|
|
||||||||
B Cells Are Unable to Complete All Developmental Programs1
Division of Developmental and Clinical Immunology, Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL 35394
| Abstract |
|---|
|
|
|---|
-light chain-expressing B
cells (VH81X-
+ B cells) was studied in VH81X heavy
chain transgenic mice as well as in VH81X JH -/- and VH81X JH -/-
Ck -/- mice, in which competition resulting from expression of heavy
and light chains from the endogenous heavy and
light chain loci was
prevented. We show that although
light chain gene rearrangements
occur normally and give rise to light chains that associate with the
transgenic heavy chain to form surface and soluble IgM molecules,
further B cell development is almost totally blocked. The few
VH81X-
+ B cells that are generated progress into a
mature compartment (expressing surface CD21, CD22, CD23, and low CD24
and having a relatively long life span) but they also have reduced
levels of surface Ig receptor and express higher amounts of Fas Ag than
VH81X-
+ B cells. These VH81X-
+ B cells
reach the peripheral lymphoid organs and accumulate in the
periarteriolar lymphoid sheath but are unable to generate primary B
cell follicles. In other heavy chain transgenic mice (MD2, M167, and
M54),
+ B cells are generated. However, they seem to be
preferentially selected in the peripheral repertoire of some transgenic
heavy chain mice (M54) but not in others (MD2, M167). These studies
show that a crucial selection step is necessary for B cell survival and
maintenance in which B cells, similar to T cells, receive signals
depending on their clonal receptors. | Introduction |
|---|
|
|
|---|
Many of these repertoire-shaping mechanisms have been demonstrated in elegant transgenic mice models in which the cellular steps and location of the selecting events were relatively easy to follow. Most of the Ig transgenes used in these experiments were derived from B cells in peripheral lymphoid organs that were rescued as hybridomas after immunization with relevant Ags. As expected, B cells with receptors encoded by these transgenes recapitulate the behavior of the B cells from which the transgene originated and enter the peripheral B cell repertoire unless negatively selected by interactions with self (neo)antigens (33, 34). However, some of the selection events that normally occur at the transition from newly formed to mature B cells may be absent when using this kind of transgene-expressing B cells. In addition, it is clear from studies of nontransgenic B cells that the avidity/affinity of the B cell receptor-Ag interaction is a major factor controlling responses in vivo (35, 36). Transgenic Ig receptors used as models for B cell selection are generally of higher affinity for their nominal Ag than are B cell receptors expressed from germline immunoglobulin genes. A germline-encoded, relatively low affinity receptor is more likely to require selection steps that have already been experienced by a somatically mutated, high affinity, Ag-selected B cell receptor, and thus the progression of B cells expressing such a transgene may be more similar to the physiologic in vivo process. Although it was shown for membrane-expressed Ags that negative selection by central deletion of self-reactive B cells occurs efficiently even at very low surface Ig affinity for Ag (37, 38), it is not known whether different categories of self Ags (transiently expressed, nonprotein, etc.) will produce different outcomes for B cells generated with such specificities.
Using a VH81X-µ transgenic mouse (39, 40), we have analyzed selection
events involved in the emergence of the preimmune B cell repertoire
focusing on the crucial transition from pre-B to immature and mature B
cells. In this model, B cells express a nonmutated VH81X-DFL16.1-JH1
rearranged heavy chain, which was derived from a day 17 fetal liver
hybridoma representative of the immature B cell repertoire (41). This
heavy chain has the potential to pair freely with light chains derived
from the germline-encoded light chain repertoire, and, in this report,
we have studied the development of B cells in which the transgene is
associated with
light chains. By using heavy and
chain locus
knock-out mice, we have restricted the association of the heavy chain
transgene to
light chains, which contain only three V
genes, so
that B cells expressing these combinations can be easily followed at
both cellular and molecular levels.
| Materials and Methods |
|---|
|
|
|---|
Eight- to twelve-week-old BALB/c and C57BL/6 mice for breeding
were purchased from Charles River Laboratories (Raleigh, NC). The
generation of VH81X lines was described previously (39, 40). All other
knockout and transgenic mice were generous gifts of Drs. D. Huszar (JH
-/- and JH -/- C
-/- mice), C. C. Goodnow (C57BL/6 MD2
transgenic mice), J. J. Kenny (C57BL/6 M167 transgenic mice), and
R. R. Hardy (CB17 M54 transgenic mice). Screening of the VH81X JH
-/- C
-/- was made on genomic tail DNA with the following
primers for VH81X, JH, C
, and Neo: 5'-VH81X,
CGCGCGGCCGCGTGGAGTCTGGGGGAGGCT;
3'-VH81X:CCCAGACATCGAAGTACCAGCTACTACCATG; 5'-JH,
GAACAGAGGCAGAACAGAGACTGTG; 3'-JH,
ACCTGAGGAGACTGTGAGAGTGGTG; 5'-Ck,
CACTGTGATTCACGTTCGGCTCG; 3'-Ck, AACGTCTAGAAGACCACGCTAC; 5'-Neo,
CTGAAGAGCTTGGCGGCGAAT; 3'-JH -/-, GACTCCACCAACACCATCACACAGA;
and 3'- Ck -/-, CATGTAGTGGACAGCCAACC. Mice were housed in
accordance with institutional policies for animal care and usage. All
experiments used 8- to 16-wk-old adults unless otherwise specified.
