The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liberg, D.
Right arrow Articles by Leanderson, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liberg, D.
Right arrow Articles by Leanderson, T.
The Journal of Immunology, 1998, 160: 3899-3907.
Copyright © 1998 by The American Association of Immunologists

Differentiation-Specific, Octamer-Dependent Costimulation of {kappa} Transcription1

David Liberg, Mikael Sigvardsson, Mats Bemark and Tomas Leanderson2

Immunology Group, Department of Cell and Molecular Biology, Lund University, Lund, Sweden


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
By mutational analysis of the octamer-TATA box intervening region in the mouse SP6 {kappa} promoter, we have mapped two octamer-dependent, costimulatory regions, A and B. The A region was active in late B cells only, while the B region was active throughout B cell differentiation. The B region was TATA proximal and contained a heptamer and an E box of the E2A type that is common in V{kappa} promoters. Mutation of the heptamer element did not decrease transcriptional stimulation from this region, but mutations in, or immediately 5' of, the E box core sequence did. A protein binding to this region could be detected in nuclear extracts. The complex could only partially be competed with a µE5 binding site and could not be supershifted with Abs raised to E2A gene products, indicating that it may represent a novel E-box binding complex. The A region was located proximal to the octamer and contained a CCCT element that is conserved both with regard to position and sequence in human V{kappa}II promoters. By mutational analysis, the transcriptional stimulatory activity was mapped to the CCCT element that also is part of an early B cell factor (EBF) binding site. In late B cells, a novel protein (FA), which did not bind to the EBF binding site in the mb1 promoter, interacted with the A region. This protein was found to be expressed at lower levels in early B cells as well as in HeLa cells. Thus, the octamer-flanking sequence contains positive control elements that may act independently but that differ in the stage of B cell differentiation at which they are active. One of these factors is an example of an ubiquitously expressed transcription factor that participate in differentiation-specific transcriptional activation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Transcription of Ig genes is controlled by lineage as well as by differentiation-specific mechanisms (1, 2, 3, 4, 5, 6). Even though Ig promoters differ in their molecular structure, they fulfill the same function with equal efficiency once rearranged. One important element in this transcriptional control is the octamer (7), which interacts with the Oct family of transcription factors (8). The octamer motif is present in all Ig promoters (9), as well as in promoters regulating transcription of non-B cell-specific genes (10, 11). B cell-restricted expression has been suggested to be dependent on the presence of B cell-restricted Oct-binding cofactors (12, 13, 14). A minimal promoter containing an octamer alone suffices for lymphoid-restricted transcriptional stimulation (4), and mutation of the octamer silences the transcription initiated from an Ig promoter (15, 16). The octamer element alone, however, is not sufficient to stimulate a high transcriptional activation from an Ig promoter (15, 16). For this to be achieved, additional elements are needed that are inactive as transcriptional stimulatory elements by themselves but nevertheless increase octamer-induced transcription (15, 16). Thus, Ig promoters are built up around a central octamer supported by octamer-dependent transcriptional control elements, resulting in their unique functional characteristics.

Ig promoters show sequence divergence at the level of heavy chain vs light chain promoters as well as between different {kappa} promoters. The V{kappa} regions in mouse and man can be divided into subgroups (human) or families (mouse) based on sequence similarities in the coding region (17, 18) However, this similarity extends further upstream for ~200 base pairs 5' of the transcription start site, into the promoter region (9, 17). Hence, within a subgroup/family, sequence elements in addition to the octamer are conserved. The SP6 {kappa} promoter contains most of the DNA elements that have been shown to be involved in transcriptional stimulation in {kappa} promoters (4, 15, 19, 20). In the region 5' of the octamer, a {kappa}-Y site is found that has been shown to interact mainly with PU.1 and Elf-1 (20, 21, 22). In addition, a pentadecamer (pd)3 element (7) is present that binds proteins at two independent sites (5). The region 3' of the octamer has also been shown to contain a positive control element centering around a CCCT core (19) that resembles a binding site for either early B cell factor (EBF) (23), AP2 (24), or Ikaros (25). In addition, an E2A E-box motif (26) and a heptamer motif are present in this region (15, 27). The current investigation focuses on the analysis of this 3' region and its role in the control of {kappa} transcription during B cell differentiation.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Transient transfections

DEAE-mediated transient transfections were performed essentially as described (19), and all experiments were repeated at least three times. In brief, splenic B cells were preactivated for 48 h by the addition 25 µg/ml LPS (Escherichia coli 055:B5, Difco, Detroit, MI) whereafter the activated cells were isolated by Ficoll (Pharmacia, Uppsala, Sweden) separation. Cells (1 x 107) were transfected with 15 µg of plasmid DNA for 45 min in 20°C and recultured for 48 h before analysis. After harvesting, protein extracts were prepared and tested for chloramphenicol-acetyl-transferase (CAT) activity by incubation with 50 nCi 14C-labeled chloramphenicol (Amersham, Life Sciences, Little Chalfont, U.K.) and 65 µg of acetyl-coenzyme A (Sigma Chemical, St. Louis, MO). The acetylated products were separated by TLC, and the silica plates were exposed to x-ray film and Fuji Bas 3 imaging plates. Quantitation was made using a Fujix BAS 2000, and the CAT conversion was calculated by dividing the counts in the acetylated forms with the total counts in each lane. In all figures, the CAT conversion is shown relative to the octamer alone (labeled 8), with no conversion exceeding 20%. A similar protocol was used for the different cell lines in which 2.5 x 106 cells were used for each transfection. Spleen cells were grown in Iscove’s modified Dulbecco’s medium supplemented with 7.5% FCS, and cell lines were grown in RPMI with 7.5% FCS. Cell lines used for transient transfections were HeLa cells, the pre-B cell line 230-238 (28), the B cell lymphoma K46R (29), and the plasmacytoma cell line S194 (20).

Nuclear extracts and electrophoretic mobility shift assay (EMSA)

Nuclear extracts were made according to Schreiber et al. (30) from splenic cells that had been activated with LPS or LPS + anti-Ig for 72 h, from the cell lines indicated above, and from the B cell lymphoma WEHI 231 (31). Protein was mixed with 1 µg poly(dI-dC) (Pharmacia) in binding buffer (20 mM phosphate buffer pH 6.0, 10 mM MgCl2, 0.1 mM EDTA, 2 mM DTT, 0.01% Nonidet P-40, 0.1 mM NaCl, 100 µg/ml BSA, and 4% Ficoll) and incubated for 5 min at room temperature. Competitors or anti-E47 Abs (1 µl; Santa Cruz sc-763 X, Santa Cruz Biotechnology, Santa Cruz, CA) were mixed with the other components and preincubated at 37°C for 10 min after which 20,000 cpm 32P-labeled probe was added and the samples incubated at 37° for an additional 25 min. Samples were separated on a 5% PAGE-TBE gel. The gels were then fixed, dried, and autoradiographed. The sequences of probes and competitors, if not indicated in the figures, were as follows: EBF/mb1, 5'-GAGAGAGACTCAAGGGAATTGTGG-3'; AP2/SV40, 5'-GTGGAAAGTCCCCAGGCTCCCCAGCA-3'; IK/TdT, 5'-GAGACATTCCTTC AGCAGGAGGAAGTTGT-3'; B, 5'- ATCTCAAGCCAGCACAGCTGCTCATGAT CTAGGTC-3'; B Em, 5'-ATCTCAAGCCAGCACCGCTGCTCATGATCTAGGTC-3'; pd, 5'-TACTCTCAAACAGCTGTGTAATTTACTTCC-3'; pdEm, 5'-TACTCTC AAACAGCTGTGTAATTTACTTCC-3'; µE5, 5'-TCTGCTGCAGGTGTTCTGTC T-3'.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Two transcriptional stimulatory elements are present in the region between the octamer and TATA box of the SP6 {kappa} promoter

In this study, we aimed at defining the functional characteristics of the octamer-TATA box intervening sequence in the SP6 {kappa} promoter with the rationale that this region contains elements conserved in {kappa} promoters, primarily the human V{kappa}II subgroup promoters and corresponding mouse V{kappa} families (9, 17). To this end, we made reporter constructs containing minimal promoters with the octamer only (labeled 8; note that this octamer also contained the 3' flanking nucleotides that increase the affinity for Oct proteins (32)), the octamer and the complete octamer-TATA intervening sequence (8 AB), and the octamer and the upstream (8 A), downstream (8 B), or middle (8 C) part of the octamer-TATA intervening sequence (Fig. 1GoA). As negative controls, we used constructs containing the complete octamer-TATA intervening sequence and a mutated octamer (8m AB), and a construct containing a TATA-only promoter (TATA). The intact SP6 {kappa} promoter ({kappa}) served as positive control. The reporter gene used was the CAT gene, and all of the constructs contained an Ig heavy chain (IgH) intron enhancer in a 3' position (33).



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 1. A, Schematic figure of the SP6 {kappa} promoter. The indicated part was cloned in front of the CAT reporter gene. The A, B, and C regions were analyzed for costimulatory activity. B, Relative CAT conversions resulting from transient transfections of the indicated constructs into LPS-stimulated spleen cells. The promoter sequences of the constructs are shown; the wild-type sequence is indicated by capital letters and the introduced mutations with lower-case letters.

 
The constructs were transfected into LPS-stimulated murine splenic B cells; the result of this analysis is shown in Figure 1GoB. The activity of the 8-construct has been given a value of 1 to facilitate comparison. Using the octamer as well as the octamer-TATA intervening sequence from the SP6 {kappa} promoter (8 AB) increased transcription fivefold. It should be noted that this activity is still less than half of that observed with the intact SP6 {kappa} promoter, the remaining activity being due to elements located 5' of the octamer (5, 16, 22). When the octamer was mutated (8 m AB), the CAT activity was at the level seen with a promoter containing only a TATA-box, illustrating the dependence of the octamer element for positive transcriptional stimulation by the octamer-TATA intervening sequence (16). When the octamer-TATA intervening region was further dissected, the 8 A and 8 B constructs were shown to induce transcription at a higher level than the octamer alone (Fig. 1GoB). The observed activity was 80 or 75%, respectively, of that seen when both regions were present. The 8 C construct did not increase transcription over the value obtained with the promoter containing the octamer only. We conclude from this analysis that the octamer-TATA intervening sequence of the SP6 {kappa} promoter contained at least two distinct positive control elements, one in the A and one in the B region.

Analysis of the B region

Subsequently, the functional activity of the B region was analyzed by mutational analysis and transfection into LPS stimulated mouse splenic B cells (Fig. 2Go). The B region contained two previously described motifs; an E-box core motif (CANNTG) (26) and a heptamer sequence (CTCATGA) (15). Upon mutation of the heptamer (8 Bm1), no reduction of the octamer-dependent transcriptional stimulation from the B region was observed. Extending the mutation into the 3' part of the E-box motif, however, reduced transcriptional stimulation from the B region by 50% (8 Bm2). Furthermore, mutating the B region sequence up to the A immediately 5' of the E-box (8 Bm3) reduced transcriptional stimulation to a similar extent. It should be noted that the mutated sequence in 8 Bm3 did not activate transcription on its own (8 C in Fig. 1Go). Thus, we conclude that the octamer-dependent, transcriptional stimulatory property of the B region centered around the E-box element, but was also influenced by sequences immediately 5' of the E-box core sequence.



View larger version (37K):
[in this window]
[in a new window]
  		FIGURE 2. Resulting CAT conversions from transient transfections of the indicated constructs into LPS-stimulated spleen cells. Mutations from the wild-type promoter sequence are indicated by lower-case letters.

 
We next analyzed whether any specific protein interactions with the B -region could be observed in EMSA. As shown in Figure 3GoA, using a nuclear extract from the K46R B cell line and B region probe, a specific complex (FB) could be detected. A complex with similar mobility has also been observed in EMSA using nuclear extracts from several B cell lines (data not shown). The FB complex could be competed by cold probe (B) and also by a pd element probe from the SP6 {kappa} promoter (pd), which contains a similar E-box element (5). It was not competed by a pd element probe with a single point mutation in the E-box core sequence (pdEm) and only with low efficiency by the µE5 E-box from the Ig heavy chain intron enhancer (µE5). Consistent with the functional data, these findings indicated that the A nucleotide immediately 5' of the E-box as well as the A and 3' C nucleotides central in the E-box core sequence (see Fig. 3GoB) were important for the specific binding of FB. To further adress the molecular identity of the FB complex, the µE5 E-box was used as a probe. A complex of similar mobility to FB (FB') could be observed with this probe, as could also another complex of lower mobility; only the latter could be supershifted with anti-E47 Abs. Thus, the B region E-box interacted preferentially with a protein complex, FB, that did not contain an E2A gene product. To further illustrate the subtle differences in protein binding, the pd element E-box (5) and the µE5 E-box were used as probes in EMSA and competed in parallel with the same competitors as the FB complex. As shown in Figure 3GoB, the µE5 competitor competed less efficiently with the pd probe, while the B region competitor competed as efficiently as the unlabeled pd probe for binding. Thus, the pd element and the B region may interact with the same protein.



View larger version (58K):
[in this window]
[in a new window]
  		FIGURE 3. A, EMSAs with nuclear extract from K46R cells, indicated probes, and competitors (the sequences of competitors are shown in Materials and Methods). Anti-E47 or competitors were added to probe at 100- or 1000-fold excess. *, Indicates a nonspecific band. B, EMSAs with K46R nuclear extract, indicated probes, and competitors.

 
Analysis of the A region

We next analyzed the transcriptional activity of the A region by a similar strategy (Fig. 4GoA). The 8 A and 8 m A constructs were included as controls, showing the activation mediated by the intact A region and the octamer dependency of the activity, respectively. The first mutant analyzed (8 Am1) was mutated in the CCCT element previously shown to be important for {kappa} transcription (19), which also is conserved in human V{kappa}II subgroup promoters (17). In addition, this element has previously been shown to be a binding site for EBF (34). This mutation abolished the transcriptional stimulatory effect of the A region, as did the mutation introduced in the 8 Am2 construct in which only four bases of the A region were conserved immediately 3' of the octamer. Furthermore, mutating the two most octamer-distal nucleotides of the A region (8 Am3) reduced the activity of the A region by 50%. Thus, by functional analysis the transcriptional stimulatory activity of the A region maps to the whole 3' part of the region, and the central CCCT element seems to be critical.



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 4. A, Relative CAT conversions resulting from transient transfections of the indicated constructs into LPS-stimulated spleen cells. Mutations from the wild-type promoter sequence are indicated by lower-case letters. B, EMSAs with nuclear extract from LPS-stimulated spleen cells, A region probe, and indicated competitors (the sequences of competitors are shown in this figure or in Materials and Methods; the competitors were added to probe at 250-, 500-, or 1000-fold excess). *, Indicates a nonspecific band.

 
As mentioned above, the cell population used for transfection analysis is highly differentiated and expresses J-chain but not EBF or Ikaros (Refs. 35–38, and data not shown). Another interacting protein has been observed in EMSA using S194 plasmacytoma extracts and A region probe (34). To further analyze the protein interaction with the A region, we made EMSAs with a probe containing the A region and extract from LPS-stimulated splenic B cells (Fig. 4GoB). A distinct complex (FA) was observed that could be competed by cold probe, while another unspecific complex (*) that was also detected in the EMSAs was not competed with a specific probe and varied in intensity between experiments. The FA complex has previously been observed and has been referred to as B cell factor (BF) (34). The 8 Am3 sequence competed partially for FA complex formation, while 8 Am1 and 8 Am2 did not compete, in agreement with the functional data shown in Figure 4GoA. Furthermore, the EBF site from the mb1 gene (36) could not compete for FA binding.

We next analyzed whether the FA complex was ubiquitously expressed; as shown in Figure 5GoA, a complex of the same mobility and specificity could also be seen in HeLa cell nuclear extracts. Finally, the similarity between the A region sequence and the described binding motifs for Ikaros and AP-2 prompted us to investigate whether the AP-2 site from the SV40 enhancer (39) or the TdT Ikaros motif (37) would compete for FA binding. As shown in Figure 5GoB, this was not the case. We conclude from this analysis that an ubiquitously expressed protein interacts with the A region in late B cells. Its binding characteristics correlate favorably with the functional analysis of the same region.



View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 5. A, EMSAs with nuclear extract from HeLa cells or LPS-stimulated spleen cells, A region probe and indicated competitors added at 250-, 500-, or 1000-fold excess to probe. *, Indicates a nonspecific band; see also Figure 4Go. B, EMSAs with nuclear extract from LPS-stimulated spleen cells, A region probe and indicated competitors added at 500- or 1000-fold excess to probe (sequences shown in Materials and Methods).

 
The functional activity of the A region but not the B region is differentiation restricted

The transcription rate of Ig genes is up-regulated during B cell differentiation in untransformed B cells (6, 40); we had previously noted that the activity of the A region might be restricted to late B cells (34). We thus investigated whether the activity of the octamer-dependent control elements in the A and B regions were restricted to certain stages of B cell differentiation. To this end, the 8, 8 A, and 8 B constructs were transfected into cell lines that represent different stages of B cell differentiation as depicted in Figure 6GoA. The 8 B promoter construct was more efficiently expressed than the 8 control construct in all cell lines tested (Fig. 6GoA). On the contrary, the 8 A promoter stimulated transcription equally to the 8 construct in the pre-B cell line 230-238 and in the B cell lymphoma K46R. However, 8 A was more efficient than 8 after transfection into the S194 plasmacytoma cell line and LPS stimulated splenic B cells. We conclude that the positive transcriptional control element in the B region is active throughout B cell differentiation, while the activity of the element in the A region is more active in B cells with a late, secretory phenotype.



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 6. A, Resulting CAT conversions when the indicated constructs were transfected into LPS-stimulated spleen cells or the cell lines 230–238, K46R, and S194. B, EMSAs with nuclear extracts from the indicated cell types. In the left panel, the octamer site was used as probe, while the A region was used in the right panel. *, Indicates a nonspecific band.

 
This result prompted us to investigate whether the levels of the A region-binding FA complex varied during B cell differentiation. Thus, nuclear extracts were prepared from the pre-B cell line 230-238, B cell lymphomas WEHI 231 and K46R, and plasmacytoma S194. Nuclear extracts were also prepared from splenic B cells stimulated with LPS for 72 h and from parallel cultures in which anti-Ig Abs had been added in addition to LPS. The addition of anti-Ig to LPS cultures inhibits differentiation to Ig secretion of these cells, as monitored by the increased transcription rate of the Ig loci or induction of J-chain expression (6, 35, 40). The probes used were an octamer probe, 8, to standardize the extracts, and the 8 m A probe used above. Furthermore, the EMSA reactions were performed without Zn2+ to avoid interference from EBF and Ikaros (25, 38), which are expressed in all of the nonsecretory B cell populations. As shown in Figure 6GoB, the FA protein was expressed throughout B cell differentiation, although the levels tended to be higher in B cells with a secretory phenotype, represented here by the S194 plasmacytoma and LPS-stimulated splenic B cells. Thus, the FA protein is also expressed in B cell lines in which the A region is functionally inactive, albeit at lower levels.

The question can be raised from the experiments described above as to whether the quantitative change in FA expression seen during plasma cell differentiation is not impressive enough to explain the differentiation-specific activity of this site. An alternative, but not mutually exclusive, hypothesis would be that EBF exerts a negative effect on {kappa} transcription (41). In Figure 7Go, we illustrate the coexpression of FA and EBF in the pre-B cell line 230-238 (panel A) and the exclusive expression of FA in LPS-stimulated splenic B cells (panel B). At low Zn2+ concentrations, only FA can be seen to interact with the A region in 230-238 cells, while at higher Zn2+ concentrations, EBF binds to a similar extent (Fig. 7GoA). Thus, a competitive situation for A region binding exist under these conditions. In extracts from LPS-stimulated splenic B cells, only FA binding can be observed independently of Zn2+ concentration (Fig. 7GoB), and hence no competition for A region binding exist in these cells. With regard to the mechanism of EBF inhibition, a simplistic model could be that it is due to steric hindrance of Oct binding (Fig. 7Go). The {kappa} promoter function is strictly dependent on the octamer element (15). If EBF would interfere with Oct protein-binding to the octamer, while the smaller FA complex would not, a down-regulation of {kappa} expression in B cells expressing EBF could be expected.



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 7. A, Hypothetical model of A region occupancy in nonplasma cells. EMSA showing EBF and FA interaction with the A region in 230-238 cell line nuclear extract. Zn2+ was included at 0, 0.07, or 0.7 mM concentration. B, Hypothetical model of A region occupancy in plasma cells. EMSA showing interaction with the A region in nuclear extract from LPS-stimulated spleen cells. Zn2+ was added as described above.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
This report characterizes two octamer-dependent transcriptional control elements. One involved a pyrimidine-rich region proximal to the octamer element (A region), while the other element contained an E-box and was located closer to the TATA box (B region). Both regions are of particular interest. The A region is conserved in promoters from the human V{kappa}II subgroup and its corresponding mouse V{kappa} families, and E-boxes are frequently observed in human and mouse {kappa} promoters (9, 17).

One octamer-dependent control element was found in the TATA box-proximal B region. In this region, a heptamer and an E2A-like E-box motif are present, but only mutations in or upstream of the E-box were of functional significance. The heptamer is a long distance from and in the wrong direction relative to the octamer, which has been shown to impair Oct dimerization (42). The activity of the B region was not differentiation restricted but supported octamer-induced transcription throughout B cell differentiation. The E-box variant, CAGCTG, can be found in a majority of human {kappa} promoters (17) and is in agreement with the core binding motif for E2A transcription factors (CAGNTG (43)). A protein complex, FB, was shown to interact with the B region in EMSA. Interestingly, the µE5 E-box competed only weakly for FB binding, and FB could not be supershifted with an anti-E2A Ab. On the other hand, a pd element competitor competed for FB binding, and the B region competed for pdMMW binding. Thus, the E-boxes of the SP6 {kappa} promoter did not seem to interact with products of the E2A gene but rather with a distinct protein complex. The question whether pdMMW and FB are identical as well as the details concerning the structure and properties of these protein complexes, need to be further investigated.

The octamer-proximal A region contained a CCCT core element previously described as a positive control element in {kappa} transcription (19). In this study, we show that the A region increased octamer-induced transcription, but only in B cells with a late, plasma cell-like phenotype. The structure of the A region makes it a potential binding site for EBF, Ikaros, or AP2 (24, 37, 38) depending on the flanking sequences surrounding the site. Here, we show that an additional factor, FA, binds to the same region. The binding of FA to the A region could not be competed by the mb1 EBF site, the TdT Ikaros site, or the AP2 site from the SV40 enhancer. FA seems to be expressed in all B cells but is up-regulated during later stages of B lymphocyte differentiation. Furthermore, FA can be detected in nuclear extracts made from HeLa cells, and we therefore assume that it is ubiquitously expressed.

We have previously shown that EBF and another protein (BF, here renamed FA) can bind to the A region (34). In this article, we show that the binding of FA was dependent on the CCCT core, but also to a certain degree, on more distal sequences involving two G residues located three base pair 3' of the CCCT core. The pattern of FA binding to the various A region mutants correlated favorably with the functional properties of the same mutants. The FA binding resembles the binding of EBF, which involves both the CCCT and at least one of the G residues when bound to this site (34); but since the binding of FA could not be competed with the mb1 EBF site, the binding specificities of the two factors differ. In addition, FA binds to the A region also in the absence of Zn2+. The functional activity of the A region was restricted to late B cells in which EBF is not expressed. It may seem like a paradox that an ubiquitously expressed protein controls differentiation-specific transcription within a distinct lineage. One can argue that the modest up-regulation of FA expression in late B cells correlates with a positive control function of {kappa} transcription. On the other hand, EBF may exert a negative control on {kappa} transcription by competing for the same binding site as FA (Fig. 7Go; Refs. 34 and 41). The detailed analysis of the properties of FA binding and its interactions with Oct proteins and EBF has to await its biochemical identification.

It is interesting to note that when a sequence comparison is performed, the differentiation-specific A region element is present in the V{kappa}II subgroup of human {kappa} promoters (9, 17). V{kappa}I promoters, which represent another major V{kappa} subgroup in humans, invariably have a pd element 5' of the octamer (17) that acts synergistically with the octamer, preferentially in late B cells (5). Thus, in humans, V{kappa} promoters that contain the differentiation-restricted A region element do not contain a pd element with the same type of restricted activity and vice versa (32). The most obvious function for the octamer-dependent positive control elements is to correct the functional activity of low affinity octamers and to support octamer-induced transcriptional activation in late B cells, in which Ig expression should be maximized. The distribution of the elements into different families and the activity of the B region in early B cell lines, however, could mean that these elements also have a function early in B cell ontogeny, for example, regulating the rearrangement of V{kappa} genes. Should such a function be the case, it follows that the rearrangement pattern between human and mouse V{kappa} genes would differ; one can hypothesize that in the mouse a regulatory step at this level is less important, since the mouse appears to have several more functional V{kappa} genes than humans (44). Finally, one may note that the functional consequence of a mutation in one of the elements described here has a rather limited effect on functional activity of the intact promoter, since each promoter contains more than one element. The presence and redundancy of octamer-dependent positive control elements in {kappa} promoters explain why structurally different promoters can have identical functional activity and would support the argument that function rather than particular sequence motifs have been conserved during their evolution.


   Acknowledgments
 
We thank Eva Miller for excellent technical assistance and I.-L. Mårtensson for critical reading of the manuscript.


   Footnotes
 
1 This work was supported by the Swedish Cancer Foundation, the Swedish Medical Research Council, the Österlund Foundation, and the Kocks Foundation. Back

2 Address correspondence and reprint requests to Dr. Tomas Leanderson, Immunology Group, CMB, Lund University, Box 7031, S-220 07 Lund, Sweden. E-mail address: Back

3 Abbreviations used in this paper: pd, pentadecamer; EBF, early B cell factor; EMSA, electrophoretic mobility shift assay; CAT, chloramphenicol- acetyl-transferase. Back

Received for publication August 27, 1997. Accepted for publication December 17, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Foster, J., J. Stafford, C. Queen. 1985. An immunoglobulin promoter displays cell-type specificity independently of the enhancer. Nature 315:423.[Medline]
  2. Bergman, Y., D. Rice, R. Grosschedl, D. Baltimore. 1984. Two regulatory elements for immunoglobulin kappa light chain gene expression. Proc. Natl. Acad. Sci. USA 81:7041.[Abstract/Free Full Text]
  3. Picard, D., W. Schaffner. 1985. Cell-type preference of immunoglobulin kappa and lambda gene promoters. EMBO J. 4:2831.[Medline]
  4. Wirth, T., L. Staudt, D. Baltimore. 1987. An octamer oligonucleotide upstream of a TATA motif is sufficient for lymphoid-specific promoter activity. Nature 329:174.[Medline]
  5. Sigvardsson, M., M. Bemark, T. Leanderson. 1995. Pentadecamer-binding proteins: definition of two independent protein-binding sites needed for functional activity. Mol. Cell. Biol. 15:1343.[Abstract]
  6. Högbom, E., I. L. Mårtensson, T. Leanderson. 1987. Regulation of immunoglobulin transcription rates and mRNA processing in proliferating normal B lymphocytes by activators of protein kinase C. Proc. Natl. Acad. Sci. USA 84:9135.[Abstract/Free Full Text]
  7. Falkner, F. G., H. G. Zachau. 1984. Correct transcription of an immunoglobulin kappa gene requires an upstream fragment containing conserved sequence elements. Nature 310:71.[Medline]
  8. Verrijzer, C. P., P. C. van der Vliet. 1993. POU domain transcription factors. Biochim. Biophys. Acta 1173:1.[Medline]
  9. Bemark, M., D. Liberg, T. Leanderson. 1998. Conserved sequence elements in {kappa} promoters from mice and humans: Implications for transcriptional regulation and repertoire expression. Immunomagnetics 47:183.
  10. Mattaj, I. W., S. Lienhard, J. Jiricny, E. M. De Robertis. 1985. An enhancer-like sequence within the Xenopus U2 gene promoter facilitates the formation of stable transcription complexes. Nature 316:163.[Medline]
  11. Sive, H. L., R. G. Roeder. 1986. Interaction of a common factor with conserved promoter and enhancer sequences in histone H2B, immunoglobulin, and U2 small nuclear RNA (snRNA) genes. Proc. Natl. Acad. Sci. USA 83:6382.[Abstract/Free Full Text]
  12. Luo, Y., H. Fujii, T. Gerster, R. G. Roeder. 1992. A novel B cell-derived coactivator potentiates the activation of immunoglobulin promoters by octamer-binding transcription factors. Cell 71:231.[Medline]
  13. Gstaiger, M., L. Knoepfel, O. Georgiev, W. Schaffner, C. M. Hovens. 1995. A B-cell coactivator of octamer-binding transcription factors. Nature 373:360.[Medline]
  14. Strubin, M., J. W. Newell, P. Matthias. 1995. OBF-1, a novel B cell-specific coactivator that stimulates immunoglobulin promoter activity through association with octamer-binding proteins. Cell 80:497.[Medline]
  15. Eaton, S., K. Calame. 1987. Multiple DNA sequence elements are necessary for the function of an immunoglobulin heavy chain promoter. Proc. Natl. Acad. Sci. USA 84:7634.[Abstract/Free Full Text]
  16. Sigvardsson, M., M. Bemark, T. Leanderson. 1995. Stimulation of kappa transcription by a decamer-dependent, synergistic mechanism. Eur. J. Immunol. 25:298.[Medline]
  17. Schäble, K. F., H. G. Zachau. 1993. The variable genes of the human immunoglobulin kappa locus. Biol. Chem. Hoppe Seyler 374:1001.[Medline]
  18. Strohal, R., A. Helmberg, G. Kroemer, R. Kofler. 1989. Mouse V{kappa} gene classification by nucleic acid sequence similarity. Immunogenetics 30:475.[Medline]
  19. Högbom, E., A. C. Magnusson, T. Leanderson. 1991. Functional modularity in the SP6 kappa promoter. Nucleic Acids Res. 19:4347.[Abstract/Free Full Text]
  20. Atchison, M. L., V. Delmas, R. P. Perry. 1990. A novel upstream element compensates for an ineffectual octamer motif in an immunoglobulin V kappa promoter. EMBO J. 9:3109.[Medline]
  21. Schwarzenbach, H., J. W. Newell, P. Matthias. 1995. Involvement of the Ets family factor PU.1 in the activation of immunoglobulin promoters. J. Biol. Chem. 270:898.[Abstract/Free Full Text]
  22. Bemark, M., T. Leanderson. 1997. Diverse transcription factors are involved in the quantitative regulation of transcriptional activation of kappa promoters. Eur. J. Immunol. 27:1308.[Medline]
  23. Travis, A., J. Hagman, L. Hwang, R. Grosschedl. 1993. Purification of early-B- cell factor and characterization of its DNA- binding specificity. Mol. Cell. Biol. 13:3392.[Abstract/Free Full Text]
  24. Imagawa, M., R. Chiu, M. Karin. 1987. Transcription factor AP-2 mediates induction by two different signal- transduction pathways: protein kinase C and cAMP. Cell 51:251.[Medline]
  25. Molnar, A., K. Georgopoulos. 1994. The Ikaros gene encodes a family of functionally diverse zinc finger DNA-binding proteins. Mol. Cell. Biol. 14:8292.[Abstract/Free Full Text]
  26. Ephrussi, A., G. M. Church, S. Tonegawa, W. Gilbert. 1985. B lineage-specific interactions of an immunoglobulin enhancer with cellular factors in vivo. Science 227:134.[Abstract/Free Full Text]
  27. Poellinger, L., R. G. Roeder. 1989. Octamer transcription factors 1 and 2 each bind to two different functional elements in the immunoglobulin heavy-chain promoter. Mol. Cell. Biol. 9:747.[Abstract/Free Full Text]
  28. Alt, F. W., N. Rosenberg, R. J. Casanova, E. Thomas, D. Baltimore. 1982. Immunoglobulin heavy-chain expression and class switching in a murine leukaemia cell line. Nature 296:325.[Medline]
  29. Kim, K. J., C. Kanellopoulos-Langevin, R. M. Merwin, D. H. Sachs, R. Asofsky. 1979. Establishment and characterization of BALB/c lymphoma lines with B cell properties. J. Immunol. 122:549.[Abstract/Free Full Text]
  30. Schreiber, E., P. Matthias, M. M. Muller, W. Schaffner. 1989. Rapid detection of octamer binding proteins with "mini-extracts", prepared from a small number of cells. Nucleic Acids Res. 17:6419.[Free Full Text]
  31. Lanier, L. L., N. L. Warner. 1981. Cell cycle related heterogeneity of Ia antigen expression on a murine B lymphoma cell line: analysis by flow cytometry. J. Immunol. 126:626.[Abstract]
  32. Sigvardsson, M., T. Leanderson. 1994. Positive transcriptional control elements within the SP6 kappa promoter decamer 3' flanking sequence. Mol. Immunol. 31:1005.[Medline]
  33. Bannerji, J., L. Olson, W. Schaffner. 1983. A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes. Cell 3:729.
  34. Sigvardsson, M., P. Å kerblad, T. Leanderson. 1996. Early B cell factor interacts with a subset of kappa promoters. J. Immunol. 156:3788.[Abstract]
  35. Sigvardsson, M., L. Olsson, E. Högbom, T. Leanderson. 1993. Characterization of the joining chain (J-chain) promoter. Scand. J. Immunol. 38:411.[Medline]
  36. Hagman, J., A. Travis, R. Grosschedl. 1991. A novel lineage-specific nuclear factor regulates mb-1 gene transcription at the early stages of B cell differentiation. EMBO J. 10:3409.[Medline]
  37. Georgopoulos, K., D. D. Moore, B. Derfler. 1992. Ikaros, an early lymphoid-specific transcription factor and a putative mediator for T cell commitment. Science 258:808.[Abstract/Free Full Text]
  38. Hagman, J., M. J. Gutch, H. Lin, R. Grosschedl. 1995. EBF contains a novel zinc coordination motif and multiple dimerization and transcriptional activation domains. EMBO J. 14:2907.[Medline]
  39. Banerji, J., L. Olson, W. Schaffner. 1983. A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes. Cell 33:729.[Medline]
  40. Johansson, K., M. Sigvardsson, T. Leanderson. 1994. Transcriptional regulation of immunoglobulin gene expression by anti-Ig. Int. Immunol. 6:41.[Abstract/Free Full Text]
  41. Åkerblad, P., M. Sigvardsson, T. Leanderson. 1996. Early B-cell factor (EBF) down-regulates immunoglobulin heavy chain intron enhancer function in a plasmacytoma cell line. Scand. J. Immunol. 44:89.[Medline]
  42. Landolfi, N. F., X. M. Yin, J. D. Capra, P. W. Tucker. 1988. A conserved heptamer upstream of the IgH promoter region octamer can be the site of a coordinate protein-DNA interaction. Nucleic Acids Res. 16:5503.[Abstract/Free Full Text]
  43. Blackwell, T. K., H. Weintraub. 1990. Differences and similarities in DNA-binding preferences of MyoD and E2A protein complexes revealed by binding site selection. Science 250:1104.[Abstract/Free Full Text]
  44. Kirschbaum, T., R. Jaenichen, H. G. Zachau. 1996. The mouse immunoglobulin kappa locus contains about 140 variable gene segments. Eur. J. Immunol. 26:1613.[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
H. Lindgren, K. Axcrona, and T. Leanderson
Regulation of Transcriptional Activity of the Murine CD40 Ligand Promoter in Response to Signals Through TCR and the Costimulatory Molecules CD28 and CD2
J. Immunol., April 1, 2001; 166(7): 4578 - 4585.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
P. Akerblad, M. Rosberg, T. Leanderson, and M. Sigvardsson
The B29 (Immunoglobulin beta -Chain) Gene Is a Genetic Target for Early B-Cell Factor
Mol. Cell. Biol., January 1, 1999; 19(1): 392 - 401.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liberg, D.
Right arrow Articles by Leanderson, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liberg, D.
Right arrow Articles by Leanderson, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS