| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Medical Biochemistry, University of Wales College of Medicine, Heath Park, Cardiff, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-chain of C8 in the C5b-8 complex, and
also to bind to the b domain of C9 (5). CD59 binding to these two
molecules prevents C9 insertion through the lipid membrane, and also
prevents C9 polymerization, thus inhibiting the formation of the pore
structures of the membrane attack complex (6, 7). We have previously purified CD59 analogues from rat, sheep, and pig erythrocytes (8, 9, 10). These analogues resemble human CD59 in terms of m.w., membrane anchorage, extent of glycosylation, and function. Each of the CD59 analogues has been shown to inhibit lysis by complement from a wide range of species, suggesting that the active sites are at least partially conserved between species (11). We have also reported the molecular cloning of the CD59 analogues from rat and mouse (12, 13). Sequence data from the cloned CD59 analogues have been compared with predicted candidate active sites that have been tested by mutagenesis and domain swapping (14, 15).
Recent initiatives in the field of organ transplantation have focused
on the possibility of using animals as a source of donor organs for
human transplants to overcome the shortage of suitable human donor
organs, xenotransplantation (16). Numerous practical and ethical
considerations have made the pig the animal of choice for the supply of
such donor organs. The first major hurdle to be overcome in
xenotransplantation is hyperacute rejection, the destruction of the
grafted organ within minutes of implantation, mediated by natural Ab
and complement. In transplants between distantly related species
(discordant transplants) such as pig and man, activation of complement
on the endothelium of the foreign organ occurs both through the
classical pathway, activated by preexisting natural Abs, and through
the alternative pathway, activated independently of Abs. Recent
evidence indicates that most of the preexisting natural Abs react with
the carbohydrate epitope Gal(1,3)Gal(6), an epitope
absent from humans and Old World primates due to the lack of a
functional 1,3 galactosyltransferase enzyme in these
species (17, 18).
Numerous investigators have sought to reduce complement activation in hyperacute rejection by removing the natural Ab and/or by inhibiting complement. Endogenous membrane-bound complement inhibitors in the donor organ were suggested to be ineffective against complement of the recipient, especially at the high levels of attack seen during rejection. To overcome this proposed deficit, several groups have introduced human complement-regulatory proteins (CRP) into pig organs or cells to obtain high levels of expression. Porcine aortic endothelial cells transfected with human CRPs were effectively protected from lysis by human serum (19, 20, 21, 22). Furthermore, pigs transgenic for human CD59 and/or decay-accelerating factor have been developed, and organs obtained from these donors showed enhanced survival in ex vivo models of xenotransplantation (23, 24, 25, 26, 27, 28, 29, 30) and when transplanted into primates (31, 32).
The potential roles of the endogenous pig CRPs in the protection of the transplanted organ have received little attention. We have undertaken the molecular and structural characterization of the pig CRPs in the expectation that the knowledge gained will be of relevance to pig-to-human xenotransplantation. We have previously described the purification and functional characterization of CD59 from pig erythrocytes and reported that pig CD59 inhibited human complement (10). In this work, we describe the molecular cloning of pig CD59 and the functional characterization of the expressed molecule.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Molecular biology.
All general reagents were from Sigma Chemical (Poole, U.K.),
unless otherwise stated. Ultraspec RNA isolation medium was from
Biotecx (Houston, TX). RNase H- Superscript reverse
transcriptase, RNase H, terminal dioxynucleotide transferase, and all
restriction enzymes were from Life Technologies (Paisley, U.K.). Nick
columns for radioactive probe purification, Taq polymerase,
and buffers were from Pharmacia (Milton Keynes, U.K.); Vent DNA
polymerase was from New England Biolabs (Beverly, MA); and dNTPs were
from Bioline (London, U.K.). RNase inhibitor rRNasin and pGEM-T vector
kit were from Promega (Southampton, U.K.). Geneclean II DNA
purification kit was from Anachem (Luton, U.K.), and plasmid
purification kits were from Qiagen (Dorking, U.K.). Hybond-N nylon
membranes, Rapid-Hyb buffer, rediprime DNA labeling system,
and [-32P]dCTP were from Amersham International
(Little Chalfont, U.K.). Oligonucleotide primers were synthesized in
house on an ABI model 394 synthesizer (Applied Biosystems, Warrington,
U.K.).
Tissues, cells, and sera. Animal sera were obtained fresh from the animal facility of University of Wales College of Medicine (Cardiff, U.K.) and stored at -70°C. Normal human serum was obtained from healthy volunteers and stored at -70°C.
The human promonocyte U937 cell line was obtained originally from European Collection of Animal Cell Cultures (ECACC, Porton Down, U.K.). The derivation of a CD59-negative subclone has been previously described (33). Cells were cultured in RPMI 1640 medium (Life Technologies) supplemented with 10% FCS, 4 mM glutamine, 2 mM sodium pyruvate, 100 IU/ml penicillin, 100 IU/ml streptomycin, and 2.5 µg/ml amphotericin. Pig endothelial cells isolated from pig aorta by standard methods were a kind gift from Department of Cardiology, University of Wales College of Medicine. The porcine endothelial cell line PLECT was a kind gift from Dr. Marilyn Moore (University of Edinburgh, Edinburgh, U.K.). All tissues for Northern blots were obtained fresh from the local abattoir.
Antibodies.
High titer polyclonal antiserum against CD59-negative U937 cells was
raised in rabbits using standard procedures. The mAbs against pig CD59
(MEL-1 IgM and MEL-2 IgG1) were generated in house using pig
erythrocytes as immunogen. These reagents will be described in detail
elsewhere (Hanna et al., in preparation). BRIC229 (-human CD59 mAb)
was from International Blood Group Reference Laboratory (IBGRL,
Bristol, U.K.). Goat anti-mouse/IgG horseradish peroxidase was from
Bio-Rad (Hemel Hempstead, U.K.). Goat anti-mouse/IgG phycoerythrin
was from DAKO (Glostrup, Denmark).
Reverse transcription
Total RNA was extracted from cultured pig endothelial cells using the Ultraspec RNA isolation system. The RNA was reverse transcribed by incubation with 500 U Superscript RNase H- reverse transcriptase at 20°C for 10 min, then 42°C for 90 min in the presence of 50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl2, 5 µM DTT, 60 U rRNasin, and 2 mM dNTPs, in a total volume of 30 µl.
PCR amplifications
All PCR reactions were conducted in an OmniGene thermal cycler (Hybaid, Middlesex, U.K.). Taq DNA polymerase (2.5 U) was used to amplify the DNA in the presence of NH4+ buffer (16 mM (NH4)2SO4, 67 mM Tris-HCl, 0.01% Tween 20), containing 1 mM MgCl2, 0.08 mM dNTPs, and appropriate primers, in a total reaction volume of 50 µl overlaid with mineral oil.
Degenerate PCR amplification
Random hexamers of DNA (500 ng) were used to prime the initial reverse transcription of 10 µg total RNA to produce a template for the PCR amplification.
Degenerate primers A-PIG
(TGC/TTAC/TAAC/TTGC/TATA/C/TAA)and
C-PIG
(AGG/ATCC/TTC/TC/TTG/TG/ACAG/ACA)
were derived from amino-terminal protein sequence corresponding to
residues 3–8 (CYNCIN) of pig CD59(7) and a region of high interspecies
homology of all known CD59 sequences close to the C terminus
corresponding to residues 63–68 (CCKKDL) in human CD59. The
approximate positions of these primers are shown in the schematic
diagram of the pig CD59 cDNA (Fig. 1
). A variation on the touchdown
procedure of Don et al. (34) was performed, with 500 ng of each primer
used in the amplification. A denaturation at 95°C for 4 min was
followed by initial cycling parameters of 94°C for 30 s, 54°C
for 40 s, and 72°C for 45 s. Thereafter, the annealing
temperature of the reaction was decreased 2°C every second cycle from
54°C to a touchdown of 40°C, at which temperature 25 cycles were
conducted.
|
The 3' end of pig CD59 cDNA was obtained using a modification of
the rapid amplification of cDNA ends (RACE) method described by Frohman
(35). A poly(dT) adaptor primer QT
(CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCT17) (28 pmol) was
used to reverse transcribe mRNA from 10 µg total RNA. QT
binds to the poly(A) tails of all mRNAs, thus priming reverse
transcription and consequently adding an extra 35 bases of unique
sequence to the cDNA end. Nested PCR was performed using primers
specific for this unique sequence, Q0
(CCAGTGAGCAGAGTGACG) and Q1 (GAGGACTCGAGCTCAAGC), along
with pig CD59-specific primers D-PIG (TGCACTACGGCCATGAATTG) and E-PIG
(TCGTTGAAGCCGTGCCACCC), designed from the cDNA sequence obtained from
the degenerate primer PCR reaction. The positions of these primers are
shown in Figure 1
.
In the first amplification, 7% of the QT-primed cDNA was amplified using 25 pmol of primer Q0 and the degenerate primer A-PIG, using touchdown PCR as above. In the second amplification, a 1-µl aliquot of a 1/20 dilution of the first reaction was amplified using 25 pmol Q1 and 25 pmol D-PIG, with the following reaction conditions: 94°C for 30 s, 54°C for 1 min (ramp 2.5), and 72°C for 2 min for 30 cycles. In the third amplification, a 1-µl aliquot of a 1/20 dilution of the second amplification was amplified using 25 pmol Q1 and 25 pmol E-PIG, with the following reaction conditions: 94°C for 30 s, 58°C for 1 min (ramp 2.5), and 72°C for 2 min for 30 cycles.
Derivation of the 5' end of pig CD59 cDNA
A pig CD59-specific primer RT-PIG (AGGTCCTTCTTGCAGCAGTTG) (6 pmol), derived from the cDNA sequence obtained from the degenerate PCR reaction, was used in the reverse transcription of the 5' end of the mRNA from 10 µg total RNA. After reverse transcription, the RNA was degraded by incubation for 20 min at 37°C with 2.5 U RNase H. The single-stranded cDNA generated by reverse transcription was purified from primers and enzyme using the Geneclean II kit (Anachem). The purified cDNA was polyadenylated at its 3' end by incubation with 10 U terminal deoxynucleotide transferase (Life Technologies) in the presence of 5 mM ATP at 37°C for 5 min, then 65°C for 10 min. The mixture was then heated to 95°C to denature the enzyme, and 5% of the resulting polyadenylated single-stranded cDNA was used directly in the first PCR amplification. The poly(A) tail generated was used to initially amplify the cDNA with the adaptor primer QT, followed by further amplification using the primers Q0 and Q1 and the pig CD59-specific primers G-PIG (CTTCTCCGCTAGGTTTCTCG) and F-PIG (GCATTCATCGAACCTCCAAC), which were designed from the cDNA sequence obtained from the degenerate PCR.
In the first amplification, the cDNA was amplified using 3 pmol QT primer, 25 pmol Q0, and 25 pmol G-PIG, using the following conditions: 96°C for 5 min, 50°C for 2 min (ramp 2.5), and 72°C for 40 min, followed by 30 cycles of 94°C for 1 min, 58°C for 1 min, and 72°C for 2 min.
A 1-µl aliquot of a 1/20 dilution of the first reaction was reamplified using 25 pmol of each of the nested primers Q1 and F-PIG, using the following conditions: 94°C for 1 min, 58°C for 1 min (ramp 2.5), and 72°C for 2 min for 30 cycles.
Cloning and sequencing of PCR products
Purified PCR products were ligated into the pGEM-T vector
cloning site (insert:vector molar ratio 3:1) by incubation with 1 Weiss
Unit of T4 DNA ligase (16°C for 16 h) in a total volume of 10
µl of 30 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 10 mM
DTT, and 1 mM ATP. A 1-µl aliquot was then electroporated into
electrocompetent DH5 Escherichia coli at 2.5 kV, 25
µFD, and 200 
using a Bio-Rad Genepulser. The bacteria were then
grown on Luria-Bertani (LB)/Agar plates and selected for by ampicillin
resistance and by blue/white color selection using X-Gal
(5-bromo-4-chloro-3-indolyl ß-D-galactoside) substrate.
Positive colonies were picked, a portion was retained for checking
insert size, and the remainder was replated on LB/Agar plates. The
retained portion was boiled in 20 µl water for 10 min to release and
denature the plasmid, then put on ice for 10 min. PCR was performed
using 5 µl of boiled bacteria as the template and T7 and SP6 primers
that flank the insert site in the vector, and the reaction was resolved
on agarose gels. Colonies with inserts of the correct size were
expanded for 16 h in 5 ml LB broth containing 50 µg/ml
ampicillin at 37°C, and the plasmids were purified using the QIAprep
spin plasmid kit (Qiagen).
Automated sequencing was conducted in house using an ABI model 377 DNA sequencer (Applied Biosystems).
Southern and Northern blot analysis
Probes for Southern and Northern blot analysis were generated by
PCR from double-stranded pig CD59 template DNA and were isolated by
elution from a low melting point agarose gel. The DNA concentration was
measured and adjusted to 550 ng/ml before denaturation at 95°C for 2
min and quenching in ice water. Lyophilized redi-prime constituents
were reconstituted in 45 µl template DNA, 5 µl (50 µCi)
[-32P]dCTP added, and the mixture was incubated
at 37°C for 1 h. The product was purified from remaining
nucleotide using a Nick column (Pharmacia, Milton Keynes, U.K.) and
stored at 4°C.
Total RNA for Northern blot analysis was purified from whole tissues and from cultured pig aortic endothelial cells using the Ultraspec RNA isolation system. The Poly(A)Tract mRNA isolation system (Promega) was used to purify mRNA from cultured endothelial cells. Total RNA (10 µg) or mRNA (2 µg) was run on denaturing agarose gels and was capillary transferred overnight to Hybond-N nylon membrane. For Southern blot analysis, PCR products were run on agarose gels and transferred to Hybond-N using capillary action. The nucleic acids were cross-linked to the membrane by U.V. irradiation (U.V. Stratalinker; Stratagene, Cambridge, U.K.). The membrane was prehybridized in Rapid-Hyb buffer at 65°C for 1 h before addition of the radiolabeled probe that had been denatured at 95°C. Southern blots were hybridized with a 200-bp probe generated from the pig CD59 cDNA cloned using degenerate primers. This was hybridized for 3 h at 65°C, washed twice for 5 min with 0.2x SSC/0.1% SDS at 65°C, and exposed to x-ray film for up to 6 h at -70°C. Northern blots were hybridized for 16 h at 65°C with a 610-bp probe generated from the pig CD59 coding sequence cloned in the expression vector. This was washed at room temperature (twice for 10 min in 2x SSC/0.1% SDS, and twice for 10 min in 1x SSC/0.1% SDS), and exposed to x-ray film for up to 48 h at -70°C.
Construction of eukaryotic expression vector for transfection of pig CD59
The eukaryotic expression vector pDR2EF1 was a gift from Dr
I. Anegon (Institut National de la Santé et de la Recherche
Médicale U437, Nantes, France) (36). pDR2EF1 contains the
hygromycin-resistance gene, allowing the selection of stable colonies,
and the powerful polypeptide chain elongation factor 1 promotor to
generate high and reproducible expression levels (37). From the
full-length pig CD59 sequence, two primers, PIGXP-1
(GGTTCTAGAGTAGCGCTGCAGCCGGAC) and PIGXP-2
(GGTGGATCCTTCTCTGCCAACAGGCCT), were designed to PCR amplify the entire
coding region, including the Kozak sequence, essential for ribosomal
recognition of the translational start site. To ensure sequence
fidelity, this PCR was performed using Vent DNA polymerase (New England
Biolabs) that has proofreading capacity. The template for the PCR was
cDNA reverse transcribed from porcine endothelial cell total RNA using
random hexamer primers. The PCR primers PIGXP-1 and PIGXP-2 contained
XbaI and BamHI restriction sites, respectively.
These sites were also present as unique sites in the insertion region
of the expression vector, ensuring correct orientation of the insert.
PCR product and vector were digested with the above restriction enzymes
before ligation. After electroporation into DH5, colonies were
picked and the plasmids were purified. The presence and fidelity of the
pig CD59 cDNA in the vector were confirmed by DNA sequencing of 12
separate clones.
Transfection of CD59-negative U937 cell line
The CD59-negative subclone of the promonocytic cell line U937 was transfected by electroporation with the empty expression vector, the expression vector containing pig CD59 cDNA, or vector containing human CD59 cDNA (13). U937 cells growing in log phase were washed three times with sterile PBS and resuspended in ice-cold RPMI at a final concentration of 3 x 107 cells/ml. Cells (450 µl) were added to a sterile cuvette with 10 µg of supercoiled plasmid. The cuvette was placed on ice for 5 min and electroporated at 270 V and 960 µF using the Bio-Rad Genepulser with capacitance extender. The cuvette was then placed on ice for an additional 30 min. Cells were returned to sterile flasks and cultured for 24 h in 10 ml fresh RPMI containing 10% FCS. Cells were washed once in sterile 0.9% NaCl and resuspended in selection medium (RPMI 1640 medium containing 10% FCS and 0.7 mg/ml hygromycin B; Boehringer Mannheim, Lewes, U.K.). Selection medium was changed every 2 days for approximately 2 wk, by which time all of the nontransfected control cells had died. Transfected cells were then maintained in RPMI containing 10% FCS and 0.1 mg/ml hygromycin B.
FACScan analysis
Cells were harvested, washed three times in PBS/1% BSA, and resuspended at 106 cells/ml in VBS/1% BSA. All steps were conducted on ice. Cells (105) were incubated with appropriate mAbs at 10 µg/ml for 30 min, washed three times with VBS/1% BSA, and incubated for 30 min with a 1/100 dilution of goat anti-mouse/IgG phycoerythrin. Cells were washed three times in VBS/1% BSA, and fluorescence was measured using a FACScalibur flow cytometer (Becton Dickinson, San Jose, CA).
To examine the effects of treatment with phosphatidylinositol-specific phospholipase C (PIPLC), cells were washed and resuspended at 3 x 106/ml in PBS containing rPIPLC (0.4 U/ml; Peninsula Laboratories, St. Helens, U.K.). After an incubation for 30 min at 37°C, cells were washed and CD59 expression was measured by flow cytometry using the above protocol.
Functional assays
To eliminate the interfering effects of the antibiotics (13), stably transfected cells were cultured in the absence of hygromycin B for 7 days before assessment of sensitivity to complement lysis. Cells growing in log phase were harvested, washed three times in PBS, resuspended in RPMI/10% FCS at 107 cells/ml, and loaded with calcein-AM (Molecular Probes, Eugene, OR; 2 µg/ml) for 30 min at 37°C. Cells were washed twice with PBS and resuspended in a 1/5 dilution of heat-inactivated rabbit anti-U937 polyclonal antiserum in VBS/1% BSA for 15 min at 4°C. Cells were washed once in PBS and resuspended in VBS/1% BSA containing the appropriate dilution of fresh serum. The mixture was incubated for 30 min at 37°C, after which the cells were pelleted, and the supernatant removed and retained for fluorescence measurement using the WellFluor system (Denley, Sussex, U.K.). The cells were then incubated for an additional 15 min in 0.1% Triton X-100, to release any remaining calcein. Residual cell debris was pelleted, and the supernatant was removed for fluorescence measurement. Percentage lysis by serum was calculated as follows: % lysis = [calcein release by complement/(calcein released by complement + calcein released by detergent)] x 100.
SDS-PAGE and Western blotting of cell lysates
Samples were run on 15% SDS-PAGE gels under reducing and nonreducing conditions, blotted onto nitrocellulose, and blocked with 5% dried milk/PBS. The blots were incubated for 1 h at room temperature with primary Abs (10 µg/ml in 5% dried milk/PBS), washed three times in PBS/0.1% Tween-20, incubated with goat anti-mouse/IgG horseradish peroxidase (1/1000 in 5% dried milk/PBS), and washed twice with PBS/0.1% Tween-20, and twice with PBS. Blots were developed using Supersignal Chemiluminescent Substrate (Pierce, Rockford, IL).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Degenerate PCR using primers A-PIG and C-PIG produced four PCR
products, of approximately 150, 200, 350, and 400 bp. All of the PCR
products were cloned. From the resultant colonies, 20 were screened by
PCR using T7 and SP6 primer sites in the vector, which identified six
colonies containing an insert of the predicted length (200 bp). These
six colonies were grown up, and the plasmids were purified and
sequenced. All were identical. The amino acid sequence derived from
this cDNA sequence was 100% identical to the published partial amino
acid sequence for purified pig CD59 (10), thus confirming that the
sequence was correct. This sequence was then used to design primers to
PCR amplify the 3' and 5' ends (primers summarized in Fig. 1). The 5' RACE produced a strong 300-bp
PCR product that hybridized on a Southern blot with a probe derived
from the 200 bp of known sequence. This was cloned, sequenced, and
confirmed to contain the 5' end of the cDNA. 3' RACE produced four PCR
products of 
350 bp, 500 bp, 1 kb, and 1.3 kb, all of which
hybridized on a Southern blot with the 200-bp probe. The 350- and
500-bp products were cloned and sequenced, and were confirmed to
contain the 3' end of pig CD59, differing only in the length of the 3'
UTR. The longer products were not analyzed further, but are likely to
represent yet longer transcripts of pig CD59.
Reverse-transcriptase PCR of the full-length cDNA for ligation
into the expression vector produced a single 629-bp product. After
ligation and electroporation, 12 clones were picked, and the plasmids
were purified and sequenced. Of these 12 clones, 10 gave the identical
sequence, the other two differing by one or two bases. This full-length
cDNA sequence is shown in Figure 2. The
sequence encodes a 84-bp 5' UTR, a 26-amino-acid
NH2-signal peptide, and a 98-amino-acid coding region,
including two putative N-glycosylation sites at N-18 and
N-71 and a GPI-anchoring signal. The predicted site of GPI anchor
addition, based upon the consensus requirements for anchor addition
(38), was at S-73. The mature protein sequence is 48% identical to
human CD59, 46.5% identical to rat CD59, and 38% identical to murine
CD59. A comparison of the sequences of the various CD59 analogues is
shown in Figure 3.
|
|
;
two faint bands of 0.8 and 3 kb were consistently seen
on a longer exposure. The 3' UTR of the longer of the sequenced clones
was 312 bp, which correlates with the 0.8-kb mRNA species, but Northern
blot analysis demonstrated that mRNA species with even longer 3' UTR
were also present (Fig. 4). Northern analysis was also performed on
total RNA freshly extracted from pig tissues (Fig. 4). Expression of
pig CD59 was found in all tissues, albeit at different levels.
Expression was highest in lung and spleen and was low in liver and
skeletal muscle. The relative expression of the two major bands at 1.8
and 1.3 kb also varied between tissues, lung expressing similar amounts
of the two, spleen expressing more of the larger band, while testis,
cardiac, and skeletal muscle expressed almost none of the lower band.
Probing for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) confirmed
that similar amounts of RNA had been loaded for all tissues, with the
exception of lung, where less RNA was loaded.
|
Stable populations of U937 cells expressing pig or human CD59 were
generated, as discussed in Materials and Methods. The
pDR
EF1 vector was chosen because it is reported to give
comparable levels of expression of different cDNAs in a given cell type
(13, 36, 37). It was therefore anticipated that similar levels of
expression of human and pig CD59 would be acheived. Expression was
confirmed using the mAb BRIC229 (IgG2b) for human CD59, and a new mAb
raised against pig erythrocytes and conclusively shown to recognize pig
CD59 (MEL-2, IgG1; Hanna et al., in preparation). Uniform high level
expression was obtained for both proteins (Fig. 5). Neither of the mAbs recognized vector
control cells, BRIC229 was negative on pig CD59-transfected cells, and
MEL-2 was negative on human CD59-transfected cells. Although precise
comparison of expression based upon staining with different reagents is
not possible, the data suggest that pig CD59 and human CD59 were
expressed at similar levels. Expression of pig CD59 on transfected U937
cells was sixfold that of endogenous CD59 on the endothelial cell line
PLECT, as assessed by flow cytometry (data not included). We have shown
previously that expression of human CD59 on U937 cells using this
vector was approximately 10-fold higher than levels obtained on cells
endogenously expressing the protein (endothelial cells and K562 cell
line) (13).
|
A). This decrease in expression following PIPLC
treatment is similar to that of human CD59 expressed on the same cell
type, which decreased in mean cell fluorescence by 65% (Fig. 5B).
Western blotting of pig erythrocyte membranes using two different
anti-pig CD59 mAb (MEL-1 IgM; MEL-2 IgG1) revealed a broad band in
the Mr range of 16 to 22 kDa, and a second
distinct band of 10 kDa, whereas blotting of pig CD59-expressing U937
cell membranes revealed a ladder of bands in the
Mr range of 17 to 23 kDa (Fig. 6). Western blots using isotype-matched
controls for both Abs showed no reactivity with pig erythrocyte
membranes, or pig CD59-expressing U937 cells. With the exception of the
distinct band at 10 kDa in pig E, these patterns closely resemble those
seen for CD59 from other species and represent variable glycosylation
of the CD59 (1, 8, 9, 10). Preliminary data indicate that the 10-kDa band
erythrocyte band represents unglycosylated/deglycosylated CD59. Neither
Ab recognized pig CD59 following reduction, a characteristic common to
all anti-CD59 Abs in all species examined. There was no
cross-reactivity of the anti-pig CD59 mAbs with human CD59 or of
any of the available anti-human CD59 Abs (a panel of 10) with pig
CD59 (data not included).
|
The complement-inhibitory activity of pig CD59 expressed on U937s
was evaluated, and compared with that of expressed human CD59, using a
calcein-AM dye release killing assay. Transfectants expressing pig
CD59, human CD59, or vector alone were Ab sensitized and incubated with
sera from various species at different dilutions. These data are shown
in Figure 7. All sera, except mouse and
sheep, lysed the sensitized vector control cells readily, averaging
80% lysis at a 1/10 dilution. Mouse and sheep sera gave a maximal
lysis of 56 and 67%, respectively, at a dilution of 1/10. Expressed
human CD59 markedly inhibited lysis by human, pig, and sheep
complement, but only moderately inhibited lysis by rodent complement,
as has already been published (11, 13, 15). Expressed pig CD59 showed a
pattern of protection almost identical to that of human CD59 for all
species tested. In particular, pig CD59 and human CD59, expressed at
similar levels in the same cell type, were equally effective at
inhibiting lysis by human complement. The anti-pig CD59 mAb MEL-1
(IgM) blocks function of this molecule. Preincubation of pig
CD59-expressing cells with this Ab effectively eliminated the
protective effect, confirming that inhibition was due to the expressed
pig CD59 (Fig. 7).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). This is similar to the situation for
human CD59, which has five different length transcripts of 0.7, 1.3,
1.9, 2.1, and 5.8 kb, all due to alternative polyadenylation (1, 39, 40, 41). In contrast, only a single CD59 transcript of 1.8 kb has been
identified in rat CD59 (42).
The full cDNA sequence (Fig. 2) contains an 84-bp 5' UTR, a 372-bp
coding region, and a 312-bp 3' UTR. In the 5' UTR, the 22 bp
immediately 5' to the ATG start site is highly homologous between
human, rat, and mouse CD59, but is not conserved in the pig CD59
sequence. The Kozak sequence (A/GNNATG),
recognized by ribosomes as the translational start site and thus
required for protein expression, is present within the pig CD59 5' UTR
sequence. The coding region consists of a 26-amino-acid
NH2-signal peptide, with leucine known to be the first
residue of the mature protein sequence from the published amino acid
sequence (10). Based on the consensus sequence for a GPI-anchor
addition signal (38), it is predicted that the COOH-terminal 25 amino
acids will be cleaved and a preformed GPI anchor attached to
Ser73. The resulting 73-amino-acid mature protein is 48%
identical to human CD59, 46.5% identical to rat CD59, and 38%
identical to murine CD59 at the amino acid level. There are two
potential N-glycosylation sites in the pig CD59 sequence, at
Asn-18 and Asn-71. The former site has previously been shown by protein
sequencing to be occupied (10); it is unlikely that the latter site is
occupied due to its close proximity to the GPI attachment site, and
thus the membrane.
It has been demonstrated by structural analysis of human CD59
that the 12 amino acids at the C terminus, following residue
Cys64, have no defined structure and act like a stalk,
giving mobility to the molecule (43). The predicted GPI attachment site
in pig CD59 is at Ser73. The stalk of pig CD59 is thus only
seven amino acids in length, the same length as that of mouse CD59, but
five amino acids shorter than that of human CD59, and seven amino acids
shorter than that of rat CD59. We have suggested previously that the
short stalk of murine CD59 is responsible for the inefficient release
of the molecule by PIPLC (13). Pig CD59 expressed on U937 is released
efficiently by PIPLC treatment, although not to the same extent as
human CD59 expressed on the same cell (Fig. 5). This indicates that the
length of stalk has relatively little effect on the accessibility of
the GPI anchor to the PIPLC enzyme.
Pig CD59 was stably expressed in the CD59-negative human cell line
U937. Western blotting showed that the expressed pig CD59 protein was
of the predicted m.w. and was glycosylated in a manner similar to that
of human CD59 (Fig. 6). Of interest was the presence in fresh pig
erythrocyte membranes of an additional form of CD59 of m.w. 10 kDa. We
suggest that this form represents unglycosylated or deglycosylated
CD59. We have previously observed the presence of small amounts of
deglycosylated CD59 on erythrocytes in other species, particularly
after prolonged storage at 4°C. The abundance of this form on fresh
pig erythrocytes suggests that the protein may be more susceptible to
deglycosylation in vivo than CD59 in other species.
U937 cells stably expressing either pig or human CD59 showed a
single homogeneous population of high expressors by flow cytometry
using appropriate mAbs. This homogeneity of expression is mediated by
the elongation factor 1 promotor in the pDREF1 expression
vector, which has previously been shown to vary little in its
expression levels in a given cell (13, 37, 44). Although it is not
possible to compare the relative amounts of expression of two different
transfected molecules using Abs that will differ in affinities, the use
of the pDREF1 vector ensures that human CD59 and pig CD59 are
expressed at similar levels. It is likely that at the high levels of
expression obtained, any differences in expression will be irrelevant.
For both CD59s, the molecule is hyperexpressed (6- to 10-fold) in
comparison with cells endogenously expressing CD59, mimicking the
situation in transgenic organs.
The expressed pig CD59 inhibited lysis by complement from a variety of
species, as previously reported with CD59 purified from pig
erythrocytes (11). The pattern and extent of inhibition were almost
identical to that obtained with human CD59 expressed in the same cell
line. Both pig and human CD59 were very effective at inhibiting pig,
human, and sheep complement, and less effective at inhibiting rodent
complement (Fig. 7). A similar comparison between mouse and human CD59
hyperexpressed in the same vector/cell model clearly showed the poor
efficiency of mouse CD59 at inhibiting human complement, demonstrating
that the model will reveal species differences where they exist (13).
The data suggest that the residues conferring species selectivity in
human CD59 are well conserved in pig CD59, but less so in rodent CD59s.
In studies of human-rat CD59 chimeras, the region of human CD59 between
residues 40 and 66 has been implicated as conferring species
selectivity between human and rat CD59 (15). Within this region are
several residues conserved between human CD59 and pig CD59, but not
conserved in rat and mouse CD59. Residues Phe47 and
Lys66 (human numbering) are conserved (Ala/Gly and Ala/Phe,
respectively, in rat/mouse) and there are conservative substitutions at
human residues 43 (Glu
Asp), 51 (ThrSer), and 65 (LysArg)
(Ser/Ser, Leu/Met, and Gln/Gln, respectively, in rat/mouse). We
therefore predict that these residues may be important in the species
selectivity of CD59 molecules. Mutagenesis studies to confirm this are
underway.
Expression of CD59 analogues at high levels in a CD59-negative cell line provides a model for the situation in transgenic pigs developed for xenotransplantation, in which human CD59 has been expressed at high levels in certain organs to inhibit the damage during complement attack by human serum (27, 28). Pig CD59 and human CD59, expressed at high levels in the human U937 cell line, inhibit human complement to a similar extent, indicating that in the context of pig-human transplants, overexpression of endogenous pig CD59 may also ameliorate or prevent hyperacute rejection. Whether other pig CRPs are similarly capable of efficiently inhibiting human complement remains to be determined. Pig membrane cofactor protein has recently been isolated from pig erythrocytes in this laboratory and shown to be functionally effective as a cofactor against human complement, inhibiting both the classical and alternative pathways, although the relative efficiencies of human and pig membrane cofactor proteins were not fully addressed (45). Pig decay-accelerating factor remains to be identified and characterized.
The above data provoke us to suggest that in the context of pig-human xenotransplantation, the level of expression of a particular CRP may be more important than the species in providing graft protection. Hence, hyperexpression of endogenous pig CD59, and perhaps other pig CRP in the transplanted organ would provide a similar degree of protection to that conferred by hyperexpression of human CRP in the pig. Hyperexpression of the endogenous inhibitors could be achieved by transgenesis, but there may be alternative ways of achieving this end, for example, by identifying agents that cause a large, sustained up-regulation of CRP expression on donor endothelial cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. B. Paul Morgan, Dept. Medical Biochemistry, University of Wales College of Medicine, Heath Park, Cardiff. CF4 4XX. U.K. E-mail address:
3 Abbreviations used in this paper: GPI, glycosylphosphatidylinositol; CRP, complement-regulatory protein; PIPLC, phosphatidylinositol-specific phospholipase C; RACE, rapid amplification of complementary deoxyribonucleic acid ends; UTR, untranslated region; VBS, veronal buffered saline.
Received for publication September 17, 1997. Accepted for publication December 22, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1,3)Gal epitopes. Proc. Natl. Acad. Sci. USA 90:11391.(1,3)-galactosyltransferase. J. Biol. Chem. 265:7055.This article has been cited by other articles:
|
|
 |
|
  C. Kobayashi, K. Matsunami, T. Omori, S. Nakatsu, K. Nakahata, H. Xu, R. Shirakura, M. Fukuzawa, and S. Miyagawa Features of a Newly Cloned Pig C1 Esterase Inhibitor J. Biochem., September 1, 2006; 140(3): 421 - 427. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Dufour, M. Hamilton, R. V. Rajotte, and G. S. Korbutt Neonatal Porcine Sertoli Cells Inhibit Human Natural Antibody-Mediated Lysis Biol Reprod, May 1, 2005; 72(5): 1224 - 1231. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. van Beek, M. van Meurs, B. A. 't Hart, H. P. M. Brok, J. W. Neal, A. Chatagner, C. L. Harris, N. Omidvar, B. P. Morgan, J. D. Laman, et al. Decay-Accelerating Factor (CD55) Is Expressed by Neurons in Response to Chronic but Not Acute Autoimmune Central Nervous System Inflammation Associated with Complement Activation J. Immunol., February 15, 2005; 174(4): 2353 - 2365. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Cascalho, B. M. Ogle, and J. L. Platt Xenotransplantation and the Future of Renal Replacement J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1106 - 1112. [Full Text] [PDF]
|
|
|
|
|
|
E. LeBouder, J. E. Rey-Nores, N. K. Rushmere, M. Grigorov, S. D. Lawn, M. Affolter, G. E. Griffin, P. Ferrara, E. J. Schiffrin, B. P. Morgan, et al. Soluble Forms of Toll-Like Receptor (TLR)2 Capable of Modulating TLR2 Signaling Are Present in Human Plasma and Breast Milk J. Immunol., December 15, 2003; 171(12): 6680 - 6689. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-M. Qian, X. Qin, T. Miwa, X. Sun, J. A. Halperin, and W.-C. Song Identification and Functional Characterization of a New Gene Encoding the Mouse Terminal Complement Inhibitor CD59 J. Immunol., September 1, 2000; 165(5): 2528 - 2534. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Perez de la Lastra, C. L. Harris, S. J. Hinchliffe, D. S. Holt, N. K. Rushmere, and B. P. Morgan Pigs Express Multiple Forms of Decay-Accelerating Factor (CD55), All of Which Contain Only Three Short Consensus Repeats J. Immunol., September 1, 2000; 165(5): 2563 - 2573. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. P. Dalmasso, B. A. Benson, J. S. Johnson, C. Lancto, and M. S. Abrahamsen Resistance Against the Membrane Attack Complex of Complement Induced in Porcine Endothelial Cells with a Gal{alpha}(1-3)Gal Binding Lectin: Up-Regulation of CD59 Expression J. Immunol., April 1, 2000; 164(7): 3764 - 3773. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-f. Zhang, J. Yu, S. Chen, B. P. Morgan, R. Abagyan, and S. Tomlinson Identification of the Individual Residues That Determine Human CD59 Species Selective Activity J. Biol. Chem., April 16, 1999; 274(16): 10969 - 10974. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Basta, S. M. Knoetig, M. Spagnuolo-Weaver, G. Allan, and K. C. McCullough Modulation of Monocytic Cell Activity and Virus Susceptibility During Differentiation into Macrophages J. Immunol., April 1, 1999; 162(7): 3961 - 3969. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Sun, C. D. Funk, C. Deng, A. Sahu, J. D. Lambris, and W.-C. Song Role of decay-accelerating factor in regulating complement activation on the erythrocyte surface as revealed by gene targeting PNAS, January 19, 1999; 96(2): 628 - 633. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
). The arrow (
) indicates the
predicted GPI anchor addition site (S-73). Pig CD59 GenBank Accession
no. 
, human CD59; 
, pig CD59; 
, pig CD59
with blocking mAb. Points are means of triplicate determinations
± SDs.