CH12 (42) and J558L and J558L-µM3 (43) cell lines were previously
described. VH81X-
hybridomas were generated from three individual
adult mouse spleens as previously described (39).
Abs and flow cytometry analysis
The anti-µ chain allotype Abs anti-IgH6a (RS3.1) and
anti-IgH6b (MB86) were described previously (44).
Fluorescein-conjugated anti-B220 (RA3-6B2), anti-CD43 (S7),
anti-heat-stable Ag
(HSA)3 (M1/69), and
anti-CD22 (Cy34.1); PE-conjugated anti-B220 (RA3-6B2) and
anti-Fas (Jo2); biotin-conjugated anti-CD23 (B3B4),
anti-HSA (M1/69), anti-CD4 (L3T4), and anti-CD8a (53-6.7);
anti-B220 (RA3-6B2) conjugated to Cychrome; and APC and
streptavidin (SA)-APC were purchased from PharMingen (San Diego, CA).
Fluorescein- and rhodamine-conjugated goat anti-mouse µ,
phycoerythrin (PE)-conjugated goat anti-mouse
and
, SA-PE,
and SA-PECy5 were purchased from Southern Biotechnology, Birmingham,
AL. The anti-CD21 (7G6) Ab-secreting hybridoma (45) was obtained
from Dr. Michael Holers (University of Colorado Health Science Center,
Denver, CO). The purified Ab was biotinylated in our laboratory, and
the anti-CD21 PE was conjugated at Southern Biotechnology.
Anti-CD19 hybridoma (1D6) was a gift from Dr. Douglas Fearon
(University of Cambridge, Cambridge, U.K.). In addition to the
preceding, we used biotinylated JC5-1 (rat anti-mouse
),
produced and characterized in our laboratory. Two-, three-, and
four-color surface staining was performed as previously described (44).
Briefly, 106 cells were first incubated with a mixture of
fluorescein-, PE-, biotin-, and APC-conjugated Abs, followed by
SA-PECy5, 15 min for each incubation. The cells were washed with 1%
BSA/PBS between steps. For cytoplasmic staining, cells were first
permeabilized with 0.5% paraformaldehyde in PBS for 30 min followed by
0.2% Tween 20 in PBS for 20 min. BrdU incorporation was analyzed in
animals fed BrdU in the drinking water, as previously described (46),
by staining the spleen cells for B220 and
expression as well as
staining with the anti-BrdU Ab (B44-FITC, Becton Dickinson,
Mountain View, CA). Data from stained cell samples were acquired on a
FACScan or FACSCalibur (with dead cells excluded using propidium
iodide) using Lysis II or CellQuest (Becton Dickinson) and analyzed
with WinList 2.01 (Verity Software House, Topsham, Maine) and WinMDI
2.0 (Trotter@scripps.edu) software programs.
Immunofluorescence of tissue sections
Spleens embedded in OCT compound (Lab-Tek Products, Naperville,
IL) were flash frozen in liquid nitrogen. Frozen sections were cut, air
dried, and fixed in ice cold acetone, blocked with normal horse serum,
and stained. The following anti-mouse Abs and secondary reagents
were used: biotinylated anti-CD4 (L3T4) and anti-CD8a (53-6.7)
(PharMingen); goat anti-mouse µ-RITC and goat anti-mouse
-FITC (Southern Biotechnology,); and
SA/7-amino-4-methylconmarin-3-acetic acid (Vector, Burlingame, CA).
Sections were washed and mounted in Fluormount G (Southern
Biotechnology) or Gel/Mount (Biomeda, Foster City, CA), then viewed
with a Leica/Leitz DMRB microscope equipped with appropriate filter
cubes (Chromatechnology, Battleboro, VT). Images were acquired with a
C5810 series digital color camera (Hamamatsu Photonic System,
Bridgewater, NJ) and processed with Adobe Photo Shop and IP LAB
Spectrum software (Signal Analytics Software, Vienna, VA).
ELISA
ELISA A/2 plates (Costar, Cambridge, MA) were coated with
unlabeled goat anti-mouse µ Ab at 2 µg/ml in borate buffer (pH
9) and incubated at 4°C overnight, followed by serial dilutions of
the transfectant supernatants or of control Ab (B18, mouse µ
,
starting at 0.5 µg/ml) in 1% PBS-BSA and incubation at 37°C for
2 h. Alkaline phosphatase-conjugated goat-mouse
Ab was used as
the third-layer Ab and incubated for 2 h at 37°C. Between each
step, the plate was washed five times with PBS. The plate was developed
with alkaline phosphatase substrate (Sigma, St. Louis, MO) at 1 mg/ml
in substrate buffer (pH 9.0). The plates were read on a Titertek
spectrophotometer at 405 nm, and after 10 min, the OD of each well was
plotted as a curve (see Fig. 6
A).
|
gene expression
RBC-depleted bone marrow or spleen cells (35 x
106) were used to extract RNA. B lineage cells
(104-5 x 104;
- or
+) were directly sorted into reaction tubes on a
FACStarPlus (Becton Dickinson). Total RNA was extracted
using Tri-Reagent (Molecular Research Center, Cincinnati, OH), and
similar amounts of RNA were reverse-transcribed with 500 ng oligo(dT),
dNTPs (5 mM), 20 U of RNAsin (Promega, Madison, WI), and 100 U of AMV
reverse transcriptase (Life Technologies, Gaithersburg, MD) in a total
buffer volume of 25 µl. PCR was performed using primers and
conditions for ß-actin, mb-1, and different
rearrangements as
previously described (47, 48). The samples were electrophoresed on a
0.8% agarose gel and blotted onto Nytran membranes (Schleicher &
Schuell, Keene, NH). The membranes were prehybridized at 42°C (6x
SSC, 0.25% SDS, 2x Denhardts solution, and 100 µg/ml denatured
salmon sperm DNA), then hybridized using 32P end-labeled
internal probes for MB-1 (5'-CATGGTGGTTCAGCCTTCAGTCT-3'),
(48), and
ß-actin as described (47). Blots were washed in 6x SSC and 0.1%
SDS, then scanned with a PhosphorImager (Molecular Dynamics, Sunnyvale,
CA) to detect signal intensity, and finally exposed to photographic
film. In the case of sorted cells, if sequence analysis of
1
rearrangements was desired, a nested amplification was performed using
the 5' V
1 and V
12 (48). For sequence analysis of
1 junctions,
PCR products were cloned using a T/A cloning kit (Invitrogen, San
Diego, CA), and sequencing was performed in the University of Alabama
at Birmingham automated sequencing facility.
Transfection of J558L cell line
The same VH81X construct used to generate transgenic mice was cotransfected with a Neo construct (gift of Charles Mashburn, Howard Hughes Medical Institute, Birmingham, AL) into J558L as previously described (43). As control, we used a human VH4-Neo (gift of Dr. Thomas Kipps, University of California San Diego, CA). Subsequently, an mb-1-hygromicin B construct (kind gift of Dr. Michael Reth, Max Planck Institute, Freiburg, Germany) was introduced in stable transfectants selected in the first round. Selection was conducted in 1 mg/ml neomycin (Sigma) and/or 1.2 mg/ml hygromicin B (Calbiochem, San Diego, CA).
| Results |
|---|
|
|
|---|
light chains
do not promote efficient B cell development
Splenic
+ B cells in VH81X transgenic mice
were fewer in number compared with nontransgenic littermates (1.3
± 0.5% vs 4.3 ± 1.2% of the lymphoid gate, n =
12) (Fig. 1
A). By
analyzing B220+ cells in transgenic and littermate mice, a
small but consistent population of
+ B cells was easily
detectable (3.1 ± 0.8% vs 8.5 ± 1.5% of the B cell gate,
n = 12) (Fig. 1
B). This phenotype was
seen in two lines of VH81X transgenic mice, one with a single copy
(Fig. 1
A) and the other with approximately 12 copies
(data not shown) of the transgene, on both BALB/c and C57BL/6
backgrounds. In all of the following experiments, the single-copy
transgenic line was used, but identical results were obtained in
experiments done with the multiple-copy line.
|
+ B cells in the transgenic mice, a clear population of
+ B cells was detected in the peritoneal cavity.
However, the majority of the
+ B cells in the peritoneal
cavity did not express the IgH6a transgenic heavy chain (Fig. 1
+ B cells within both the lymphoid gate
(4 ± 1% vs 11.5 ± 1.7%) and B cell gate (8.8 ±
1.5% vs 15.7 ± 2%) (n = 12) was lower
than in the littermate mice. The few
+ B cells in VH81X
transgenic mice are not allelically excluded, suggesting that
endogenous heavy chain rearrangements have rescued B cells that express
the transgene and
light chains.
To examine this possibility, a nonfunctional endogenous heavy chain
locus was introduced by breeding the VH81X transgenic mice onto the JH
-/- background (49). As seen in Figure 1
B, elimination of
functional endogenous heavy chains abolishes the development of splenic
+ cells in VH81X JH -/- transgenic mice. There are
also no
+ B cells in the peritoneal cavity of the VH81X
JH -/- transgenic mice (data not shown). In contrast to the failure
of
+ B cell development, comparable B cell populations
associated with a wide variety of
light chains develop in JH +/+
and JH -/- transgenic mice (39) pointing to a selective defect in the
generation of VH81X-
+ B cells.
The absence of VH81X-
B cells is not due to their inability to
compete with VH81X-
B cells
To determine whether any VH81X-
+ B cells could
be formed, we generated VH81X JH -/- C
-/- mice (VH81X kHD). In
this case, the entire B cell receptor repertoire is formed by the
association of the transgenic heavy chain with light chains derived
from the remaining functional endogenous
locus. In VH81X kHD mice,
the VH81X transgene promotes the transition of large
B220+CD43+ pro-B cells into small
B220+CD43- pre-B cells (Fig. 2
A). Although small
CD43- pre-B cells are generated in comparable numbers in
the bone marrow of VH81X kHD and VH81X JH +/- C
-/- (Fig. 2
A) mice, only the latter develop a substantial
+ B cell population in the bone marrow (not shown),
spleen (10.5 ± 2% of the lymphoid gate, n = 6)
and peritoneal cavity (38 ± 9% of the lymphoid gate,
n = 6) (Fig. 2
B). In the VH81X kHD
mice, in contrast to the JH -/- C
-/- (kHD) mice in which no
+ cells are found, a small but detectable population of
+ cells is found in both bone marrow (data not shown)
and spleen (0.25 ± 0.05% of the lymphoid gate, n
= 6). However, most of these B cells express 10- to 20-fold lower
levels of surface
light chains than normal B cells, as determined
by flow cytometry.
|
+ B cells to develop, B cell development is abnormal,
since a significant population of B220+
-
pro-/pre-B cells are present in the spleens of adult VH81X JH +/- C
-/- mice (Fig. 2
+ cells were below detection limits in the peritoneum of
the VH81X kHD mice (Fig. 2
+ B cells.
VH81X-
+ B cells are lost after the pre-B/B
cell interface
Although a normal-sized small pre-B cell compartment is present in
the bone marrow of the VH81X kHD mice (Fig. 2
A), only
a very small number of
+ B cells develop, suggesting
that there is a block in B cell progression at an immature B cell
stage.
Immunohistologic analysis of spleen sections (Fig. 3
, AD) shows that
pre-B/B cells from the VH81X kHD mice that have either migrated from
the bone marrow or developed in the spleen appear to be localized in
the T cell-rich areas around the arterial vessels (periarteriolar
lymphoid sheath (PALS)) (Fig. 3
, B and D).
However, in contrast to B cells from VH81X JH +/- C
-/- (Fig. 3
A) they do not accumulate further outside the distal
PALS to form primary B cell follicles. Both cytoplasmic µ only pre-B
cells and
+ B cells are found in the PALS, albeit at a
low frequency (Fig. 3
, D1 and D2). Most of
the B cells in VH81X kHD mice probably die in situ at this stage since
there is no appreciable accumulation of surface IgM/
high B cells
elsewhere in lymphoid organs of these mice (Figs. 2
B and
3B).
|
+ B cells detected in VH81X kHD
mice have a mature phenotype
We next determined if the small numbers of
+ B
cells that are generated, accumulate to greater numbers in the spleens
of old VH81X kHD mice. Mice up to 12 mo of age were analyzed and as
seen in Figure 4
A, a large
normal B cell population never develops. The splenic B cell
compartment, determined by flow cytometry as the proportion of
B220+ cells within the lymphoid gate, is similar between
12-wk-old (4.13 ± 0.5%, n = 6) and 12-mo-old
(4.33 ± 0.8%, n = 3) mice. Since B lymphopoiesis
is considerably diminished in old mice, pre-B cells decline in numbers,
so that in a B cell compartment of similar size, there are
proportionally more
low B cells (6.05 ± 0.9% at
12 wk vs 43.5 ± 5.1% at 12 mo). Surprisingly, phenotypic
analysis of these
low B cells revealed that most of them
express several surface markers typical of mature B cells. Although
surface IgM and
are very low on these cells, they express CD21,
CD22, CD23 (the majority), and CD24 (HSA) at levels similar to mature
follicular B cells (Fig. 4
B). In addition, by
measuring their BrdU incorporation in vivo over a period of 7 and 14
days, only 20 and 33%, respectively, were labeled (Fig. 4
B), in contrast to bone marrow-derived newly formed
B cells that are all labeled within 3 to 4 days (50). To gain insight
into the mechanisms that remove these cells that have a phenotype and
life span more similar to long-lived recirculating B cells than to
newly formed B cells, we analyzed their expression of Fas Ag. As seen
in Figure 4
C, VH81X-
+ B cells (TG H-/-
-/-), which express CD23, have higher levels of Fas than
VH81X-
+ B cells (TG H -/-
+/-), providing a
possible explanation for their disappearance.
|
+ B cells after the pre-B/B
cell interface. Few pre-B cells develop into B cells, which express low
levels of surface IgM, fail to organize into B cell follicles, and fail
to generate a numerically normal B cell compartment. However, the
maturation program of these B cells seems partially intact, since they
express surface markers characteristic of normal mature B cells, but
they also express higher levels of Fas.
The developmental block In VH81X-
+ B cells is
not due to abnormal
rearrangements or failure of heavy cbain-light
chain pairing
Because of the genetic features of our transgenic model, we next
determined whether the
rearrangements giving rise to
+ B cells are representative of the normal
repertoire. Robust rearrangements at the
locus involving all V
segments can be detected in the bone marrow of the VH81X kHD mice (Fig. 5
). Such rearrangements are not seen at
this level of sensitivity in kHD nontransgenic littermates. We also
sequenced a panel of V
1-J
1-C
1 splenic rearrangements from mice
with the genotypes described in Figure 5
. From the heterogeneity
observed at the V
1-J
1 junctions, it is clear that these
rearrangements are derived from a polyclonal set of B cells (Table I
). The most frequent junctions (A, B,
and C) in all of the experimental mice are the same as previously
reported in normal BALB/c mice (48, 51, 52). These experiments show
that abnormal rearrangement or transcription of
light chain genes
does not account for the observed developmental block in the VH81X kHD
mice. In addition, since low levels of
protein are detected both on
the cell surface (Figs. 2
B and 4A) and in
cytoplasm (Fig. 3
D1), these mice can also translate
the
message into protein.
|
|
light chains. To study this possibility, we transfected the VH81X heavy
chain into the J558L plasmacytoma variant, which has a commonly
expressed functional V
1-J
1-C
1 rearrangement (type A in Table I
1 protein secreted by these
transfectants was detected in the supernatant (Fig. 6
Abs). The VH81X-
1 IgM Ab was also purified on an
anti-IgH6a Sepharose column, and when analyzed on reducing and
nonreducing SDS-PAGE gels, appeared to be intact and of the appropriate
size (data not shown). In parallel, we generated five VH81X-
hybridomas from three different VH81X kHD mice, and all were able to
secrete VH81X-
Abs. Although these experiments prove that the VH81X
heavy chain can associate with
as a secreted Ab, it was essential
to determine the ability of the two proteins to form a surface
receptor. Due to the lack of Ig-
protein, J558L-VH81X stable
transfectants do not express a surface IgM receptor (Fig. 6
light chain complex can occur and that failure of surface
receptor expression is unlikely to be the cause of the block in
VH81X-
+ B cell development. Since
1 represents the
majority of
rearrangements (
70%), and the junction A (Table I
chain and repeatedly isolated in the analysis of
our mice) is the most commonly used junction in all
Abs (48), these
data provide evidence for the ability of the VH81X µ chain to pair
with the available
light chains in vivo.
A final and most likely explanation for the developmental block is that
the VH81X-
B cell receptor delivers a negative or inappropriate
(lacking positive selection) signal to the emerging B cell, preventing
further maturation. We next screened the VH81X-
IgM Abs from a
transfectoma and hybridomas on different mouse tissues and cell lines
by methods used in our laboratory to identify self-reactive Abs, but no
self-reactive Abs were found (Fig. 6
C). Although the
VH81X-
1 Ab has multireactive specificities as assayed by Western
blots of mouse tissue lysates (P. Zimmer and J.F.K., unpublished
results), the pattern is similar to other VH81X-
control Abs
isolated from hybridomas derived from mature splenic B cells in VH81X
transgenic mice. Furthermore, the VH81X-
repertoire is polyclonal
(V
1-J
1-C
1, V
1-J
3-C
3, V
2-J
2-C
2,
V
x-J
2-C
2 each with junctional diversity), and it seems
unlikely that all possible VH81X-
combinations form self-reactive
receptors that ensure deletion of all B cells expressing these
receptors. As a way of assaying at a molecular level whether there is
selection of the array of potential
chains between the pre-B
compartment in which the
light chain genes rearrange and the more
mature B cells, we sorted B220+
- and
B220+
low cells from the VH81X kHD spleens
and compared the
rearrangements found in these two populations. A
similar polyclonal repertoire containing
1,
2,
3, and
x was
found in both populations (data not shown), and sequence analysis of
the
1 rearrangements revealed the same major hierarchical
representation of junctions in both populations (Table I
, last two
columns). These results collectively argue against a large scale
negative selection step between the pre-B cell compartment, which is
normal in size, and the drastically reduced in size B cell compartment,
suggesting that the entire polyclonal VH81X-
repertoire is blocked
in development at this point.
Is the VH81X-
developmental block unique for the VH81X
transgene?
To compare the ability of Ig heavy chain transgenes to generate
+ B cells, we studied other independently derived
µ transgenic mice. Although it is known that several µ
transgenesMD2, 3H9, anti-H2K, and M54generate mature
+ B cells, a comparative analysis between these
individual transgenic mice has not been performed (12, 37, 54, 55, 56). We
compared the abundance of
+ B cells within the splenic
B220+ compartment of VH81X, M167 (57), MD2 (6), and M54
(58) transgenic mice (Fig. 7
). In the
VH81X, MD2, and M167 lines, 20 to 55% fewer
B cells are present in
the transgenic vs the littermate mice (Fig. 7
). As shown above, in the
case of VH81X, all of these
+ B cells are rescued by an
endogenous heavy chain rearrangement. Both the anti-HEL heavy chain
(MD2 transgenic mice) and the M167 heavy chain (M167 transgenic mice)
can generate transgene-
+ B cells (37, 59). The
reduction in the number of
+ B cells in the VH81X, MD2,
and M167 transgenic mice compared with littermates (Fig. 7
) suggests
that in the establishment of the mature repertoire, transgenic B cells
expressing
light chains are at an advantage. An opposite situation
is apparent in the CB17 M54 mice, in which more
+ B
cells are present in the transgenic (10.3 ± 1.5%) than
littermate (4.2 ± 0.9%) mice, suggesting that in this case
the M54 heavy chain
+ B cells have a selective
advantage. Interestingly, the original hybridomas from which the
transgenic heavy chains were derived are all
with the exception of
M54, which was derived from a
-producing anti-nitrophenyl-acetyl
(NP) hybridoma (58).
|
, VH81X is at one extreme (totally unable to
generate
B cells), M54 is at the other extreme (having a
predilection for
B cells), while M167 and MD2 are intermediate in
their ability to produce
+ B cells. | Discussion |
|---|
|
|
|---|
+ B cells were generated alone
or in conjunction with a diverse population of VH81X-
+ B
cells.
We showed previously that a largely polyclonal
repertoire develops
in VH81X transgenic mice with VH81X-V
pairs being preferentially
selected into distinct peripheral B cell subsets (39, 60). However,
VH81X-
+ B cells, which suffer a different fate, are
missing in the mature B cell subsets. The VH81X-
+ cells
are not generated either in the presence of a heterogeneous
VH81X-kappa repertoire or in the absence of competition with
V
-expressing B cells in VH81X kHD mice. Genomic
rearrangements
and
polypeptide synthesis appear normal, as does the capacity of
the transgenic VH81X heavy chain to pair with
light chains in
vitro. The possibility remains that in pre-B cells, in contrast to
plasmacytomas, there are subtle imperfections in molecular mechanisms
of heavy-light chain pairing or in the folding and transport of the
assembled receptors to the surface. It is also clear that pairing of
the same heavy chain transgene with a wide variety of
light chains
can occur to form functional B cell receptors. In a parallel experiment
using >100 transgenic hybridomas generated from VH81X spleen cells,
all but two of the hybridomas had functional
light chains belonging
to 11 different families (39). The two exceptions, which expressed
light chains, also had productive endogenous IgH6b gene rearrangements
(J.F.K., unpublished observation).
The block in the development of VH81X-
+ B cells occurs
after the pre-B/B cell transition, the point at which it has previously
been reported that half of the loss of VH81X-expressing B cells occurs
in normal BALB/c mice (61). A few of the B cells that are generated
move through immature stages and reach a longer-lived compartment in
which they display low levels of clonal receptors and are then removed.
Although at present we cannot completely disprove the explanation that
negative selection resulting in B cell deletion is the cause of the
developmental block in our mice, the only self Ags for which this has
been shown are dsDNA or membrane-bound HEL and H-2K. Recent studies
have shown that even very low affinity membrane expressed self Ag are
able to induce central tolerance by deletion (38). Our attempts to
screen for potential deleting Ags using VH81X-
Abs failed to reveal
any specific self-reactivity to the mouse tissues and cell lines that
we tested. In addition, the
repertoire is quite diverse, with four
possible V
-J
-C
combinations and superimposed junctional
diversity. It has also been shown that in cases of self-reactive Abs,
such as in the 3H9 heavy chain transgenic mice, only 3H9-
1 reacts
with dsDNA while the other
combinations that are generated do
not (55).
The presence of elevated Fas expression on the VH81X
+ B
cells also argues against a central deletion mechanism (62, 63) as the
cause of the cell loss and suggests the possibility that a peripheral
B-T cell interaction is involved in the homeostatic maintenance of the
B cell compartment as described for foreign antigenic stimulation (30, 64). The level of Fas expression on VH81X
+ B cells is
similar to that expressed by tolerant B cells that were subsequently
reexposed to Ag and is lower than on foreign Ag-stimulated B cells
(30). These observations might explain the topographical location of
these unusual cells and their failure to develop B cell follicles. From
our data, we favor the explanation that the block is most likely due to
a failure to receive the proper balance of signals (positive and
negative) inducing further development or maintenance.
Evidence is accumulating for positive selection steps involving surface
Ig signaling at the immature B cell stage that is necessary for further
development. In the soluble HEL/anti-HEL system, by manipulating
the accessory molecule CD45, which is involved in the transduction of
sIgM mediated signals, it was shown that B cells lacking CD45 entered
the mature repertoire much more efficiently when soluble HEL was
present (23). In addition, the increased size of some B cell
compartments from CD45 -/- mice might be due to positive selection
events (65). Another genetic manipulation of signaling through the sIgM
receptor in syk tyrosine kinase -/- mice results in a
similar block at the very immature B cell stage (24, 25). When this
defect was introduced into the H-2K/anti-H-2K model, a
syk-derived signal was found to be necessary for further B
cell selection and/or expansion but not for negative selection (66). In
all of these cases, the signal was manipulated indirectly through
accessory molecules, while in our system the block appears to be due to
the composition of surface IgM receptor itself. Although we cannot
estimate how frequently rearranged germline VH genes fail
to match with appropriate light chains to permit delivery of a
functional signal at this crucial selection point, this case is
unlikely to be restricted to VH81X-
receptors. It appears that VH12
heavy chain may not generate B cells in association with
light
chains (S. Clarke, unpublished observations). In addition, it is
possible that B cells are not generated in a VH1-Vk22 (T15)
"monoclonal" mouse due to a similar phenomena (F. Alt, unpublished
observations). In the sp6-rag -/- transgenic mice (67), a
similar B cell block occurs, which is partially released by the i.v.
injection of trinitrophenyl Ag. Since, in this case, reactivity of the
transgene-encoded receptor with dsDNA can also be demonstrated, a
deletional mechanism was proposed as being responsible for the observed
block. A very recent report investigates the development of different
types in the M54 and H3 heavy chain transgenic mice and concludes
that positive selection favors different transgenic
B cell clones
in the two models (68).
We have compared and summarized the observations made in the generation
of VH81X-
+ cells and B cell development in current
transgenic and gene deletion mice (Fig. 8
). The B cell developmental program is
considered from four independent aspects: 1) initial clonal receptor
development, 2) appearance of maturation markers, 3) subsequent
migration patterns in vivo, and 4) clonal life span. Normal mice as
well as nonautoimmune transgenic mice have all four programs intact (6, 7, 40, 68), while a first group of genetic defects including
scid and rag -/- µTG (65, 69) have cells that
are blocked completely at the pre-B stage in vivo. Under certain
conditions of in vitro growth or activation, portions of these programs
can be resurrected (70) but give rise to cells that do not have in vivo
counterparts in intact mice. A second group of defects occur in the
deletional models of B cell self-reactivity (6, 8, 71) in which these
four programs are blocked at an immature B cell stage. Introduction of
a bcl-2 transgene into mice of the first group releases the block in
maturation markers and migration pattern of pre-B cells that now
express mature markers and can form (pre-B) follicles in the spleen
(72, 73). However, if a bcl-2 transgene is introduced into mice of the
second group, as represented by the mHEL/anti-HEL deletional
system, the maturation program is only minimally released (50); there
have been no reports, however, on the topographical migration pattern
of B cells in peripheral lymphoid organs of these mice. Our VH81X-
transgenic model resembles the deletional transgenic mouse models with
a block in clonal receptor selection and further migration; but in
contrast to other models, they appear to have at least part of the
maturation marker program intact. A possibility exists that very small
numbers of B cells with a mature phenotype also develop in the
above-mentioned deletional models, but these have not yet been
described. Each of the maturation markers is up-regulated by signals
from the environment through which the maturing B cell moves.
Therefore, the chronologic period from the generation of B cells until
their removal by death might be different in each of these transgenic
models depending on the form, location, and affinity of the specific
self Ag. The subsequent maturation marker profiles identified on the B
cells that develop in each system may reflect the intrinsically
different characteristics of each mouse. In turn, the fate of B cells
in these systems viewed collectively reflects the normal fate of
heterogeneous populations of cells expressing receptors to Ags of
different characteristics and presentation modes.
|
) to develop in the
peripheral repertoire and have defined precisely the site of the block.
Abs containing the VH81X-
chains do not seem to be highly
self-reactive, suggesting that the lack of positive selection is the
operative mechanism in this system and that it prevents further
maturation and expansion of a normal peripheral B cell population. In
addition, by comparing the
compartments in other well-characterized
heavy chain transgenic mice, we show that there is a hierarchy in the
frequency of B cells expressing heavy chain-
pairs entering the
mature repertoire.
Our model will permit the study of signals and environmental factors
involved in the generation and maintenance of germline mature B cells.
Positive selecting stages are likely to be identified in B cell
generation and maintenance, comparable to T cell development in which
positive selection is well established. The process favoring certain B
cell receptor heavy-light chain pairs would be analogous to the thymic
positive selection at the double-positive stage, where pairs of TCR
- and ß-chains are selected together to form a mature functional
TCR repertoire, while the peripheral long term maintenance of B cell
clones may depend on continuous low level interactions of the receptor
with Ag in a self environment similar to that required by mature T
cells (74).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. John F. Kearney, 378 Wallace Tumor Institute, University of Alabama at Birmingham, Birmingham, AL 35394-3300. ![]()
3 Abbreviations used in this paper: HSA, heat-stable Ag; SA, streptavidin; PE, phycoerythrin; PALS, periarteriolar lymphoid sheath. ![]()
Received for publication September 26, 1997. Accepted for publication December 17, 1997.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. B. Foote and J. F. Kearney Generation of B Cell Memory to the Bacterial Polysaccharide {alpha}-1,3 Dextran J. Immunol., November 15, 2009; 183(10): 6359 - 6368. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lutz, W. Muller, and H.-M. Jack VH Replacement Rescues Progenitor B Cells with Two Nonproductive VDJ Alleles J. Immunol., November 15, 2006; 177(10): 7007 - 7014. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Whitmore, H. R. Neely, R. Diz, and P. M. Flood Rapid Induction of Splenic and Peritoneal B-1a Cells in Adult Mice by Thymus-Independent Type-2 Antigen J. Immunol., November 1, 2004; 173(9): 5406 - 5414. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Attanavanich and J. F. Kearney Marginal Zone, but Not Follicular B Cells, Are Potent Activators of Naive CD4 T Cells J. Immunol., January 15, 2004; 172(2): 803 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, F. Martin, A. M. Oliver, J. F. Kearney, and R. H. Carter Antigen Receptor Proximal Signaling in Splenic B-2 Cell Subsets J. Immunol., March 1, 2001; 166(5): 3122 - 3129. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hachemi-Rachedi, A.-M. Drapier, P.-A. Cazenave, and P. Sanchez Affiliation to mature B cell repertoire and positive selection can be separated in two distinct processes Int. Immunol., March 1, 2000; 12(3): 385 - 395. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. W. v. Ginkel, S. M. Wahl, J. F. Kearney, M.-N. Kweon, K. Fujihashi, P. D. Burrows, H. Kiyono, and J. R. McGhee Partial IgA-Deficiency with Increased Th2-Type Cytokines in TGF-{beta}1 Knockout Mice J. Immunol., August 15, 1999; 163(4): 1951 - 1957. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Oliver, F. Martin, and J. F. Kearney IgMhighCD21high Lymphocytes Enriched in the Splenic Marginal Zone Generate Effector Cells More Rapidly Than the Bulk of Follicular B Cells J. Immunol., June 15, 1999; 162(12): 7198 - 7207. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |