The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ross, D. A.
Right arrow Articles by Warr, G. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ross, D. A.
Right arrow Articles by Warr, G. W.
The Journal of Immunology, 1998, 160: 3874-3882.
Copyright © 1998 by The American Association of Immunologists

Characterization of Oct2 from the Channel Catfish: Functional Preference for a Variant Octamer Motif1

David A. Ross*, Bradley G. Magor2,*, Darlene L. Middleton*, Melanie R. Wilson{dagger}, Norman W. Miller{dagger}, L. William Clem{dagger} and Gregory W. Warr3,*

* Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, SC 29425; and {dagger} Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Ig heavy chain enhancer of the channel catfish (Ictalurus punctatus) has an unusual position and structure, being found in the 3' region of the µ gene and containing eight functional octamer motifs of consensus (ATGCAAAT) and variant sequences. The presence of multiple octamer motifs suggests that an Oct2 homologue may play an important role in driving expression of the Ig heavy chain locus in a teleost fish. To test this hypothesis, two catfish Oct2 cDNAs ({alpha} and ß) were cloned by screening a catfish B cell cDNA library. Catfish Oct2 {alpha} and ß isoforms are derived by alternative RNA splicing; as determined by Southern analysis, Oct2 is a single copy gene. In comparisons with mammalian Oct2, the catfish Oct2 isoforms show high sequence conservation in their N-terminal regions and POU domains, but extensive divergence in their C-terminal regions. Catfish Oct2 {alpha} and ß are tissue restricted, bind both consensus and variant octamer motifs, and activate transcription in both catfish and murine cells. In contrast, mouse Oct2 activated transcription in mouse but not catfish cells. Catfish Oct2 ß is a more potent transcriptional activator than Oct2 {alpha}. In transient expression assays, catfish Oct2 ß showed a marked preference for the octamer variant, ATGtAAAT, which occurs twice in the catfish enhancer. Mouse Oct2 also showed increased activity with the variant octamer when tested in mouse B cells. Gel-shift analysis competition assays indicated that catfish Oct2 binds the consensus octamer motif with an apparently higher affinity than it does the variant motif.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Transcriptional control of the Ig heavy chain (IgH)4 genes in mammals by the intronic enhancer (Eµ) appears to involve at least three major mechanisms that drive B cell-specific expression. These include 1) E-box motifs (µE1-5), which are found in both promoters and enhancers, and which associate with transcription factors such as E47 and TFE3; 2) µA ({pi}) and µB sites in the enhancer, which are bound by Ets-family transcription factors (such as ets-1 and PU.1); and 3) octamer motifs, which are found in both the promoter and enhancer regions and are bound by the POU-domain transcription factors (for reviews, see Refs. 1 and 2). Thus, the mechanisms by which mammalian B cells control expression of IgH genes show extensive diversity, and the manner whereby such a complex system evolved is unclear.

Teleosts, such as the channel catfish (Ictalurus punctatus), possess an IgH locus of a similar organizational pattern to that found in mammals (reviewed in 3 . While fish VH, D, and JH segments are similar in number and arrangement to those seen in mammals, one major difference is in the number of the constant region genes in fish. Catfish express primarily IgM-like Abs, and although a homologue of the {delta} gene has recently been described (4), there is no evidence that the fish IgH locus can undergo typical class switching via chromosomal rearrangement. In previous studies of catfish IgH gene expression (5), it was observed that the catfish IgH enhancer (Eµ3') was not only present in a unique position (3' of the µ gene), but it also had an unusual diffuse structure, lacking a defined core region and extending approximately 1.8 kb. The catfish appears to lack functional µA and µB elements, considered essential to the Eµ of mice (5, 6). Although µE3 and µE5 motifs are present in Eµ3', no studies have yet defined their role. Eµ3' contains eight octamer motifs of six different sequences, including the consensus (ATGCAAAT), capable of driving expression in B cells (6). Octamer motifs are found in the regulatory regions of many ubiquitously expressed genes (reviewed in 7 , as well as in elements regulating genes (including Igs) expressed specifically in B cells (8, 9, 10, 11, 12, 13). Despite the structural differences from its mammalian counterparts, the catfish IgH enhancer shows a B cell-specific function even when tested in mouse cells (5). Thus, the catfish IgH enhancer may rely primarily on the octamer motifs, albeit functioning in a different fashion than observed in mammals, particularly in the absence of µA and µB motifs.

The Oct1 (14) and Oct2 (15) transcription factors, of which there are six alternatively spliced Oct2 isoforms (16), play major roles in murine IgH transcription through interactions with the octamer motif and coactivators. Although mouse Oct1 and Oct2 possess a very similar DNA binding (POU) domain, composed of a POU-specific domain and a POU homeodomain connected by a linker region (reviewed in 17 , differences in the activation domains confer different functions on Oct1 and Oct2. Glutamine-rich activation domains capable of activating transcription from a promoter, but not from a remote enhancer, have been identified in the N termini of both Oct1 and Oct2 (18, 19). In addition, Oct2, but not Oct1, has a proline-, serine-, threonine-rich activation domain in the C-terminal region (20). This C-terminal activation domain can activate transcription from a promoter and, with B cell specificity, from a remote enhancer (21, 19). A B cell-specific coactivator, variously called Bob-1, OBF-1, or OCA-B (22, 23, 24, 25, 26), has been shown to associate with the POU-specific domain of Oct1 (27). Although Bob-1 is highly B cell specific, it appears not to be the coactivator capable of mediating octamer-dependent activation from a distant enhancer. Instead, it is believed to act through Oct1 and/or Oct2 bound at the promoter (22, 23, 24).

An important role of the octamer motifs in the catfish IgH enhancer can be inferred from the observation that artificial promoters containing octamer motifs drive strong expression in catfish B cells (6). To date, Oct2 has been reported only in mammals, while Oct1 has also been described in birds and amphibians (28, 29). The studies reported here were undertaken to test the hypothesis that catfish possess a homologue of Oct2 that can act through multiple, variant octamer motifs to drive B cell-specific transcription of the catfish IgH gene.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation and analysis of Oct2 clones

cDNA libraries from the catfish B lymphoblastoid cell line 1B10 (30) and the catfish monocyte-like cell line 42TA (31) were constructed in lambda ZAP II (Stratagene, La Jolla, CA). Approximately 2.5 x 105 plaque-forming units of the 1B10 cDNA library were screened at low stringency with 32P-labeled probes for mouse Oct2 cDNAs (kind gifts of Dr. T. Wirth, University of Würzburg). For the screening of the 42TA cDNA library, the same number of plaque-forming units was screened at high stringency with a 32P-labeled probe for the catfish Oct2 POU domain. Sequences of catfish Oct2 {alpha} and ß (Y12651 and Y12652), mouse Oct2.1 (X57936), human Oct2 (X13810), human Oct1 (X13403), pig Oct1 (L38524), mouse Oct1 (X68363), chicken Oct1 (M29972), frog Oct1 (X57165), and Drosophila dOct2 (M93149) were aligned using the Clustal V program (DNAStar, Madison WI) with PAM 250 residue weight table, gap penalty of 10, and gap-length penalty of 10. The alignment was used to generate most-parsimonious phylogenetic trees (branch swapping, tree bisection reconnection, 100 bootstrap replicates) in the PAUP program (32).

Southern blots

Genomic DNA was isolated from the erythrocytes of two individual fish. Approximately 10 µg of DNA was digested to completion with HindIII, EcoRI, or BamHI and subjected to electrophoresis on a 0.8% agarose gel. Southern blot analysis was performed with a 32P-labeled Oct2 probe (AJ003122), as previously described (30). Blots were then exposed to a storage phosphor screen (Molecular Dynamics, Sunnyvale, CA) for 20 h.

S1 nuclease protection

The sequence of the catfish Oct2 probe was 5'- GTGCTGGCTCCACGTCACCGTTCTTGTGACGCCACGAACCTGTGTTCAGATTTAATGTGTGAGTGGCCGGAACAGGGCTGGCGTCACTGCGAGGAGACGG-3' and of the catfish actin probe 5'-GGGTCACACCATCACCAGAGTCCATCACGATACCAGTGGGCATCAACTC-3'. The actin probe was 5' end-labeled with [{gamma}-32P]ATP (New England Nuclear, Boston, MA), while the Oct2 probe was 3' end-labeled using terminal deoxynucleotidyl-transferase (Life Technologies, Gaithersburg, MD) and [{alpha}-32P]cordycepin (New England Nuclear). Actin and Oct2 probes were hybridized with total RNA at 43°C for 16 to 18 h. The S1 nuclease digestion (S1-Assay Kit; Ambion, Austin, TX) was performed according to the manufacturer’s instructions, with the exception that 250 U of S1 nuclease was used and digestions were conducted at 46°C for 1 h. The protected fragments were resolved on a 12% denaturing polyacrylamide gel, which was then exposed to a storage phosphor screen (Molecular Dynamics) and quantified using the Imagequant program (Molecular Dynamics).

Electromobility shift assays (EMSA) and antisera production

Template DNA for EMSAs consisted of synthesized oligonucleotides containing one copy of the consensus (ATGCAAAT), variant (ATGtAAAT), or mutant (ACAAAATA) octamer motif (octamer motif underlined): 5'-CAATATGAATATGCAAATTACCT-3' and 5'-CATAGGTAATTTGCATATTCATA-3'. Templates were radiolabeled by fill-in with Klenow fragment using [{alpha}-32P]dATP (New England Nuclear; 33 to a sp. act. of 107 to 109 cpm/µg.

Nuclear proteins from each cell line were prepared as described by Riggs et al. (34). EMSA protein-DNA binding reactions contained 20 mM HEPES, 1 mM MgCl2, 0.5 mM DTT (Sigma, St. Louis, MO), 4% Ficoll (Pharmacia, Uppsala, Sweden), 2 µg poly(dI-dC).poly(dI-dC) (Pharmacia), 105 cpm of template (1 to 10 fmol), 3.5 to 5 µg nuclear extract (containing 400 mM NaCl), KCl to a final Na+ plus K+ concentration of approximately 120 mM, and unlabeled competitor template where indicated. Before addition of radiolabeled template, the nuclear extract was allowed to prebind the poly(dI-dC).poly(dI-dC) for 10 min at room temperature. The binding reaction was allowed to proceed for an additional 20 min at room temperature after addition of radiolabeled template and competitor (as necessary). Band supershifting/abrogation was tested by preincubating antisera with nuclear extract for 30 min on ice, before addition of the DNA binding mix. Samples that did not receive rabbit serum contained 0.25 mg/ml (final concentration) of BSA (New England Biolabs, Beverly, MA). The binding reaction was resolved on a 6% (80:1 acrylamide:bis-acrylamide; Bio-Rad, Hercules, CA) PAGE gel at 10 V/cm and 4°C, with recirculating running buffer.

For immunization of rabbits, N-terminal (ONT, amino acids 2-108) or C-terminal (Oß, amino acids 365-480) domains of the catfish ß isoform were expressed in Escherichia coli using pQE-30 vectors (Qiagen, Chatsworth, CA) and purified. Rabbit anti-mouse Oct2 specific for the N-terminus (35) was a kind gift of Dr. Philippe Douville (University of Zürich, Switzerland), and control rabbit sera were either anti-bovine lactoperoxidase or preimmunization serum.

The competition EMSA were performed as specified above, with the addition of unlabeled competitor at the same time as labeled probe. Quantitation of the percent signal inhibition was by phosphoimaging, as described above for the S1 nuclease protection assays.

Plasmids

Construction of the octamer-dependent reporter plasmids has been described (6). Full-length coding regions of catfish Oct2 {alpha} and ß were directionally cloned (HindIII and NotI) into the expression vector pRc/CMV (Invitrogen, San Diego, CA). The murine Oct 2.2 expression vector was a generous gift of Dr. T. Wirth. Plasmids for transfection were purified by cesium chloride centrifugation and dialyzed extensively against 1x TE (10 mM Tris-Cl, 1 mm EDTA, pH 8.0).

Cell lines and DNA transfection

The catfish cell lines 1B10, 3B11, F13L-3.1, and 42TA were maintained as previously described (5, 6). The murine myeloma cell line J558L (Ref. 36; a kind gift of Dr. S. Morrison (UCLA, Los Angeles, CA)) was maintained as described previously (5). The S-194 murine myeloma cell line (originally described in Ref. 37; a kind gift of Dr. L. Pilström, Uppsala University, Uppsala, Sweden) was kept in RPMI 1640 supplemented with 5% bovine calf serum and 7.5% FCS (Life Technologies).

Transfections into cell lines were performed as previously described (5), except for S-194 cells, which were harvested at 4 x 106 cells/ml and electroporated at 168V, 1100 µF, and 48 ohms. Six micrograms of octamer-dependent reporter plasmid was used, except in F13L-3.1, which required 12 µg. Equimolar concentrations (2 to 6 µg) of empty or Oct2 expression plasmids were cotransfected in each experiment. As controls for transfection efficiency, 0.5 to 3 µg of luciferase reporter construct, driven by either an RSV promoter or CMV promoter (used in F13L-3.1, which does not express from the RSV promoter) were transfected. Assays for expression of the reporter genes were performed as previously described (5).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of an Oct2 homologue in catfish

A cDNA library from the catfish B lymphoblastoid cell line 1B10 was screened with probes containing the coding regions of mouse Oct 2.2 and 2.5. Of six positive cDNA clones isolated, three had high sequence similarity to mammalian Oct transcription factors and were selected for further study. Two of the clones were identical and contained open reading frames encoding the sequence termed Oct2 {alpha}. The third clone contained a partial sequence, related to that of Oct2 {alpha}, and reverse transcriptase-PCR permitted the complete sequence (termed Oct2 ß) to be derived. The nucleotide sequences of Oct2 {alpha} and Oct2 ß were identical, except in their 3' regions; this was interpreted as most likely resulting from alternative RNA processing events. These two sequences were initially identified as isoforms of catfish Oct2 (rather than Oct1 or other POU-domain transcription factors) because alignments with mouse Oct2 revealed clear overall sequence similarities (Fig. 1GoA). Parsimony-based phylogenetic analysis of several available Oct1 and Oct2 sequences (Fig. 1GoB) confirmed that the catfish Oct2 was homologous to mammalian Oct2. In an unrooted tree, the Oct1 and Oct2 sequences from vertebrates cluster on distinct branches. The dOct2 of Drosophila served as an outgroup in this analysis since it is related to mammalian Oct2 only through its class II POU domain (38). The vertebrate Oct2 branch, which contains the catfish, mouse, and human sequences, is strongly supported by a bootstrap resampling value of 99 (Fig. 1GoB).



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 1. Analysis of catfish Oct2 sequences. A, Comparison of catfish Oct2 {alpha} and ß sequences with murine Oct 2.1. The amino acid sequences of murine Oct 2.1 (16) were aligned with catfish Oct2 {alpha} (Y12651) and Oct2 ß (Y12652), as described in Materials and Methods. The POU-specific (POUsp) and POU homeodomains (POUhd) are boxed, while a putative glutamine activation domain (as defined in Seipel, Georgiev, and Schaffner (18), residues 99-161 of mouse Oct 2.1) is overlined. Residues of exact identity are indicated by "." and gaps introduced in the alignment are shown as "-". B, Unrooted phylogenetic tree showing the relationship between various vertebrate Oct1, Oct2, and the Drosophila dOct2 sequences. Bootstrap resampling values (out of 100) are shown at each node.

 
Comparisons of the inferred amino acid sequence(s) of catfish Oct2 and those of murine Oct2 (Fig. 1GoA) show substantial similarity in the N-terminal region, i.e., up to 48% identity depending on the isoform of mouse Oct2 chosen for comparison. Catfish Oct2 exhibits up to 66% identity with the region identified as a glutamine activation domain in mouse Oct2. The POU domains of catfish and murine Oct2 are virtually identical, with only a single amino acid difference in the POU-specific domain and six differences in the POU homeodomain. However, neither catfish Oct2 {alpha} nor ß shows significant similarity to mammalian Oct2 in the C-terminal regions; in mammalian Oct2, this region contains a proline, serine, and threonine-rich activation domain (20). While the C-terminal regions of catfish Oct2 {alpha} and ß do not show significant sequence similarity to mammalian Oct2, they do possess an abundance of proline, serine, and threonine residues, raising the possibility that they may also serve as activation domains.

Oct2 {alpha} and ß are alternatively spliced from a single RNA transcript

Upon the screening of a catfish monocyte cDNA library, four other Oct2 clones were isolated, indicating that catfish Oct2 is not exclusive to B cells. One of these was a 5' truncated clone (Fig. 2GoA) that contained an unprocessed transcript for the 3' region of Oct2 ß. Sequencing of this clone revealed that a single RNA transcript can encode both Oct2 {alpha} and Oct2 ß mRNAs. The C-terminal coding region specific for the ß isoform is created when 2 ß-specific exons are spliced into a site immediately 5' of the stop codon for the {alpha} isoform. A probe generated from this clone, approximately 2.5 kb (Fig. 2GoA), was used to detect the Oct2 gene in Southern blot analysis (Fig. 2GoB). A single hybridizing band was obtained with BamHI, and two bands with EcoRI and HindIII. The two bands observed with EcoRI digests were predicted by the presence of an internal EcoRI site. These results are consistent with the presence of Oct2 as a single copy gene: the two bands observed with HindIII digestion would then represent allelic polymorphism in these sites.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 2. Catfish Oct2 is a single copy gene. A, Schematic (to scale) of the unprocessed Oct2 cDNA (AJ003122), containing coding sequence common to {alpha} and ß, the unique 3' regions of {alpha} and ß, and the two introns within the 3' region of Oct2. The stop codons and poly(A)/cleavage sites for the Oct2 {alpha} and ß messages are indicated. PCR primers (F + R) used to generate the probe for catfish genomic Southern analysis are indicated below the appropriate regions. B, Genomic Southern blot analysis of catfish Oct2. DNA from two individual animals was digested with HindIII (H3), EcoRI (R1), and BamHI (Bam). DNA size standards (bp) are indicated to the right of the figure.

 
Expression of Oct2 isoforms in catfish tissues

S1 nuclease protection assays (Fig. 3GoA) were used to identify the expression patterns of the Oct2 isoforms in catfish cell lines and tissues. The results showed that Oct2 {alpha} and ß transcripts are both expressed at relatively high levels in B cells (lanes 3 and 4, Fig. 3GoB). Oct2 ß is the predominant isoform in B cells, comprising 71% of total Oct2 mRNA transcripts. In contrast, both isoforms are expressed at much lower levels in T cells, about one-fifth that observed in B cells (lane 5, Fig. 3GoB). Oct2 is expressed in the spleen, head kidney (a major lymphohemopoietic organ of catfish), brain, kidney (a resident site for lymphoid cells in catfish), and testes (lanes 8-11 and 13, Fig. 3GoB). However, the gut (lane 12), skin (lane 14), liver, and muscle (data not shown) are negative for Oct2 mRNA. Thymus was not tested due to the involution of this organ in adult fish. Although the ratio of the {alpha} to ß isoforms varies between the tissues expressing Oct2, the ß isoform predominates in most catfish tissues (Fig. 3GoB). The extent to which Oct2 expression in catfish nonlymphoid tissues is associated with B cells present in the tissue is unknown.



View larger version (80K):
[in this window]
[in a new window]
 
FIGURE 3. Oct2 mRNA expression in catfish. A, Schematic showing the fragments protected from S1 nuclease digestion by Oct2 {alpha} and ß mRNA. The coding regions, beginning at the POU domain, of catfish Oct2 {alpha} and ß are shown, with the corresponding protected fragments (sizes in parentheses) of the full-length probe (101 bases), Oct2 {alpha} (64 bases), and Oct2 ß (91 bases). B, Catfish Oct2 mRNA expression in various tissues as analyzed by S1 nuclease protection. The amount of total RNA loaded in each lane was normalized for actin message. Cell lines and tissues used are indicated above each lane. To the left is an indication of the observed bands, F O2; full-length Oct2 probe, O2 ß; fragment protected by Oct2 ß mRNA, O2 {alpha}; fragment protected by Oct2 {alpha} mRNA, F A; full-length actin probe, A; fragment protected by actin mRNA. Below each lane containing catfish RNA is the relative proportion of Oct2 {alpha} and ß message, as quantified by phosphoimaging.

 
Octamer binding proteins of catfish B cells

The abilities of nuclear extracts from catfish B cells (1B10) and macrophages (42TA) to bind the consensus octamer motif were compared with that of mouse B lineage cells (J558L, a plasmacytoma) in EMSA (Fig. 4Go). Comparing the patterns of shifted bands seen with the mouse and catfish B lineage cells, it is apparent that they are very similar, i.e., one distinct slow moving band and a faster migrating band, or envelope of bands in the case of the 1B10 cells (cf lanes 1 and 5 in Fig. 4Go). These bands were interpreted as being attributable to Oct1 and Oct2, respectively, in the case of J558L. The nature of the Oct2-shifted bands for the J558L extracts was confirmed by supershifting with anti-Oct2 Ab (cf lanes 3 and 4 in Fig. 4Go). In comparing the gel shifts obtained with catfish B cell (1B10) and macrophage (42TA) extracts, it is clear that the faster migrating bands were more prominent in the B cells than in the macrophages (cf lanes 5 and 9 in Fig. 4Go). This result is interpreted as indicating that the faster migrating envelope of bands is produced by the catfish Oct2, a situation tested directly by using rabbit antisera to recombinant N-terminal and C-terminal regions of the catfish Oct2 molecules in an EMSA supershift experiment. As shown in Figure 5GoA, antisera to both the N-terminal (ONT) and C-terminal (Oß) regions produced specific supershifts only of the bands identified as Oct2. Rabbit antisera to murine Oct2 showed no cross-reactivity with catfish Oct2 and vice versa (lanes 4 and 8 of Fig. 4Go, and data not shown). The variant octamer motif (ATGtAAAT) found in the catfish enhancer, which drives strong expression in catfish B cells (6), was also tested in EMSA with catfish B cell extracts (Fig. 5GoB). The pattern of shifted bands seen with the variant octamer was very similar to that seen with the consensus motif, although EMSA with the variant motif produced distinct bands clearly visible within the Oct2 envelope, and the additional group of fast migrating bands (marked with an asterisk (*) in Fig. 5GoB) was more prominent at equivalent exposures. The putative Oct1 band and one of the bands within the Oct2 envelope failed to show supershifts with antisera to catfish Oct2 N or C termini (Fig. 5Go). However, the fastest migrating group of bands (* in Fig. 5GoB, lane 6) was shifted by antisera to catfish Oct2 C termini, suggesting considerable diversity in the octamer binding proteins of catfish.



View larger version (97K):
[in this window]
[in a new window]
 
FIGURE 4. EMSA with consensus octamer motif. These were performed using mouse B cell (J558L), catfish B cell (1B10), and catfish monocyte (42TA) nuclear extracts. J558L is shown in lanes 1 to 4, 1B10 in lanes 5 to 8, and 42TA in lanes 9 and 10. Extracts alone (lanes 1, 5, and 9) and 100x molar excess unlabeled competitor (lanes 2, 6, and 10) are shown for J558L, 1B10, and 42TA. Control antiserum to bovine lactoperoxidase (lanes 3 and 7) and murine Oct2 antiserum (lanes 4 and 8) are shown only for J558L and 1B10. The Oct2-specific bands, Oct2-supershifted bands (lane 4), and the band predicted to be produced by the homologue of Oct1 are indicated.

 


View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 5. EMSA with consensus and variant octamer motifs. EMSA was performed using catfish B (1B10) cell nuclear extracts and the consensus octamer (A) or the octamer variant, ATGtAAAT (B). For both A and B: lane 1, extract alone; 2, 100x molar excess unlabeled competitor; 3, prebleed to ONT (N-terminus) antiserum; 4, ONT antiserum; 5, prebleed to Oß (C-terminus) antiserum; 6, Oß antiserum. The Oct2-specific bands, Oct2-supershifted bands (lanes 4 and 6), and the band predicted to be shifted by the homologue to Oct1 are indicated in A and B. An * indicates the envelope of bands specifically recognized by the Oß antiserum, but of unidentified nature (B, lane 6).

