|
|
||||||||



*
Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, SC 29425; and
Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216
| Abstract |
|---|
|
|
|---|
and ß) were cloned by screening a catfish
B cell cDNA library. Catfish Oct2
and ß isoforms are derived by
alternative RNA splicing; as determined by Southern analysis, Oct2 is a
single copy gene. In comparisons with mammalian Oct2, the catfish Oct2
isoforms show high sequence conservation in their N-terminal regions
and POU domains, but extensive divergence in their C-terminal regions.
Catfish Oct2
and ß are tissue restricted, bind both consensus and
variant octamer motifs, and activate transcription in both catfish and
murine cells. In contrast, mouse Oct2 activated transcription in mouse
but not catfish cells. Catfish Oct2 ß is a more potent
transcriptional activator than Oct2
. In transient expression
assays, catfish Oct2 ß showed a marked preference for the octamer
variant, ATGtAAAT, which occurs twice in the catfish enhancer. Mouse
Oct2 also showed increased activity with the variant octamer when
tested in mouse B cells. Gel-shift analysis competition assays
indicated that catfish Oct2 binds the consensus octamer motif with an
apparently higher affinity than it does the variant motif. | Introduction |
|---|
|
|
|---|
) and µB sites in the enhancer,
which are bound by Ets-family transcription factors (such as ets-1 and
PU.1); and 3) octamer motifs, which are found in both the promoter and
enhancer regions and are bound by the POU-domain transcription factors
(for reviews, see Refs. 1 and 2). Thus, the mechanisms by which
mammalian B cells control expression of IgH genes show extensive
diversity, and the manner whereby such a complex system evolved is
unclear.
Teleosts, such as the channel catfish (Ictalurus
punctatus), possess an IgH locus of a similar
organizational pattern to that found in mammals (reviewed in 3 .
While fish VH, D, and JH segments are similar
in number and arrangement to those seen in mammals, one major
difference is in the number of the constant region genes in fish.
Catfish express primarily IgM-like Abs, and although a homologue of the
gene has recently been described (4), there is no evidence that the
fish IgH locus can undergo typical class switching via chromosomal
rearrangement. In previous studies of catfish IgH gene expression (5),
it was observed that the catfish IgH enhancer (Eµ3') was not only
present in a unique position (3' of the µ gene), but it also had an
unusual diffuse structure, lacking a defined core region and extending
approximately 1.8 kb. The catfish appears to lack functional µA and
µB elements, considered essential to the Eµ of mice (5, 6).
Although µE3 and µE5 motifs are present in Eµ3', no studies have
yet defined their role. Eµ3' contains eight octamer motifs of six
different sequences, including the consensus (ATGCAAAT), capable of
driving expression in B cells (6). Octamer motifs are found in the
regulatory regions of many ubiquitously expressed genes (reviewed in
7 , as well as in elements regulating genes (including Igs)
expressed specifically in B cells (8, 9, 10, 11, 12, 13). Despite the structural
differences from its mammalian counterparts, the catfish IgH enhancer
shows a B cell-specific function even when tested in mouse cells (5).
Thus, the catfish IgH enhancer may rely primarily on the octamer
motifs, albeit functioning in a different fashion than observed in
mammals, particularly in the absence of µA and µB motifs.
The Oct1 (14) and Oct2 (15) transcription factors, of which there are six alternatively spliced Oct2 isoforms (16), play major roles in murine IgH transcription through interactions with the octamer motif and coactivators. Although mouse Oct1 and Oct2 possess a very similar DNA binding (POU) domain, composed of a POU-specific domain and a POU homeodomain connected by a linker region (reviewed in 17 , differences in the activation domains confer different functions on Oct1 and Oct2. Glutamine-rich activation domains capable of activating transcription from a promoter, but not from a remote enhancer, have been identified in the N termini of both Oct1 and Oct2 (18, 19). In addition, Oct2, but not Oct1, has a proline-, serine-, threonine-rich activation domain in the C-terminal region (20). This C-terminal activation domain can activate transcription from a promoter and, with B cell specificity, from a remote enhancer (21, 19). A B cell-specific coactivator, variously called Bob-1, OBF-1, or OCA-B (22, 23, 24, 25, 26), has been shown to associate with the POU-specific domain of Oct1 (27). Although Bob-1 is highly B cell specific, it appears not to be the coactivator capable of mediating octamer-dependent activation from a distant enhancer. Instead, it is believed to act through Oct1 and/or Oct2 bound at the promoter (22, 23, 24).
An important role of the octamer motifs in the catfish IgH enhancer can be inferred from the observation that artificial promoters containing octamer motifs drive strong expression in catfish B cells (6). To date, Oct2 has been reported only in mammals, while Oct1 has also been described in birds and amphibians (28, 29). The studies reported here were undertaken to test the hypothesis that catfish possess a homologue of Oct2 that can act through multiple, variant octamer motifs to drive B cell-specific transcription of the catfish IgH gene.
| Materials and Methods |
|---|
|
|
|---|
cDNA libraries from the catfish B lymphoblastoid cell line 1B10
(30) and the catfish monocyte-like cell line 42TA (31) were constructed
in lambda ZAP II (Stratagene, La Jolla, CA). Approximately 2.5 x
105 plaque-forming units of the 1B10 cDNA library were
screened at low stringency with 32P-labeled probes for
mouse Oct2 cDNAs (kind gifts of Dr. T. Wirth, University of
Würzburg). For the screening of the 42TA cDNA library, the same
number of plaque-forming units was screened at high stringency with a
32P-labeled probe for the catfish Oct2 POU domain.
Sequences of catfish Oct2
and ß (Y12651 and Y12652), mouse Oct2.1
(X57936), human Oct2 (X13810), human Oct1 (X13403), pig Oct1 (L38524),
mouse Oct1 (X68363), chicken Oct1 (M29972), frog Oct1 (X57165), and
Drosophila dOct2 (M93149) were aligned using the Clustal V
program (DNAStar, Madison WI) with PAM 250 residue weight table, gap
penalty of 10, and gap-length penalty of 10. The alignment was used to
generate most-parsimonious phylogenetic trees (branch swapping, tree
bisection reconnection, 100 bootstrap replicates) in the PAUP
program (32).
Southern blots
Genomic DNA was isolated from the erythrocytes of two individual fish. Approximately 10 µg of DNA was digested to completion with HindIII, EcoRI, or BamHI and subjected to electrophoresis on a 0.8% agarose gel. Southern blot analysis was performed with a 32P-labeled Oct2 probe (AJ003122), as previously described (30). Blots were then exposed to a storage phosphor screen (Molecular Dynamics, Sunnyvale, CA) for 20 h.
S1 nuclease protection
The sequence of the catfish Oct2 probe was 5'-
GTGCTGGCTCCACGTCACCGTTCTTGTGACGCCACGAACCTGTGTTCAGATTTAATGTGTGAGTGGCCGGAACAGGGCTGGCGTCACTGCGAGGAGACGG-3'
and of the catfish actin probe
5'-GGGTCACACCATCACCAGAGTCCATCACGATACCAGTGGGCATCAACTC-3'. The actin
probe was 5' end-labeled with [
-32P]ATP (New
England Nuclear, Boston, MA), while the Oct2 probe was 3' end-labeled
using terminal deoxynucleotidyl-transferase (Life Technologies,
Gaithersburg, MD) and [
-32P]cordycepin (New England
Nuclear). Actin and Oct2 probes were hybridized with total RNA at
43°C for 16 to 18 h. The S1 nuclease digestion (S1-Assay Kit;
Ambion, Austin, TX) was performed according to the manufacturers
instructions, with the exception that 250 U of S1 nuclease was used and
digestions were conducted at 46°C for 1 h. The protected
fragments were resolved on a 12% denaturing polyacrylamide gel, which
was then exposed to a storage phosphor screen (Molecular Dynamics) and
quantified using the Imagequant program (Molecular Dynamics).
Electromobility shift assays (EMSA) and antisera production
Template DNA for EMSAs consisted of synthesized oligonucleotides
containing one copy of the consensus (ATGCAAAT), variant (ATGtAAAT), or
mutant (ACAAAATA) octamer motif (octamer motif underlined):
5'-CAATATGAATATGCAAATTACCT-3' and
5'-CATAGGTAATTTGCATATTCATA-3'. Templates were
radiolabeled by fill-in with Klenow fragment using
[
-32P]dATP (New England Nuclear; 33 to a sp.
act. of 107 to 109 cpm/µg.
Nuclear proteins from each cell line were prepared as described by Riggs et al. (34). EMSA protein-DNA binding reactions contained 20 mM HEPES, 1 mM MgCl2, 0.5 mM DTT (Sigma, St. Louis, MO), 4% Ficoll (Pharmacia, Uppsala, Sweden), 2 µg poly(dI-dC).poly(dI-dC) (Pharmacia), 105 cpm of template (1 to 10 fmol), 3.5 to 5 µg nuclear extract (containing 400 mM NaCl), KCl to a final Na+ plus K+ concentration of approximately 120 mM, and unlabeled competitor template where indicated. Before addition of radiolabeled template, the nuclear extract was allowed to prebind the poly(dI-dC).poly(dI-dC) for 10 min at room temperature. The binding reaction was allowed to proceed for an additional 20 min at room temperature after addition of radiolabeled template and competitor (as necessary). Band supershifting/abrogation was tested by preincubating antisera with nuclear extract for 30 min on ice, before addition of the DNA binding mix. Samples that did not receive rabbit serum contained 0.25 mg/ml (final concentration) of BSA (New England Biolabs, Beverly, MA). The binding reaction was resolved on a 6% (80:1 acrylamide:bis-acrylamide; Bio-Rad, Hercules, CA) PAGE gel at 10 V/cm and 4°C, with recirculating running buffer.
For immunization of rabbits, N-terminal (ONT, amino acids 2-108) or C-terminal (Oß, amino acids 365-480) domains of the catfish ß isoform were expressed in Escherichia coli using pQE-30 vectors (Qiagen, Chatsworth, CA) and purified. Rabbit anti-mouse Oct2 specific for the N-terminus (35) was a kind gift of Dr. Philippe Douville (University of Zürich, Switzerland), and control rabbit sera were either anti-bovine lactoperoxidase or preimmunization serum.
The competition EMSA were performed as specified above, with the addition of unlabeled competitor at the same time as labeled probe. Quantitation of the percent signal inhibition was by phosphoimaging, as described above for the S1 nuclease protection assays.
Plasmids
Construction of the octamer-dependent reporter plasmids has been
described (6). Full-length coding regions of catfish Oct2
and ß
were directionally cloned (HindIII and
NotI) into the expression vector pRc/CMV (Invitrogen, San
Diego, CA). The murine Oct 2.2 expression vector was a generous gift of
Dr. T. Wirth. Plasmids for transfection were purified by cesium
chloride centrifugation and dialyzed extensively against 1x TE
(10 mM Tris-Cl, 1 mm EDTA, pH 8.0).
Cell lines and DNA transfection
The catfish cell lines 1B10, 3B11, F13L-3.1, and 42TA were maintained as previously described (5, 6). The murine myeloma cell line J558L (Ref. 36; a kind gift of Dr. S. Morrison (UCLA, Los Angeles, CA)) was maintained as described previously (5). The S-194 murine myeloma cell line (originally described in Ref. 37; a kind gift of Dr. L. Pilström, Uppsala University, Uppsala, Sweden) was kept in RPMI 1640 supplemented with 5% bovine calf serum and 7.5% FCS (Life Technologies).
Transfections into cell lines were performed as previously described (5), except for S-194 cells, which were harvested at 4 x 106 cells/ml and electroporated at 168V, 1100 µF, and 48 ohms. Six micrograms of octamer-dependent reporter plasmid was used, except in F13L-3.1, which required 12 µg. Equimolar concentrations (2 to 6 µg) of empty or Oct2 expression plasmids were cotransfected in each experiment. As controls for transfection efficiency, 0.5 to 3 µg of luciferase reporter construct, driven by either an RSV promoter or CMV promoter (used in F13L-3.1, which does not express from the RSV promoter) were transfected. Assays for expression of the reporter genes were performed as previously described (5).
| Results |
|---|
|
|
|---|
A cDNA library from the catfish B lymphoblastoid cell line 1B10
was screened with probes containing the coding regions of mouse Oct 2.2
and 2.5. Of six positive cDNA clones isolated, three had high sequence
similarity to mammalian Oct transcription factors and were selected for
further study. Two of the clones were identical and contained open
reading frames encoding the sequence termed Oct2
. The third clone
contained a partial sequence, related to that of Oct2
, and reverse
transcriptase-PCR permitted the complete sequence (termed Oct2 ß) to
be derived. The nucleotide sequences of Oct2
and Oct2 ß were
identical, except in their 3' regions; this was interpreted as most
likely resulting from alternative RNA processing events. These two
sequences were initially identified as isoforms of catfish Oct2 (rather
than Oct1 or other POU-domain transcription factors) because alignments
with mouse Oct2 revealed clear overall sequence similarities (Fig. 1
A). Parsimony-based
phylogenetic analysis of several available Oct1 and Oct2 sequences
(Fig. 1
B) confirmed that the catfish Oct2 was
homologous to mammalian Oct2. In an unrooted tree, the Oct1 and Oct2
sequences from vertebrates cluster on distinct branches. The dOct2 of
Drosophila served as an outgroup in this analysis since it
is related to mammalian Oct2 only through its class II POU domain (38).
The vertebrate Oct2 branch, which contains the catfish, mouse, and
human sequences, is strongly supported by a bootstrap resampling value
of 99 (Fig. 1
B).
|
nor ß shows
significant similarity to mammalian Oct2 in the C-terminal regions; in
mammalian Oct2, this region contains a proline, serine, and
threonine-rich activation domain (20). While the C-terminal regions of
catfish Oct2
and ß do not show significant sequence similarity to
mammalian Oct2, they do possess an abundance of proline, serine, and
threonine residues, raising the possibility that they may also serve as
activation domains.
Oct2
and ß are alternatively spliced from a single RNA
transcript
Upon the screening of a catfish monocyte cDNA library, four other
Oct2 clones were isolated, indicating that catfish Oct2 is not
exclusive to B cells. One of these was a 5' truncated clone (Fig. 2
A) that contained an
unprocessed transcript for the 3' region of Oct2 ß. Sequencing of
this clone revealed that a single RNA transcript can encode both Oct2
and Oct2 ß mRNAs. The C-terminal coding region specific for the
ß isoform is created when 2 ß-specific exons are spliced into a
site immediately 5' of the stop codon for the
isoform. A probe
generated from this clone, approximately 2.5 kb (Fig. 2
A), was used to detect the Oct2 gene in Southern
blot analysis (Fig. 2
B). A single hybridizing band
was obtained with BamHI, and two bands with EcoRI
and HindIII. The two bands observed with EcoRI
digests were predicted by the presence of an internal EcoRI
site. These results are consistent with the presence of Oct2 as a
single copy gene: the two bands observed with HindIII
digestion would then represent allelic polymorphism in these sites.
|
S1 nuclease protection assays (Fig. 3
A) were used to
identify the expression patterns of the Oct2 isoforms in catfish cell
lines and tissues. The results showed that Oct2
and ß transcripts
are both expressed at relatively high levels in B cells
(lanes 3 and 4, Fig. 3
B). Oct2 ß is the predominant isoform in B cells,
comprising 71% of total Oct2 mRNA transcripts. In contrast, both
isoforms are expressed at much lower levels in T cells, about one-fifth
that observed in B cells (lane 5, Fig. 3
B). Oct2 is expressed in the spleen, head kidney (a
major lymphohemopoietic organ of catfish), brain, kidney (a resident
site for lymphoid cells in catfish), and testes
(lanes 8-11 and 13,
Fig. 3
B). However, the gut (lane
12), skin (lane
14), liver, and muscle (data not shown) are negative
for Oct2 mRNA. Thymus was not tested due to the involution of this
organ in adult fish. Although the ratio of the
to ß isoforms
varies between the tissues expressing Oct2, the ß isoform
predominates in most catfish tissues (Fig. 3
B). The
extent to which Oct2 expression in catfish nonlymphoid tissues is
associated with B cells present in the tissue is unknown.
|
The abilities of nuclear extracts from catfish B cells (1B10) and
macrophages (42TA) to bind the consensus octamer motif were compared
with that of mouse B lineage cells (J558L, a plasmacytoma) in EMSA
(Fig. 4
). Comparing the patterns of
shifted bands seen with the mouse and catfish B lineage cells, it is
apparent that they are very similar, i.e., one distinct slow moving
band and a faster migrating band, or envelope of bands in the case of
the 1B10 cells (cf lanes 1 and 5 in
Fig. 4
). These bands were interpreted as being attributable to Oct1 and
Oct2, respectively, in the case of J558L. The nature of the
Oct2-shifted bands for the J558L extracts was confirmed by
supershifting with anti-Oct2 Ab (cf lanes 3
and 4 in Fig. 4
). In comparing the gel shifts obtained with
catfish B cell (1B10) and macrophage (42TA) extracts, it is clear that
the faster migrating bands were more prominent in the B cells than in
the macrophages (cf lanes 5 and 9 in
Fig. 4
). This result is interpreted as indicating that the faster
migrating envelope of bands is produced by the catfish Oct2, a
situation tested directly by using rabbit antisera to recombinant
N-terminal and C-terminal regions of the catfish Oct2 molecules in an
EMSA supershift experiment. As shown in Figure 5
A, antisera to both the
N-terminal (ONT) and C-terminal (Oß) regions produced specific
supershifts only of the bands identified as Oct2. Rabbit antisera to
murine Oct2 showed no cross-reactivity with catfish Oct2 and vice versa
(lanes 4 and 8 of Fig. 4
, and data not shown). The variant octamer motif (ATGtAAAT) found in the
catfish enhancer, which drives strong expression in catfish B cells
(6), was also tested in EMSA with catfish B cell extracts (Fig. 5
B). The pattern of shifted bands seen with the
variant octamer was very similar to that seen with the consensus motif,
although EMSA with the variant motif produced distinct bands clearly
visible within the Oct2 envelope, and the additional group of fast
migrating bands (marked with an asterisk (*) in Fig. 5
B) was more prominent at equivalent exposures. The
putative Oct1 band and one of the bands within the Oct2 envelope failed
to show supershifts with antisera to catfish Oct2 N or C termini (Fig. 5
). However, the fastest migrating group of bands (* in Fig. 5
B, lane 6) was shifted by
antisera to catfish Oct2 C termini, suggesting considerable diversity
in the octamer binding proteins of catfish.
|
|
Previously, it has been shown that reporter constructs containing
a trimer of octamer motifs are highly active in catfish relative to
those lacking octamer motifs; in particular, the octamer variant,
ATGtAAAT, had far greater activity than did the consensus (6).
Transcriptional activation by exogenous Oct2 was measured by induction
of an octamer-dependent reporter plasmid cotransfected with vectors
expressing murine Oct2, catfish Oct2
, catfish Oct2 ß, or the
empty parental vector (expressing nothing). Reporter plasmids
containing either the consensus or variant octamer were initially
compared in catfish B cells (1B10, Fig. 6
A). When induction was
set relative to 1 for the reporter construct and empty expression
vector (to normalize for activation due to endogenous Oct2), none of
the transcription factors induced high levels of expression from
reporter plasmids containing the consensus octamer (Fig. 6
A,
black bars). Catfish Oct2 ß showed approximately 3.5-fold activation
over that of the empty expression vector (no differences were observed
between cotransfected pRc/CMV or pBS, data not shown); Oct2
was
somewhat less active, with murine Oct2 showing the least activity.
However, the results obtained using the reporter plasmid with the
variant octamer (ATGtAAAT) were in contrast to those with the consensus
octamer; i.e., Oct2 ß showed the strongest activation (about 9-fold),
whereas Oct2
was much weaker and mouse Oct2 was essentially
inactive. These results indicate that, when measured in catfish B
cells, Oct2 ß was the most active of the transcription factors
tested. Furthermore, it showed a preference for the variant over the
consensus octamer motif. These reporter constructs are B cell specific,
as judged by their extremely low activity when transfected into T cells
without additional vectors expressing Oct2 transcription factors (data
not shown). When the activities of the transcription factors were
tested with octamer-dependent reporter constructs in a catfish T cell
line, the relative strength of Oct2 ß was again very clear (Fig. 6
B). First, Oct2 ß showed a higher activation of
expression than Oct2
or mouse Oct2 from reporter constructs
containing either consensus or variant octamer motifs. Second, Oct2 ß
showed a 28-fold higher activation from the reporter containing the
variant octamer than from the reporter with the consensus octamer. To
test the influence of the species of host cell, consensus and variant
reporter constructs along with vectors expressing Oct2
and ß and
mouse Oct2 were transfected into a mouse plasmacytoma cell line, S-194.
The results (Fig. 6
C) showed that each of the three
tested transcription factors was able to induce expression of an
octamer-dependent reporter gene. Unexpectedly, each of the
transcription factors, including the mouse Oct2, showed a greater
degree of enhancement when the variant octamer motif (as opposed to the
consensus) was used in the reporter construct.
|
The relative affinity of catfish Oct2 for consensus or variant
octamer motifs was determined by competitive EMSA. Nuclear extracts
from the 1B10 cell line were allowed to bind either labeled consensus
or variant octamer motifs, with increasing amounts of unlabeled
consensus or variant octamer as competitor. Radioactivity in the
Oct2-specific band was then quantitated (Fig. 7
). For Oct2 bound to the consensus (Fig. 7
A) or variant (Fig. 7
B) probes,
the consensus octamer motif was a better competitor than was the
variant motif, indicating that catfish Oct2 does not have a higher
relative affinity for the variant octamer. The mutant octamer motif was
unable to compete for Oct2 binding (Mu, Fig. 7
), even at 32-fold
excess, at which both consensus and variant motifs showed 80 to 90%
signal inhibition of probe.
|
| Discussion |
|---|
|
|
|---|
and ß isoforms is rich
in proline, serine, and threonine residues, suggesting that it may
function as an activation domain. The observation that the ß isoform
(which differs from the
isoform by only a 34-amino acid C-terminal
extension) has substantially greater transcriptional activity than the
isoform supports the notion that the C-terminal region of catfish
Oct2 contains an activation domain. However, formal proof for such a
functional domain in the catfish Oct2 C-terminus requires further
study.
Conservation between mammalian and catfish Oct2 extends to the
pattern of RNA expression, and the existence of multiple RNA isoforms,
generated from a single gene (39). Six Oct2 isoforms have been
described in the mouse (16), whereas only two were described for
catfish in the present study. Evidence that additional (yet to be
defined) isoforms of catfish Oct2 may exist comes both from EMSA (Fig. 5
B), wherein specific bands can be supershifted with
Abs to Oct2, and from reverse transcriptase-PCR analyses of catfish B
cell mRNAs (unpublished observations). However, the
and ß
isoforms described in the present study appear to be the major Oct2
isoforms expressed, as judged by their relative abundance in the cDNA
library screen and the presence of only the predicted protected bands
in S1 nuclease assays (Fig. 3
).
A major finding of the present study is the preference of Oct2 ß for
the variant octamer ATGtAAAT. Previous studies have shown that the
variant octamer is preferred over the consensus when transfected into
catfish B cells in the context of an artificial promoter (6); the
present results show that this finding is most likely attributable to
the preference of catfish Oct2 for this motif. This functional
preference of Oct2 ß for the variant is apparent from studies using B
cells of both mouse and catfish, but is particularly striking (28-fold)
when assayed in catfish T cells. Presumably, the low levels of
endogenous Oct2 expressed in F13L-3.1 T cells permit measurement of the
full effects of the ectopically expressed transcription factor. It is
surprising that mouse Oct2 also has a slight preference for the variant
octamer (ATGtAAAT), albeit this preference by mouse Oct2 is most likely
not physiologically relevant because the octamer motifs found in
mammalian Ig promoters and enhancers are typically of the consensus
sequence. The only octamer variants of the sequence ATGtAAAT found in
mouse and human Ig genes are in germ-line
promoters (40, 41).
However, these promoters function independently of their octamer motifs
(42). Conversely, the catfish IgH locus has been shown to have this
motif twice in the enhancer, and the deletion of one of these motifs
from an enhancer fragment results in a loss of 66% of enhancer
activity (5). In addition, Tanaka (43) has shown that binding of a
transcription factor to its target is cooperative, i.e., dependent not
only on the interaction of the DNA binding domain with its motif, but
also on the number of binding sites and the transcriptional strength of
the activation domain. Consequently, the unusual structure of catfish
Eµ3' (with multiple octamer motifs) could be an ideal configuration
in which to achieve high levels of transcriptional activity from a
single species of transcription factor (i.e., Oct2) binding to multiple
octamer motifs.
Several explanations are possible for the functional preference of catfish Oct2 ß for the variant octamer. First, this may relate to its ability to interact either with components of the basal transcriptional complex or with coactivators when bound to a particular target sequence. Viral proteins can associate with the POU domains of Oct1 in a manner that is dependent on the sequence of the motif to which Oct1 is bound, presumably reflecting variations in conformation of the POU domain (44). Of direct interest are the observations of Gstaiger et al. (27) and Cepek, Chasman, and Sharp (45), wherein the stability of the DNA/Oct/Bob-1 ternary complex is dependent on both the octamer sequence and the context in which the sequence occurs. Second, the POU domain of catfish Oct2 may have an intrinsically higher affinity for the variant motif than for the consensus octamer. This altered affinity would likely result from effects other than differences in the residues directly contacting DNA, since these residues are known for human Oct1 (46) and are invariant between mammalian Oct1 and Oct2 and catfish Oct2. While the POU domains are very flexible, and hence can bind to many variants of the octamer motif (reviewed in 17 , the effects on DNA binding caused by sequence changes at positions distant from the DNA-contacting residues are possible. For example, the linker region of the POU domains has been reported to influence DNA binding specificity of POU domain factors (47). The sequence of the linker region of the catfish differs by 34% from that of the mouse, raising the possibility that it may affect the POU domain of catfish Oct2 such that the variant octamer is favored. In light of the fact that catfish Oct2 does not have a demonstrably higher affinity for the variant motif, the first explanation for the octamer preference is favored, i.e., that catfish Oct2 binding to the ATGtAAAT variation of the octamer motif leads to differentially favorable interactions with other components of the transcriptional complex.
It can be concluded that throughout the approximately 350 million years of evolution separating teleosts from mammals, Oct2 transcription factors have remained an integral part of the regulation of the IgH locus. While catfish Oct2 bridges this extensive evolutionary distance, functioning well in both catfish and mouse B cells, murine Oct2 does not drive octamer-dependent transcription in catfish B cells. Explanations for these observations may lie in the interactions of Oct2 with other transcription factors and/or coactivators present in the B cells of these species. Thus, although the structural relationship between mouse and catfish Oct2 is evident, the manner in which Oct2 functions has apparently changed as the teleost and tetrapod lineages diverged and is not yet understood.
| Footnotes |
|---|
2 Current address: Dr. Bradley G. Magor, Hopkins Marine Station, Stanford University, Pacific Grove, CA 93950 USA. ![]()
3 Address correspondence and reprint requests to Dr. Gregory W. Warr, Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, SC 29425. E-mail address: ![]()
4 Abbreviations used in this paper: IgH, Ig heavy chain; Eµ, intronic enhancer; EMSA, electromobility shift assays; Eµ3', catfish IgH enhancer. ![]()
Received for publication September 16, 1997. Accepted for publication December 10, 1997.
| References |
|---|
|
|
|---|
constant region. Mol. Cell. Biol. 13:1547.
-hs4, a novel Ig heavy chain enhancer element regulated at multiple stages of B cell differentiation. Nucleic Acids Res. 23:975.
locus: sequence of the initiation region and comparison of activity with a rearranged V
-C
gene. Cell 27:593.[Medline]
light chain germ-line transcripts in human precursor B lymphocytes. Eur. J. Immunol. 22:3167.[Medline]
This article has been cited by other articles:
![]() |
A. K. Mah, K. R. Armstrong, D. S. Chew, J. S. Chu, D. K. Tu, R. C. Johnsen, N. Chen, H. M. Chamberlin, and D. L. Baillie Transcriptional Regulation of AQP-8, a Caenorhabditis elegans Aquaporin Exclusively Expressed in the Excretory System, by the POU Homeobox Transcription Factor CEH-6 J. Biol. Chem., September 21, 2007; 282(38): 28074 - 28086. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-i. Hikima, M. L. Lennard, M. R. Wilson, N. W. Miller, L. W. Clem, and G. W. Warr Evolution of vertebrate E protein transcription factors: comparative analysis of the E protein gene family in Takifugu rubripes and humans Physiol Genomics, April 14, 2005; 21(2): 144 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-i. Hikima, C. C. Cioffi, D. L. Middleton, M. R. Wilson, N. W. Miller, L. W. Clem, and G. W. Warr Evolution of Transcriptional Control of the IgH Locus: Characterization, Expression, and Function of TF12/HEB Homologs of the Catfish J. Immunol., November 1, 2004; 173(9): 5476 - 5484. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Cioffi, D. L. Middleton, M. R. Wilson, N. W. Miller, L. W. Clem, and G. W. Warr An IgH Enhancer That Drives Transcription through Basic Helix-Loop-Helix and Oct Transcription Factor Binding Motifs. FUNCTIONAL ANALYSIS OF THE E{micro}3' ENHANCER OF THE CATFISH J. Biol. Chem., July 20, 2001; 276(30): 27825 - 27830. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |