| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,
*
The University of Regensburg, Department of Medicine I, Regensburg, Germany;
The University of Alabama at Birmingham, Department of Medicine, Division of Clinical Immunology and Rheumatology, and the Veterans Administration Medical Center, Birmingham, AL 35294; and
Sankyo Co. Ltd., Tokyo, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Previous studies have indicated that Fas/Fas ligand-mediated apoptosis is critical to the maintenance of tolerance of peripheral T cells by mediating activation-induced cell death in an autocrine fashion (7, 8, 9, 10, 11), and that activation-induced cell death is significantly impaired in Fas-deficient lpr/lpr mice (12). It has been demonstrated that neonatal thymectomy inhibits the development of lymphoproliferation and prevents autoimmune disease in lpr/lpr mice, suggesting that defective Fas-mediated apoptosis of thymocytes is involved in the pathogenesis of the lpr disease phenotype (13, 14, 15). The data concerning the significance of Fas-mediated apoptosis during negative selection are conflicting. Several studies have indicated that the Fas/Fas ligand interaction is not involved in negative selection (11, 16, 17, 18, 19, 20, 21, 22), although modulation of apoptosis by Fas during negative selection of thymocytes has been described by other investigators (23, 24, 25). In addition, the extent of expression and function of Fas ligand in the thymus is controversial (4, 5, 26). Defective selection of CD4+ Db/HY T cells in the thymus of female mice has been reported by members of this research team (18, 27) and other investigators (28, 29), indicating modulation of apoptosis by Fas during the positive selection of thymocytes.
Although >90% of thymocytes and almost 100% of CD4+CD8+ thymocytes express abundant Fas Ag on the cell surface, anti-Fas Ab and soluble Fas ligand induce apoptosis predominantly in the CD4+CD8+ thymocyte subpopulation, whereas CD4+ and CD8+ thymocytes are less susceptible and CD4-CD8- thymocytes are resistant (30, 31, 32, 33, 34, 35). To accurately correlate the timing of susceptibility to Fas-mediated apoptosis with the expression of Fas and Fas ligand in thymocytes, we analyzed apoptosis during fetal thymic development of B6 +/+ and B6-lpr/lpr mice in vivo and examined Fas-mediated apoptosis during fetal thymic organ culture (FTOC)3 of B6 +/+ thymocytes in vitro. Our data support the concept that Fas-mediated apoptosis occurs during early T cell maturation before expression of the TCR, and that TCR/CD3 signaling prevents Fas-mediated apoptosis in FTOC. Therefore, the Fas/Fas ligand interaction might lead to the elimination of "neglected" thymocytes and of thymocytes that do not receive a survival signal through TCR/CD3.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Over an 8-h period, 10- to 14-wk-old female C57BL/6+/+ and C57BL/6-lpr/lpr mice (The Jackson Laboratory, Bar Harbor, MA) were mated with C57BL/6+/+ or C57BL/6-lpr/lpr male mice, respectively. A visible vaginal plug demonstrated successful mating and was used to establish day 1 of gestation. At days 15 to 18 of gestational age, mice were sacrificed and fetal thymi were obtained.
Abs and reagents
Anti-Fas (clone Jo2), anti-Fas ligand (clone Kay-10) anti-CD4 (clone GK1.5), anti-CD8 (clone 53-6.7), anti-TCR (clone H57), anti-CD3 (clone 145-2C11) mAbs, and hamster IgG control Ab were purchased from PharMingen (San Diego, CA) in either purified or conjugated form. Soluble Fas was prepared as previously described (36).
Fetal thymic organ culture
FTOC was conducted using thymi from fetal B6+/+ mice at day 16 of gestational age. Thymi were obtained under sterile conditions and two to three thymic lobes were placed on a nitrocellulose membrane (Millipore, Bedford, MA) supported by Gelfoam (Upjohn, Chicago, IL) in 24-well tissue culture plates that had been equilibrated with 1.2 ml of complete DMEM medium. The cultures were incubated at 37°C in a humidified atmosphere of 5% CO2. At the indicated timepoints, purified mAb specific for Fas (1 µg/ml), purified mAb specific for TCR (0.1–10 µg/ml), or control Ab were added to the cultures. Thymocytes were harvested 12 h after addition of Ab or at the end of the 6-day culture period and analyzed by flow cytometry. At each culture time point, thymi from three separate cultures were removed and analyzed. The error represents the mean ± SEM.
Semiquantitative PCR analysis for Fas and Fas ligand mRNA
Total RNA was isolated from thymocytes of B6+/+ and B6-lpr/lpr mice at days 15 through 17 of gestational age using the guanidine isothiocyanate/acid phenol method. In all, 10 µg of total RNA were subjected to first strand cDNA synthesis in a total vol of 66 µl using the First-Strand cDNA Synthesis kit (Pharmacia P-L Biochemicals, Milwaukee, WI). The primers used to amplify murine Fas were 5' primer (sequence: CGCTGTTTTCCCTTGCTGCA) and 3' primer (sequence: ACAGGTTGGTGTACCCCCAT). The primers used to amplify murine Fas ligand were 5' primer (sequence: TCCACAAGGCTGTGAGAA) and 3' primer (sequence: GGAATTCCTGGTGCCCATGAT). The primers used to amplify murine ß-actin were 5' primer (sequence: GACCTGACAGACTACCTCAT) and 3' primer (sequence: AGACAGCACTGTGTTGGCAT). The amplification was performed in a 50-µl reaction vol containing 1x reaction buffer (Promega, Madison, WI), 1.5 mM of MgCl2, 200 µM of dNTPs, 1 µM of each primer, and 2.5 U of Taq DNA polymerase (Promega) using a Perkin-Elmer Gene Amp PCR System 9600 (Norwalk, CT). Each cycle consisted of denaturation at 94°C for 1 min, annealing at 60°C for 1.5 min, and extension at 72°C for 1 min. For semiquantitative analysis of expression of PCR products for Fas and Fas ligand, various numbers of PCR cycles were performed followed by extension for 10 min. The RT-PCR-derived DNA fragments were subjected to electrophoresis on a 0.5% agarose gel. Gels were blotted and hybridized to a [32P]dCTP (Amersham Life Science, Arlington Heights, IL)-labeled cDNA for ß-actin (control), Fas, or Fas ligand to verify specificity of each product. The amount of hybridized probe was quantified by the intensity (cpm) of each specific PCR product on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). The intensity of the specific hybridization signal was plotted against the number of PCR cycles to ensure that comparisons were conducted in the linear range. The ratio of Fas or Fas ligand expression was determined relative to ß-actin gene expression for different PCR cycles. The ratio of Fas or Fas ligand expression was determined relative to ß-actin gene expression for four samples. The error represents the mean ± SEM. Significant differences in the expression patterns are marked by asterisks (p < 0.05, Student’s t test).
Terminal deoxynucleotidyl transferase (TDT)-mediated dUTP nick end labeling (TUNEL)
At least three thymi were obtained from each mouse strain at gestational days 15, 16, and 17 and analyzed. The method was modified slightly from that described previously (37). Briefly, snap-frozen sections of fetal thymic tissue were fixed in 10% formalin for 30 min. After thorough washing with deionized water, the slides were subjected to proteinase K digestion (10 µg/ml at room temperature for 7 min), and then incubated with freshly prepared TDT reaction mix (0.4 U/liter TDT, 10 nM digitonigen modified-dUTP, and TDT buffer, which were purchased from Boehringer Mannheim, Indianapolis, IN) at 37°C for 60 min. The incorporated digitonigen-dUTP was detected by incubation with alkaline phosphatase-conjugated anti-digitonigen Ab at room temperature for 60 min, and positive reactions were revealed using nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate substrate. The percentage of apoptotic cells was estimated using a microscopic grid. At least 10 random independent fields of view on two to four serial sections from each thymus were analyzed to determine the percentage of apoptotic cells.
Immunohistochemical analysis
Immunohistochemical staining was conducted using a direct staining method. Briefly, sections from snap-frozen tissue were fixed in ice-cold acetone for 10 min. After washing, slides were incubated with 5% horse serum in PBS for 20 min and then stained with phycoerythrin-conjugated anti-Fas ligand Ab (PharMingen) for 30 min at room temperature. Sections were analyzed using a fluorescence microscope (magnification x320).
Transmission electron microscopic analysis of apoptotic cells
Fetal thymic tissue was first fixed in 1% glutaraldehyde in 0.1% cacodylate buffer and postfixed with 2% phosphate-buffered osmium tetroxide. After routine dehydration with alcohol and propylene oxide, the tissue was embedded in Spurr low viscosity medium (38). Ultrathin sections (70–100 nm) were counterstained with uranyl acetate and lead citrate and analyzed using a Philips 300 electron microscope (Philips, Mahwah, NJ).
Three-color flow cytometry for analysis of the phenotype of nonapoptotic thymocytes
Staining was performed according to the published procedure (39, 40). Briefly, thymocytes were first stained with phycoerythrin-conjugated CD4-specific mAb for 20 min at 4°C. Thymocytes were washed twice and then further incubated with FITC-conjugated CD8-specific mAb for 20 min at 4°C. For discrimination of apoptotic and nonapoptotic thymocytes, cells were washed and stained with 20 µg/ml of 7-amino-actinomycin D (7-AAD; Calbiochem, San Diego, CA) in PBS on ice for 30 min in the dark. Following washing with PBS, thymocytes were fixed in 1% paraformaldehyde supplemented with 10 µg/ml of actinomycin D. A total of 10,000 nongated cells were analyzed using FACScan (Becton Dickinson, Mountain View, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Fetal thymi of B6 +/+ and B6-lpr/lpr mice were obtained
at days 15 to 17 of gestational age. At least three different pregnant
mice were sacrificed at each time point. The number and distribution of
apoptotic thymocytes was detected in situ by TDT labeling of DNA strand
breaks (TUNEL) in three to five thymic lobes at each time point (Fig. 1
). Thymocytes undergoing apoptosis were
observed at day 15 of gestational age in B6 +/+ mice (Fig. 1). The
apoptotic cells appeared to be confined to scattered individual
thymocytes (Fig. 2A),
mainly located in the more mature medullary region of the thymus (41).
In contrast, only a few or no apoptotic thymocytes could be detected in
thymic tissue of B6-lpr/lpr mice obtained at the same
gestational age. On gestational day 16, clusters of apoptotic cells
were present in the cortex and the region of the corticomedullary
junction in B6 +/+ mice, whereas a few single apoptotic thymocytes were
detected in B6-lpr/lpr mice. Larger clusters of apoptotic
cortical thymocytes and increased numbers of scattered single apoptotic
cells were found at day 17 of gestational age in thymic tissue of both
B6 +/+ mice and B6-lpr/lpr mice (Figs. 1 and 2B). The number of apoptotic thymocytes at each time
point estimated by cell counting in representative regions is shown in
Figure 3.
|
|
|
There was a sixfold increase in Fas mRNA expression in fetal
thymic tissue of B6+/+ mice from gestational days 15
to 17 as estimated by semiquantitative PCR (Fig. 4A). In contrast, Fas
mRNA expression remained at low levels in B6-lpr/lpr mice
(Fig. 4B) and was approximately 1 to 2% of that
observed in B6 +/+ mice at gestational day 17, which is consistent with
our previous report that the levels of Fas expression in adult
B6-lpr/lpr mice are reduced to 1 to 5% of those in B6 +/+
mice (42). The expression of Fas ligand mRNA was highest at gestational
day 15, followed by a ninefold decreased expression by gestational day
17 (Fig. 4C). Thus, in B6 +/+ mice, there was an
inverse correlation between the expression of Fas and Fas ligand during
gestational days 15 to 17. Thymocytes of B6-lpr/lpr mice
continued to express high amounts of Fas ligand mRNA throughout (Fig. 4D), with the expression of Fas ligand mRNA in B6 +/+
mice at day 17 of gestational age being approximately 8% of that
observed in B6-lpr/lpr mice.
|
E) compared with gestational day 18 (Fig. 4F) was also determined by immunohistochemical
staining. There was a focal and scattered distribution of Fas ligand in
the cortex and medulla during fetal thymic development, which
correlated with the foci of apoptotic thymocytes. Anti-Fas Ab-induced apoptosis in thymocytes in situ during FTOC
The data thus far indicate that Fas-mediated thymocyte apoptosis
occurs on gestational days 15 and 16. To determine the location and
frequency of Fas apoptosis-sensitive thymocytes at gestational day 16,
FTOC was conducted for 12 h in the presence or absence of
anti-Fas Ab. Approximately 7% of the B6 +/+ thymocytes cultured
with control Ab exhibited characteristic DNA strand breaks, as
indicated by TDT labeling, compared with approximately 30% of
thymocytes in the anti-Fas Ab-treated FTOC (Fig. 5A). Electron
microscopic analysis confirmed that thymocytes were undergoing a
typical apoptosis process as a consequence of the anti-Fas Ab
treatment, demonstrated by membrane blebbing, cell shrinkage, and
nuclear condensation (Fig. 5B). These results
indicate that on gestational day 16, there are numerous foci of Fas
apoptosis-sensitive thymocytes throughout the entire thymus.
|
Previous reports by us and other investigators indicated that
immature CD4+CD8+ thymocytes that express
low to intermediate levels of CD3 complexes represent the major
thymocyte population that is deleted by Fas-mediated apoptosis (25, 33, 35, 43). To determine the effect of anti-Fas Ab treatment on
thymocytes at an early developmental stage, we added anti-Fas Ab at
the indicated time points of FTOC and then analyzed thymi 12 h
later for anti-Fas-induced apoptosis using 7-AAD, CD4, and CD8
labeling as described (Fig. 6). There was
a gradual increase in the total number of
7-AAD-CD4+CD8+ thymocytes from
20 x 103 to 50 x 103 cells per
thymic lobe during FTOC days 16 to 18 followed by a decrease during
FTOC days 19 to 21. Incubation with anti-Fas Ab did not affect the
initial increase or later decrease in the number of these
CD4+CD8+ thymocytes during the 6 days of FTOC
compared with the control FTOC. Initially, a population of
CD4+CD8+ thymocytes was present that was highly
susceptible to anti-Fas Ab-induced apoptosis (days 16–17). By days
18 to 19 of FTOC, most thymocytes had differentiated into the
CD4+CD8+ phenotype, and were now resistant to
induction of apoptosis after incubation with anti-Fas Ab for
12 h. By days 20 to 21 of FTOC, most of the
CD4+CD8+ thymocytes were resistant to
anti-Fas-induced apoptosis. Treatment with anti-Fas Ab had no
effect on apoptosis of CD4+ or CD8+ thymocytes.
These results indicate that newly generated
CD4+CD8+ thymocytes are highly sensitive to
Fas-mediated apoptosis; however, by day 18 of FTOC, most
CD4+CD8+ thymocytes are no longer susceptible
to Fas-mediated apoptosis.
|
The presence of anti-Fas Ab at gestational day 16 completely
suppressed the development of thymocytes during 6 days of FTOC (Fig. 7A). In contrast, there
was a progressive development of CD4+CD8+
thymocytes followed by development of CD4+ and
CD8+ positive thymocytes in the presence of control Ab.
Inhibition of thymocyte development was due to Fas-mediated apoptosis,
since addition of soluble Fas (1 µg/ml), which can neutralize
anti-Fas Ab, also blocked the ability of anti-Fas Ab to induce
apoptosis.
|
, B and C). Most of the
thymocytes remaining after 6 days of culture with anti-Fas Ab were
CD4-CD8- and Fas-. In contrast,
there was a progressive increase in the survival of thymocytes after 6
days in culture if the addition of anti-Fas Ab was delayed until
days 17 to 20 of fetal age. Thus, a transition in Fas sensitivity
occurred before or during the progression of thymocytes from the
CD4-CD8- to the
CD4+CD8+ phenotype corresponding to day 17 of
FTOC. By day 18 of FTOC, some of the thymocytes had differentiated into
anti-Fas apoptosis-resistant thymocytes, and 14% of the thymocytes
survived to the end of culture. Addition of anti-Fas Ab at days 20
to 21 did not significantly inhibit development of these thymocytes,
indicating that most of these Fas+ thymocytes have become
Fas-apoptosis resistant. This resistance to Fas-mediated apoptosis was
not attributable to decreased Fas expression in that, by day 20,
approximately 82% of the thymocytes exhibited high expression of Fas
Ag but were totally refractory to Fas Ab-induced apoptosis even after
incubation with Fas-specific Ab for 48 h (treated on day 20 and
assayed on day 22) (Fig. 7C). Engagement of TCR rescued double positive thymocytes from anti-Fas-mediated apoptosis
The results thus far demonstrate that Fas-mediated apoptosis in
the thymus is limited to newly generated, early stage
CD4+8+ thymocytes. It has been shown that,
in thymocyte development, high avidity binding of the TCR/CD3 complex
leads to clonal deletion, whereas low avidity binding leads to survival
(44, 45, 46, 47, 48). To determine whether TCR/CD3 signaling might be responsible
for the transition in Fas sensitivity that occurs during the
CD4+CD8+ stage of thymic development, we
performed FTOC that was initiated in the presence of anti-Fas Abs,
and in the presence or absence of different concentrations of
anti-TCR Abs (Fig. 8). Abs were added
at the time of the initiation of culture and the results were
analyzed after 6 days of culture. Treatment with anti-Fas Ab (1
µg/ml) alone prevented the development of
CD4+CD8+, CD4+, and
CD8+ single positive thymocytes and reduced the total
number of thymocytes to 12% of the medium control (Fig. 8A). Treatment with anti-TCR Ab (10 µg/ml)
alone reduced the total number of thymocytes to approximately 30% of
the medium control, and reduced the number of
CD4+CD8+ thymocytes by approximately 60%,
presumably due to TCR/CD3 signaling-mediated deletion (49). On
treatment with both anti-Fas and anti-TCR Ab, the depletion of
CD4+CD8+ thymocytes was decreased compared with
that observed in the cultures treated with anti-Fas Ab alone,
indicating that Fas-mediated apoptosis was inhibited by the addition of
anti-TCR Ab (Fig. 8). Lower concentrations of anti-TCR Ab (0.1
µg/ml) resulted in decreased TCR-induced deletion, representing less
inhibition of Fas-mediated apoptosis. Thus, TCR engagement provides a
survival signal for immature CD4+CD8+
thymocytes by rendering the thymocytes insensitive to
Fas-mediated apoptosis. In contrast, thymocytes that do not receive an
appropriate TCR engagement signal during early development remain
sensitive to Fas-mediated apoptosis.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Histologic examination of FTOC cultured in the presence of anti-Fas Ab at gestational day 16 demonstrated functional Fas expression in approximately 30% of the thymocytes, as these cells underwent apoptosis and apoptotic thymocytes were scattered throughout the thymus. Moreover, kinetic analysis of Fas-mediated apoptosis during FTOC of B6 +/+ mice indicated that immature, newly generated CD4+CD8+ thymocytes were highly sensitive to Fas-mediated apoptosis. However, a transition in Fas sensitivity occurred before or during the progression of thymocytes from CD4-CD8- to CD4+CD8+ phenotype at gestational day 17. This finding was further substantiated by the subsequent development to more mature CD4+CD8+, CD4+, and CD8+ T cells, which were resistant to anti-Fas Ab-induced apoptosis despite high Fas Ag expression. A similar transition from Fas apoptosis sensitivity to resistance occurs during maturation of CD4+CD8+ thymocytes in vivo since all CD4+CD8+ thymocytes express Fas, but only newly generated CD4+CD8+ thymocytes are sensitive to Fas apoptosis. A comparable phenomenon of Fas-apoptosis resistance after Ag receptor engagement has been observed in B cells (51). The clear separation between early stage Fas-sensitive and late stage Fas-resistant CD4+CD8+ thymocytes in the present experiments may be also due to the analysis of thymocyte development using in vitro organ culture. This allowed the analysis of CD4+CD8+ thymocyte development without the complicating effect of new thymic emigrants from the bone marrow to replenish the pool of CD4-CD8- thymocytes and early stage CD4+CD8+ thymocytes, resulting in a gradually diminished rate of transition of CD4-CD8- thymocytes to CD4+CD8+ thymocytes. Depletion of the pool of CD4-CD8- thymocytes may account for the decrease in CD4-CD8- thymocytes at late time points as well as the lack of Fas-mediated apoptosis effect on CD4+CD8+ thymocytes at the end of the culture period. Our interpretation of these data is that there is a window of susceptibility during thymocyte development from gestational days 15 to 17 during which induction of apoptosis by Fas signaling can result in substantial apoptosis.
Previous studies have demonstrated that rearrangement of the TCRß locus begins as the cells differentiate to the CD25+ stage and that the production of the ß-chain of the TCR on double negative thymocytes is required for prepositive selection and further maturation (48, 49, 52, 53). It has been proposed that only a small number of CD4-CD8- thymocytes with productive TCRß rearrangement are selected for further maturation characterized by the loss of CD25 expression, subsequent expression of CD4 and CD8 coreceptors, and rapid proliferation, whereas large numbers of CD4-CD8- thymocytes with nonproductive rearrangement of the TCRß gene die by apoptosis (44, 45, 46, 47, 48, 49). Alternatively, it has been proposed that the number of apoptotic thymocytes is low in early gestational development as only a few apoptotic cells have been detected in fetal thymic tissue (54). Using the TUNEL method for detection, we found apoptotic thymocytes at gestational day 15 in B6 +/+ mice and increasing numbers of apoptotic thymocytes on the following days. Using this technique, we observed significantly lower levels of apoptosis in B6-lpr/lpr mice compared with B6 +/+ mice only on gestational days 15 and 16, but not on gestational day 17. These results are consistent with our previous report of an increase in the percentage of the CD44low IL-2R+ subpopulation of thymocytes in Fas mutant lpr/lpr mice (43), and that the accumulation of peripheral CD4-CD8-B220+ T cells might result from a Fas-related apoptosis defect in early thymocyte development (55).
The finding of apoptotic cells at gestational day 15 is novel and
indicates that Fas plays a role in deletion of thymocytes at a very
early stage of thymocyte development. These thymocytes do not express
CD3 or TCR, so the basis for the selection is unknown. Notably, the
cells undergoing apoptosis at gestational day 15 were located in the
thymic medulla, whereas apoptosis at later stages was detected mainly
in the cortex and the corticomedullary junction. This difference in
anatomic sites may reflect activation of different apoptosis pathways
(41). Previous reports have demonstrated that early thymocytes are
dependent on several cytokines, including IL-1, IL-2, IL-7, and TNF-
(56, 57, 58, 59), and the prevention of apoptosis by endogenous steroids has
been described for thymocytes at an early stage of FTOC (60).
Furthermore, deprivation of cytokines has been demonstrated to render
activated T cells susceptible to Fas-mediated apoptosis (61, 62).
Therefore, it appears possible that cytokine deprivation or lack of
endogenous steroids may contribute to the induction of Fas-mediated
apoptosis in B6 +/+ mice on gestational day 15.
The grouping of apoptotic thymocytes in cortical clusters at gestational days 16 and 17 suggests the elimination of thymocytes that developed from a single precursor clone. Such clonal elimination may be the result of a prepositive selection event in the thymus that invokes apoptosis after 1 to 2 days of thymic development but does not require functional TCR/CD3 expression (52).
A synergistic effect of Fas and TCR/CD3 signaling resulting in
apoptosis has been described in late CD4+CD8+,
CD4+, and CD8+ fetal and adult ß
thymocytes using high concentrations of TCR/CD3 Abs (63, 64). The
present results indicating decreased apoptosis in the presence of
anti-TCR plus anti-Fas Ab in thymocytes do not contradict these
findings, as the antagonistic effect was observed in a different
experimental system using low concentrations of anti-TCR Abs in
cultures of intact thymi and at an earlier stage of development. One
possible mechanism for the decreased apoptosis is that TCR engagement
in early thymocytes might activate downstream inhibitors of
Fas-mediated apoptosis, including Bcl-2 and Bcl-X (65). We propose that
inhibition of Fas-mediated apoptosis by low affinity anti-TCR
signaling on CD3dullCD4+CD8+
thymocytes might be one event associated with survival of thymocytes
during positive selection.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. John D. Mountz, The University of Alabama at Birmingham, Department of Medicine, Division of Clinical Immunology and Rheumatology, 701 South 19th Street, LHRB 473, Birmingham, AL 35294-0007. E-mail address:
3 Abbreviations used in this paper: FTOC, fetal thymic organ culture; 7-AAD, 7-amino-actinomycin D; TDT, terminal deoxynucleotidyl transferase; TUNEL, dUTP nick end labeling.
Received for publication August 28, 1997. Accepted for publication December 18, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/ß+ and abnormal lpr and gld cell populations. J. Exp. Med. 170:1869./ß T cell antigen receptors in autoimmune gld mice. Eur. J. Immunol. 20:723.[Medline]
ß thymocytes. Int. Immunol. 6:73. and IL-1 in fetal thymocyte commitment and differentiation. Science 268:1906.This article has been cited by other articles:
|
|
 |
|
  M. Villa-Morales, J. Santos, E. Perez-Gomez, M. Quintanilla, and J. Fernandez-Piqueras A Role for the Fas/FasL System in Modulating Genetic Susceptibility to T-Cell Lymphoblastic Lymphomas Cancer Res., June 1, 2007; 67(11): 5107 - 5116. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Brown, M. Nagarkatti, and P. S. Nagarkatti Induction of Apoptosis in Murine Fetal Thymocytes Following Perinatal Exposure to Diethylstilbestrol International Journal of Toxicology, January 1, 2006; 25(1): 9 - 15. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. A. Camacho, M. Nagarkatti, and P. S. Nagarkatti Evidence for Induction of Apoptosis in T Cells from Murine Fetal Thymus following Perinatal Exposure to 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) Toxicol. Sci., March 1, 2004; 78(1): 96 - 106. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Marchetti, B. Di Marco, G. Cifone, G. Migliorati, and C. Riccardi Dexamethasone-induced apoptosis of thymocytes: role of glucocorticoid receptor-associated Src kinase and caspase-8 activation Blood, January 15, 2003; 101(2): 585 - 593. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Bonzon and H. Fan Moloney Murine Leukemia Virus-Induced Tumors Show Altered Levels of Proapoptotic and Antiapoptotic Proteins J. Virol., September 1, 2000; 74(17): 8151 - 8158. [Abstract] [Full Text]
|
|
|
|
 |
|
 S. Kurebayashi, E. Ueda, M. Sakaue, D. D. Patel, A. Medvedev, F. Zhang, and A. M. Jetten Retinoid-related orphan receptor gamma (RORgamma ) is essential for lymphoid organogenesis and controls apoptosis during thymopoiesis PNAS, August 29, 2000; 97(18): 10132 - 10137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Lin, L. Genestier, M. J. Pinkoski, A. Castro, S. Nicholas, R. Mogil, F. Paris, Z. Fuks, E. H. Schuchman, R. N. Kolesnick, et al. Role of Acidic Sphingomyelinase in Fas/CD95-mediated Cell Death J. Biol. Chem., March 17, 2000; 275(12): 8657 - 8663. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. R. Ludviksson, R. O. Ehrhardt, and W. Strober Role of IL-12 in Intrathymic Negative Selection J. Immunol., October 15, 1999; 163(8): 4349 - 4359. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Jenkins, M. Keir, and J. M. McCune Fas Is Expressed Early in Human Thymocyte Development But Does Not Transmit an Apoptotic Signal J. Immunol., August 1, 1999; 163(3): 1195 - 1204. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Nataf, N. Davoust, R. S. Ames, and S. R. Barnum Human T Cells Express the C5a Receptor and Are Chemoattracted to C5a J. Immunol., April 1, 1999; 162(7): 4018 - 4023. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
