The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martin, F.
Right arrow Articles by Kearney, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martin, F.
Right arrow Articles by Kearney, J. F.
The Journal of Immunology, 1998, 160: 3748-3758.
Copyright © 1998 by The American Association of Immunologists

Generation of the Germline Peripheral B Cell Repertoire: VH81X-{lambda} B Cells Are Unable to Complete All Developmental Programs1

Flavius Martin, Woong-Jai Won and John F. Kearney2

Division of Developmental and Clinical Immunology, Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL 35394


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The generation of VH81X heavy chain {lambda}-light chain-expressing B cells (VH81X-{lambda}+ B cells) was studied in VH81X heavy chain transgenic mice as well as in VH81X JH -/- and VH81X JH -/- Ck -/- mice, in which competition resulting from expression of heavy and light chains from the endogenous heavy and {kappa} light chain loci was prevented. We show that although {lambda} light chain gene rearrangements occur normally and give rise to light chains that associate with the transgenic heavy chain to form surface and soluble IgM molecules, further B cell development is almost totally blocked. The few VH81X-{lambda}+ B cells that are generated progress into a mature compartment (expressing surface CD21, CD22, CD23, and low CD24 and having a relatively long life span) but they also have reduced levels of surface Ig receptor and express higher amounts of Fas Ag than VH81X-{kappa}+ B cells. These VH81X-{lambda}+ B cells reach the peripheral lymphoid organs and accumulate in the periarteriolar lymphoid sheath but are unable to generate primary B cell follicles. In other heavy chain transgenic mice (MD2, M167, and M54), {lambda}+ B cells are generated. However, they seem to be preferentially selected in the peripheral repertoire of some transgenic heavy chain mice (M54) but not in others (MD2, M167). These studies show that a crucial selection step is necessary for B cell survival and maintenance in which B cells, similar to T cells, receive signals depending on their clonal receptors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bcell repertoire development is controlled by a variety of molecular and cellular mechanisms that continue throughout the progression of the B lineage, from early committed progenitors to mature B cells. Immediately after the Ig heavy chain is generated by the initial rearrangement process in pre-B cells, these mechanisms begin to reshape the repertoire by selection against certain reading frames for or against certain CDR3 regions (1, 2) and by the selective expression of particular VH regions (3, 4, 5). Following the generation of an Ig light chain and the formation of a B cell receptor, other mechanisms ensure that the complete clonal signaling unit functions properly and that B cells with potentially harmful self-reactive receptors are purged from the repertoire by negative selection, through deletion and functional silencing (6, 7, 8, 9, 10, 11) or by a change in their specificity resulting from receptor editing (12, 13, 14, 15, 16, 17). Positive selection has also been postulated to shape the B cell repertoire (18, 19), and although indirect and direct evidence supports the need for positive signals in B cell generation (20, 21, 22, 23, 24, 25), the mechanisms involved are still unknown. The exact relationship between positive and negative selection during early B cell generation is unclear, but these opposing selective forces continue throughout the entire B cell life span and involve not only B cell receptor signaling (26, 27, 28), but also cosignals received from other cells of the immune system (26, 29, 30) and competition between B cell clones (31, 32).

Many of these repertoire-shaping mechanisms have been demonstrated in elegant transgenic mice models in which the cellular steps and location of the selecting events were relatively easy to follow. Most of the Ig transgenes used in these experiments were derived from B cells in peripheral lymphoid organs that were rescued as hybridomas after immunization with relevant Ags. As expected, B cells with receptors encoded by these transgenes recapitulate the behavior of the B cells from which the transgene originated and enter the peripheral B cell repertoire unless negatively selected by interactions with self (neo)antigens (33, 34). However, some of the selection events that normally occur at the transition from newly formed to mature B cells may be absent when using this kind of transgene-expressing B cells. In addition, it is clear from studies of nontransgenic B cells that the avidity/affinity of the B cell receptor-Ag interaction is a major factor controlling responses in vivo (35, 36). Transgenic Ig receptors used as models for B cell selection are generally of higher affinity for their nominal Ag than are B cell receptors expressed from germline immunoglobulin genes. A germline-encoded, relatively low affinity receptor is more likely to require selection steps that have already been experienced by a somatically mutated, high affinity, Ag-selected B cell receptor, and thus the progression of B cells expressing such a transgene may be more similar to the physiologic in vivo process. Although it was shown for membrane-expressed Ags that negative selection by central deletion of self-reactive B cells occurs efficiently even at very low surface Ig affinity for Ag (37, 38), it is not known whether different categories of self Ags (transiently expressed, nonprotein, etc.) will produce different outcomes for B cells generated with such specificities.

Using a VH81X-µ transgenic mouse (39, 40), we have analyzed selection events involved in the emergence of the preimmune B cell repertoire focusing on the crucial transition from pre-B to immature and mature B cells. In this model, B cells express a nonmutated VH81X-DFL16.1-JH1 rearranged heavy chain, which was derived from a day 17 fetal liver hybridoma representative of the immature B cell repertoire (41). This heavy chain has the potential to pair freely with light chains derived from the germline-encoded light chain repertoire, and, in this report, we have studied the development of B cells in which the transgene is associated with {lambda} light chains. By using heavy and {kappa} chain locus knock-out mice, we have restricted the association of the heavy chain transgene to {lambda} light chains, which contain only three V{lambda} genes, so that B cells expressing these combinations can be easily followed at both cellular and molecular levels.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and cell lines

Eight- to twelve-week-old BALB/c and C57BL/6 mice for breeding were purchased from Charles River Laboratories (Raleigh, NC). The generation of VH81X lines was described previously (39, 40). All other knockout and transgenic mice were generous gifts of Drs. D. Huszar (JH -/- and JH -/- C{kappa} -/- mice), C. C. Goodnow (C57BL/6 MD2 transgenic mice), J. J. Kenny (C57BL/6 M167 transgenic mice), and R. R. Hardy (CB17 M54 transgenic mice). Screening of the VH81X JH -/- C{kappa} -/- was made on genomic tail DNA with the following primers for VH81X, JH, C{kappa}, and Neo: 5'-VH81X, CGCGCGGCCGCGTGGAGTCTGGGGGAGGCT; 3'-VH81X:CCCAGACATCGAAGTACCAGCTACTACCATG; 5'-JH, GAACAGAGGCAGAACAGAGACTGTG; 3'-JH, ACCTGAGGAGACTGTGAGAGTGGTG; 5'-Ck, CACTGTGATTCACGTTCGGCTCG; 3'-Ck, AACGTCTAGAAGACCACGCTAC; 5'-Neo, CTGAAGAGCTTGGCGGCGAAT; 3'-JH -/-, GACTCCACCAACACCATCACACAGA; and 3'- Ck -/-, CATGTAGTGGACAGCCAACC. Mice were housed in accordance with institutional policies for animal care and usage. All experiments used 8- to 16-wk-old adults unless otherwise specified. CH12 (42) and J558L and J558L-µM3 (43) cell lines were previously described. VH81X-{lambda} hybridomas were generated from three individual adult mouse spleens as previously described (39).

Abs and flow cytometry analysis

The anti-µ chain allotype Abs anti-IgH6a (RS3.1) and anti-IgH6b (MB86) were described previously (44). Fluorescein-conjugated anti-B220 (RA3-6B2), anti-CD43 (S7), anti-heat-stable Ag (HSA)3 (M1/69), and anti-CD22 (Cy34.1); PE-conjugated anti-B220 (RA3-6B2) and anti-Fas (Jo2); biotin-conjugated anti-CD23 (B3B4), anti-HSA (M1/69), anti-CD4 (L3T4), and anti-CD8a (53-6.7); anti-B220 (RA3-6B2) conjugated to Cychrome; and APC and streptavidin (SA)-APC were purchased from PharMingen (San Diego, CA). Fluorescein- and rhodamine-conjugated goat anti-mouse µ, phycoerythrin (PE)-conjugated goat anti-mouse {lambda} and {kappa}, SA-PE, and SA-PECy5 were purchased from Southern Biotechnology, Birmingham, AL. The anti-CD21 (7G6) Ab-secreting hybridoma (45) was obtained from Dr. Michael Holers (University of Colorado Health Science Center, Denver, CO). The purified Ab was biotinylated in our laboratory, and the anti-CD21 PE was conjugated at Southern Biotechnology. Anti-CD19 hybridoma (1D6) was a gift from Dr. Douglas Fearon (University of Cambridge, Cambridge, U.K.). In addition to the preceding, we used biotinylated JC5-1 (rat anti-mouse {lambda}), produced and characterized in our laboratory. Two-, three-, and four-color surface staining was performed as previously described (44). Briefly, 106 cells were first incubated with a mixture of fluorescein-, PE-, biotin-, and APC-conjugated Abs, followed by SA-PECy5, 15 min for each incubation. The cells were washed with 1% BSA/PBS between steps. For cytoplasmic staining, cells were first permeabilized with 0.5% paraformaldehyde in PBS for 30 min followed by 0.2% Tween 20 in PBS for 20 min. BrdU incorporation was analyzed in animals fed BrdU in the drinking water, as previously described (46), by staining the spleen cells for B220 and {lambda} expression as well as staining with the anti-BrdU Ab (B44-FITC, Becton Dickinson, Mountain View, CA). Data from stained cell samples were acquired on a FACScan or FACSCalibur (with dead cells excluded using propidium iodide) using Lysis II or CellQuest (Becton Dickinson) and analyzed with WinList 2.01 (Verity Software House, Topsham, Maine) and WinMDI 2.0 (Trotter@scripps.edu) software programs.

Immunofluorescence of tissue sections

Spleens embedded in OCT compound (Lab-Tek Products, Naperville, IL) were flash frozen in liquid nitrogen. Frozen sections were cut, air dried, and fixed in ice cold acetone, blocked with normal horse serum, and stained. The following anti-mouse Abs and secondary reagents were used: biotinylated anti-CD4 (L3T4) and anti-CD8a (53-6.7) (PharMingen); goat anti-mouse µ-RITC and goat anti-mouse {lambda}-FITC (Southern Biotechnology,); and SA/7-amino-4-methylconmarin-3-acetic acid (Vector, Burlingame, CA). Sections were washed and mounted in Fluormount G (Southern Biotechnology) or Gel/Mount (Biomeda, Foster City, CA), then viewed with a Leica/Leitz DMRB microscope equipped with appropriate filter cubes (Chromatechnology, Battleboro, VT). Images were acquired with a C5810 series digital color camera (Hamamatsu Photonic System, Bridgewater, NJ) and processed with Adobe Photo Shop and IP LAB Spectrum software (Signal Analytics Software, Vienna, VA).

ELISA

ELISA A/2 plates (Costar, Cambridge, MA) were coated with unlabeled goat anti-mouse µ Ab at 2 µg/ml in borate buffer (pH 9) and incubated at 4°C overnight, followed by serial dilutions of the transfectant supernatants or of control Ab (B1–8, mouse µ{lambda}, starting at 0.5 µg/ml) in 1% PBS-BSA and incubation at 37°C for 2 h. Alkaline phosphatase-conjugated goat-mouse {lambda} Ab was used as the third-layer Ab and incubated for 2 h at 37°C. Between each step, the plate was washed five times with PBS. The plate was developed with alkaline phosphatase substrate (Sigma, St. Louis, MO) at 1 mg/ml in substrate buffer (pH 9.0). The plates were read on a Titertek spectrophotometer at 405 nm, and after 10 min, the OD of each well was plotted as a curve (see Fig. 6GoA).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. VH81X heavy and {lambda}1 light chains can form secreted and membrane associated IgM molecules that do not seem to be self-reactive. A, Detection of µ-{lambda} IgM molecules by capture ELISA. Serial dilutions of supernatants from J558L ({lambda}1), VH81X-J558L transfectant, and B1–8 (control J558-{lambda}1) were captured on plates coated with goat anti-mouse µ and developed with goat anti-mouse {lambda} Abs. B, Surface expression of VH81X-{lambda}1 molecules in J558L cells cotransfected with VH81X and mb-1 molecules. C, VH81X-{lambda} Abs lack self-reactivity to splenocytes. Mouse spleen cells were stained cytoplasmically with a negative control IgM Ab (thin lines), VH81X-{lambda} (from either the transfectant or the VH81X kHD spleen-derived hybridomas), or VH81X-V{kappa}1C (positive control; Ref. 39) Abs (thick lines).

 
RT-PCR and sequence analysis of {lambda} gene expression

RBC-depleted bone marrow or spleen cells (3–5 x 106) were used to extract RNA. B lineage cells (104-5 x 104; {lambda}- or {lambda}+) were directly sorted into reaction tubes on a FACStarPlus (Becton Dickinson). Total RNA was extracted using Tri-Reagent (Molecular Research Center, Cincinnati, OH), and similar amounts of RNA were reverse-transcribed with 500 ng oligo(dT), dNTPs (5 mM), 20 U of RNAsin (Promega, Madison, WI), and 100 U of AMV reverse transcriptase (Life Technologies, Gaithersburg, MD) in a total buffer volume of 25 µl. PCR was performed using primers and conditions for ß-actin, mb-1, and different {lambda} rearrangements as previously described (47, 48). The samples were electrophoresed on a 0.8% agarose gel and blotted onto Nytran membranes (Schleicher & Schuell, Keene, NH). The membranes were prehybridized at 42°C (6x SSC, 0.25% SDS, 2x Denhardt’s solution, and 100 µg/ml denatured salmon sperm DNA), then hybridized using 32P end-labeled internal probes for MB-1 (5'-CATGGTGGTTCAGCCTTCAGTCT-3'), {lambda} (48), and ß-actin as described (47). Blots were washed in 6x SSC and 0.1% SDS, then scanned with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) to detect signal intensity, and finally exposed to photographic film. In the case of sorted cells, if sequence analysis of {lambda}1 rearrangements was desired, a nested amplification was performed using the 5' V{lambda}1 and V{lambda}12 (48). For sequence analysis of {lambda}1 junctions, PCR products were cloned using a T/A cloning kit (Invitrogen, San Diego, CA), and sequencing was performed in the University of Alabama at Birmingham automated sequencing facility.

Transfection of J558L cell line

The same VH81X construct used to generate transgenic mice was cotransfected with a Neo construct (gift of Charles Mashburn, Howard Hughes Medical Institute, Birmingham, AL) into J558L as previously described (43). As control, we used a human VH4-Neo (gift of Dr. Thomas Kipps, University of California San Diego, CA). Subsequently, an mb-1-hygromicin B construct (kind gift of Dr. Michael Reth, Max Planck Institute, Freiburg, Germany) was introduced in stable transfectants selected in the first round. Selection was conducted in 1 mg/ml neomycin (Sigma) and/or 1.2 mg/ml hygromicin B (Calbiochem, San Diego, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
VH81X transgenic heavy chains in association with {lambda} light chains do not promote efficient B cell development

Splenic {lambda}+ B cells in VH81X transgenic mice were fewer in number compared with nontransgenic littermates (1.3 ± 0.5% vs 4.3 ± 1.2% of the lymphoid gate, n = 12) (Fig. 1GoA). By analyzing B220+ cells in transgenic and littermate mice, a small but consistent population of {lambda}+ B cells was easily detectable (3.1 ± 0.8% vs 8.5 ± 1.5% of the B cell gate, n = 12) (Fig. 1GoB). This phenotype was seen in two lines of VH81X transgenic mice, one with a single copy (Fig. 1GoA) and the other with approximately 12 copies (data not shown) of the transgene, on both BALB/c and C57BL/6 backgrounds. In all of the following experiments, the single-copy transgenic line was used, but identical results were obtained in experiments done with the multiple-copy line.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 1. {lambda}+ B cells in VH81X H +/+, VH81X H -/- transgenic and littermate mice. A, Splenic or peritoneal cells from C57BL/6 VH81X transgenic and littermate mice were stained with RS3.1 (anti-IgH6a) or MB.86 (anti-IgH6b) and with anti-{lambda} Abs. {lambda}+ B cells are reduced in number in the transgenic spleen and peritoneum compared with the littermate mice. In the peritoneum, most of the {lambda} B cells do not express the transgenic IgH6a. B, Spleen cells were stained with anti-B220, anti-IgM, and anti-{lambda} Abs; and B220+ B lineage cells are displayed. {lambda}+ B cells are entirely missing in VH81X JH -/- transgenic mice (TG H -/-).

 
It can be seen that although there were few splenic {lambda}+ B cells in the transgenic mice, a clear population of {lambda}+ B cells was detected in the peritoneal cavity. However, the majority of the {lambda}+ B cells in the peritoneal cavity did not express the IgH6a transgenic heavy chain (Fig. 1GoA) and did express endogenous IgH6b heavy chains (data not shown). In the peritoneum of transgenic mice, the overall percentage of {lambda}+ B cells within both the lymphoid gate (4 ± 1% vs 11.5 ± 1.7%) and B cell gate (8.8 ± 1.5% vs 15.7 ± 2%) (n = 12) was lower than in the littermate mice. The few {lambda}+ B cells in VH81X transgenic mice are not allelically excluded, suggesting that endogenous heavy chain rearrangements have rescued B cells that express the transgene and {lambda} light chains.

To examine this possibility, a nonfunctional endogenous heavy chain locus was introduced by breeding the VH81X transgenic mice onto the JH -/- background (49). As seen in Figure 1GoB, elimination of functional endogenous heavy chains abolishes the development of splenic {lambda}+ cells in VH81X JH -/- transgenic mice. There are also no {lambda}+ B cells in the peritoneal cavity of the VH81X JH -/- transgenic mice (data not shown). In contrast to the failure of {lambda}+ B cell development, comparable B cell populations associated with a wide variety of {kappa} light chains develop in JH +/+ and JH -/- transgenic mice (39) pointing to a selective defect in the generation of VH81X-{lambda}+ B cells.

The absence of VH81X-{lambda} B cells is not due to their inability to compete with VH81X-{kappa} B cells

To determine whether any VH81X-{lambda}+ B cells could be formed, we generated VH81X JH -/- C{kappa} -/- mice (VH81X kHD). In this case, the entire B cell receptor repertoire is formed by the association of the transgenic heavy chain with light chains derived from the remaining functional endogenous {lambda} locus. In VH81X kHD mice, the VH81X transgene promotes the transition of large B220+CD43+ pro-B cells into small B220+CD43- pre-B cells (Fig. 2GoA). Although small CD43- pre-B cells are generated in comparable numbers in the bone marrow of VH81X kHD and VH81X JH +/- C{kappa} -/- (Fig. 2GoA) mice, only the latter develop a substantial {lambda}+ B cell population in the bone marrow (not shown), spleen (10.5 ± 2% of the lymphoid gate, n = 6) and peritoneal cavity (38 ± 9% of the lymphoid gate, n = 6) (Fig. 2GoB). In the VH81X kHD mice, in contrast to the JH -/- C{kappa} -/- (kHD) mice in which no {lambda}+ cells are found, a small but detectable population of {lambda}+ cells is found in both bone marrow (data not shown) and spleen (0.25 ± 0.05% of the lymphoid gate, n = 6). However, most of these B cells express 10- to 20-fold lower levels of surface {lambda} light chains than normal B cells, as determined by flow cytometry.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 2. Development of VH81X-{lambda}+ B cells is blocked in VH81X JH -/- k-/- transgenic mice (VH81X kHD). A, Bone marrow cells were stained with anti-B220, anti-CD43, and anti-IgM. The surface IgM-negative lymphoid cells were gated and their B220/CD43 profiles displayed. The VH81X transgene can promote normal development of pre-B cells (B220+ CD43-) in the absence of endogenous H and {kappa} loci. B, Spleen and peritoneal cavity (PEC) cells are stained with anti-B220 and anti-{lambda}. Small amounts of {lambda}low B cells can be detected in the spleen but not in the peritoneal cavity of VH81X kHD mice.

 
Although it is clear that the activity of a single intact endogenous heavy chain locus together with the transgenic heavy chain permits {lambda}+ B cells to develop, B cell development is abnormal, since a significant population of B220+{lambda}- pro-/pre-B cells are present in the spleens of adult VH81X JH +/- C{kappa} -/- mice (Fig. 2GoB). The low level-expressing {lambda}+ cells were below detection limits in the peritoneum of the VH81X kHD mice (Fig. 2GoB). These data confirm the observations made in VH81X and VH81X JH -/- mice and show conclusively that there is a block in the development of VH81X-{lambda}+ B cells.

VH81X-{lambda}+ B cells are lost after the pre-B/B cell interface

Although a normal-sized small pre-B cell compartment is present in the bone marrow of the VH81X kHD mice (Fig. 2GoA), only a very small number of {lambda}+ B cells develop, suggesting that there is a block in B cell progression at an immature B cell stage.

Immunohistologic analysis of spleen sections (Fig. 3Go, A–D) shows that pre-B/B cells from the VH81X kHD mice that have either migrated from the bone marrow or developed in the spleen appear to be localized in the T cell-rich areas around the arterial vessels (periarteriolar lymphoid sheath (PALS)) (Fig. 3Go, B and D). However, in contrast to B cells from VH81X JH +/- C{kappa}-/- (Fig. 3GoA) they do not accumulate further outside the distal PALS to form primary B cell follicles. Both cytoplasmic µ only pre-B cells and {lambda}+ B cells are found in the PALS, albeit at a low frequency (Fig. 3Go, D1 and D2). Most of the B cells in VH81X kHD mice probably die in situ at this stage since there is no appreciable accumulation of surface IgM/{lambda} high B cells elsewhere in lymphoid organs of these mice (Figs. 2GoB and 3B).



View larger version (133K):
[in this window]
[in a new window]
 
FIGURE 3. Immunohistologic analysis of splenic compartments in VH81X kHD and littermate mice. Frozen sections were stained for T cells (blue, anti-CD4+anti-CD8), µ heavy chains (red), and {lambda} light chains (green). B cell follicles can be detected at the periphery of the T cell zones in TG JH+/- C{kappa}-/- mice (A), while no B or pre-B cells can be seen in LM JH -/- C{kappa} -/- mice (C). µ+ cells (red) can be seen in the T cell zone of TG JH-/- C{kappa} -/- mice (B). Individual pre-B and B cells can be detected in the T cell zones of VH81X kHD mice (D1 and D2). The same microscopic field from VH81X kHD spleen is represented in both D1 (green filter) and D2 (red and blue filters) and reveals {lambda}+ B cells (green, arrows in D1), which are also µ+ (red in D2), and pre-B cells (µ+{lambda}-, arrows in D2). ca, central artery. Original magnification is x40 in A, B, and C and x100 in D1 and D2.

 
Most of the {lambda}+ B cells detected in VH81X kHD mice have a mature phenotype

We next determined if the small numbers of {lambda}+ B cells that are generated, accumulate to greater numbers in the spleens of old VH81X kHD mice. Mice up to 12 mo of age were analyzed and as seen in Figure 4GoA, a large normal B cell population never develops. The splenic B cell compartment, determined by flow cytometry as the proportion of B220+ cells within the lymphoid gate, is similar between 12-wk-old (4.13 ± 0.5%, n = 6) and 12-mo-old (4.33 ± 0.8%, n = 3) mice. Since B lymphopoiesis is considerably diminished in old mice, pre-B cells decline in numbers, so that in a B cell compartment of similar size, there are proportionally more {lambda}low B cells (6.05 ± 0.9% at 12 wk vs 43.5 ± 5.1% at 12 mo). Surprisingly, phenotypic analysis of these {lambda}low B cells revealed that most of them express several surface markers typical of mature B cells. Although surface IgM and {lambda} are very low on these cells, they express CD21, CD22, CD23 (the majority), and CD24 (HSA) at levels similar to mature follicular B cells (Fig. 4GoB). In addition, by measuring their BrdU incorporation in vivo over a period of 7 and 14 days, only 20 and 33%, respectively, were labeled (Fig. 4GoB), in contrast to bone marrow-derived newly formed B cells that are all labeled within 3 to 4 days (50). To gain insight into the mechanisms that remove these cells that have a phenotype and life span more similar to long-lived recirculating B cells than to newly formed B cells, we analyzed their expression of Fas Ag. As seen in Figure 4GoC, VH81X-{lambda}+ B cells (TG H-/- {kappa}-/-), which express CD23, have higher levels of Fas than VH81X-{kappa}+ B cells (TG H -/- {kappa}+/-), providing a possible explanation for their disappearance.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 4. Characterization of the {lambda}+ B cells in VH81X kHD mice. A, VH81X-{lambda}+ B cells do not accumulate with age. Spleen cells from adult (12 wk) and old (12 mo) VH81X kHD (TG, H-/-, k-/-) mice were stained with anti-B220 and anti-{lambda} Abs. Gates indicate B220+{lambda}low and B220+{lambda}- compartments (see text). B, Phenotype of B220+{lambda}low and B220+{lambda}- compartments from A in VH81X kHD mice. Spleen cells were stained as in A, plus one of the indicated markers and the two indicated gates displayed as histograms. BrdU histograms are representative for mice fed BrdU for 14 days. C, VH81X-{lambda}+ B cells express higher levels of Fas Ag than VH81X-{kappa}+ B cells. Spleen cells from mice with the indicated genotypes were stained with anti-CD23, anti-Fas, and anti-CD19 Abs; live (propidium iodide-negative) CD19+ cells are displayed. The profiles are representative of three independent experiments.

 
All of the above data show that there is a major block in further development of the VH81X-{lambda}+ B cells after the pre-B/B cell interface. Few pre-B cells develop into B cells, which express low levels of surface IgM, fail to organize into B cell follicles, and fail to generate a numerically normal B cell compartment. However, the maturation program of these B cells seems partially intact, since they express surface markers characteristic of normal mature B cells, but they also express higher levels of Fas.

The developmental block In VH81X-{lambda}+ B cells is not due to abnormal {lambda} rearrangements or failure of heavy cbain-light chain pairing

Because of the genetic features of our transgenic model, we next determined whether the {lambda} rearrangements giving rise to {lambda}+ B cells are representative of the normal {lambda} repertoire. Robust rearrangements at the {lambda} locus involving all V{lambda} segments can be detected in the bone marrow of the VH81X kHD mice (Fig. 5Go). Such rearrangements are not seen at this level of sensitivity in kHD nontransgenic littermates. We also sequenced a panel of V{lambda}1-J{lambda}1-C{lambda}1 splenic rearrangements from mice with the genotypes described in Figure 5Go. From the heterogeneity observed at the V{lambda}1-J{lambda}1 junctions, it is clear that these rearrangements are derived from a polyclonal set of B cells (Table IGo). The most frequent junctions (A, B, and C) in all of the experimental mice are the same as previously reported in normal BALB/c mice (48, 51, 52). These experiments show that abnormal rearrangement or transcription of {lambda} light chain genes does not account for the observed developmental block in the VH81X kHD mice. In addition, since low levels of {lambda} protein are detected both on the cell surface (Figs. 2GoB and 4A) and in cytoplasm (Fig. 3GoD1), these mice can also translate the {lambda} message into protein.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 5. Analysis of {lambda} rearrangements in the bone marrow of VH81X kHD and littermate mice. {lambda} Rearrangements were amplified from cDNA using specific primer pairs for V{lambda}1-C{lambda}1, V{lambda}1-C{lambda}3+V{lambda}2-C{lambda}2, or V{lambda}x-C{lambda}2. mb-1 cDNA was amplified as a positive B lineage marker. CH12-{kappa}+ (lane 2) and J558L {lambda}+ (which has a functional V{lambda}1-C{lambda}1 and a nonfunctional V{lambda}1-C{lambda}3; lane 3) lines were used as controls. Rearrangements can be detected in VH81X TG H -/- k -/- (lanes 5 and 6) and in all littermates except non-TG H -/- k -/- mice (lanes 7 and 8).

 

View this table:
[in this window]
[in a new window]
 
Table I. The {lambda}1 junction of splenic B lineage cells from VH81 x kHD (H -/-, k -/-, TG+) and littermates as well as from VH81 x kHD-sorted B220+{lambda}- and B220+{lambda}low populations1

 
A second possibility for the observed block in development may be the impaired ability of the VH81X heavy chain polypeptide to pair with {lambda} light chains. To study this possibility, we transfected the VH81X heavy chain into the J558L plasmacytoma variant, which has a commonly expressed functional V{lambda}1-J{lambda}1-C{lambda}1 rearrangement (type A in Table IGo) but no heavy chain (53). VH81X-{lambda}1 protein secreted by these transfectants was detected in the supernatant (Fig. 6GoA) by a standard capture ELISA (captured with anti-µ and developed with anti-{lambda} Abs). The VH81X-{lambda}1 IgM Ab was also purified on an anti-IgH6a Sepharose column, and when analyzed on reducing and nonreducing SDS-PAGE gels, appeared to be intact and of the appropriate size (data not shown). In parallel, we generated five VH81X-{lambda} hybridomas from three different VH81X kHD mice, and all were able to secrete VH81X-{lambda} Abs. Although these experiments prove that the VH81X heavy chain can associate with {lambda} as a secreted Ab, it was essential to determine the ability of the two proteins to form a surface receptor. Due to the lack of Ig-{alpha} protein, J558L-VH81X stable transfectants do not express a surface IgM receptor (Fig. 6GoB), as described previously for other heavy chains (53). However, after transfection of the mb-1 cDNA into J558L-VH81X cells, surface expression of IgM receptors was detected in several independent lines at levels comparable with J558L cells expressing a VH4 human µ chain used as control (Fig. 6GoB) and with the J558L-µM3 previously described (43). From this in vitro system, we conclude that surface expression of the VH81X heavy chain-{lambda} light chain complex can occur and that failure of surface receptor expression is unlikely to be the cause of the block in VH81X-{lambda}+ B cell development. Since {lambda}1 represents the majority of {lambda} rearrangements (~=70%), and the junction A (Table IGo; used in the J558L {lambda} chain and repeatedly isolated in the analysis of our mice) is the most commonly used junction in all {lambda} Abs (48), these data provide evidence for the ability of the VH81X µ chain to pair with the available {lambda} light chains in vivo.

A final and most likely explanation for the developmental block is that the VH81X-{lambda} B cell receptor delivers a negative or inappropriate (lacking positive selection) signal to the emerging B cell, preventing further maturation. We next screened the VH81X-{lambda} IgM Abs from a transfectoma and hybridomas on different mouse tissues and cell lines by methods used in our laboratory to identify self-reactive Abs, but no self-reactive Abs were found (Fig. 6GoC). Although the VH81X-{lambda}1 Ab has multireactive specificities as assayed by Western blots of mouse tissue lysates (P. Zimmer and J.F.K., unpublished results), the pattern is similar to other VH81X-{kappa} control Abs isolated from hybridomas derived from mature splenic B cells in VH81X transgenic mice. Furthermore, the VH81X-{lambda} repertoire is polyclonal (V{lambda}1-J{lambda}1-C{lambda}1, V{lambda}1-J{lambda}3-C{lambda}3, V{lambda}2-J{lambda}2-C{lambda}2, V{lambda}x-J{lambda}2-C{lambda}2 each with junctional diversity), and it seems unlikely that all possible VH81X-{lambda} combinations form self-reactive receptors that ensure deletion of all B cells expressing these receptors. As a way of assaying at a molecular level whether there is selection of the array of potential {lambda} chains between the pre-B compartment in which the {lambda} light chain genes rearrange and the more mature B cells, we sorted B220+{lambda}- and B220+{lambda}low cells from the VH81X kHD spleens and compared the {lambda} rearrangements found in these two populations. A similar polyclonal repertoire containing {lambda}1, {lambda}2, {lambda}3, and {lambda}x was found in both populations (data not shown), and sequence analysis of the {lambda}1 rearrangements revealed the same major hierarchical representation of junctions in both populations (Table IGo, last two columns). These results collectively argue against a large scale negative selection step between the pre-B cell compartment, which is normal in size, and the drastically reduced in size B cell compartment, suggesting that the entire polyclonal VH81X-{lambda} repertoire is blocked in development at this point.

Is the VH81X-{lambda} developmental block unique for the VH81X transgene?

To compare the ability of Ig heavy chain transgenes to generate {lambda}+ B cells, we studied other independently derived µ transgenic mice. Although it is known that several µ transgenes—MD2, 3H9, anti-H2K, and M54—generate mature {lambda}+ B cells, a comparative analysis between these individual transgenic mice has not been performed (12, 37, 54, 55, 56). We compared the abundance of {lambda}+ B cells within the splenic B220+ compartment of VH81X, M167 (57), MD2 (6), and M54 (58) transgenic mice (Fig. 7Go). In the VH81X, MD2, and M167 lines, 20 to 55% fewer {lambda} B cells are present in the transgenic vs the littermate mice (Fig. 7Go). As shown above, in the case of VH81X, all of these {lambda}+ B cells are rescued by an endogenous heavy chain rearrangement. Both the anti-HEL heavy chain (MD2 transgenic mice) and the M167 heavy chain (M167 transgenic mice) can generate transgene-{lambda}+ B cells (37, 59). The reduction in the number of {lambda}+ B cells in the VH81X, MD2, and M167 transgenic mice compared with littermates (Fig. 7Go) suggests that in the establishment of the mature repertoire, transgenic B cells expressing {kappa} light chains are at an advantage. An opposite situation is apparent in the CB17 M54 mice, in which more {lambda}+ B cells are present in the transgenic (10.3 ± 1.5%) than littermate (4.2 ± 0.9%) mice, suggesting that in this case the M54 heavy chain {lambda}+ B cells have a selective advantage. Interestingly, the original hybridomas from which the transgenic heavy chains were derived are all {kappa} with the exception of M54, which was derived from a {lambda}-producing anti-nitrophenyl-acetyl (NP) hybridoma (58).



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 7. Development of {lambda}+ B cells in the spleen of several µ transgenic mice (VH81X, M167, MD2, M54). A, Spleen cells stained with anti-IgM, anti-{lambda}, and anti-B220 Abs as well as B220+ cells within the lymphoid gate are displayed. All four trangenic mice (TG) are IgH6a, while littermates (LM) are IgH6b. Representative profiles of three independent experiments are shown. B, Quantitative representation of {lambda}+ B cells as percentage of B220+ cells in the four µ transgenic mice. Three to four mice analyzed on the same day are included in each group.

 
These data suggest that B cells expressing individual heavy-light chain pairs are subject to a selection process at the level of the immature B cell stage before they reach the mature B cell compartment. For the particular case of {lambda}, VH81X is at one extreme (totally unable to generate {lambda} B cells), M54 is at the other extreme (having a predilection for {lambda} B cells), while M167 and MD2 are intermediate in their ability to produce {lambda}+ B cells.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We investigated the generation of the mature primary B cell repertoire using transgenic mice as a model in which a limited population of VH81X-{lambda}+ B cells were generated alone or in conjunction with a diverse population of VH81X-{kappa}+ B cells.

We showed previously that a largely polyclonal {kappa} repertoire develops in VH81X transgenic mice with VH81X-V{kappa} pairs being preferentially selected into distinct peripheral B cell subsets (39, 60). However, VH81X-{lambda}+ B cells, which suffer a different fate, are missing in the mature B cell subsets. The VH81X-{lambda}+ cells are not generated either in the presence of a heterogeneous VH81X-kappa repertoire or in the absence of competition with V{kappa}-expressing B cells in VH81X kHD mice. Genomic {lambda} rearrangements and {lambda} polypeptide synthesis appear normal, as does the capacity of the transgenic VH81X heavy chain to pair with {lambda} light chains in vitro. The possibility remains that in pre-B cells, in contrast to plasmacytomas, there are subtle imperfections in molecular mechanisms of heavy-light chain pairing or in the folding and transport of the assembled receptors to the surface. It is also clear that pairing of the same heavy chain transgene with a wide variety of {kappa} light chains can occur to form functional B cell receptors. In a parallel experiment using >100 transgenic hybridomas generated from VH81X spleen cells, all but two of the hybridomas had functional {kappa} light chains belonging to 11 different families (39). The two exceptions, which expressed {lambda} light chains, also had productive endogenous IgH6b gene rearrangements (J.F.K., unpublished observation).

The block in the development of VH81X-{lambda}+ B cells occurs after the pre-B/B cell transition, the point at which it has previously been reported that half of the loss of VH81X-expressing B cells occurs in normal BALB/c mice (61). A few of the B cells that are generated move through immature stages and reach a longer-lived compartment in which they display low levels of clonal receptors and are then removed. Although at present we cannot completely disprove the explanation that negative selection resulting in B cell deletion is the cause of the developmental block in our mice, the only self Ags for which this has been shown are dsDNA or membrane-bound HEL and H-2K. Recent studies have shown that even very low affinity membrane expressed self Ag are able to induce central tolerance by deletion (38). Our attempts to screen for potential deleting Ags using VH81X-{lambda} Abs failed to reveal any specific self-reactivity to the mouse tissues and cell lines that we tested. In addition, the {lambda} repertoire is quite diverse, with four possible V{lambda}-J{lambda}-C{lambda} combinations and superimposed junctional diversity. It has also been shown that in cases of self-reactive Abs, such as in the 3H9 heavy chain transgenic mice, only 3H9-{lambda}1 reacts with dsDNA while the other {lambda} combinations that are generated do not (55).

The presence of elevated Fas expression on the VH81X {lambda}+ B cells also argues against a central deletion mechanism (62, 63) as the cause of the cell loss and suggests the possibility that a peripheral B-T cell interaction is involved in the homeostatic maintenance of the B cell compartment as described for foreign antigenic stimulation (30, 64). The level of Fas expression on VH81X {lambda}+ B cells is similar to that expressed by tolerant B cells that were subsequently reexposed to Ag and is lower than on foreign Ag-stimulated B cells (30). These observations might explain the topographical location of these unusual cells and their failure to develop B cell follicles. From our data, we favor the explanation that the block is most likely due to a failure to receive the proper balance of signals (positive and negative) inducing further development or maintenance.

Evidence is accumulating for positive selection steps involving surface Ig signaling at the immature B cell stage that is necessary for further development. In the soluble HEL/anti-HEL system, by manipulating the accessory molecule CD45, which is involved in the transduction of sIgM mediated signals, it was shown that B cells lacking CD45 entered the mature repertoire much more efficiently when soluble HEL was present (23). In addition, the increased size of some B cell compartments from CD45 -/- mice might be due to positive selection events (65). Another genetic manipulation of signaling through the sIgM receptor in syk tyrosine kinase -/- mice results in a similar block at the very immature B cell stage (24, 25). When this defect was introduced into the H-2K/anti-H-2K model, a syk-derived signal was found to be necessary for further B cell selection and/or expansion but not for negative selection (66). In all of these cases, the signal was manipulated indirectly through accessory molecules, while in our system the block appears to be due to the composition of surface IgM receptor itself. Although we cannot estimate how frequently rearranged germline VH genes fail to match with appropriate light chains to permit delivery of a functional signal at this crucial selection point, this case is unlikely to be restricted to VH81X-{lambda} receptors. It appears that VH12 heavy chain may not generate B cells in association with {lambda} light chains (S. Clarke, unpublished observations). In addition, it is possible that B cells are not generated in a VH1-Vk22 (T15) "monoclonal" mouse due to a similar phenomena (F. Alt, unpublished observations). In the sp6-rag -/- transgenic mice (67), a similar B cell block occurs, which is partially released by the i.v. injection of trinitrophenyl Ag. Since, in this case, reactivity of the transgene-encoded receptor with dsDNA can also be demonstrated, a deletional mechanism was proposed as being responsible for the observed block. A very recent report investigates the development of different {lambda} types in the M54 and H3 heavy chain transgenic mice and concludes that positive selection favors different transgenic {lambda} B cell clones in the two models (68).

We have compared and summarized the observations made in the generation of VH81X-{lambda}+ cells and B cell development in current transgenic and gene deletion mice (Fig. 8Go). The B cell developmental program is considered from four independent aspects: 1) initial clonal receptor development, 2) appearance of maturation markers, 3) subsequent migration patterns in vivo, and 4) clonal life span. Normal mice as well as nonautoimmune transgenic mice have all four programs intact (6, 7, 40, 68), while a first group of genetic defects including scid and rag -/- µTG (65, 69) have cells that are blocked completely at the pre-B stage in vivo. Under certain conditions of in vitro growth or activation, portions of these programs can be resurrected (70) but give rise to cells that do not have in vivo counterparts in intact mice. A second group of defects occur in the deletional models of B cell self-reactivity (6, 8, 71) in which these four programs are blocked at an immature B cell stage. Introduction of a bcl-2 transgene into mice of the first group releases the block in maturation markers and migration pattern of pre-B cells that now express mature markers and can form (pre-B) follicles in the spleen (72, 73). However, if a bcl-2 transgene is introduced into mice of the second group, as represented by the mHEL/anti-HEL deletional system, the maturation program is only minimally released (50); there have been no reports, however, on the topographical migration pattern of B cells in peripheral lymphoid organs of these mice. Our VH81X-{lambda} transgenic model resembles the deletional transgenic mouse models with a block in clonal receptor selection and further migration; but in contrast to other models, they appear to have at least part of the maturation marker program intact. A possibility exists that very small numbers of B cells with a mature phenotype also develop in the above-mentioned deletional models, but these have not yet been described. Each of the maturation markers is up-regulated by signals from the environment through which the maturing B cell moves. Therefore, the chronologic period from the generation of B cells until their removal by death might be different in each of these transgenic models depending on the form, location, and affinity of the specific self Ag. The subsequent maturation marker profiles identified on the B cells that develop in each system may reflect the intrinsically different characteristics of each mouse. In turn, the fate of B cells in these systems viewed collectively reflects the normal fate of heterogeneous populations of cells expressing receptors to Ags of different characteristics and presentation modes.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 8. Comparison of the VH81X-{lambda} B cell developmental block with other models (see Discussion). The line made of large filled circles from VH81X-{lambda} programs shows that a small number of cells are passing through the block.

 
In conclusion, we have investigated at a molecular and cellular level the inability of a polyclonal germline-encoded receptor-expressing B cell population (VH81X-{lambda}) to develop in the peripheral repertoire and have defined precisely the site of the block. Abs containing the VH81X-{lambda} chains do not seem to be highly self-reactive, suggesting that the lack of positive selection is the operative mechanism in this system and that it prevents further maturation and expansion of a normal peripheral B cell population. In addition, by comparing the {lambda} compartments in other well-characterized heavy chain transgenic mice, we show that there is a hierarchy in the frequency of B cells expressing heavy chain-{lambda} pairs entering the mature repertoire.

Our model will permit the study of signals and environmental factors involved in the generation and maintenance of germline mature B cells. Positive selecting stages are likely to be identified in B cell generation and maintenance, comparable to T cell development in which positive selection is well established. The process favoring certain B cell receptor heavy-light chain pairs would be analogous to the thymic positive selection at the double-positive stage, where pairs of TCR {alpha}- and ß-chains are selected together to form a mature functional TCR repertoire, while the peripheral long term maintenance of B cell clones may depend on continuous low level interactions of the receptor with Ag in a self environment similar to that required by mature T cells (74).


    Acknowledgments
 
We thank Lisa Jia and Anne Elizabeth Ratcliffe for expert technical help, Dr. Larry Gartland for the cell sorting, as well as Ann Brookshire for assistance in the preparation of the manuscript. The generous gifts of Drs. C. C. Goodnow, D. Fearon, M. Holers, D. Huszar, J. J. Kenny, G. Kraal, T. Kipps, C. Mashburn, R. R. Hardy, and M. Reth were instrumental in the accomplishment of these experiments. We thank Drs. P. Burrows, J. Cyster, and A. Oliver for helpful suggestions on this manuscript.


    Footnotes
 
1 This work was supported by National Institutes of Health Grant AI 14782. Back

2 Address correspondence and reprint requests to Dr. John F. Kearney, 378 Wallace Tumor Institute, University of Alabama at Birmingham, Birmingham, AL 35394-3300. Back

3 Abbreviations used in this paper: HSA, heat-stable Ag; SA, streptavidin; PE, phycoerythrin; PALS, periarteriolar lymphoid sheath. Back

Received for publication September 26, 1997. Accepted for publication December 17, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ye, J., S. K. McCray, S. H. Clarke. 1996. The transition of pre-BI to pre-BII cells is dependent on the VH structure of the mu/surrogate L chain receptor. EMBO J. 15:1524.[Medline]
  2. Keyna, U., G. B. Beck-Engeser, J. Jongstra, S. E. Applequist, H. M. Jack. 1995. Surrogate light chain-dependent selection of Ig heavy chain V regions. J. Immunol. 155:5536.[Abstract]
  3. Huetz, F., L. Carlsson, U. C. Tornberg, D. Holmberg. 1993. V-region directed selection in differentiating B lymphocytes. EMBO J. 12:1819.[Medline]
  4. Arnold, L. W., C. A. Pennell, S. K. McCray, S. H. Clarke. 1994. Development of B-1 cells: segregation of phosphatidyl choline-specific B cells to the B-1 population occurs after immunoglobulin gene expression. J. Exp. Med. 179:1585.[Abstract/Free Full Text]
  5. Pennell, C. A.. 1995. Selection for S107-V11 gene expression by peritoneal B cells in adult mice. J. Immunol. 155:1264.[Abstract]
  6. Goodnow, C. C., J. Crosbie, S. Adelstein, T. B. Lavoie, S. J. Smith-Gill, R. A. Brink, H. Pritchard-Briscoe, J. S. Wotherspoon, R. H. Loblay, K. Raphael. 1988. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature 334:676.[Medline]
  7. Nemazee, D., K. Buerki. 1989. Clonal deletion of autoreactive B lymphocytes in bone marrow chimeras. Proc. Natl. Acad. Sci. USA 86:8039.[Abstract/Free Full Text]
  8. Goodnow, C. C., J. Crosbie, H. Jorgensen, R. A. Brink, A. Basten. 1989. Induction of self-tolerance in mature peripheral B lymphocytes. Nature 342:385.[Medline]
  9. Hartley, S. B., J. Crosbie, R. Brink, A. B. Kantor, A. Basten, C. C. Goodnow. 1991. Elimination from peripheral lymphoid tissues of self-reactive B lymphocytes recognizing membrane-bound antigens. Nature 353:765.[Medline]
  10. Zou, Y. R., S. Takeda, K. Rajewsky. 1993. Gene targeting in the Ig kappa locus: efficient generation of lambda chain-expressing B cells, independent of gene rearrangements in Ig kappa. EMBO J. 12:811.[Medline]
  11. Erikson, J., M. Z. Radic, S. A. Camper, R. R. Hardy, C. Carmack, M. Weigert. 1991. Expression of anti-DNA immunoglobulin transgenes in non-autoimmune mice. Nature 349:331.[Medline]
  12. Tiegs, S. L., D. M. Russell, D. Nemazee. 1993. Receptor editing in self-reactive bone marrow B cells. J. Exp. Med. 177:1009.[Abstract/Free Full Text]
  13. Radic, M. Z., J. Erikson, S. Litwin, M. Weigert. 1993. B lymphocytes may escape tolerance by revising their antigen receptors. J. Exp. Med. 177:1165.[Abstract/Free Full Text]
  14. Gay, D., T. Saunders, S. Camper, M. Weigert. 1993. Receptor editing: an approach by autoreactive B cells to escape tolerance. J. Exp. Med. 177:999.[Abstract/Free Full Text]
  15. Chen, C., Z. Nagy, E. L. Prak, M. Weigert. 1995. Immunoglobulin heavy chain gene replacement: a mechanism of receptor editing. Immunity. 3:747.[Medline]
  16. Rolink, A., U. Grawunder, D. Haasner, A. Strasser, F. Melchers. 1993. Immature surface Ig+ B cells can continue to rearrange kappa and lambda L chain gene loci. J. Exp. Med. 178:1263.[Abstract/Free Full Text]
  17. Ghia, P., A. Gratwohl, E. Signer, T. H. Winkler, F. Melchers, A. G. Rolink. 1995. Immature B cells from human and mouse bone marrow can change their surface light chain expression. Eur. J. Immunol. 25:3108.[Medline]
  18. Jerne, N. K.. 1974. Towards a network theory of the immune system. Ann. Immunol. 125C:373.
  19. Melchers, F., A. Rolink, U. Grawunder, T. H. Winkler, H. Karasuyama, P. Ghia, J. Andersson. 1995. Positive and negative selection events during B lymphopoiesis. Curr. Opin. Immunol. 7:214.[Medline]
  20. Gu, H., D. Tarlinton, W. Muller, K. Rajewsky, I. Forster. 1991. Most peripheral B cells in mice are ligand selected. J. Exp. Med. 173:1357.[Abstract/Free Full Text]
  21. Wienands, J., O. Larbolette, M. Reth. 1996. Evidence for a preformed transducer complex organized by the B cell antigen receptor. Proc. Natl. Acad. Sci. USA 93:7865.[Abstract/Free Full Text]
  22. Iglesias, A., A. Nichogiannopoulou, G. S. Williams, H. Flaswinkel, G. Kohler. 1993. Early B cell development requires mu signaling. Eur. J. Immunol. 23:2622.[Medline]
  23. Cyster, J. G., J. I. Healy, K. Kishihara, T. W. Mak, M. L. Thomas, C. C. Goodnow. 1996. Regulation of B-lymphocyte negative and positive selection by tyrosine phosphatase CD45. Nature 381:325.[Medline]
  24. Turner, M., P. J. Mee, P. S. Costello, O. Williams, A. A. Price, L. P. Duddy, M. T. Furlong, R. L. Geahlen, V. L. Tybulewicz. 1995. Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk. Nature 378:298.[Medline]
  25. Cheng, A. M., B. Rowley, W. Pao, A. Hayday, J. B. Bolen, T. Pawson. 1995. Syk tyrosine kinase required for mouse viability and B-cell development. Nature 378:303.[Medline]
  26. Fulcher, D. A., A. B. Lyons, S. L. Korn, M. C. Cook, C. Koleda, C. Parish, B. Fazekas de St. Groth, A. Basten. 1996. The fate of self-reactive B cells depends primarily on the degree of antigen receptor engagement and availability of T cell help. J. Exp. Med. 183:2313.[Abstract/Free Full Text]
  27. Cyster, J. G., C. C. Goodnow. 1995. Protein tyrosine phosphatase 1C negatively regulates antigen receptor signaling in B lymphocytes and determines thresholds for negative selection. Immunity 2:13.[Medline]
  28. Lam, K. P., R. Kuhn, K. Rajewsky. 1997. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90:1073.[Medline]
  29. Goodnow, C. C.. 1996. Balancing immunity and tolerance: deleting and tuning lymphocyte repertoires. Proc. Natl. Acad. Sci. USA 93:2264.[Abstract/Free Full Text]
  30. Rathmell, J. C., S. E. Townsend, J. C. Xu, R. A. Flavell, C. C. Goodnow. 1996. Expansion or elimination of B cells in vivo: dual roles for CD40-and Fas (CD95)-ligands modulated by the B cell antigen receptor. Cell 87:319.[Medline]
  31. Cyster, J. G., S. B. Hartley, C. C. Goodnow. 1994. Competition for follicular niches excludes self-reactive cells from the recirculating B-cell repertoire. Nature 371:389.[Medline]
  32. Cyster, J. G., C. C. Goodnow. 1995. Antigen-induced exclusion from follicles and anergy are separate and complementary processes that influence peripheral B cell fate. Immunity. 3:691.[Medline]
  33. Goodnow, C. C., S. Adelstein, A. Basten. 1990. The need for central and peripheral tolerance in the B cell repertoire. Science 248:1373.[Abstract/Free Full Text]
  34. Russell, D. M., Z. Dembic, G. Morahan, J. F. Miller, K. Burki, D. Nemazee. 1991. Peripheral deletion of self-reactive B cells. Nature 354:308.[Medline]
  35. Kelsoe, G.. 1996. Life and death in germinal centers (redux). Immunity 4:107.[Medline]
  36. Jacob, J., J. Przylepa, C. Miller, G. Kelsoe. 1993. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. III. The kinetics of V region mutation and selection in germinal center B cells. J. Exp. Med. 178:1293.[Abstract/Free Full Text]
  37. Hartley, S. B., C. C. Goodnow. 1994. Censoring of self-reactive B cells with a range of receptor affinities in transgenic mice expressing heavy chains for a lysozyme-specific antibody. Int. Immunol. 6:1417.[Abstract/Free Full Text]
  38. Lang, J., M. Jackson, L. Teyton, A. Brunmark, K. Kane, D. Nemazee. 1996. B cells are exquisitely sensitive to central tolerance and receptor editing induced by ultralow affinity, membrane-bound antigen. J. Exp. Med. 184:1685.[Abstract/Free Full Text]
  39. Chen, X., F. Martin, K. A. Forbush, R. M. Perlmutter, J. F. Kearney. 1997. Evidence for selection of a population of multi-reactive B cells into the splenic marginal zone. Int. Immunol. 9:27.[Abstract/Free Full Text]
  40. Martin, F., X. Chen, J. F. Kearney. 1997. Development of VH81X transgene bearing B cells in fetus and adult: sites for expansion and deletion in conventional and CD5/B1 cells. Int. Immunol. 9:493.[Abstract/Free Full Text]
  41. Kearney, J. F., J. Bartels, A. M. Hamilton, A. Lehuen, N. Solvason, M. Vakil. 1992. Development and function of the early B cell repertoire. Int. Rev. Immunol. 8:247.[Medline]
  42. Pennell, C. A., L. W. Arnold, P. M. Lutz, N. J. LoCascio, P. B. Willoughby, G. Haughton. 1985. Cross-reactive idiotypes and common antigen binding specificities expressed by a series of murine B-cell lymphomas: etiological implications. Proc. Natl. Acad. Sci. USA 82:3799.[Abstract/Free Full Text]
  43. Hombach, J., T. Tsubata, L. Leclercq, H. Stappert, M. Reth. 1990. Molecular components of the B-cell antigen receptor complex of the IgM class. Nature 343:760.[Medline]
  44. Hamilton, A. M., J. F. Kearney. 1994. Effects of IgM allotype suppression on serum IgM levels, B-1 and B-2 cells, and antibody responses in allotype heterozygous F1 mice. Dev. Immunol. 4:27.[Medline]