 
Catfish Oct2 has a functional preference for a variant octamer

Previously, it has been shown that reporter constructs containing a trimer of octamer motifs are highly active in catfish relative to those lacking octamer motifs; in particular, the octamer variant, ATGtAAAT, had far greater activity than did the consensus (6). Transcriptional activation by exogenous Oct2 was measured by induction of an octamer-dependent reporter plasmid cotransfected with vectors expressing murine Oct2, catfish Oct2 {alpha}, catfish Oct2 ß, or the empty parental vector (expressing nothing). Reporter plasmids containing either the consensus or variant octamer were initially compared in catfish B cells (1B10, Fig. 6GoA). When induction was set relative to 1 for the reporter construct and empty expression vector (to normalize for activation due to endogenous Oct2), none of the transcription factors induced high levels of expression from reporter plasmids containing the consensus octamer (Fig. 6GoA, black bars). Catfish Oct2 ß showed approximately 3.5-fold activation over that of the empty expression vector (no differences were observed between cotransfected pRc/CMV or pBS, data not shown); Oct2 {alpha} was somewhat less active, with murine Oct2 showing the least activity. However, the results obtained using the reporter plasmid with the variant octamer (ATGtAAAT) were in contrast to those with the consensus octamer; i.e., Oct2 ß showed the strongest activation (about 9-fold), whereas Oct2 {alpha} was much weaker and mouse Oct2 was essentially inactive. These results indicate that, when measured in catfish B cells, Oct2 ß was the most active of the transcription factors tested. Furthermore, it showed a preference for the variant over the consensus octamer motif. These reporter constructs are B cell specific, as judged by their extremely low activity when transfected into T cells without additional vectors expressing Oct2 transcription factors (data not shown). When the activities of the transcription factors were tested with octamer-dependent reporter constructs in a catfish T cell line, the relative strength of Oct2 ß was again very clear (Fig. 6GoB). First, Oct2 ß showed a higher activation of expression than Oct2 {alpha} or mouse Oct2 from reporter constructs containing either consensus or variant octamer motifs. Second, Oct2 ß showed a 28-fold higher activation from the reporter containing the variant octamer than from the reporter with the consensus octamer. To test the influence of the species of host cell, consensus and variant reporter constructs along with vectors expressing Oct2 {alpha} and ß and mouse Oct2 were transfected into a mouse plasmacytoma cell line, S-194. The results (Fig. 6GoC) showed that each of the three tested transcription factors was able to induce expression of an octamer-dependent reporter gene. Unexpectedly, each of the transcription factors, including the mouse Oct2, showed a greater degree of enhancement when the variant octamer motif (as opposed to the consensus) was used in the reporter construct.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 6. Induction of an octamer-driven reporter gene by Oct2 in catfish B cells (A), catfish T cells (B), and mouse B cells (C). Reporter constructs containing a minimal promoter with a trimer of either consensus (ATGCAAAT, black) or the variant (ATGtAAAT, cross-hatched) octamer motifs were cotransfected with vectors expressing murine Oct2, catfish Oct2 {alpha}, or catfish Oct2 ß into (A) the catfish B lymphoblastoid cell line 1B10, (B) the catfish F13L-3.1 T cell line, and (C) the mouse S-194 B cell line. Induction of the reporter construct is shown relative to expression seen with a cotransfected empty parental expression vector, which was arbitrarily set at one. Values given as mean ± SEM are the results of at least five replicate transfections.

 
Catfish Oct2 does not have a higher affinity for the variant octamer

The relative affinity of catfish Oct2 for consensus or variant octamer motifs was determined by competitive EMSA. Nuclear extracts from the 1B10 cell line were allowed to bind either labeled consensus or variant octamer motifs, with increasing amounts of unlabeled consensus or variant octamer as competitor. Radioactivity in the Oct2-specific band was then quantitated (Fig. 7Go). For Oct2 bound to the consensus (Fig. 7GoA) or variant (Fig. 7GoB) probes, the consensus octamer motif was a better competitor than was the variant motif, indicating that catfish Oct2 does not have a higher relative affinity for the variant octamer. The mutant octamer motif was unable to compete for Oct2 binding (Mu, Fig. 7Go), even at 32-fold excess, at which both consensus and variant motifs showed 80 to 90% signal inhibition of probe.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 7. Oct2 binding of octamer motifs: competition between consensus and variant sequences. A quantitative EMSA was conducted using consensus (A) or variant (B) probes in competition with consensus and variant octamer motifs. A, Nuclear extracts from the catfish B cell line 1B10 were incubated with a labeled consensus octamer (ATGCAAAT) probe and competed with increasing amounts (shown as molar ratios) of variant, consensus, or mutant (Mu) octamer motifs. Only the Oct2-specific bands are shown (as identified in Fig. 5Go). The relative % signal inhibition is plotted against the molar ratio of the unlabeled variant or consensus competitor. B, Experiment as in A, but with labeled variant octamer (ATGtAAAT) probe. Each data point is shown as the mean of two independent experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous studies indicated that Oct1 transcription factors are detectable in the chicken and Xenopus, in both cases showing high similarity to mammalian Oct1 (28, 29). However, the present study represents the first report of Oct2 in a nonmammalian species, confirming that the Oct family of transcription factors has been highly conserved in the vertebrates. The POU domain of catfish Oct2 is virtually identical to that of mammalian Oct2 proteins. The high degree of similarity with mammalian Oct2 also extends to other regions, including the N-terminal region, the putative glutamine-rich activation domain, and the linker region of the POU domain. The identifiable homology between mammalian and catfish Oct2 breaks down in the C-terminal region, and the sequence in catfish becomes unique: the C-terminal region common to catfish Oct2 {alpha} and ß isoforms is rich in proline, serine, and threonine residues, suggesting that it may function as an activation domain. The observation that the ß isoform (which differs from the {alpha} isoform by only a 34-amino acid C-terminal extension) has substantially greater transcriptional activity than the {alpha} isoform supports the notion that the C-terminal region of catfish Oct2 contains an activation domain. However, formal proof for such a functional domain in the catfish Oct2 C-terminus requires further study.

Conservation between mammalian and catfish Oct2 extends to the pattern of RNA expression, and the existence of multiple RNA isoforms, generated from a single gene (39). Six Oct2 isoforms have been described in the mouse (16), whereas only two were described for catfish in the present study. Evidence that additional (yet to be defined) isoforms of catfish Oct2 may exist comes both from EMSA (Fig. 5GoB), wherein specific bands can be supershifted with Abs to Oct2, and from reverse transcriptase-PCR analyses of catfish B cell mRNAs (unpublished observations). However, the {alpha} and ß isoforms described in the present study appear to be the major Oct2 isoforms expressed, as judged by their relative abundance in the cDNA library screen and the presence of only the predicted protected bands in S1 nuclease assays (Fig. 3Go).

A major finding of the present study is the preference of Oct2 ß for the variant octamer ATGtAAAT. Previous studies have shown that the variant octamer is preferred over the consensus when transfected into catfish B cells in the context of an artificial promoter (6); the present results show that this finding is most likely attributable to the preference of catfish Oct2 for this motif. This functional preference of Oct2 ß for the variant is apparent from studies using B cells of both mouse and catfish, but is particularly striking (28-fold) when assayed in catfish T cells. Presumably, the low levels of endogenous Oct2 expressed in F13L-3.1 T cells permit measurement of the full effects of the ectopically expressed transcription factor. It is surprising that mouse Oct2 also has a slight preference for the variant octamer (ATGtAAAT), albeit this preference by mouse Oct2 is most likely not physiologically relevant because the octamer motifs found in mammalian Ig promoters and enhancers are typically of the consensus sequence. The only octamer variants of the sequence ATGtAAAT found in mouse and human Ig genes are in germ-line {kappa} promoters (40, 41). However, these promoters function independently of their octamer motifs (42). Conversely, the catfish IgH locus has been shown to have this motif twice in the enhancer, and the deletion of one of these motifs from an enhancer fragment results in a loss of 66% of enhancer activity (5). In addition, Tanaka (43) has shown that binding of a transcription factor to its target is cooperative, i.e., dependent not only on the interaction of the DNA binding domain with its motif, but also on the number of binding sites and the transcriptional strength of the activation domain. Consequently, the unusual structure of catfish Eµ3' (with multiple octamer motifs) could be an ideal configuration in which to achieve high levels of transcriptional activity from a single species of transcription factor (i.e., Oct2) binding to multiple octamer motifs.

Several explanations are possible for the functional preference of catfish Oct2 ß for the variant octamer. First, this may relate to its ability to interact either with components of the basal transcriptional complex or with coactivators when bound to a particular target sequence. Viral proteins can associate with the POU domains of Oct1 in a manner that is dependent on the sequence of the motif to which Oct1 is bound, presumably reflecting variations in conformation of the POU domain (44). Of direct interest are the observations of Gstaiger et al. (27) and Cepek, Chasman, and Sharp (45), wherein the stability of the DNA/Oct/Bob-1 ternary complex is dependent on both the octamer sequence and the context in which the sequence occurs. Second, the POU domain of catfish Oct2 may have an intrinsically higher affinity for the variant motif than for the consensus octamer. This altered affinity would likely result from effects other than differences in the residues directly contacting DNA, since these residues are known for human Oct1 (46) and are invariant between mammalian Oct1 and Oct2 and catfish Oct2. While the POU domains are very flexible, and hence can bind to many variants of the octamer motif (reviewed in 17 , the effects on DNA binding caused by sequence changes at positions distant from the DNA-contacting residues are possible. For example, the linker region of the POU domains has been reported to influence DNA binding specificity of POU domain factors (47). The sequence of the linker region of the catfish differs by 34% from that of the mouse, raising the possibility that it may affect the POU domain of catfish Oct2 such that the variant octamer is favored. In light of the fact that catfish Oct2 does not have a demonstrably higher affinity for the variant motif, the first explanation for the octamer preference is favored, i.e., that catfish Oct2 binding to the ATGtAAAT variation of the octamer motif leads to differentially favorable interactions with other components of the transcriptional complex.

It can be concluded that throughout the approximately 350 million years of evolution separating teleosts from mammals, Oct2 transcription factors have remained an integral part of the regulation of the IgH locus. While catfish Oct2 bridges this extensive evolutionary distance, functioning well in both catfish and mouse B cells, murine Oct2 does not drive octamer-dependent transcription in catfish B cells. Explanations for these observations may lie in the interactions of Oct2 with other transcription factors and/or coactivators present in the B cells of these species. Thus, although the structural relationship between mouse and catfish Oct2 is evident, the manner in which Oct2 functions has apparently changed as the teleost and tetrapod lineages diverged and is not yet understood.


    Footnotes
 
1 This research was supported by awards from the National Science Foundation (MCB-9406249) and the National Institutes of Health (R37-A1-19530). Back

2 Current address: Dr. Bradley G. Magor, Hopkins Marine Station, Stanford University, Pacific Grove, CA 93950 USA. Back

3 Address correspondence and reprint requests to Dr. Gregory W. Warr, Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, SC 29425. E-mail address: Back

4 Abbreviations used in this paper: IgH, Ig heavy chain; Eµ, intronic enhancer; EMSA, electromobility shift assays; Eµ3', catfish IgH enhancer. Back

Received for publication September 16, 1997. Accepted for publication December 10, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Calame, K., S. Ghosh. 1995. Regulation of immunoglobulin gene transcription. T. Honjo, and F. W. Alt, eds. Immunoglobulin Genes 397. Academic Press, San Diego.
  2. Ernst, P., S. T. Smale. 1995. Combinatorial regulation of transcription II: the immunoglobulin µ heavy chain gene. Immunity 2:427.[Medline]
  3. Warr, G. W.. 1995. The immunoglobulin genes of fish. Dev. Comp. Immunol. 19:1.[Medline]
  4. Wilson, M., E. Bengtén, N. W. Miller, L. W. Clem, L. Du Pasquier, G. W. Warr. 1997. A novel chimeric immunoglobulin heavy chain from a teleost fish shares similarities to IgD. Proc. Natl. Acad. Sci. USA 94:4593.[Abstract/Free Full Text]
  5. Magor, B. G., M. R. Wilson, N. W. Miller, L. W. Clem, D. L. Middleton, G. W. Warr. 1994. An Ig heavy chain enhancer of the channel catfish Ictalurus punctatus: evolutionary conservation of function but not structure. J. Immunol. 153:5556.[Abstract]
  6. Magor, B. G., D. A. Ross, D. L. Middleton, G. W. Warr. 1997. Functional motifs in the IgH enhancer of the Channel Catfish. Immunogenetics 46:192.[Medline]
  7. Verrijzer, C. P., P. C. Van der Vliet. 1993. POU domain transcription factors. Biochim. Biophys. Acta 1173:1.[Medline]
  8. Currie, R. A., R. G. Roeder. 1989. Identification of an octamer-binding site in the mouse kappa light-chain immunoglobulin enhancer. Mol. Cell. Biol. 9:4239.[Abstract/Free Full Text]
  9. Kistler, B., P. Pfisterer, T. Wirth. 1995. Lymphoid- and myeloid-specific activity of the PU.1 promoter is determined by the combitorial action of octamer and ets transcription factors. Oncogene 11:1095.[Medline]
  10. Lieberson, R., S. L. Giannini, B. K. Birshtein, L. A. Eckhardt. 1991. An enhancer at the 3' end of the mouse immunoglobulin heavy chain locus. Nucleic Acids Res. 19:933.[Abstract/Free Full Text]
  11. Matthias, P., D. Baltimore. 1993. The immunoglobulin heavy chain locus contains another B-cell-specific 3' enhancer close to the {alpha} constant region. Mol. Cell. Biol. 13:1547.[Abstract/Free Full Text]
  12. Michaelson, J. S., S. L. Giannini, B. K. Birshtein. 1995. Identification of 3'{alpha}-hs4, a novel Ig heavy chain enhancer element regulated at multiple stages of B cell differentiation. Nucleic Acids Res. 23:975.[Abstract/Free Full Text]
  13. Parslow, T. G., D. L. Blair, W. J. Murphy, D. K. Granner. 1984. Structure of the 5' ends of immunoglobulin genes: a novel conserved sequence. Proc. Natl. Acad. Sci. USA 81:2650.[Abstract/Free Full Text]
  14. Fletcher, C., N. Heintz, R. G. Roeder. 1987. Purification and characterization of OTF-1, a transcription factor regulating cell cycle expression of a human histone H2b gene. Cell 51:773.[Medline]
  15. Scheidereit, C., A. Heguy, R. G. Roeder. 1987. Identification and purification of a human lymphoid-specific octamer-binding protein (OTF-2) that activates transcription of an immunoglobulin promoter in vitro. Cell 51:773.
  16. Wirth, T., A. Priess, A. Annweiler, S. Zwilling, B. Oeler. 1991. Multiple Oct2 isoforms are generated by alternative splicing. Nucleic Acids Res. 19:43.[Abstract/Free Full Text]
  17. Herr, W., M. A. Cleary. 1995. The POU domain: versatility in transcriptional regulation by a flexible two-in-one DNA-binding domain. Genes Dev. 9:1679.[Free Full Text]
  18. Seipel, K., O. Georgiev, W. Schaffner. 1992. Different activation domains stimulate transcription from remote (’enhancer’) and proximal (’promoter’) positions. EMBO J. 11:4961.[Medline]
  19. Friedl, E. M., P. Matthias. 1995. Transcriptional activation and repression, two properties of the lymphoid-specific transcription factor Oct-2a. Eur. J. Biochem. 234:308.[Medline]
  20. Tanaka, M., W. Herr. 1990. Differential transcriptional activation by Oct-1 and Oct-2: interdependent activation domains induce Oct-2 phosphorylation. Cell 60:375.[Medline]
  21. Annweiler, A., S. Zwilling, T. Wirth. 1994. Functional difference between the Oct2 transactivation domains determine the transactivation potential of individual isoforms. Nucleic Acids Res. 22:4250.[Abstract/Free Full Text]
  22. Strubin, M., J. W. Newell, P. Matthias. 1995. OBF-1, a novel B cell-specific coactivator that stimulates immunoglobulin promoter activity through association with octamer-binding proteins. Cell 80:497.[Medline]
  23. Gstaiger, M., L. Knoepfel, O. Georgiev, W. Schaffner, C. M. Hovens. 1995. A B-cell coactivator of octamer-binding transcription factors. Nature 373:360.[Medline]
  24. Luo, Y., R. G. Roeder. 1995. Cloning, functional characterization, and mechanism of action of the B-cell-specific transcriptional coactivator OCA-B. Mol. Cell. Biol. 15:4115.[Abstract]
  25. Pfisterer, P., S. Zwilling, T. Wirth. 1995. Functional characterization of the murine homolog of the B cell-specific coactivator BOB.1/OBF.1. J. Biol. Chem. 270:29870.[Abstract/Free Full Text]
  26. Schubart, D. B., P. Sauter, S. Massa, E. M. Friedl, H. Schwarzenbach, P. Matthias. 1996. Gene structure and characterization of the murine homologue of the B cell-specific transcriptional coactivator OBF-1. Nucleic Acids Res. 24:1913.[Abstract/Free Full Text]
  27. Gstaiger, M., O. Georgiev, H. van Leeuwen, P. van der Vliet, W. Schaffner. 1996. The B cell coactivator Bob1 shows DNA sequence-dependent complex formation with Oct-1/Oct-2 factors, leading to differential promoter activation. EMBO J. 15:2781.[Medline]
  28. Petryniak, B., L. M. Staudt, C. E. Postema, W. T. McCormack, C. B. Thompson. 1990. Characterization of chicken octamer-binding proteins demonstrates that POU domain-containing homeobox transcription factors have been highly conserved during vertebrate evolution. Proc. Natl. Acad. Sci. USA 87:1099.[Abstract/Free Full Text]
  29. Hinkley, C., D. Leibham, and M. Perry. 1991. Regulated binding specificity of Xenopus OCT-1, a maternal transcription factor. GenBank/EMBL Accession no. X57165.
  30. Miller, N. W., M. A. Rycyzyn, M. R. Wilson, G. W. Warr, J. P. Naftel, L. W. Clem. 1994. Development and characterization of channel catfish long term B cell lines. J. Immunol. 152:2180.[Abstract]
  31. Vallejo, A. N., C. F. Ellsaesser, N. W. Miller, L. W. Clem. 1991. Spontaneous development of functionally active long-term monocyte-like cell lines from channel catfish. In Vitro Cell. Dev. Biol. 27A:279.
  32. Swofford, D. L. 1993. PAUP: phylogenetic analysis using parsimony, version 3.1.1. Illinois Natural History Survey, Champagne, IL.
  33. Sambrook, J., E. F. Fritsch, T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratories Press, Plainview, NY.
  34. Riggs, K. J., S. Saleque, K. K. Wong, K. T. Merrell, J. S. Lee, Y. Shi, K. Calame. 1993. Yin-yang 1 activates the c-myc promoter. Mol. Cell. Biol. 13:7487.[Abstract/Free Full Text]
  35. Chen, U., R. H. Scheuermann, T. Wirth, T. Gerster, R. G. Roeder, K. Harshman, C. Berger. 1991. Anti-IgM antibodies down modulate mu-enhancer activity and OTF2 levels in LPS-stimulated mouse splenic B-cells. Nucleic Acids Res. 19:5981.[Abstract/Free Full Text]
  36. Oi, V. T., S. L. Morrison, L. A. Herzenberg, P. Berg. 1983. Immunoglobulin gene expression in transformed lymphoid cells. Proc. Natl. Acad. Sci. USA 80:825.[Abstract/Free Full Text]
  37. Horibata, K., A. W. Harris. 1970. Mouse myelomas and lymphomas in culture. Exp. Cell Res. 60:61.[Medline]
  38. Prakash, K., X. Fang, D. Engelberg, A. Behal, C. S. Parker. 1992. dOct2, a Drosophila Oct transcription factor that functions in yeast. Proc. Natl. Acad. Sci. USA 89:7080.[Abstract/Free Full Text]
  39. Hatzopoulos, A. K., A. S. Stoykova, J. R. Erselius, M. Goulding, T. Neuman, P. Gruss. 1990. Structure and expression of the mouse Oct2a and Oct2b, two differentially spliced products of the same gene. Development 109:349.[Abstract]
  40. Van Ness, B. G., M. Weigert, C. Coleclough, E. L. Mather, D. E. Kelly, R. P. Perry. 1981. Transcription of the unrearranged mouse C{kappa} locus: sequence of the initiation region and comparison of activity with a rearranged V{kappa}-C{kappa} gene. Cell 27:593.[Medline]
  41. Thompson, A., E. Timmers, M. J. H. Kenter, M. E. M. Kraakman, R. W. Hendriks, R. K. B. Schuurman. 1992. Immunoglobulin {kappa} light chain germ-line transcripts in human precursor B lymphocytes. Eur. J. Immunol. 22:3167.[Medline]
  42. Prabhu, A., D. P. O’Brien, G. L. Weisner, R. Fulton, B. Van Ness. 1996. Octamer independent activation of transcription from the kappa immunoglobulin germline promoter. Nucleic Acids Res. 24:4805.[Abstract/Free Full Text]
  43. Tanaka, M.. 1996. Modulation of promoter occupancy by cooperative DNA binding and activation-domain function is a major determinant of transcriptional regulation by activators in vivo. Proc. Natl. Acad. Sci. USA 93:4311.[Abstract/Free Full Text]
  44. Walker, S., S. Hayes, P. O’Hare. 1994. Site-specific conformational alteration of the Oct-1 POU domain-DNA complex as the basis for differential recognition by Vmw65 (VP16). Cell 79:841.[Medline]
  45. Cepek, K. L., D. I. Chasman, P. A. Sharp. 1996. Sequence-specific DNA binding of the B-cell-specific coactivator OCA-B. Genes Dev. 10:2079.[Abstract/Free Full Text]
  46. Klemm, J. D., M. A. Rould, R. Aurora, W. Herr, C. O. Pabo. 1994. Crystal structure of the Oct-1 POU domain bound to an octamer site: DNA recognition with tethered DNA-binding modules. Cell 77:21.[Medline]
  47. Aurora, R., W. Herr. 1992. Segments of the POU domain influence one another’s DNA-binding specificity. Mol. Cell. Biol. 12:455.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. K. Mah, K. R. Armstrong, D. S. Chew, J. S. Chu, D. K. Tu, R. C. Johnsen, N. Chen, H. M. Chamberlin, and D. L. Baillie
Transcriptional Regulation of AQP-8, a Caenorhabditis elegans Aquaporin Exclusively Expressed in the Excretory System, by the POU Homeobox Transcription Factor CEH-6
J. Biol. Chem., September 21, 2007; 282(38): 28074 - 28086.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J.-i. Hikima, M. L. Lennard, M. R. Wilson, N. W. Miller, L. W. Clem, and G. W. Warr
Evolution of vertebrate E protein transcription factors: comparative analysis of the E protein gene family in Takifugu rubripes and humans
Physiol Genomics, April 14, 2005; 21(2): 144 - 151.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J.-i. Hikima, C. C. Cioffi, D. L. Middleton, M. R. Wilson, N. W. Miller, L. W. Clem, and G. W. Warr
Evolution of Transcriptional Control of the IgH Locus: Characterization, Expression, and Function of TF12/HEB Homologs of the Catfish
J. Immunol., November 1, 2004; 173(9): 5476 - 5484.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. C. Cioffi, D. L. Middleton, M. R. Wilson, N. W. Miller, L. W. Clem, and G. W. Warr
An IgH Enhancer That Drives Transcription through Basic Helix-Loop-Helix and Oct Transcription Factor Binding Motifs. FUNCTIONAL ANALYSIS OF THE E{micro}3' ENHANCER OF THE CATFISH
J. Biol. Chem., July 20, 2001; 276(30): 27825 - 27830.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ross, D. A.
Right arrow Articles by Warr, G. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ross, D. A.
Right arrow Articles by Warr, G. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS