The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bonder, C. S.
Right arrow Articles by Hart, P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bonder, C. S.
Right arrow Articles by Hart, P. H.
The Journal of Immunology, 1998, 160: 4048-4056.
Copyright © 1998 by The American Association of Immunologists

Involvement of the IL-2 Receptor {gamma}-Chain ({gamma}c) in the Control by IL-4 of Human Monocyte and Macrophage Proinflammatory Mediator Production1

Claudine S. Bonder*, Harold L. Dickensheets{dagger}, John J. Finlay-Jones*, Raymond P. Donnelly{dagger} and Prue H. Hart2,*

* Department of Microbiology and Infectious Diseases, School of Medicine, Flinders University of South Australia, Adelaide, Australia; and {dagger} Division of Cytokine Biology, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-4 has potent anti-inflammatory properties on monocytes and suppresses both IL-1ß and TNF-{alpha} production. Well-characterized components of the IL-4 receptor on monocytes include the 140-kDa {alpha}-chain and the IL-2R {gamma}-chain, {gamma}c, which normally dimerize 1:1 for signaling from the receptor. However, mRNA levels for {gamma}c were very low in 7-day-cultured monocytes. As mRNA levels for {gamma}c declined with culture, so too did the ability of IL-4 to down-regulate LPS-induced TNF-{alpha} production. In contrast, IL-4 consistently down-regulated IL-1ß production by cultured monocytes. Immunoprecipitation and Western blot analyses demonstrated that 7-day-cultured monocytes do not express the functionally active 64-kDa {gamma}c protein. This was associated with decreased STAT6 activation by IL-4. Studies with Abs to {gamma}c and an IL-4 mutant that is unable to bind to {gamma}c showed that IL-4 can suppress IL-1ß but not TNF-{alpha} production by LPS-stimulated monocytes in the presence of little or no functioning {gamma}c. IL-4 also suppressed IL-1ß but not TNF-{alpha} production by Mono Mac 6 cells, which express minimal levels of {gamma}c. For {gamma}c-expressing LPS/PMA-activated U937 cells, IL-4 decreased both TNF-{alpha} and IL-1ß production. These results suggest that functional {gamma}c is not present on in vitro-derived macrophages, and that while some anti-inflammatory responses to IL-4 are lost with this down-regulation of functional {gamma}c, others are retained. We conclude that different functional responses to IL-4 by human monocytes and macrophages are regulated by different IL-4 receptor configurations.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
In most inflammatory and autoimmune conditions, the macrophage is central to the manifestation of inflammation because of its ability to produce many molecules (e.g., proteases, prostanoids, and cytokines) that can damage tissue or, in turn, activate other cells to produce pro-inflammatory and immune mediators. Type 1 cytokines (IFN-{gamma}, granulocyte-macrophage CSF (GM-CSF),3 and TNF) stimulate monocyte/macrophage activation, while type 2 cytokines (IL-4, IL-10, IL-13) down-regulate monocyte/macrophage activity in inflammatory type 1 responses. It has been suggested that type 2 cytokines may be useful as natural anti-inflammatory agents in therapy. However, when we examined the in vitro effects of IL-4, a prototypic type 2 cytokine, on pro-inflammatory mediator production by synovial fluid macrophages isolated from the joint fluids of patients with rheumatoid arthritis, i.e., cells taken from a site of chronic inflammation and the cells that must be regulated during immunotherapy, IL-4 only selectively suppressed pro-inflammatory mediator production (1).

In these studies, the responses of synovial fluid cells to IL-4 were compared directly with the responses of blood monocytes isolated from the same patients at the same time as joint aspiration. Two patterns of response to IL-4 were identified. Some responses to IL-4, e.g., suppression of LPS-induced TNF-{alpha} production, were detected with blood monocytes, but poorly or not at all with the activated, more differentiated, synovial fluid cells. Other responses to IL-4, e.g., suppression of LPS-induced IL-1ß production, were very similar in both monocytes and synovial fluid macrophages (1, 2, 3). Responses to IL-4 by 7-day-cultured monocytes were very similar to those of synovial fluid macrophages, namely IL-4 efficiently suppressed IL-1ß but not TNF-{alpha} production (4). The culture system for monocytes using nonadherent conditions and inflammatory (GM-CSF) and less inflammatory cytokines (M-CSF) was established to obtain a more robust and reproducible population to study monocyte/macrophage differentiation-associated changes (4). Phenotypic evidence that the monocytes had undergone a degree of differentiation during the 7 days in culture was shown in a previous study (4).

The IL-4R is traditionally thought to comprise two chains, the IL-4R {alpha}-chain of 140 kDa (CDw124) and the IL-2R {gamma}-chain ({gamma}c) (5, 6). However, from the early 1990s there was evidence of two IL-4R with different functional properties. Scatchard analysis of IL-4 binding to pre-B-lymphocytes suggested the existence of high and low affinity receptors (7). Studies in B cells (8) suggested that different concentrations of IL-4 were required for induction of CD23 and surface IgM expression (involving different pathways). It is now recognized that not all cells that respond to IL-4 express {gamma}c. For example, B cells from patients with X-linked SCID (XSCID) do not express {gamma}c but respond to IL-4 for some functions (9), as do endothelial cells (10) and renal (11) and colon (12) carcinoma cells. It has been suggested that in certain cell types, a chain belonging to the IL-13 receptor is able to dimerize with the IL-4R {alpha}-chain for intracellular signaling (11-14).

The differential responses to IL-4 by monocytes, on the one hand, and in vitro monocyte-derived macrophages and synovial fluid macrophages, on the other hand, suggested to us that 1) different functional responses of monocytes to IL-4 may be regulated by different IL-4 receptors, and 2) IL-4R expression may vary with monocyte activation and differentiation. In this study of matched freshly isolated and cultured monocytes, we examined mRNA expression for the IL-4R {alpha}-chain and {gamma}c and correlated their levels of expression with functional responses to IL-4. In the absence of a 64-kDa {gamma}c protein on 7-day-cultured monocytes, we investigated IL-4 activation of STAT6. The effects of Abs to {gamma}c on IL-4 regulation of monocyte TNF-{alpha} and IL-1ß production were examined, as well as the regulatory properties on monocytes of an IL-4 mutant molecule that can bind to the IL-4R {alpha}-chain but not to {gamma}c (14, 15). We also investigated the functional responses to IL-4 by myeloid cell lines that exhibit varying expression of {gamma}c. These studies suggest that a functional {gamma}c is required for IL-4 regulation of TNF-{alpha} but not IL-1ß production by monocytes and macrophages.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents

Reagents were obtained as gifts as indicated: human rIL-4 (5 x 107 U/mg, Dr. S. Gillis, Immunex, Seattle, WA); a human IL-4 mutant protein (IL-4A (Y124D); Dr. R. de Waal Malefyt, DNAX, Palo Alto, CA); recombinant human GM-CSF (Batch 9A01N040, Genetics Institute, Cambridge, MA); recombinant human M-CSF (Dr. J. Schreurs, Chiron Corporation, Cetus Oncology Division, Emeryville, CA); recombinant human TNF-{alpha} (108 U/mg, Dr. D. Rathjen, Women’s and Children’s Hospital, Adelaide, Australia); recombinant human IL-1ß (R&D Systems, Minneapolis, MN). The phycoerythrin (PE)-labeled mAb TUGh4 (rat mAb to {gamma}c) was kindly donated by Dr. C. Shih, PharMingen, San Diego, CA; unlabeled TUGh4 was provided by Prof. K. Sugamura, Tohoku University School of Medicine, Sendai, Japan. The ELISA Abs for TNF-{alpha} (2TNF-H22, 2TNF-H34) and IL-1ß (ILB1-H6 M, ILB1-H67) were from Prof. A. C. Allison (formerly of Syntex, Palo Alto, CA). The murine mAb to {gamma}c (MAB284) was from R&D Systems; rabbit polyclonal Ab to {gamma}c (sc-670 and sc-667) were from Santa Cruz Biotechnology, Santa Cruz, CA.

Isolation and culture of monocyte-enriched PBMC

Monocytes were isolated as published (1, 2, 3, 4) by countercurrent centrifugal elutriation from leukocyte-enriched buffy coats kindly provided by the Adelaide Red Cross Blood Bank (South Australia). Monocytes were enriched to >93% and cultured in RPMI 1640 medium (Cytosystems, Castle Hill, Australia) supplemented with 13.3 mM NaHCO3, 2 mM glutamine, 50 µM ß-mercaptoethanol, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 nM 3-(N-morpholino)propane-sulfonic acid with an osmolality of 290 mmol/kg H2O (complete RPMI). Monocytes were sometimes cultured for 1 to 7 days before assessment of their responses to IL-4 at 106/ml in 15 to 25 ml of complete RPMI supplemented with 1 to 10% FCS (heat inactivated for 30 min at 56°C) and GM-CSF (10 ng/ml) or M-CSF (200 ng/ml) in 40-ml Teflon pots (Savillex, Minnetonka, MN) (4). During isolation and subsequent culture of all cells, extreme care was taken to limit LPS contamination of buffers and culture fluids (1, 2, 3, 4).

Assessment of functional responses to IL-4 or the IL-4 mutant, IL-4A

Freshly isolated monocytes or monocytes previously cultured for 1, 3, or 5 days were cultured at 106 cells/ml in complete RPMI in Nunc cell-nonadherent Minisorp tubes (Cat. No. 466892, Nunc, Roskilde, Denmark). Unless otherwise specified, the following reagents were added at the initiation of culture to give the indicated final concentrations: IL-4 (10 ng/ml); IL-4A (10 ng/ml); M-CSF (200 ng/ml); GM-CSF (10 ng/ml). LPS from Escherichia coli 0111:34 purified by the Westphal method (Sigma, St. Louis, MO) was added to give a final concentration of 500 ng/ml unless otherwise stated. Replicate cultures for each test variable were incubated at 37°C in 5% CO2. After 20 h, the cultures were centrifuged and cell pellets used for mRNA measurements or lysed in 0.9% NaCl with 10 mM HEPES for measurement of cell-associated IL-1ß (secreted IL-1ß was measured only for monocytes cultured for 1, 3, or 5 days). TNF-{alpha} levels were assessed in the culture supernatants.

Assay of TNF{alpha} and IL-1ß by ELISA

Culture supernatants and cell lysates from monocytes, Mono Mac 6, and U937 cells were stored at -20°C until used. TNF-{alpha} and IL-1ß were measured by sandwich ELISA using mAbs to human TNF-{alpha} (capture Ab, 2TNF-H22; biotinylated detecting Ab, 2TNF-H34) and to human IL-1ß (capture Ab, ILB1-H6 M; biotinylated Ab, ILB1-H67). The assays were sensitive to levels of >40 pg/ml.

mRNA isolation, reverse transcription, PCR, and semiquantitation of the product

Freshly isolated and cultured monocytes (3 x 106) were lysed in 800 µl Total RNA Isolation Reagent (Advanced Biotechnologies, Leatherhead, U.K.). RNA was isolated at 4°C by chloroform extraction, isopropanol precipitation, and ethanol washes, then dried under vacuum before synthesis of cDNA as previously described (3). For PCR, deoxynucleotide triphosphate and Mg2+ concentrations were 200 µM and 1.5 mM, respectively. Primer sequences (5' and 3', respectively) and cycle number were as follows: glyceraldhehyde 3-phosphate dehydrogenase (GAPDH): ACCACCATGGAGAAGACTGG, CTCAGTGTAGCCCAGGATGC, 20 cycles; IL-4R {alpha}-chain: GATGCCTTTCCAGGGCTCTGG, AGGTGGCTCCCTGTCCAGTCC, 35 cycles; IL-2R {gamma}c: ACGGGAACCCAGGAGACAGG, AGCGGCTCCGAACACGAAAC, 35 cycles.

Cycling parameters were 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min for GAPDH; 95°C for 30 s, 60°C for 30 s, and 72°C for 2 min for IL-4R{alpha}; and 95°C for 1 min, 68°C for 50 s, and 72°C for 1 min for {gamma}c. The PCR product was electrophoresed, denatured, neutralized, and transferred to nylon membrane (Hybond N+, Amersham, North Ryde, Australia) by Southern blotting, then probed with an oligonucleotide internal to the PCR primers and end-labeled with 32P as previously reported (3). The sequences of the internal oligonucleotide probes were as follows: GAPDH, GTGGAAGGACTCATGACCACAGTCCATGCC; IL-4R{alpha}, GCAGCCTCTCCACCTTGGAGC; {gamma}c, GCAGTACCGGGACTGACTGGGACC.

Bound 32P label was measured by a Storage PhosphorScreen (Molecular Dynamics, Sunnyvale, CA), which was scanned on a Series 400 PhosphorImager (Molecular Dynamics), and data were calculated using the ImageQuant program (Molecular Dynamics). To ensure that variations in receptor mRNA expression were not due to variations in the amount of cDNA starting material, all values were standarized according to GAPDH mRNA expression by the same sample. Within all samples from a particular donor, there was <2.5-fold variation in GAPDH mRNA. In addition, to show that the amount of PCR product measured under the conditions chosen was a function of the number of target molecules, cDNA from monocytes was serially diluted resulting in proportionally less amplified product (data not shown).

Immunoprecipitation and Western blot analysis

Cells were washed three times with Dulbecco’s PBS containing 0.1 mM Na3VO4, then lysed in buffer containing 20 mM Tris-HCl (pH 7.5), 1% Nonidet P-40, 150 mM NaCl, 10 mM NaF, 10 mM NaPPi, 2.5 mM EDTA, 1 mM Na3VO4, 1 mM PMSF, 20 µg/ml aprotinin, 20 µg/ml leupeptin, and 0.5 mM 3,4-dichloroisocoumarin (Sigma). The total protein content of the lysates was determined by the Bio-Rad protein assay (Richmond, CA). Equal amounts of clarified cell lysates were immunoprecipitated with rabbit anti-human {gamma}c (1:50; sc-667) plus 30 µl of a 50% slurry of protein G-coupled Sepharose (Pharmacia Biotech, Piscataway, NJ). Immunoprecipitates were washed three times with lysis buffer, solubilized with Laemmli buffer, boiled, and resolved by electrophoresis on 8% polyacrylamide Tris-glycine gels.

Immunoblot analysis was performed by transferring separated proteins onto polyvinylidene difluoride membrane (Novex, Palo Alto, CA) in Tris-glycine buffer containing 20% methanol. The membranes were then treated for 1 to 2 h with 3% nonfat dry milk in TTBS (20 mM Tris-HCl (pH 7.5), 154 mM NaCl, 0.05% Tween, 0.05% NaN3), incubated with a 1:1000 dilution of the same rabbit anti-{gamma}c (sc-667) in TTBS containing 0.5% BSA (TTBS-BSA) at 4°C overnight with rocking, then incubated with horseradish peroxidase-conjugated donkey anti-rabbit IgG (1:5000, Amersham, Little Chalfont, U.K.) in TTBS-BSA for 1 h. All procedures were performed at room temperature, and membranes were washed extensively with TTBS after each treatment. After the final wash, the membranes were rinsed with distilled water and air dried, and {gamma}c expression was detected by enhanced chemiluminescence (ECL) according to the manufacturer’s protocol (Amersham).

For Figure 7GoB, a slight variation to this protocol for immunoprecipitation was followed. Cells (107) were lysed in ice-cold lysis buffer (10 mM Tris, 50 mM NaCl, 5 mM EDTA, 1% Triton X100, pH 7.6, supplemented with 10 µg/ml each of the protease inhibitors, aprotinin, antipain, leupeptin, and PMSF (Sigma) (16)). After brief sonication, clarified lysates were immunoprecipitated overnight with 3.5 µg sc-667 and 30 µl of a 50% slurry protein A-coupled Sepharose. Immunoprecipitates were electrophoresed through 10% SDS-PAGE gels before transfer and Western analysis as described above.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 7. Expression of {gamma}c on freshly isolated monocytes, Mono Mac 6 cells, and U937 cells as judged by flow cytometry and using a PE-labeled Ab to {gamma}c (TUGh4) (A); and Western blot analysis after immunoprecipitation with a rabbit {gamma}c Ab (sc-667) (B). For A, the abscissa is a logarithmic scale and shows fluorescence intensity. For B, immunoprecipitates from 107 cells were resolved by electrophoresis, transblotted, and probed with the same rabbit {gamma}c Ab.

 
Electrophoretic mobility shift assays (EMSA)

Nuclear extracts were prepared from monocytes and 7-day-cultured monocytes using a modification (17) of the original method described by Dignam et al. (18). Briefly, nuclei were isolated by hypotonic lysis in buffer A (10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, and 0.5 mM PMSF) supplemented with 25 µl of 10% Triton X-100 (Boehringer Mannheim, Indianapolis, IN) per 400 µl (1:16, v/v). This buffer, as well as buffer C described below, also contained the following mixture of phosphatase and protease inhibitors: 1 mM Na3VO4, 10 mM ß-glycerophosphate, 1 mM DTT, 100 µg/ml chymostatin, complete protease inhibitor mixture (Boehringer Mannheim), and 1 µg/ml pepstatin A (Boehringer Mannheim). Nuclear proteins were extracted by incubating the nuclei for 30 min on ice in buffer C (20 mM HEPES, pH 7.9, 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, and 1 mM PMSF). Nuclear extracts were stored at -80°C until use.

A double-stranded oligonucleotide (STAT-binding element-1 (SBE1)) based on a DNA sequence present in the promoter of the human IL-1 receptor antagonist (IL-1ra) gene was used as a probe in the gel shift assays (19). The sequences of these oligonucleotides were: 5'-gatcGCTCTTCTTCCCAGGAACTCAATG-3' (sense); and 5'-tcgaCATTGAGTTCCTGGGAAGAAGAGC-3' (antisense).

This sequence contains a {gamma}-IFN activation site (GAS)-like element (underlined) that exhibits high affinity for STAT6 (19). Double-stranded oligonucleotides were prepared by annealing the complementary single strands and radiolabeled with Klenow fragment of DNA polymerase I and [{alpha}-32P]dCTP in a fill-in reaction for 5' protruding ends. Unincorporated nucleotides were removed by filtration through Sephadex G-25 columns (Pharmacia Biotech). A second double-stranded oligonucleotide probe, GRR ({gamma}-IFN response region), corresponding to a sequence present in the proximal promoter region of the human Fc{gamma}R1 gene (20), was used for detection of STAT activity in nuclear extracts from cells treated with IFN-{gamma}, GM-CSF, or IL-10. Binding reactions were performed by incubating radiolabeled probe DNA (0.1 ng) with 5 µg nuclear extract in the presence of 2 µg poly dI-dC (Pharmacia Biotech) in a final volume of 20 µl as previously described (17). Binding reactions were incubated at room temperature for 30 min, then 8 µl of each mixture was electrophoresed on nondenaturing, 6% polyacrylamide gels (Novex) using an electrophoresis buffer (0.25 x Tris-borate EDTA) containing 22 mM Tris-HCl (pH 8), 22 mM borate, and 0.5 mM EDTA. The gels were then dried and visualized by autoradiography.

Mono Mac 6 and U937 cells

Mono Mac 6 cells were obtained from Dr. H. W. L. Ziegler-Heitbrock (Institute of Immunology, Munich, Germany). Mono Mac 6 cells were cultured in RPMI 1640 medium supplemented with 13.3 mM NaHCO3, 2 mM glutamine, 200 U/ml penicillin, 200 µg/ml streptomycin, 1x nonessential amino acids (Life Technologies, Gaithersburg, MD), OPI supplement (Sigma), and 10% FCS at a density of 105 cells/ml in 2-ml volumes in 24-well plates at 37°C in a humidified 5% CO2 atmosphere (21, 22). For testing of functional responses to IL-4 and IL-4A, Mono Mac 6 cells were cultured at 106 cells/ml in RPMI 1640-supplemented media (see above) in 24-well plates and activated as required with LPS (10 ng/ml) and PMA (30 ng/ml) for 5 h (21, 22).

U937 cells were cultured in complete RPMI supplemented with 10% FCS. For testing of functional responses to IL-4, U937 cells were cultured at 2 x 105 cells/0.2 ml in 96-well plates and activated with LPS (10 ng/ml) and PMA (20 ng/ml) for 48 h (23).

Labeling of cells for flow cytometric analysis

Cell pellets from 106 cells were labeled as previously reported (1, 3). As controls, cells were incubated with 1 µg X63 (nonspecific IgG1) or 5 µl of PE-labeled Simultest Control {gamma}1/{gamma}2a (Becton Dickinson, Mountain View, CA).

Expression of results and statistical analysis

Cytokine measurements were performed on samples from replicate cultures; the mean values from each set of replicates were used to determine the mean ± SEM for n donors or experiments. For comparison of differences in the responses by cell populations from a number of different donors or experiments, Student’s paired t test was used. For comparison of results within an experiment, an unpaired t test was used. A value of p < 0.05 was considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
IL-4R mRNA levels in monocytes and 7-day-cultured monocytes

In five separate experiments, monocytes from five donors were cultured under nonadherent conditions for 7 days with 10% FCS and M-CSF or GM-CSF (4). mRNA levels detected by RT-PCR for the IL-4R {alpha}-chain (expressed as a ratio to mRNA levels for the housekeeping gene, GAPDH) increased, but not significantly, over this time (Fig. 1Go). However, mRNA levels for {gamma}c were greatly reduced (Fig. 1Go). Similar reductions in {gamma}c mRNA levels in cells cultured for 7 days were detected when a second set of PCR primers spanning a larger region of {gamma}c was used (data not shown). The first set of primers spanned a 277-base pair region from exons 3 to 5, i.e., a region of the extracellular domain only. The second set of primers spanned an 862-base pair region from exons 1 to 8, i.e., both extracellular and intracellular domains. Detection of minimal amounts of mRNA suggested little ongoing or new synthesis of {gamma}c by 7-day-cultured monocytes.



View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 1. The ratio of the mRNA levels for the IL-4R {alpha}-chain and {gamma}c to GAPDH mRNA levels for freshly isolated and 7-day-cultured monocytes. mRNA was extracted from monocytes (C) isolated from five donors or from monocytes from these same donors cultured for 7 days in M-CSF or GM-CSF. mRNA levels, quantified by measuring the RT-PCR product, have been expressed relative to the GAPDH mRNA level for the same cDNA preparation. The mean ratio + SEM for 5 experiments is shown.

 
The duration of time required for the decline in mRNA levels for {gamma}c was examined for M-CSF-cultured monocytes and correlations with functional responses to IL-4 examined. Monocytes were cultured under nonadherent conditions for 1, 3, or 5 days; the cells were then incubated at 106/ml with LPS with or without IL-4 for 20 h. Supernatants from cells from four donors in four separate experiments were used for measurements of IL-1ß and TNF-{alpha}; mRNA was extracted from the cell pellets for three donors. The {gamma}c mRNA level (expressed as a ratio to GAPDH mRNA level) for monocytes cultured for 1 day before the 20-h incubation with IL-4 was normalized to 100%. After 3 days (+20 h), {gamma}c mRNA levels were reduced to a mean of 60% (± 24%). After 5 days (+20 h), 20% of {gamma}c mRNA remained (±22%, Fig. 2Go). For all three monocyte preparations, mRNA levels for the IL-4R {alpha}-chain did not vary significantly with increasing time in culture (data not shown).



View larger version (44K):
[in this window]
[in a new window]
  		FIGURE 2. Relative changes in {gamma}c mRNA levels and IL-4 regulation of TNF-{alpha} and IL-1ß production by monocytes with increasing time in culture. In separate experiments, monocytes from four donors were incubated for 1, 3, or 5 days before incubation with LPS ± IL-4 for a further 20 h. {gamma}c mRNA levels were quantified by measuring the RT-PCR product and were expressed relative to the GAPDH mRNA level for the same cDNA preparation (histograms, mean + SEM (n = 3), left axis). For each time point, the LPS-induced level of secreted TNF-{alpha} and IL-1ß was defined as 100% production, and the changes due to the presence of IL-4 were expressed relative to this level (lines, mean - SEM (n = 4), right axis).

 
For LPS-induced TNF-{alpha}, mean levels of 1.8, 2.0, and 2.2 ng/ml were detected in the culture supernatants after 1, 3, and 5 days culture, respectively; these values were normalized to 100% in Figure 2Go. Mean IL-1ß levels were 148, 146, and 888 pg/ml of supernatant, respectively (also normalized to 100% in Fig. 2Go). IL-4 significantly suppressed LPS-induced TNF-{alpha} production by a mean of 43 ± 9% for monocytes cultured for 1 day. However, IL-4 was without significant effect on monocytes cultured for 3 or 5 days (Fig. 2Go). In contrast, IL-4 suppressed LPS-induced IL-1ß levels by 48, 52, and 43%, respectively, for monocytes cultured for 1, 3, and 5 days (Fig. 2Go).

Expression of 64-kDa {gamma}c is down-regulated in 7-day-cultured monocytes and correlates with decreased IL-4-induced STAT6 activity

With low levels of {gamma}c mRNA, the expression of {gamma}c protein on 7-day-cultured monocytes was examined by immunoprecipitation and Western blotting with a polyclonal {gamma}c Ab to amino acids 342–361 at the carboxy (intracellular) terminus of {gamma}c (sc-667). The {gamma}c protein was immunoprecipitated from two matched sets of freshly isolated and 7-day, M-CSF-cultured monocytes before analysis by Western blotting. As shown in Figure 3Go, freshly isolated monocytes contained significant levels of {gamma}c protein, which increased slightly in each case after brief (15 min) treatment with IL-4 (lanes 2 and 6). In contrast, {gamma}c protein expression was undetectable in 7-day-cultured monocytes from both donors (lanes 3, 4, 7, and 8). The 64-kDa form of {gamma}c has previously been shown to be the form that associates with the IL-2R ß-chain in monocytes (24).



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 3. Western blot analysis of {gamma}c expression in matched monocytes and 7-day-cultured monocytes from two donors. Cells were incubated with medium alone or IL-4 (10 ng/ml) for 15 min at 37°C. The cells were then lysed, and {gamma}c was immunoprecipitated using a rabbit {gamma}c Ab (sc-667). Immunoprecipitates were resolved by electrophoresis, transblotted, and probed with the same rabbit {gamma}c Ab.

 
To determine whether the marked reduction in 64-kDa {gamma}c protein expression in 7-day-cultured monocytes was associated with decreased responsiveness to IL-4, we compared the ability of IL-4 to activate STAT6 (25) in freshly isolated monocytes and 7-day-cultured cells. The oligonucleotide probe used for measuring STAT6 activity was derived from a sequence found in the promoter of the human IL-1ra gene (19). This probe, referred to as SBE1, contains a GAS-like sequence that binds STAT6 with high affinity but does not bind other STAT proteins such as STAT1{alpha} or STAT3. As shown in Figure 4GoA, IL-4 stimulation induced high levels of STAT6 DNA-binding activity in freshly isolated monocytes (lanes 2–4). In contrast, 7-day-cultured monocytes exhibited much lower levels of STAT6 activity after stimulation by IL-4 at the same concentrations and for the same time period (lanes 6–8). Therefore, IL-4-induced STAT6 activity was significantly decreased in 7-day M-CSF-cultured monocytes. To determine whether the loss of {gamma}c expression by 7-day-cultured monocytes affected their responses to other cytokines, we compared the responses of fresh monocytes and 7-day-cultured monocytes to stimulation by IFN-{gamma}, GM-CSF, and IL-10. IFN-{gamma}, GM-CSF, and IL-10 do not activate STAT6, but they activate other STAT proteins. To detect STAT activation by these cytokines, we assayed DNA-binding activity using an oligonucleotide corresponding to the GAS element found in the GRR in the proximal promoter region of the Fc{gamma}RI gene (20). As shown in Figure 4GoB, freshly isolated and 7-day-cultured monocytes exhibited equivalent responses to IFN-{gamma}, GM-CSF, and IL-10. These results suggest that the loss of expression of {gamma}c did not suppress responses to IFN-{gamma}, GM-CSF, or IL-10.



View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 4. A, Comparison of IL-4-induced STAT6 activity in freshly isolated and 7-day-cultured monocytes. Cells were incubated with medium alone or IL-4 (10, 1, or 0.1 ng/ml) for 30 min at 37°C. At the end of the incubation period, nuclear protein extracts were prepared and analyzed by EMSA for STAT6 activity using radiolabeled IL-1ra SBE1 probe. B, Comparison of STAT activation by various cytokines in freshly isolated and 7-day-cultured monocytes. Cells were incubated with medium alone, IFN-{gamma} (10 ng/ml), GM-CSF (10 ng/ml), or IL-10 (10 ng/ml) for 30 min at 37°C. At the end of the incubation period, nuclear protein extracts were prepared and analyzed by EMSA using radiolabeled Fc{gamma}RI GRR probe.

 
Effect of Abs to {gamma}c on IL-4 regulation of monocyte IL-1ß and TNF{alpha} production

Data shown in Figure 2Go suggested a correlation between mRNA levels for {gamma}c and an ability of IL-4 to inhibit LPS-stimulated TNF-{alpha} but not IL-1ß production. Data in Figure 3Go suggested that low mRNA levels translated into little, if any, expression of a 64-kDa {gamma}c protein on 7-day-cultured monocytes. Experiments were then performed with freshly isolated monocytes to confirm that IL-4 depends on the expression and function of {gamma}c to regulate TNF-{alpha} production by these cells. Freshly isolated monocytes (2 x 105/well) were incubated with 5 µg of a mAb to {gamma}c (MAB284) in a final volume of 200 µl of complete RPMI with 1% FCS for 60 min at 37°C. MAB284 has been reported previously to block the IL-2R{gamma}-mediated IL-2 response on human MO7e cells (R&D Information Sheet for MAB284). The cells were then incubated with LPS and IL-4 for 20 h. For three experiments, MAB284 was without effect on IL-1ß production by LPS-stimulated monocytes incubated with IL-4 (Fig. 5Go). In contrast, although there remained a significant effect of IL-4, the suppressive effect of IL-4 on TNF-{alpha} production by LPS-stimulated monocytes was significantly decreased from 42 to 13% suppression by preincubating the cells with MAB284 (Fig. 5Go). It is unknown whether higher concentrations of MAB284 could further block the effects of IL-4 on LPS-stimulated TNF-{alpha} production. In a single experiment, identical amounts of MAB284 and another {gamma}c Ab, TUGh4, reversed the inhibitory effects of IL-4 on monocyte LPS-stimulated TNF-{alpha} production from 42% to 8 and 23% inhibition, respectively, with no significant effect on IL-4 regulation of IL-1ß (data not shown). MAB284 also had no effect on IL-4 regulation of IL-1ß and TNF-{alpha} production by LPS-stimulated 7-day-cultured monocytes (data not shown), further supporting the lack of a functional role for {gamma}c in these cells.



View larger version (52K):
[in this window]
[in a new window]
  		FIGURE 5. Effect of a {gamma}c Ab (MAB284) on the regulation by IL-4 of monocyte IL-1ß and TNF-{alpha} production. Monocytes from three donors were preincubated for 60 min with the AB before incubation for 20 h with LPS ± IL-4. Cytokine levels (+ SEM) have been expressed as a percentage of the level induced by LPS alone. *, Indicates a significant effect of IL-4 on cytokine production; #, indicates a significant effect of MAB284 on IL-4 regulation of cytokine production.

 
Effect of an IL-4 mutant protein on monocyte IL-1ß and TNF{alpha} production

The activity of an IL-4 mutant protein (IL-4A), which can bind to the IL-4R {alpha}-chain but not to {gamma}c (14, 15) due to a tyrosine to aspartic acid switch at position 124, was compared directly with the activity of IL-4 on monocytes from six donors (in six separate experiments). Mean (± SEM) LPS-induced levels of cell-associated IL-1ß and secreted TNF-{alpha} were 2.70 ± 0.45 and 1.44 ± 0.47 ng/ml, respectively. IL-4A at 10 ng/ml significantly suppressed LPS-induced IL-1ß production by 44 ± 11% (Fig. 6GoA). However, even at 100 ng/ml, IL-4A was unable to suppress LPS-induced TNF-{alpha} production (Fig. 6GoB). In contrast, IL-4 (10 ng/ml) efficiently suppressed LPS-induced monocyte production of both IL-1ß and TNF-{alpha} (by 83 ± 6% and 85 ± 4%, respectively) (Fig. 6Go).



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 6. Effect of the mutant IL-4 molecule (IL-4A) on production of intracellular IL-1ß (A) and secreted TNF-{alpha} (B) by freshly isolated monocytes. Monocytes from 6 donors were incubated with LPS ± IL-4A (1–100 ng/ml) or with IL-4 (10 ng/ml) for 20 h. Cytokine levels (+ SEM) have been expressed as a percentage of the level induced by LPS. *, Indicates a significant effect of IL-4A or IL-4 on cytokine production.

 
Expression of {gamma}c on myeloid cell lines

To investigate further the contribution of {gamma}c to IL-4 control of monocyte activities, myeloid cell lines were examined for {gamma}c expression and correlations sought between expression of {gamma}c and functional responses to IL-4. In contrast to peripheral blood monocytes and as previously published (26), Mono Mac 6 cells expressed minimal {gamma}c on their cell surface (Fig. 7GoA). U937 cells expressed high levels of {gamma}c (Fig. 7GoA). The expression of 64-kDa {gamma}c protein by these myeloid cell lines was also investigated by immunoprecipitation using the {gamma}c Ab used in Figure 3Go and subsequent Western analysis. Mono Mac 6 cells, like 7-day-cultured monocytes, did not contain 64-kDa {gamma}c protein (Fig. 7GoB). In contrast, monocytes and U937 cells expressed this protein, and the strength of the signal in Figure 7GoB for U937 cells confirmed the high level of expression of {gamma}c on these cells.

Effect of IL-4 and the IL-4 mutant protein on IL-1ß and TNF{alpha} production by Mono Mac 6 and U937 cells

Mono Mac 6 cells were incubated for 5 h at 106/ml with control medium or LPS (10 ng/ml) and PMA (30 ng/ml), with and without IL-4 and IL-4A. In response to LPS and PMA, mean levels of cell-associated IL-1ß and secreted TNF-{alpha} of 2.1 and 1.05 ng/ml, respectively, were detected. In support of a role for {gamma}c in the regulation of TNF-{alpha} but not IL-1ß production, both IL-4 and IL-4A at 10 ng/ml significantly suppressed IL-1ß production (Fig. 8GoA), whereas TNF-{alpha} levels induced by LPS and PMA were not regulated, even by IL-4 or IL-4A, at 100 ng/ml (Fig. 8GoB).



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 8. Effect of IL-4 and the mutant IL-4 molecule (IL-4A) on the production of cell-associated IL-1ß (A) and secreted TNF-{alpha} (B) by Mono Mac 6 cells. In A and B, cells were incubated with LPS and PMA ± IL-4 (10 ng/ml) or LPS ± IL-4A (10 and 100 ng/ml) for 5 h. All results show the mean (+ SEM) for 3 experiments. In A and B, cytokine levels have been expressed as a percentage of the level induced by PMA with LPS. *, Indicates a significant effect of IL-4A or IL-4 on cytokine production or surface molecule expression.

 
U937 were incubated for 48 h at 106/ml with control medium or LPS (10 ng/ml) and PMA (20 ng/ml), with and without IL-4. IL-4 significantly down-regulated both IL-1ß and TNF-{alpha} production by LPS- and PMA-treated cells (Table IGo). Incubation of 2 x 105 U937 cells for 60 min at 37°C with 5 µg MAB284 significantly reversed the suppressive effect of IL-4 on LPS/PMA-stimulated TNF-{alpha} but not IL-1ß production (data not shown). Thus, U937 cells were similar to monocytes both in their expression of {gamma}c and in functional responses to IL-4.


View this table:
[in this window]
[in a new window]
  		Table I. Production of cell-associated IL-1ß and secreted TNF{alpha} by U937 cells in response to LPS and PMA ± IL-4

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
This is the first study to show that expression levels of the IL-2R {gamma}-chain, {gamma}c, by human monocytes, macrophages, and myeloid cell lines markedly affect the ability of IL-4 to induce certain anti-inflammatory responses, namely inhibition of cytokine production. This is also the first study to suggest that with differentiation of monocytes to macrophages, the IL-4 receptor composition may alter and, thus, functional responses to IL-4 may vary. The results of this study provide a mechanism for our previous observations that 7-day-cultured monocytes and inflammatory cells from the synovial fluid of patients with rheumatoid and other forms of inflammatory arthritis respond to IL-4 for suppression of IL-1ß but not TNF-{alpha} production (1, 2, 4). The importance of the observation that IL-4 control of TNF-{alpha} production is greatly reduced in activated macrophages from inflammatory sites is highlighted by the hierarchical position of TNF-{alpha} as the cytokine that controls the production of other pro-inflammatory cytokines (27).

In this study, monocytes were differentiated in vitro under nonadherent conditions; we have previously found that IL-4 can suppress LPS-induced IL-1ß but not TNF-{alpha} production by these cells (4). After culture for 7 days, during which mRNA levels for the IL-4R {alpha}-chain were not altered, mRNA levels for {gamma}c were reduced to very low, and sometimes undetectable levels, suggesting no ongoing synthesis of this receptor protein. Furthermore, loss of mRNA for {gamma}c coincided with an inability of IL-4 to suppress LPS-induced TNF-{alpha} production. Immunoprecipitation and Western blot analysis showed no expression of the 64-kDa {gamma}c protein in 7-day-cultured monocytes, and this decrease in {gamma}c resulted in significantly reduced activation of STAT6 when these cells were stimulated with IL-4. The relationship between levels of STAT6 activation and regulation of LPS-induced TNF-{alpha} and IL-1ß production has not, to our knowledge, been previously studied. These results suggest that only low levels of STAT6 activation may be required to regulate LPS-induced IL-1ß production. It would be interesting to investigate the stimulation by IL-4 of other intracellular signals determined by IL-2 binding to {gamma}c (induction of c-fos and c-myc (28)), as they may have contributed to the control by IL-4 of TNF-{alpha} production by activated monocytes.

Our results showing reduced STAT6 activation by IL-4 in 7-day-cultured monocytes supports the hypothesis that signaling through {gamma}c is not necessary for activation of STAT6 by IL-4, but that signals from {gamma}c enhance its activity (29, 30). The Janus kinase, JAK3, physically associates with the intracytoplasmic region of {gamma}c and a lack of, or mutation in, {gamma}c results in an inability of IL-4 to activate JAK3 phosphorylation (13, 31). This deficiency is characteristic of hemopoietic cells derived from patients with XSCID. The finding of reduced STAT6 activation in cells with no functional 64-kDa {gamma}c is consistent with the findings of Oakes and colleagues (29) who showed reduced STAT6 activation by IL-4 in B cell lines derived from JAK3-deficient SCID patients compared with B cell lines from normal donors.

Preliminary studies suggest that a dysfunctional {gamma}c or {gamma}c-like protein remains on 7-day-cultured monocytes. Nonfunctional {gamma}c receptors have been reported (16, 24), with some variation depending on N-glycosylation. A form of {gamma}c with a lower molecular mass has been previously reported for monocytes; however, only the 64-kDa form was able to associate with the IL-2R ß-chain (24). There was no 64-kDa {gamma}c protein on 7-day-cultured monocytes when an Ab to a 20-amino acid cytoplasmic domain of {gamma}c was used for immunoprecipitation and Western analysis. However, by flow cytometric analysis of cells labeled with TUGh4 or a polyclonal Ab raised to 20 amino acids at the extracellular amino terminus of {gamma}c (sc-670), significant ligand binding was detected on 7-day-cultured monocytes. Only when MAB284 was used for flow cytometric analysis, i.e., the Ab reported to block IL-2 binding to {gamma}c on MO7e cells and which probably binds to critical residues involved in IL-4 interaction with {gamma}c, was significantly reduced binding of Ab to 7-day-cultured monocytes observed (data not shown). It remains possible that dysfunctional {gamma}c is long-lived on monocytes. Alternatively, a splice variant of {gamma}c is expressed on in vitro-derived macrophages. These possibilities are the subject of ongoing investigation.

For binding of IL-4 to its conventional receptor (IL-4R {alpha}-chain and {gamma}c), a site within the A/C helices of IL-4 first attaches to the IL-4R {alpha}-chain with high affinity (5, 6, 13, 15). A site located on the end of helix D (tyrosine at position 124) of IL-4 then binds {gamma}c creating an active receptor dimer and increasing the affinity of IL-4 binding two- to threefold (5, 13, 15). The results of the present study suggest that monocytes and in vitro-derived macrophages can respond to IL-4 by signals generated through at least two receptor configurations, one without {gamma}c. Incubation of monocytes with an Ab that blocked {gamma}c suggested the involvement of {gamma}c in IL-4 regulation of TNF-{alpha} but not IL-1ß production. A mutant IL-4 molecule, which because of a tyrosine to aspartic acid switch at position 124 cannot bind to {gamma}c (14, 15) was able to decrease LPS-induced IL-1ß but not TNF-{alpha} production by monocytes. Furthermore, we investigated functional responses to IL-4 by myeloid cell lines that expressed varying levels of {gamma}c. Mono Mac 6 cells, which expressed negligible levels of {gamma}c, responded to IL-4 by suppression of IL-1ß but not TNF-{alpha} production following stimulation with LPS and PMA. In contrast, IL-4 suppressed both TNF-{alpha} and IL-1ß production by the higher-{gamma}c-expressing U937 cells stimulated with LPS and PMA. It should be noted that although {gamma}c mRNA has been reported for Mono Mac 6 cells (32), these cells did not express an immunoprecipitable 64-kDa protein and had minimal {gamma}c surface receptors that could be detected by TUGh4 (Fig. 7Go) or MAB284 or a polyclonal Ab to amino acids 22–41 of the amino (extracellular) domain of {gamma}c (data not shown).

These results suggest that IL-4 ligation to both the IL-4R {alpha}-chain and to {gamma}c is necessary for suppression of TNF-{alpha} production by activated myeloid cells. However, signals generated by IL-4 binding to IL-4R chains other than {gamma}c appeared sufficient to suppress IL-1ß production by activated myeloid cells. It is interesting to compare these results with those of Villa et al. (33) who showed that IL-4-induced responses in monocytes from JAK-3-negative SCID patients were identical to those of monocytes from normal donors. In particular, they studied the ability of IL-4 to inhibit LPS-induced production of TNF and IL-8 and to potentiate synthesis of IL-1ra. It is possible that signals other than JAK3 phosphorylation may contribute to regulation of TNF-{alpha} production by IL-4 in activated monocytes.

The IL-4R {alpha}-chain and {gamma}c on monocytes would normally dimerize 1:1 upon IL-4 binding and signal the expression of IL-4 functional activity. Our results suggest at least one alternative configuration (Fig. 9Go). It is feasible that IL-4R {alpha}-chains homodimerize, resulting in selective IL-4 functional activities. Dimerization of IL-4R {alpha}-chains has now been reported from several laboratories (34, 35, 36). However, in all cases, chimeric receptors were used with the receptor ligand ensuring close physical association of the cytoplasmic regions of two IL-4R {alpha}-chains (34, 35, 36). Alternatively, IL-4 may function by binding to a dimer of the IL-4R {alpha}-chain and the {alpha}1 chain of the IL-13 receptor (12, 13, 14, 37, 38, 39). The IL-13R{alpha}1 chain is very similar to {gamma}c and was originally called {gamma}' or {alpha}' (37, 38, 39). It is unknown whether monocytes also express a trimeric IL-4R configuration comprising the IL-4R {alpha}-chain, {gamma}c, and the {alpha}1 chain of the IL-13 receptor. Such a heterotrimeric IL-4R configuration was suggested by Murata and colleagues (12).



View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 9. Models for the IL-4R on monocytes and macrophages. It is proposed that signaling from IL-4 receptors on monocytes may result from dimerization of the IL-4R {alpha}-chain ({alpha}) with {gamma}c (a). A trimer of receptor chains involving the IL-13R{alpha}1 chain ({gamma}') may also be biologically active on monocytes (b). Alternatively, two IL-4R {alpha}-chains may interact upon IL-4 binding (c). On macrophages with dysfunctional or absent {gamma}c, signaling may result from the dimerization of the IL-4R {alpha}-chain with an as yet unidentified receptor chain (d) or with IL-13R{alpha}1 ({gamma}') chain (e). IL-4R {alpha}-chains may also dimerize (f).

 
The data presented here suggest that upon differentiation of monocytes, the IL-4R configuration alters (Fig. 9Go). We hypothesize that {gamma}c on synovial fluid macrophages, like 7-day-cultured monocytes is down-regulated or dysfunctional; these cells display functional responses to IL-4 that are very similar to those of 7-day-cultured monocytes (1). From this study, we hypothesize that changes in the IL-4R composition on monocytes and macrophages may explain some of the reported dysfunctional responses to IL-4 in certain disease states, e.g., inflammatory bowel disease (40) and asthma (41). Figure 9Go presents several options for signaling from the IL-4 receptor on activated and differentiated monocytes and macrophages. As for monocytes, the IL-13R{alpha}1 chain ({gamma}') may enable signaling from the IL-4 receptor in the absence of {gamma}c. However, down-regulation by IL-13 of LPS-induced TNF-{alpha} but not IL-1ß production by monocytes and macrophages is also lost upon culture for 7 days with CSFs (42) and the differentiation of monocytes to synovial fluid macrophages (42). Further data suggest that the IL-13R{alpha}1 chain ({gamma}') may be regulated similarly to {gamma}c (our manuscript in preparation). Alternatively, on macrophages, the IL-4R {alpha}-chain may dimerize with a previously unrecognized receptor chain for expression of the functional activity of IL-4 on differentiated cells (Fig. 9Go).

Our studies suggest that IL-4 can signal in monocytes by not only binding to the primary receptor, IL-4R {alpha}-chain plus {gamma}c, but also by binding to IL-4 receptors without {gamma}c. This study lends some support to the hypothesis of Russell and colleagues in their first description in 1993 of {gamma}c as a component of the IL-4 receptor; to quote: "It is interesting to speculate that some IL-4-induced signals might not require {gamma}c, whereas others require {gamma}c" (5). The results of our studies demonstrate that not only cytokine levels but also cytokine receptor composition may determine functional outcomes to the type 2 cytokine, IL-4, in inflammation.


   Acknowledgments
 
We thank Dr. Sarah Russell, and also Drs. Helena Ward and Vicki Avery, for support and expert advice.


   Footnotes
 
1 This work was supported by the National Health and Medical Research Council of Australia, the Arthritis Foundation of Australia, and the Flinders Medical Centre Foundation (to P.H.H. and J.J.F.-J.). H.L.D. was supported in part by a Postgraduate Research Fellowship Award from the Oak Ridge Institute for Science and Education (ORISE) through an interagency agreement between the U.S. Department of Energy and the U.S. Food and Drug Administration. Back

2 Address correspondence and reprint requests to Dr. P. H. Hart, Department of Microbiology & Infectious Diseases, School of Medicine, Flinders University of South Australia, GPO Box 2100, Adelaide, Australia 5001. E-mail address: Back

3 Abbreviations used in this paper: GM-CSF, granulocyte-macrophage CSF; M-CSF, macrophage-CSF; EMSA, electrophoretic mobility shift assay; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GAS, {gamma}-IFN activation site; IL-4A, IL-4 mutant protein; IL-1ra, IL-1r antagonist; PE, phycoerythrin; SBE1, STAT-binding element-1; XSCID, X-linked SCID; GRR, {gamma}-IFN response region. Back

Received for publication May 22, 1997. Accepted for publication December 19, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hart, P. H., M. J. Ahern, C. A. Jones, K. L. Jones, M. D. Smith, J. J. Finlay-Jones. 1993. Synovial fluid macrophages and blood monocytes differ in their responses to interleukin-4. J. Immunol. 151:3370.[Abstract]
  2. Hart, P. H., M. J. Ahern, M. D. Smith, J. J. Finlay-Jones. 1995. Comparison of the suppressive effects of IL-10 and IL-4 on synovial fluid macrophages and blood monocytes from patients with inflammatory arthritis. Immunology 84:536.[Medline]
  3. Hart, P. H., E. K. Hunt, C. S. Bonder, C. J. Watson, J. J. Finlay-Jones. 1996. Regulation of surface and soluble TNF receptor expression on human monocytes and synovial fluid macrophages by IL-4 and IL-10. J. Immunol. 157:3672.[Abstract]
  4. Hart, P. H., C. A. Jones, J. J. Finlay-Jones. 1995. Monocytes cultured in cytokine-defined environments differ from freshly isolated monocytes in their responses to IL-4 and IL-10. J. Leukocyte Biol. 57:909.[Abstract]
  5. Russell, S. M., A. D. Keegan, N. Harada, Y. Nakamura, M. Noguchi, P. Leland, M. C. Friedmann, A. Miyajima, R. K. Puri, W. E. Paul, W. J. Leonard. 1993. IL-2 receptor {gamma} chain: a functional component of the IL-4 receptor. Science 262:1880.[Abstract/Free Full Text]
  6. Kondo, M., T. Takeshita, N. Ishii, M. Nakamura, S. Watanabe, K.-I. Arai, K. Sugamura. 1993. Sharing of the interleukin-2 (IL-2) receptor {gamma} chain between receptors for IL-2 and IL-4. Science 262:1874.[Abstract/Free Full Text]
  7. Fanslow, W. C., M. K. Spriggs, C. T. Rauch, K. N. Clifford, B. M. Macduff, S. F. Ziegler, K. A. Schooley, K. M. Mohler, C. J. March, R. J. Armitage. 1993. Identification of a distinct low-affinity receptor for human interleukin-4 on pre-B cells. Blood 81:2998.[Abstract/Free Full Text]
  8. Rigley, K. P., S. M. Thurstan, R. E. Callard. 1991. Independent regulation of IL-4-induced expression of human B cell surface CD23 and IgM: functional evidence for two IL-4 receptors. Int. Immunol. 3:197.[Abstract/Free Full Text]
  9. Matthews, D. J., P. A. Clark, J. Herbert, G. Morgan, R. J. Armitage, C. Kinnon, A. Minty, K. H. Grabstein, D. Caput, P. Ferrara, R. Callard. 1995. Function of the IL-2 receptor {gamma}-chain in biologic responses of X-linked severe combined immunodeficient B cells to IL-2, IL-4, IL-13 and IL-15. Blood 85:38.[Abstract/Free Full Text]
  10. Schnyder, B., S. Lugli, N. Feng, H. Etter, R. A. Lutz, B. Ryffel, K. Sugamura, H. Wunderli-Allenspach, R. Moser. 1996. IL-4 and IL-13 bind to a shared heterodimeric complex on endothelial cells mediating vascular cell adhesion molecule-1 induction in the absence of the common {gamma} chain. Blood 87:4286.[Abstract/Free Full Text]
  11. Obiri, N. I., W. Debinski, W. J. Leonard, R. K. Puri. 1995. Receptor for IL-13. Interaction with IL-4 by a mechanism that does not involve the common {gamma} chain shared by receptors for interleukins 2, 4, 7, 9 and 15. J. Biol. Chem. 270:8797.[Abstract/Free Full Text]
  12. Murata, T., P. D. Noguchi, R. K. Puri. 1996. Receptors for IL-4 do not associate with common {gamma} chain, and IL-4 induces the phosphorylation of JAK2 tyrosine kinase in human colon carcinoma cells. J. Biol. Chem. 270:30829.[Abstract/Free Full Text]
  13. Duschl, A., W. Sebald. 1996. Transmembrane and intracellullar signalling by interleukin-4: receptor dimerization and beyond. Eur. Cytokine Netw. 7:37.[Medline]
  14. Zurawski, S. M., Jr F. Vega, B. Huyghe, G. Zurawski. 1993. Receptors for interleukin-13 and interleukin-4 are complex and share a novel component that functions in signal transduction. EMBO J. 12:2663.[Medline]
  15. Kruse, N., B.-J. Shen, S. Arnold, H.-P. Tony, T. Muller, W. Sebald. 1993. Two distinct functional sites of human interleukin 4 are identified by variants impaired in either receptor binding or receptor activation. EMBO J. 12:5121.[Medline]
  16. Bosco, M. C., I. Espinoza-Delgado, M. Schwabe, S. M. Russell, W. J. Leonard, D. L. Longo, L. Varesio. 1994. The {gamma} subunit of the IL-2 receptor is expressed in human monocytes and modulated by IL-2, interferon {gamma}, and transforming growth factor ß1. Blood 83:3462.[Abstract/Free Full Text]
  17. Schreiber, E., P. Matthias, M. M. Muller, W. Schaffner. 1989. Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Res. 17:6419.[Free Full Text]
  18. Dignam, J. D., R. M. Lebovitz, R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
  19. Ohmori, Y., M. F. Smith, T. A. Hamilton. 1996. IL-4-induced expression of the IL-1 receptor antagonist gene is mediated by STAT6. J. Immunol. 157:2058.[Abstract]
  20. Pearse, R. N., R. Feinman, J. V. Ravetch. 1991. Characterization of the promoter of the human gene encoding the high-affinity IgG receptor. Proc. Natl. Acad. Sci. USA 88:11305.[Abstract/Free Full Text]
  21. Ziegler-Heitbrock, H. W. L., W. Schraut, P. Wendelgab, M. Strobel, T. Sternsdorf, C. Weber, M. Aepfelbacher, M. Ehlers, C. Schutt, J. G. Haas. 1994. Distinct patterns of differentiation in the monocytic cell line Mono Mac 6. J. Leukocyte Biol. 55:73.[Abstract]
  22. Pradines-Figueres, A., R. H. Raetz. 1992. Processing and secretion of tumor necrosis factor {alpha} in endotoxin-treated Mono Mac 6 cells are dependent on phorbol myristate acetate. J. Biol. Chem. 267:23261.[Abstract/Free Full Text]
  23. Takeshita, S., J. R. Gage, T. Kishimoto, D. L. Vredevoe, O. Martinez-Maza. 1996. Differential regulation of IL-6 gene transcription and expression by IL-4 and IL-10 in human monocytic cell lines. J. Immunol. 156:2591.[Abstract]
  24. Epling-Burnette, P. K., S. Wei, J. H. Liu, F. Pericle, D. Ussery, S. M. Russell, W. J. Leonard, J. Y. Djeu. 1995. Expression of IL-2 receptor {gamma} on human monocytes: characterization of lineage specific post-translational modifications. Eur. J. Immunol. 25:291.[Medline]
  25. Takeda, K., T. Tanaka, W. Shi, M. Matsumoto, M. Minami, S.-I. Kashiwamura, K. Nakanishi, N. Yoshida, T. Kishimoto, S. Akira. 1996. Essential role of Stat6 in IL-4 signalling. Nature 380:627.[Medline]
  26. De Wit, H., D. W. Hendriks, M. R. Halie, E. Vellenga. 1994. Interleukin-4 receptor regulation in human monocytic cells. Blood 84:608.[Abstract/Free Full Text]
  27. Tracey, K. J., A. Cerami. 1994. TNF: a pleiotropic cytokine and therapeutic target. Annu. Rev. Med. 45:491.[Medline]
  28. Nelson, B. H., J. D. Lord, P. D. Greenberg. 1996. A membrane-proximal region of the interleukin-2 receptor {gamma}c chain sufficient for Jak kinase activation and induction of proliferation in T cells. Mol. Cell. Biol. 16:309.[Abstract]
  29. Oakes, S. A., F. Candotti, J. A. Johnston, Y.-Q. Chen, J. J. Ryan, N. Taylor, X. Liu, L. Hennighausen, L. D. Notarangelo, W. E. Paul, R. M. Blaese, J. J. O’Shea. 1996. Signaling via IL-2 and IL-4 in JAK3-deficient severe combined immunodeficiency lymphocytes: JAK3-dependent and independent pathways. Immunity 5:605.[Medline]
  30. Taylor, N., F. Candotti, S. Smith, S. A. Oakes, T. Jahn, J. Isakov, J. M. Puck, J. J. O’Sea, K. Weinberg, J. J. Johnston. 1997. Interleukin-4 signaling in B lymphocytes from patients with X-linked severe combined immunodeficiency. J. Biol. Chem. 272:7314.[Abstract/Free Full Text]
  31. Russell, S. M., J. A. Johnston, M. Noguchi, M. Kawamura, C. M. Bacon, M. Friedmann, M. Berg, D. W. McVicar, B. A. Witthuhn, O. Silvennoinen, A. S. Goldman, F. C. Schmalstieg, J. N. Ihle, J. J. O’Shea, W. J. Leonard. 1994. Interaction of IL-2Rß and {gamma}c chains with Jak1 and Jak3: implications for XSCID and XCID. Science 266:1042.[Abstract/Free Full Text]
  32. Quentmeier, H., K. Kolsdorf, M. Zaborski, H. G. Drexler. 1995. IL-4R{alpha} and {gamma} chain expression in LPS- and IL-4-stimulated MONO-MAC-6 cells. Leukemia 9:336.[Medline]
  33. Villa, A., M. Sironi, P. Macchi, C. Matteucci, L. D. Notarangelo, P. Vezzoni, A. Mantovani. 1996. Monocyte function in a severe combined immunodeficient patient with a donor splice site mutation in the Jak3 gene. Blood 88:817.[Abstract/Free Full Text]
  34. Lai, S. Y., J. Molden, K. D. Liu, J. M. Puck, M. D. White, M. A. Goldsmith. 1996. Interleukin-4-specific signal transduction events are driven by homotypic interactions of the interleukin-4 receptor {alpha} subunit. EMBO J. 15:4506.[Medline]
  35. Kammer, W., A. Lischke, R. Morigg, B. Groner, A. Ziemiecki, C. B. Gurniak, L. J. Berg, K. Friedrich. 1996. Homodimerization of interleukin-4 receptor {alpha} chain can induce intracellular signaling. J. Biol. Chem. 271:23634.[Abstract/Free Full Text]
  36. Reichel, M., B. H. Nelson, P. D. Greenberg, P. B. Rothman. 1997. The IL-4 receptor {alpha}-chain cytoplasmic domain is sufficient for activation of JAK-1 and STAT6 and the induction of IL-4-specific gene expression. J. Immunol. 158:5860.[Abstract]
  37. Aman, M. J., N. Tayebi, N. I. Obiri, R. K. Puri, W. S. Modi, W. J. Leonard. 1996. cDNA cloning and characterization of the human IL-13 receptor {alpha} chain. J. Biol. Chem. 271:29265.[Abstract/Free Full Text]
  38. Miloux, B., P. Laurent, O. Bonnin, J. Lupker, D. Caput, N. Vita, P. Ferrara. 1997. Cloning of the human IL-13R{alpha}1 chain and reconstitution with the IL-4R{alpha} of a functional IL-4/IL-13 receptor complex. FEBS Lett. 401:163.[Medline]
  39. Obiri, N. I., P. Leland, T. Murata, W. Debinski, R. K. Puri. 1997. The IL-13 receptor structure differs on various cell types and may share more than one component with IL-4 receptor. J. Immunol. 158:756.[Abstract]
  40. Schreiber, S., T. Heinig, U. Panzer. R. Reinking, A. Bouchard, P. D. Stahl, A. Raedler. 1995. Impaired response of activated mononuclear phagocytes to interleukin-4 in inflammatory bowel disease. G