  45. Kinoshita, T., G. Typhronitis, G. C. Tsokos, F. D. Finkelman, K. Hong, H. Sakai, K. Inoue. 1990. Characterization of murine complement receptor type 2 and its immunological cross-reactivity with type 1 receptor. Int. Immunol. 2:651.[Abstract/Free Full Text]
  46. Tough, D. F., J. Sprent. 1994. Turnover of naive- and memory-phenotype T cells. J. Exp. Med. 179:1127.[Abstract/Free Full Text]
  47. Li, Y. S., K. Hayakawa, R. R. Hardy. 1993. The regulated expression of B lineage associated genes during B cell differentiation in bone marrow and fetal liver. J. Exp. Med. 178:951.[Abstract/Free Full Text]
  48. Boudinot, P., A. M. Drapier, P. A. Cazenave, P. Sanchez. 1994. Mechanistic and selective constraints act on the establishment of V lambda J lambda junctions in the B cell repertoire. J. Immunol. 152:2248.[Abstract]
  49. Chen, J., M. Trounstine, C. Kurahara, F. Young, C. C. Kuo, Y. Xu, J. F. Loring, F. W. Alt, D. Huszar. 1993. B cell development in mice that lack one or both immunoglobulin kappa light chain genes. EMBO J. 12:821.[Medline]
  50. Hartley, S. B., M. P. Cooke, D. A. Fulcher, A. W. Harris, S. Cory, A. Basten, C. C. Goodnow. 1993. Elimination of self-reactive B lymphocytes proceeds in two stages: arrested development and cell death. Cell 72:325.[Medline]
  51. Sanchez, P., A. M. Drapier, M. Cohen-Tannoudji, E. Colucci, C. Babinet, P. A. Cazenave. 1994. Compartmentalization of lambda subtype expression in the B cell repertoire of mice with a disrupted or normal C kappa gene segment. Int. Immunol. 6:711.[Abstract/Free Full Text]
  52. Boudinot, P., A. M. Drapier, P. A. Cazenave, P. Sanchez. 1994. Conserved distribution of lambda subtypes from rearranged gene segments to immunoglobulin synthesis in the mouse B cell repertoire. Eur. J. Immunol. 24:2013.[Medline]
  53. Hombach, J., L. Leclercq, A. Radbruch, K. Rajewsky, M. Reth. 1988. A novel 34-kd protein co-isolated with the IgM molecule in surface IgM-expressing cells. EMBO J. 7:3451.[Medline]
  54. Prak, E. L., M. Trounstine, D. Huszar, M. Weigert. 1994. Light chain editing in kappa-deficient animals: a potential mechanism of B cell tolerance. J. Exp. Med. 180:1805.[Abstract/Free Full Text]
  55. Chen, C., M. Z. Radic, J. Erikson, S. A. Camper, S. Litwin, R. R. Hardy, M. Weigert. 1994. Deletion and editing of B cells that express antibodies to DNA. J. Immunol. 152:1970.[Abstract]
  56. Iacomini, J., N. Yannoutsos, S. Bandyopadhay, T. Imanishi-Kari. 1991. Endogenous immunoglobulin expression in mu transgenic mice. Int. Immunol. 3:185.[Abstract/Free Full Text]
  57. Storb, U., C. Pinkert, B. Arp, P. Engler, K. Gollahon, J. Manz, W. Brady, R. L. Brinster. 1986. Transgenic mice with mu and kappa genes encoding antiphosphorylcholine antibodies. J. Exp. Med. 164:627.[Abstract/Free Full Text]
  58. Weaver, D., M. H. Reis, C. Albanese, F. Costantini, D. Baltimore, T. Imanishi-Kari. 1986. Altered repertoire of endogenous immunoglobulin gene expression in transgenic mice containing a rearranged mu heavy chain gene. Cell 45:247.[Medline]
  59. Kenny, J. J., C. M. Moratz, G. Guelde, C. D. O’Connell, J. George, C. Dell, S. J. Penner, J. S. Weber, J. Berry, J. L. Claflin. 1992. Antigen binding and idiotype analysis of antibodies obtained after electroporation of heavy and light chain genes encoding phosphocholine-specific antibodies: a model for T15-idiotype dominance. J. Exp. Med. 176:1637.[Abstract/Free Full Text]
  60. Martin, F., X. Chen, F. Shu, J. F. Kearney. 1995. Development of the mouse B-cell repertoire. Ann. NY Acad. Sci. 764:207.[Medline]
  61. Decker, D. J., G. H. Kline, T. A. Hayden, S. N. Zaharevitz, N. R. Klinman. 1995. Heavy chain V gene-specific elimination of B cells during the pre-B cell to B cell transition. J. Immunol. 154:4924.[Abstract]
  62. Rathmell, J. C., C. C. Goodnow. 1994. Effects of the lpr mutation on elimination and inactivation of self-reactive B cells. J. Immunol. 153:2831.[Abstract]
  63. Rathmell, J. C., C. C. Goodnow. 1995. Autoimmunity. The Fas track. Curr. Biol. 5:1218.[Medline]
  64. Rathmell, J. C., M. P. Cooke, W. Y. Ho, J. Grein, S. E. Townsend, M. M. Davis, C. C. Goodnow. 1995. CD95 (Fas)-dependent elimination of self-reactive B cells upon interaction with CD4+ T cells. Nature 376:181.[Medline]
  65. Byth, K. F., L. A. Conroy, S. Howlett, A. J. Smith, J. May, D. R. Alexander, N. Holmes. 1996. CD45-null transgenic mice reveal a positive regulatory role for CD45 in early thymocyte development, in the selection of CD4+CD8+ thymocytes, and B cell maturation. J. Exp. Med. 183:1707.[Abstract/Free Full Text]
  66. Turner, M., A. Gulbranson-Judge, M. E. Quinn, A. E. Walters, I. C. M. MacLennon, V. L. Y. Tybulewicz. 1997. Syk tyrosine kinase is required for the positive selection of immature B cells into the recirculatory B cell pool. J. Exp. Med. 186:2013.[Abstract/Free Full Text]
  67. Andersson, J., F. Melchers, A. Rolink. 1995. Stimulation by T cell independent antigens can relieve the arrest of differentiation of immature auto-reactive B cells in the bone marrow. Scand. J. Immunol. 42:21.[Medline]
  68. Hachemi-Rachedi, S., A. Cumano, A. M. Drapier, P. A. Cazenave, P. Sanchez. 1997. Does positive selection determine the B cell repertoire?. Eur. J. Immunol. 27:1069.[Medline]
  69. Spanopoulou, E., C. A. Roman, L. M. Corcoran, M. S. Schlissel, D. P. Silver, D. Nemazee, M. C. Nussenzweig, S. A. Shinton, R. R. Hardy, D. Baltimore. 1994. Functional immunoglobulin transgenes guide ordered B-cell differentiation in Rag-1-deficient mice. Genes Dev. 8:1030.[Abstract/Free Full Text]
  70. Rolink, A., P. Ghia, U. Grawunder, D. Haasner, H. Karasuyama, C. Kalberer, T. Winkler, F. Melchers. 1995. In vitro analyses of mechanisms of B-cell development. Semi. Immunol. 7:155.
  71. Chen, C., Z. Nagy, M. Z. Radic, R. R. Hardy, D. Huszar, S. A. Camper, M. Weigert. 1995. The site and stage of anti-DNA B-cell deletion. Nature 373:252.[Medline]
  72. Strasser, A., A. W. Harris, L. M. Corcoran, S. Cory. 1994. Bcl-2 expression promotes B- but not T-lymphoid development in scid mice. Nature 368:457.[Medline]
  73. Young, F., E. Mizoguchi, A. K. Bhan, F. Alt. 1997. Constitutive Bcl-2 expression during immunoglobulin heavy chain-promoted B cell differentiation expands novel precursor B cells. Immunity 6:23.[Medline]
  74. Tanchot, C., F. A. Lemonnier, B. Perarnau, A. Freitas, B. Rocha. 1997. Differential requirements for survival and proliferation of CD8 naive or memory T cells. Science 276:2057.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
J. B. Foote and J. F. Kearney
Generation of B Cell Memory to the Bacterial Polysaccharide {alpha}-1,3 Dextran
J. Immunol., November 15, 2009; 183(10): 6359 - 6368.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Lutz, W. Muller, and H.-M. Jack
VH Replacement Rescues Progenitor B Cells with Two Nonproductive VDJ Alleles
J. Immunol., November 15, 2006; 177(10): 7007 - 7014.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. C. Whitmore, H. R. Neely, R. Diz, and P. M. Flood
Rapid Induction of Splenic and Peritoneal B-1a Cells in Adult Mice by Thymus-Independent Type-2 Antigen
J. Immunol., November 1, 2004; 173(9): 5406 - 5414.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Attanavanich and J. F. Kearney
Marginal Zone, but Not Follicular B Cells, Are Potent Activators of Naive CD4 T Cells
J. Immunol., January 15, 2004; 172(2): 803 - 811.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
X. Li, F. Martin, A. M. Oliver, J. F. Kearney, and R. H. Carter
Antigen Receptor Proximal Signaling in Splenic B-2 Cell Subsets
J. Immunol., March 1, 2001; 166(5): 3122 - 3129.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. Hachemi-Rachedi, A.-M. Drapier, P.-A. Cazenave, and P. Sanchez
Affiliation to mature B cell repertoire and positive selection can be separated in two distinct processes
Int. Immunol., March 1, 2000; 12(3): 385 - 395.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. W. v. Ginkel, S. M. Wahl, J. F. Kearney, M.-N. Kweon, K. Fujihashi, P. D. Burrows, H. Kiyono, and J. R. McGhee
Partial IgA-Deficiency with Increased Th2-Type Cytokines in TGF-{beta}1 Knockout Mice
J. Immunol., August 15, 1999; 163(4): 1951 - 1957.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. M. Oliver, F. Martin, and J. F. Kearney
IgMhighCD21high Lymphocytes Enriched in the Splenic Marginal Zone Generate Effector Cells More Rapidly Than the Bulk of Follicular B Cells
J. Immunol., June 15, 1999; 162(12): 7198 - 7207.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martin, F.
Right arrow Articles by Kearney, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martin, F.
Right arrow Articles by Kearney, J. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS