. J. Demetris, A. S. Rao, T. E. Starzl. 1995. Microchimerism, dendritic cell progenitors and transplantation tolerance. Stem Cells 13:622.[Medline]
  10. Steptoe, R. J., A. W. Thomson. 1996. Dendritic cells and tolerance induction. Clin. Exp. Immunol. 105:397.[Medline]
  11. Fontes, P., A. S. Rao, A. J. Demetris, A. Zeevi, M. Trucco, P. Carroll, W. Rybka, W. A. Rudert, C. Ricordi, F. Dodson, R. Shapiro, A. Tzakis, S. Todo, K. Abu-Elmagd, M. Jordan, J. J. Fung, T. E. Starzl. 1994. Bone marrow augmentation of donor-cell chimerism in kidney, liver, heart, and pancreas islet transplantation. Lancet 344:151.[Medline]
  12. Shapiro, R., A. S. Rao, P. Fontes, M. Jordan, V. P. Scantlebury, C. Vivas, A. J. Demetris, A. Zeevi, W. Rybka, P. Carroll, M. Trucco, T. E. Starzl. 1995. Combined kidney/bone marrow transplantation: evidence of augmentation of chimerism. Transplantation 59:306.[Medline]
  13. Tsaroucha, A. K., C. Ricordi, T. A. Noto, N. S. Kenyon, R. Garcia-Morales, J. R. Nery, J. Miller, A. G. Tzakis. 1997. Donor peripheral blood stem cell infusions in recipients of living-related liver allografts. Transplantation 64:362.[Medline]
  14. Lyman, S. D., L. James, T. V. Bos, P. deVries, K. Brasel, B. Gliniak, L. T. Hollingsworth, S. Picha, H. J. McKenna, R. R. Splett, F. A. Fletcher, E. Maraskovsky, T. Farrah, D. Foxworthe, D. E. Williams, M. P. Beckmann. 1993. Molecular cloning of a ligand for the flt3/flk2 tyrosine kinase receptor: a proliferative factor for primitive hematopoietic cells. Cell 75:1157.[Medline]
  15. Lyman, S. D., L. James, L. Johnson, K. Brasel, P. de Vries, S. S. Escobar, H. Downey, R. R. Splett, P. Beckmann, H. J. McKenna. 1994. Cloning of the human monologue of the murine flt3 ligand: a growth factor for early hematopoietic progenitor cells. Blood 83:2795.[Abstract/Free Full Text]
  16. Brasel, K., H. J. McKenna, P. J. Morrisey, K. Charrier, A. E. Morris, C. C. Lee, D. E. Williams, S. D. Lyman. 1996. Hematological effects of flt-3 ligand in vivo in mice. Blood 88:2004.[Abstract/Free Full Text]
  17. Matthews, W., C. T. Jordan, G. W. Wiegand, D. Pardoll, I. R. Lemischka. 1991. A receptor tyrosine kinase specific to hematopoietic stem and progenitor cell-enriched populations. Cell 65:1143.[Medline]
  18. Small, D., M. Levenstein, E. Kim, C. Carow, S. Amin, P. Rockwell, L. Witte, C. Burrow, M. S. Ratajczak. 1994. STK-1, the human homolog of Flk-2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in the proliferation of early progenitor/stem cells. Proc. Natl. Acad. Sci. USA 91:459.[Abstract/Free Full Text]
  19. Galy, A., M. Travis, B. Cen. 1995. Human T, B, natural killer, and dendritic cells arise from a common bone marrow progenitor cell subset. Immunity 3:459.[Medline]
  20. Maraskovsky, E., K. Brasel, M. Teepe, E. R. Roux, S. D. Lyman, K. Shortman, H. J. McKenna. 1996. Dramatic increase in the numbers of functionally mature dendritic cells in Flt-3 ligand-treated mice: multiple dendritic cell subpopulations identified. J. Exp. Med. 184:1953.[Abstract/Free Full Text]
  21. Pulendran, B., J. Lingappa, M. K. Kennedy, J. Smith, M. Teepe, A. Rudensky, C. R. Maliszewski, E. Maraskovsky. 1997. Developmental pathways of dendritic cells in vivo: distinct function, phenotype and localization of dendritic cell subsets in flt3 ligand-treated mice. J. Immunol. 159:2222.[Abstract/Free Full Text]
  22. Steptoe, R. J., F. Fu, W. Li, M. L. Drakes, L. Lu, A. J. Demetris, S. Qian, H. J. McKenna, A. W. Thomson. 1997. Augmentation of dendritic cells in murine organ donors by flt-3 ligand alters the balance between transplant tolerance and immunity. J. Immunol. 159:5483.[Abstract]
  23. Drakes, M. L., L. Lu, V. M. Subbotin, A. W. Thomson. 1997. In vivo administration of flt3 ligand markedly stimulates generation of dendritic cell progenitors from mouse liver. J. Immunol. 159:4268.[Abstract]
  24. Lynch, D. A., A. Andreasen, E. Maraskovsky, J. Whitmore, R. E. Miller, J. C. L. Schuh. 1997. Flt3 ligand induces tumor regression and anti-tumor immune responses in vivo. Nat. Med. 3:625.[Medline]
  25. Fulmer, R. I., A. T. Cramer, R. A. Liebelt, A. G. Liebelt. 1963. Transplantation of cardiac tissue into the mouse ear. Am. J. Anat. 113:273.[Medline]
  26. Lu, L., J. Woo, A. S. Rao, Y. Li, S. C. Watkins, S. Qian, T. E. Starzl, A. J. Demetris, A. W. Thomson. 1994. Propagation of dendritic cell progenitors from normal mouse liver using granulocyte/macrophage colony-stimulating factor and their maturational development in the presence of type-1 collagen. J. Exp. Med. 179:1823.[Abstract/Free Full Text]
  27. Ricordi, C., T. Karatzas, J. Nery, M. Webb, G. Selvaggi, L. Fernandez, F. A. Khan, P. Rutz, E. Schiff, L. Olson, H. Fernandez, J. Bean, V. Esquenazi, J. Miller, A. G. Tzakis. 1997. High-dose donor bone marrow infusions to enhance allograft survival: the effect of timing. Transplantation 63:7.[Medline]
  28. Thomson, A. W., L. Lu, V. M. Subbotin, Y. Li, S. Qian, A. S. Rao, J. J. Fung, T. E. Starzl. 1995. In vitro propagation and homing of liver-derived dendritic cell progenitors to lymphoid tissues of allogeneic recipients. Transplantation 59:544.[Medline]
  29. Thomson, A. W., L. Lu, Y. Wan, S. Qian, C. P. Larsen, T. E. Starzl. 1996. Identification of donor-derived dendritic cell progenitors in bone marrow of spontaneously tolerant liver allograft recipients. Transplantation 60:1.
  30. Matzinger, P., S. Guerdner. 1989. Does T-cell tolerance require an antigen-presenting cell?. Nature 338:74.[Medline]
  31. Saleem, M., G. J. Sawyer, R. A. Schofield, N. D. Seymour, K. Gustafsson, J. W. Fabre. 1997. Discordant expression of major histocompatibility complex class II antigens and invariant chain in interstitial dendritic cells. Transplantation 63:1134.[Medline]
  32. Inaba, K., M. Pack, M. Inaba, H. Sakuta, F. Isdell, R. M. Steinman. 1997. High levels of a major histocompatibility complex II-self peptide complex on dendritic cells from the T cell areas of lymph nodes. J. Exp. Med. 186:665.[Abstract/Free Full Text]
  33. Lu, L., D. McCaslin, T. E. Starzl, A. W. Thomson. 1995. Mouse bone marrow-derived dendritic cell progenitors (NLDC 145+, MHC class II+, B7-1dim, B7-2-) induce alloantigen-specific hyporesponsiveness in murine T lymphocytes. Transplantation 60:1539.[Medline]
  34. Fu, F., Y. Li, S. Qian, L. Lu, F. Chambers, T. E. Starzl, J. J. Fung, A. W. Thomson. 1996. Costimulatory molecule-deficient dendritic cell progenitors (MHC class II+, CD80dim, CD86-) prolong cardiac allograft survival in non-immunosuppressed recipients. Transplantation 62:659.[Medline]
  35. Rastellini, C., L. Lu, C. Ricordi, T. E. Starzl, A. S. Rao, A. W. Thomson. 1995. GM-CSF stimulated hepatic dendritic cell progenitors prolong pancreatic islet allograft survival. Transplantation 60:1366.[Medline]
  36. Suss, G., K. Shortman. 1996. A subclass of dendritic cells kills CD4 T cells via Fas/Fas-ligand-induced apoptosis. J. Exp. Med. 183:1789.[Abstract/Free Full Text]
  37. Lu, L., S. Qian, P. Hershberger, W. A. Rudert, D. H. Lynch, A. W. Thomson. 1997. Fas ligand (CD95L) and B7 expression on dendritic cells provide counter-regulatory signals for T cell survival and proliferation. J. Immunol. 158:5676.[Abstract]
  38. Dahmen, U., S. Qian, A. S. Rao, A. J. Demetris, F. Fu, H. Sun, L. Gao, J. J. Fung, T. E. Starzl. 1994. Split tolerance induced by orthotopic liver transplantation in mice. Transplantation 58:1.[Medline]
  39. Starzl, T. E., A. J. Demetris, N. Murase, A. W. Thomson, M. Trucco, C. Ricordi. 1993. Donor cell chimerism permitted by immunosuppressive drugs: a new view of organ transplantation. Immunol. Today 14:326.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
M. Eto, H. Hackstein, K. Kaneko, K. Nomoto, and A. W. Thomson
Promotion of Skin Graft Tolerance Across MHC Barriers by Mobilization of Dendritic Cells in Donor Hemopoietic Cell Infusions
J. Immunol., September 1, 2002; 169(5): 2390 - 2396.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Teshima, P. Reddy, K. P. Lowler, M. A. KuKuruga, C. Liu, K. R. Cooke, and J. L. M. Ferrara
Flt3 ligand therapy for recipients of allogeneic bone marrow transplants expands host CD8alpha + dendritic cells and reduces experimental acute graft-versus-host disease
Blood, March 1, 2002; 99(5): 1825 - 1832.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Shimizu, S.-i. Fujii, K. Fujimoto, K. Kawa, A. Yamada, and F. Kawano
Tacrolimus (FK506) treatment of CD34+ hematopoietic progenitor cells promote the development of dendritic cells that drive CD4+ T cells toward Th2 responses
J. Leukoc. Biol., November 1, 2000; 68(5): 633 - 640.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
A. E. Morelli, M. A. Antonysamy, T. Takayama, H. Hackstein, Z. Chen, S. Qian, N. B. Zurowski, and A. W. Thomson
Microchimerism, Donor Dendritic Cells, and Alloimmune Reactivity in Recipients of Flt3 Ligand-Mobilized Hemopoietic Cells: Modulation by Tacrolimus
J. Immunol., July 1, 2000; 165(1): 226 - 237.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Antonysamy, M. A.
Right arrow Articles by Thomson, A. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Antonysamy, M. A.
Right arrow Articles by Thomson, A. W.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Bone Marrow Transplantation
*Heart Transplantation


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS