The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shnyra, A.
Right arrow Articles by Morrison, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shnyra, A.
Right arrow Articles by Morrison, D. C.
The Journal of Immunology, 1998, 160: 3729-3736.
Copyright © 1998 by The American Association of Immunologists

Reprogramming of Lipopolysaccharide-Primed Macrophages Is Controlled by a Counterbalanced Production of IL-10 and IL-121

Alexander Shnyra3, Ryan Brewington, Arlene Alipio2, Claudia Amura and David C. Morrison

Department of Microbiology, Molecular Genetics, and Immunology, University of Kansas Medical Center, Kansas City, KS 66160


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We studied the potential role of a cytokine regulatory mechanism(s) in LPS-dependent reprogramming and modulation of TNF-{alpha} and nitric oxide (NO) responses in mouse peritoneal macrophages. Reciprocal regulation of TNF-{alpha} and NO production by LPS-primed and LPS-stimulated macrophages was found to be dependent on the presence of soluble secretory products released by the cells during the initial LPS priming interaction. Pretreatment of naïve macrophages with different mouse recombinant cytokines such as rIL-10, rIL-12, and rIFN-{gamma} dose dependently and differentially regulated subsequent LPS-induced production of TNF-{alpha}, IL-6, and NO by cytokine-primed cells. Analysis of IL-12 and IL-10 levels present in culture supernatants of LPS-primed and LPS-stimulated macrophages revealed a high degree of correlation between the profiles of TNF-{alpha} and IL-12 as well as NO and IL-10. Furthermore, LPS priming of macrophages in the presence of anti-IL-12-neutralizing mAb attenuated TNF-{alpha} responses while at the same time up-regulated NO production. In contrast, neutralization of endogenous IL-10 with anti-IL-10 mAb resulted in considerable TNF-{alpha} response at LPS priming doses under conditions that would otherwise strongly inhibit TNF-{alpha} production. We also found that the initial LPS priming of naïve macrophages differentially and dose dependently regulates expression of mRNAs for IL-10, IL-12, and IFN-{gamma} in LPS-primed macrophages. Collectively, our data provide experimental support for the hypothesis that a cytokine regulatory network, most probably autocrine, tightly controls the reciprocal modulation of TNF-{alpha} and NO responses in LPS-primed macrophages.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Endotoxin or LPS of Gram-negative bacteria is an integral component of the bacterial cell wall, and is known to mediate a number of biologic activities associated with the sepsis syndrome, including fever, hypotension, multiple organ failure, shock, and death (1). These deleterious host responses to endotoxin are believed to result from an uncontrolled cascade of proinflammatory cytokines produced by cells of the reticuloendothelial system in general, and macrophages in particular. Cytokines represent a family of intercellular mediators that are now recognized to play a central role in virtually all interactions involving cells of the immune system, e.g., communication and differentiation of cellular components of the immune system, induction and amplification of inflammatory responses, and generation of antiinflammatory reactions (2). Macrophages are considered to be one of the main cellular sources of cytokines released in the body in response to different microbial products, including LPS. In numerous in vitro studies, it has been demonstrated that LPS-dependent activation of macrophages results in the release of various secretory products, including proinflammatory cytokines such as TNF-{alpha}, IL-1, IL-6, IL-12, and antiinflammatory cytokines, e.g., IL-10. It is of importance that these cytokines can be both produced and utilized by macrophages in processes known as autocrine regulatory pathways.

A unique property of endotoxin is that it can modulate in mammals a transient state of either hypersensitivity to itself, seen in animals with bacterial infections (3), or low responsiveness induced by a single or repeated injections of low LPS amounts in human volunteers and experimental animals (reviewed in 4 . The later phenomenon, referred as endotoxin tolerance, and its molecular mechanism(s) has been the subject of extensive studies, in large part due to its potential application for correction and/or prevention of the pathophysiologic sequelae associated with endotoxemia and Gram-negative sepsis. Unlike the early interpretation of endotoxin tolerance as a protection from the lethal effects of bacterial pyrogens (5), the current concept of this phenomenon implies that LPS unresponsiveness is controlled at the cellular level, and that the activity of macrophages may well be instrumental in the development of LPS tolerance (6, 7, 8). Control of macrophage LPS responsiveness may be of primary importance for the host and may function to limit the extent of the proinflammatory response to protect the host from excessive destructive processes during inflammation and infection. However, it is becoming increasingly apparent that the acquisition of an endotoxin refractory state is not derived from complete unresponsiveness of exhausted macrophages exposed to chronic LPS stimulus. Rather, this process is mediated by a highly orchestrated compensatory mechanism(s) controlling the balance of pro- and antiinflammatory cytokines in the host (9, 10). In this respect, it is attractive to hypothesize that some microbial pathogens, and probably malignant cells, may utilize a similar strategy to create an imbalance in the coordinated proinflammatory response of the immune system in an effort to circumvent host immunity.

Although the phenomenon of modulation of LPS responsiveness was initially described in in vivo experiments, recent studies have demonstrated that in vitro pretreatment of naïve macrophages with LPS also results in modulation of a refractory state in macrophages to subsequent activation with LPS (11, 12, 13). Furthermore, we have recently demonstrated that in vitro pretreatment of macrophages with LPS may result in a more complex process than a simple abrogation of proinflammatory responses in the cells. In those studies, it was shown that pretreatment of elicited mouse peritoneal macrophages with different threshold LPS doses induces a complex of intracellular reprogramming events resulting in a differential dose-dependent secretory activity of macrophages upon restimulation with a secondary effective LPS dose (14, 15, 16). This reprogramming is characterized phenotypically by a biphasic enhancement/suppression of TNF-{alpha} responsiveness compared with a reciprocal suppression/enhancement of nitric oxide (NO)4 secretion. Although we have suggested that reprogramming of macrophages may represent a fundamental regulatory mechanism for governing the host responses to LPS and, perhaps, controlling immunity to infection in general, the exact biochemical and molecular mechanism(s) underlying LPS-induced priming events in macrophages has not been well defined.

The present study was undertaken to test experimentally our hypothesis that LPS-dependent priming of macrophages is mediated by a cytokine autocrine/paracrine regulatory network and, specifically, is dictated by a profile of pro- and antiinflammatory cytokines produced by the cells during the reprogramming stage.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

C3Heb/FeJ mice of both sexes were purchased from The Jackson Laboratory (Bar Harbor, ME). Animals were maintained in the American Association for Accreditation of Laboratory Animal Care-certified Kansas University Medical Center animal facility under 12-h light/dark cycles with food and water provided ad libitum. Eight- to twelve-week-old mice were used for isolation of peritoneal macrophages.

Reagents

Phenol-extracted LPS from Escherichia coli O111:B4 was purchased from List Biologic Laboratories (Campbell, CA). Mouse rIL-10 (sp. act. 5 x 105 U/mg) and mouse rIL-4 (sp. act. 107 U/mg) were obtained from PharMingen (San Diego, CA). Recombinant mouse IL-12 (sp. act. 5 x 105 U/mg) was purchased from Genzyme (Cambridge, MA). Recombinant mouse IFN-{gamma} (sp. act. 1 x 106 U/mg) was a gift from Dr. S. W. Russell (University of Kansas Medical Center, Kansas City, KS). The endotoxin level in all recombinant cytokines used was less than 0.1 ng per µg of cytokine according to an analysis performed by the producer of the cytokines. Neutralizing rat anti-mouse IFN-{gamma} mAb (IgG1; clone XMG1.2) was obtained from PharMingen, neutralizing rat anti-mouse IL-12 mAb (IgG2a; clone C17.8) was from Genzyme, and neutralizing rat anti-mouse IL-10 mAb (IgG1; clone JES5-2A5) was purchased from Biosource International (Camarillo, CA). According to the manufacturer’s analysis, endotoxin contamination of all mAbs utilized was less than 0.01 ng/µg of protein. Endotoxin-tested RPMI 1640 culture medium and heat-inactivated FBS (endotoxin content, less than 0.6 endotoxin U/ml) was purchased from Sigma (St. Louis, MO).

Isolation and culture of peritoneal macrophages

Macrophages were obtained from C3Heb/FeJ mice i.p. injected with 1.5 ml of 4% thioglycollate broth (Difco Laboratories, Detroit, MI) 4 days before cell isolation. Macrophages were harvested by peritoneal lavage with sterile HBSS and washed twice with the same solution by centrifugation at 800 x g for 10 min. Isolated cells were resuspended in serum-free RPMI 1640 culture medium supplemented with 100 U/ml of penicillin and 100 µg/ml of streptomycin, counted, and dispensed into either 24-well tissue culture plates (Costar, Cambridge, MA) or 6-well plates (Costar) at an approximate density of 1 x 106 and 5 x 106 cells per well, respectively. Cells were incubated in 5% CO2 humidified atmosphere of a CO2 incubator for 20 to 30 min at 37°C before nonadherent cells (primarily lymphocytes) were removed by washing with HBSS. An initial culturing of macrophages in the absence of FBS facilitated a selective attachment and spreading of peritoneal macrophages, while preventing lymphocytes and other cells from being attached to the culture surface. After monolayer cultures of macrophages were obtained, the cells were cultured and treated as described in the text in the presence of RPMI 1640 supplemented with 10% FBS unless otherwise indicated.

RNA isolation, cDNA synthesis, and semiquantitative analysis of cytokine mRNA levels by reverse transcriptase (RT)-PCR

Peritoneal macrophages cultured in six-well plates were primed for 6 h at 37°C with O111:B4 LPS in a range of concentrations of 0.1 to 10 ng/ml. Total RNA was extracted from the cells by TRIzol Reagent (Life Technologies, Grand Island, NY) following the manufacturer’s procedure. Equal amounts of total RNA (0.8–1.0 µg) corresponding to each priming dose were reverse transcribed using oligo(dT)16 as a primer and a complete GeneAmp RNA PCR Kit (Perkin-Elmer, Norwalk, CT). cDNA obtained after reverse transcription was amplified using specific cytokine primers and AmpliTaq DNA polymerase (Perkin-Elmer) following the protocols provided. The primers used were mouse ß-actin (sense, residues 206–227, TGTGATGGTGGGAATGGGTCAG; antisense, residues 698–719, TTTGATGTCACGCACGATTTCC), mouse IL-12 p40 (sense, CAGAAGCTAACCATCTCCTGGTTTG; antisense, TCCGGAGTAATTTGGTGCTTCACAC), mouse IL-10 (sense, residues 226–249, GTGAAGACTTTCTTTCAAACAAAG; antisense, residues 476–499, CTGCTCCACTGCCTTGCTCTTATT), mouse IFN-ß (sense, residues 16–36, CTCCAGCTCCAAGAAAGGACG; antisense, residues 457–477, GAAGTTTCTGGTAAGTCTTCG), and mouse IFN-{gamma} (sense, residues 130–153, TACTGCCACGGCACAGTCATTGAA; antisense, residues 511–534, GCAGCGACTCCTTTTCCGCTTCCT). PCR amplification was performed using 30 cycles of 2 min of denaturation at 94°C, 2 min of annealing at 60°C, and 7 min of extension at 72°C. Samples were subjected to electrophoresis on 1% agarose gels, stained with ethidium bromide, and photographed.

Cytokine analysis

Cytokine production by macrophages was analyzed in culture supernatants after a 24-h cell stimulation with LPS. TNF-{alpha} bioactivity in cell culture supernatants was measured by a cytotoxicity assay on L929 cells essentially as described previously (16). A specific ELISA was used for determination of IL-12, IL-6, and IL-10. A mouse IL-10 ELISA Kit obtained from Genzyme was used for detection of IL-10 (sensitivity of ELISA: 15 pg/ml). IL-6 was measured by ELISA using a specific pair of anti-mouse IL-6 mAbs and recombinant mouse IL-6 purchased from PharMingen (sensitivity of assay: 50 pg/ml). Recombinant IL-12 and anti-mouse IL-12 mAbs were provided by Genzyme and used for the determination of IL-12. Briefly, 96-well plates (Immulon 1; Dynatech Laboratories, Chantilly, VA) were coated overnight at 4°C with either 100 µl/well of capture anti-IL-6 or anti-IL-12 mAb at 1 µg/ml in 50 mM borate buffer, pH 8.5. Nonspecific binding was blocked with PBS supplemented with 0.1% Tween-20 and 10% FBS at 37°C for 1 h. Appropriately diluted samples were added in triplicates together with a serial twofold dilution of corresponding recombinant cytokine for the creation of a standard curve. After incubation at 37°C for 2 h, plates were washed with PBS/Tween-20 buffer, and 100 µl of corresponding biotinylated mAbs at a concentration of 1 µg/ml were added to each well and incubated for an additional hour at 37°C. After extensive washing with PBS/Tween-20, horseradish peroxidase-conjugated avidin (Pierce, Rockford, IL) was added to each well and incubated for 30 min at 37°C. Finally, 3,3',5,5' Tetramethylbenzidine substrate solution (Kirkegaard & Perry Laboratories, Gaithersburg, MD) was added and OD was measured at 405 nm after 15 min of developing at room temperature. Cytokine concentrations in test samples were calculated by comparison with a corresponding standard curve. The sensitivity of IL-12 ELISA was 20 pg/ml.

NO assay

NO in 24-h conditioned culture supernatants was measured as amounts of nitrite, a stable product of NO decay, using Greiss reagent (17).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Priming with LPS modulates different phenotypes in macrophages

Previously, we have shown that priming of mouse thioglycollate-elicited peritoneal macrophages with threshold LPS concentrations results in a dose-dependent differential regulation of TNF-{alpha}, IL-6, and NO production by the cells (14, 15, 16). Thus, when freshly isolated and otherwise naïve macrophages were primed with low LPS concentrations for 6 h and then restimulated with 1 µg/ml of LPS for 24 h, a reciprocal regulation of TNF-{alpha} and NO responses in the cells was observed (Fig. 1GoA). As a next step to understanding the molecular mechanism of this phenomenon, we have assessed the stability of modulated TNF-{alpha} and NO responses in macrophages. These experiments were conducted to test the hypothesis that the commitment of macrophages to either the TNF-{alpha} or NO phenotype is entirely dependent on the reprogramming stage so that the relative balance of TNF-{alpha}/NO is maintained constant upon subsequent stimulation with various effective concentrations. In these experiments, three separate sets of peritoneal macrophages were primed with either 100 pg/ml, 500 pg/ml, or 5 ng/ml of LPS for modulation of either a TNF-{alpha}- or NO-dominant type of response, respectively. Primed macrophages were then washed and restimulated with various effective concentrations of LPS in the range of concentrations of 20 to 2000 ng/ml. TNF-{alpha} and NO levels in the cell culture supernatants were determined after a 24-h stimulation with LPS and, thus, a pair of TNF-{alpha} and NO values corresponding to each effective LPS dose was obtained. Figure 1GoB shows experimental curves reflecting a relative balance of TNF-{alpha} and NO produced by LPS-stimulated macrophages that were primed with the three different LPS doses. The data shown in Figure 1GoB strongly suggest that, regardless of the secondary LPS dose used for stimulation of the cells, macrophages primed with the same LPS pretreatment concentration express a similar response in the sense that the relative balance of TNF-{alpha} and NO produced by the cells is maintained at the same level.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 1. Modulation of stable TNF-{alpha} and NO responses in LPS-primed macrophages. A, Isolated macrophages were primed with the indicated concentrations of LPS for 6 h before the cells were stimulated with 1 µg/ml of O111:B4 LPS for 24 h. After stimulation, cell culture supernatants were collected and TNF-{alpha} and NO levels were determined as described in Materials and Methods. The levels of TNF-{alpha} and nitrite produced by the cells without LPS priming are shown as dashed bars (mean ± SD). B, Three identical sets of naïve macrophages were primed for 6 h with 0.1 ng/ml, 0.5 ng/ml, or 5 ng/ml of LPS to modulate the TNF-{alpha} or NO type of response. Then, LPS-primed cells were stimulated with various effective doses of LPS for 24 h and TNF-{alpha} and NO levels were determined in 24-h culture supernatants. Experimental curves of TNF vs NO were created for each LPS priming dose. The data are mean ± SEM.

 
Role of soluble factors in LPS-induced modulation of macrophage phenotypes

In an attempt to identify the role of soluble factors/mediators in supernatants of LPS-primed macrophages that might be responsible for modulation of macrophage phenotypes, two identical sets of naïve peritoneal macrophages were obtained. One set of macrophages was maintained in standard culture conditions of RPMI 1640 supplemented with 10% FBS, while another set of the cells was primed with various LPS amounts for 6 h. Cell culture supernatants at each LPS priming dose were individually collected and filtered to remove cells and debris particles. The LPS concentrations in the samples were then adjusted by adding stock LPS to generate culture supernatants containing 1 µg/ml of LPS. Then, the supernatants were transferred to unprimed naïve macrophages for a direct LPS stimulation in the presence of secretory products produced by LPS-primed cells. The data presented in Figure 2Go would support the concept that LPS-dependent TNF-{alpha} and NO responses in unprimed macrophages may be modulated by soluble factors present in supernatants from LPS-primed cells.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 2. LPS-dependent stimulation of unprimed macrophages in the presence of soluble secretory products released by LPS-primed cells. Isolated macrophages were primed with different thresholds of LPS concentrations for 6 h as described in the legend to Figure 1GoA. Culture supernatants conditioned by the cells during the LPS priming stage were then individually collected, filtered, and adjusted to an LPS concentration of 1 µg/ml before their transfer to unprimed naïve macrophages. After 24 h of stimulation with LPS in the presence of transferred supernatants, TNF-{alpha} and NO levels were measured in 24-h culture supernatants. Experimental curves were plotted as TNF-{alpha} and NO over LPS priming doses. The data represent the mean (± SD) of triplicate measurements from one representative experiment of four performed. The levels of TNF-{alpha} and nitrite produced by the cells without LPS priming are shown as dashed bars (mean ± SD).

 
Modulation of LPS-dependent responses in macrophages with recombinant cytokines

To further ascertain the potential role of a cytokine regulatory network in driving polarization of macrophage phenotypes, naïve macrophages were primed with various concentrations of different recombinant cytokines for 6 h before challenge with LPS. The effects of this cytokine pretreatment on subsequent TNF-{alpha}, IL-6, and NO production by LPS-stimulated cells were then analyzed. In the experiments presented in Figure 3Go, we tested the effects of mouse rIFN-{gamma} in the range of concentrations of 0.1 to 10 U/ml on the modulation of LPS-dependent activation of naïve macrophages. Pretreatment with IFN-{gamma} strongly up-regulated TNF-{alpha} (Fig. 3GoA) in a dose-dependent fashion and NO (Fig. 3GoB) production by LPS-stimulated macrophages. Interesting, the effect of IFN-{gamma} pretreatment on LPS-dependent IL-6 release was insignificant. A neutralizing anti-IFN-{gamma} mAb at a concentration of 1 µg/ml partially inhibited the effects of IFN-{gamma} pretreatment (Fig. 3GoA), whereas the control isotype-matched IgG had little effect (data not shown). Although anti-IFN-{gamma} mAbs and other neutralizing anti-cytokine mAbs (see below) taken at concentrations of 1 µg/ml only partially inhibited cytokine priming effects, the use of this concentration was dictated by the findings that higher Ab doses resulted in highly unacceptable background, e.g., detectable cytokine and NO levels in supernatants of cells exposed to the cytokine/Ab mixture without LPS stimulation (data not shown). Interesting, the presence of anti-cytokine Abs during stimulation of the primed macrophages with LPS did not substantially affect modulation of phenotypic responses, suggesting the pivotal role of cytokine regulatory mechanism(s) operating during the priming stage.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 3. The effects of rIFN-{gamma} pretreatment on modulation of LPS-dependent cytokine and NO responses in macrophages. Naïve macrophages were primed with the indicated amounts of rIFN-{gamma} for 6 h. Cytokine-primed cells were then extensively washed with HBSS and stimulated with 1 µg/ml LPS for 24 h. TNF-{alpha}, IL-6, and NO were determined in collected culture supernatants as described in Materials and Methods. In parallel experiments, priming with IFN-{gamma} was performed in the presence of 1 µg/ml of anti-IFN-{gamma}-neutralizing mAb and the effects of anti-IFN-{gamma} mAb on TNF-{alpha}, IL-6, and NO production by primed macrophages was assessed as described above. A, LPS-dependent production of TNF-{alpha} by IFN-{gamma}-primed macrophages. The level of TNF-{alpha} produced by the cells without LPS priming is shown as a dashed bar (mean ± SD). B, IL-6 and NO release by cytokine-primed macrophages. The levels of IL-6 and nitrite produced by the cells without LPS priming are shown as dashed bars (mean ± SD). The data represent the mean (±SD) of triplicate measurements from one representative experiment of three performed.

 
Priming of naïve macrophages with rIL-12 had a modest potentiating effect on both LPS-dependent TNF-{alpha} (Fig. 4GoA) and IL-6 (Fig. 4GoB) responses in the cells. However, IL-12 pretreatment was ineffective in modulation of the NO response (Fig. 4GoB). The specificity of IL-12 priming effects on macrophages was confirmed by inhibition of its effects with neutralizing anti-IL-12 mAb (Fig. 4GoA).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 4. Modulation of LPS-dependent TNF-{alpha}, IL-6, and NO production in macrophages by priming with rIL-12. Naïve macrophages were primed with rIL-12, stimulated with 1 µg/ml of LPS and TNF-{alpha}, and IL-6 and NO production by cytokine-primed cells was assessed essentially as indicated in the legend to Figure 3Go. A neutralizing anti-IL-12 mAb was used at a concentration of 1 µg/ml and added to naïve macrophages together with rIL-12 to inhibit rIL-12-mediated priming effects in the cells. A, LPS-dependent production of TNF-{alpha} by IL-12-primed macrophages. The level of TNF-{alpha} produced by the cells without LPS priming is shown as a dashed bar (mean ± SD). B, IL-6 and NO release by cytokine-primed macrophages. The levels of IL-6 and nitrite produced by the cells without LPS priming are shown as dashed bars (mean ± SD). The data represent the mean (±SD) of triplicate measurements from one representative experiment of three performed.

 
Finally, priming with rIL-10 dose dependently down-regulated TNF-{alpha} and IL-6 production in cytokine-primed cells and slightly up-regulated NO release upon restimulation of macrophages with LPS (Fig. 5Go). In addition, rIL-10, added in combinations with IL-12 or IFN-{gamma} taken at their optimal priming doses, was still capable of inhibiting in a dose-dependent manner the priming effects of these cytokines on TNF-{alpha} and NO production by macrophages (data not shown).



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 5. Inhibitory effects of rIL-10 on LPS-dependent production of TNF-{alpha}, IL-6, and NO by macrophages. Macrophages were primed with rIL-10 for 6 h before a 24-h stimulation with 1 µg/ml of LPS. TNF-{alpha}, IL-6, and NO production by rIL-10-primed and LPS-stimulated cells was analyzed as described in Materials and Methods. A, LPS-dependent production of TNF-{alpha} by IL-10-primed macrophages. The level of TNF-{alpha} produced by the cells without LPS priming is shown as a dashed bar (mean ± SD). B, IL-6 and NO release by cytokine-primed macrophages. The levels of IL-6 and nitrite produced by the cells without LPS priming are shown as dashed bars (mean ± SD). The data represent the mean (±SD) of triplicate measurements from one representative experiment of three performed.

 
Differential regulation of IL-10 and IL-12 production by LPS-primed macrophages

Due to the common permissive/inhibitory relationship of cytokines in the control of cellular production of each other, we next evaluated the levels of IL-10, IL-12, and IFN-{gamma} in 24-h supernatants of LPS-primed and LPS-stimulated macrophages to assess the potential role of these cytokines in modulation of TNF-{alpha} and NO responses in LPS-primed macrophages. Although a sensitive ELISA was performed to measure the amounts of IFN-{gamma} (detection limit 25 pg/ml) in culture supernatants, no detectable levels of IFN-{gamma} were found in the test samples (data not shown). In contrast, priming with LPS differentially and dose dependently regulated production of IL-10 and IL-12, which were reciprocally regulated in LPS-primed macrophages (Fig. 6Go). In addition, data shown in Figure 6Go indicate that the peak of IL-12 production approximately coincides with the peak of TNF-{alpha} production by LPS-primed macrophages, whereas the profile of IL-10 release parallels the one for NO response (Fig. 1GoA).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 6. Dose-dependent production of IL-10 and IL-12 by LPS-primed and LPS-stimulated macrophages. Naïve macrophages were LPS-primed and stimulated with LPS as described in the legend to Figure 1Go. IL-10 and IL-12 levels in cell culture supernatants were measured by specific ELISAs as indicated in Materials and Methods. The levels of IL-10 and IL-12 produced by the cells without LPS priming are shown as dashed bars (mean ± SEM). The data represent the mean (±SD) of triplicate measurements from one representative experiment of three performed.

 
Effects of neutralizing anti-cytokine mAbs on LPS-induced priming of macrophages

To further characterize the cytokine regulatory pathway(s) involved in LPS-dependent priming of macrophages, we tested the capacity of neutralizing anti-IL-10, anti-IL-12, and anti-IFN-{gamma} mAbs to influence the LPS-induced priming process. In this set of experiments, macrophages were primed with LPS in the presence of 20 µg/ml of each neutralizing mAb added alone. Then, after extensive washing, cells were restimulated with an effective LPS dose and the amounts of TNF-{alpha} and NO were determined in culture supernatants 24 h later. The data presented in Figure 7GoA show that neutralization of IL-12 and IFN-{gamma} during the LPS priming stage attenuated TNF-{alpha} production by LPS-stimulated macrophages. In contrast, neutralization of IL-10 resulted in TNF-{alpha} release at LPS priming concentrations that otherwise strongly inhibited TNF-{alpha} production by the cells. When the effects of neutralizing mAbs on NO response of LPS-primed macrophages were analyzed, we found that anti-IFN-{gamma} and anti-IL-10 mAb inhibited NO production by LPS-primed macrophages, whereas neutralization of IL-12 boosted LPS-dependent NO responses in the cells (Fig. 7GoB). These data would indicate the potential role of IL-10, IL-12, and IFN-{gamma} in modulation of both TNF-{alpha} and NO phenotypes in LPS-primed macrophages.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 7. The effects of neutralizing anti-IL-10, anti-IL-12, and anti-IFN-{gamma} mAbs on TNF-{alpha} and NO production by LPS-primed and LPS-stimulated macrophages. Macrophages were LPS primed in the presence of 20 µg/ml of anti-IL-10, anti-IL-12, or anti-IFN-{gamma} mAbs added alone. After extensive washing with HBSS, LPS-primed cells were stimulated with 1 µg/ml LPS and LPS-dependent TNF-{alpha} and NO production by the cells was analyzed in 24-h culture supernatants. A, The effects of anti-cytokine-neutralizing mAbs on LPS-induced TNF-{alpha} production by LPS-primed cells. B, The effects of neutralizing mAbs on LPS-induced NO production by LPS-primed cells. The data represent the mean (±SD) of triplicate measurements from one representative experiment of three performed.

 
RT-PCR analysis of cytokine mRNA expression during the LPS priming stage

That macrophages were exposed to the tested anti-cytokine-neutralizing mAbs only during the LPS priming stage would suggest that polarization of the development of macrophage phenotypes may occur during the priming stage and be mediated by an LPS-activated cytokine network. To test this experimental hypothesis, we analyzed cytokine levels in culture supernatants of macrophages that were only primed with threshold LPS concentrations for 6 h. However, we were unable to detect ELISA-measurable amounts of IL-10, IL-12, TNF-{alpha}, and IFN-{gamma} in collected supernatants. We therefore analyzed the differential expression of cytokine mRNA using RT-PCR. In these experiments, naïve macrophages were primed with various concentrations of LPS for 6 h before total cellular RNA was isolated, reverse transcribed, and specifically amplified using primers for different mouse cytokines. Data presented in Figure 8Go show a differential dose-dependent regulation of cytokine mRNA expression in LPS-primed macrophages. Expression of IL-12 mRNA was found to be up-regulated at LPS priming concentrations that overlapped with the LPS priming doses we previously established to modulate an increased TNF-{alpha} production in macrophages (TNF-{alpha} phenotype). In contrast, IL-10 mRNA, IFN-ß mRNA, and IFN-{gamma} mRNA were detectable only at high LPS priming doses of 1 to 10 ng/ml and overlapped with LPS priming concentrations previously established to preferentially induce the NO phenotype in macrophages. Interestingly, analysis of expression of the TNF-{alpha} message revealed comparable levels of TNF-{alpha} mRNA in macrophages primed with different LPS reprogramming doses in the range of 0.1 to 10 ng/ml, suggesting a posttranscriptional mechanism governing TNF-{alpha} production by the cells.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 8. Analysis of IL-10, IL-12, IFN-ß, and IFN-{gamma} mRNA expression in LPS-primed macrophages. After priming with the indicated amounts of LPS (ng/ml) for 6 h, total cellular RNA was isolated, adjusted to yield comparable amounts of RNA, and then cDNA was obtained by reverse transcription using oligo (dT)16 as a primer. cDNAs obtained were amplified by PCR technique using specific primers for different mouse cytokines. The amplified DNA was applied to 1% agarose gel, subjected to electrophoresis, and stained with ethidium bromide.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we provide experimental evidence for the hypothesis that modulation of specific responses in LPS-primed macrophages is dictated by a cytokine regulatory mechanism(s) derived through a reciprocal regulation of IL-10 and IL-12 production in the cells. We found that an efficient LPS-dependent modulation of TNF-{alpha} and NO phenotypes in macrophages may well depend on autocrine/paracrine signals mediated via the release of specific soluble factors/mediators by the cells during the LPS priming stage. To confirm the potential role of cytokines in the modulation of LPS priming effects, we evaluated LPS-dependent TNF-{alpha} and NO responses in cytokine-primed macrophages pretreated with different recombinant cytokines before stimulation with LPS. Our data strongly suggest that an exposure of naïve macrophages to individual cytokines such as IFN-{gamma}, IL-12, and IL-10 or a combination of these cytokines may differentially modulate cell responsiveness to LPS. Therefore, among other regulatory pathways, a cytokine network may well represent a potential mechanism(s) controlling the bias of specific macrophage phenotypes induced by LPS priming. Analysis of cell-derived IL-10 and IL-12 concentrations in culture supernatants of LPS-primed and LPS-stimulated macrophages revealed a significant correlation between the levels of IL-12 and TNF-{alpha} as well as between the levels of IL-10 and NO. This finding establishes a necessity between modulation of proinflammatory TNF-{alpha} phenotype of response and up-regulated production of IL-12 in LPS-primed macrophages, whereas modulation of the NO phenotype may well be associated with up-regulated production of IL-10 and its antiinflammatory effects. Furthermore, neutralization of endogenously produced IL-10 and IL-12 with anti-IL-10 and anti-IL-12 mAbs significantly affected LPS-dependent responses in LPS-primed cells, further suggesting the pivotal role of IL-12 and IL-10 in the modulation of TNF-{alpha} and NO phenotypes in macrophages. In addition, we found differential and dose-dependent regulation of mRNA expression for IL-12 and IL-10 in LPS-primed cells. Therefore, it is reasonable to conclude that endogenously produced IL-12 may promote and control a proinflammatory TNF-{alpha} phenotype in LPS-primed macrophages by up-regulating TNF-{alpha} production and inhibiting NO release. In contrast, cell-derived IL-10 may well control modulation of an NO phenotype associated with antiinflammatory cell responses by up-regulating NO release and limiting TNF-{alpha} production in LPS-primed macrophages. In addition, up-regulated expression of IFN-ß and IFN-{gamma} mRNAs in LPS-primed macrophages and recently reported synergistic effects of these cytokines on LPS-dependent activation of inducible NO synthase suggest the potential role of IFNs in the modulation of the NO phenotype in LPS-primed macrophages.

Although IL-10 inhibits in vitro activation and NO production by macrophages, our results suggest a potential regulatory role of IL-10 in the modulation of the NO phenotype in LPS-primed macrophages. It has yet to be established whether IL-10 directly modulates the NO phenotype in LPS-primed macrophages or whether this correlation is circumstantial and other factors/cytokines play a key role in the complex regulatory process controlling macrophage reprogramming. Additional experiments on macrophages isolated from IL-10, IL-12, and IFN-{gamma} knockout mice will allow the dissection of the specific role of each of these cytokines in the modulation of different phenotypes in LPS-primed macrophages. However, experimental data available support our hypothesis that the commitment of macrophages to either the TNF-{alpha} or NO phenotype of the LPS-dependent response occurs during the priming stage and is mediated by a cytokine regulatory pathway(s) derived through a reciprocal induction of IL-12 and IL-10.

Due to the crucial role of IL-10 and IL-12 in the polarization of T cell responses, a reciprocal control of IL-12 and IL-10 production in LPS-primed macrophages such as APCs may well be instrumental for developing host immune responses in general. The adaptive response to infections is characterized by the differentiation of Th cells into either the Th1 or Th2 phenotype, which then favors cell-mediated immunity and humoral responses, respectively (18, 19, 20, 21). Th1 development is positively regulated by two major cytokines, IL-12 and IFN-{gamma}, and, in general, results in localization and cure of the infection (22, 23, 24, 25, 26). In contrast, IL-10, an antiinflammatory cytokine produced by activated macrophages/monocytes, synergizes with IL-4 in the induction of Th2-type lymphocyte development and is found to be associated with chronic, progressive infections (27, 28).

Macrophages can produce cytokines that are vital for T cell development, such as IL-10 and IL-12, as well as some amounts of IFN-{gamma}, as suggested in earlier studies (29). Evidently, if a reciprocal production of IL-12 and IL-10 in macrophages is achieved, it would be expected to provide a cytokine microenvironment facilitating development of either the Th1 or Th2 subset, respectively. We therefore hypothesize that the plasticity of APC-derived cytokine production as shown in the data presented here for macrophages, and controlled by dose-dependent LPS priming of the cells, may dictate the outcome of APC-T cell interactions. We speculate that, depending on the dominant type of cytokine response, e.g., IL-12 or IL-10, acquired by macrophages after priming with LPS, primed macrophages functioning as APC would provide an accessory signal for the development of either the Th1 or Th2 subset, respectively. Specifically, up-regulated production of IL-12 can directly (30, 31, 32) or, most likely, via synergism with TNF-{alpha}-dependent induction of IFN-{gamma} (33, 34), control the development of Th1 type. In contrast, macrophage phenotype characterized by overproduction of IL-10 may well favor proliferation of the Th2 type of T cells through a synergistic action with IL-4 (27, 28) and antagonistic effects on Th1-type cytokine production (35, 36). Furthermore, the differential IL-10 and IL-12 production in LPS-primed macrophages such as APCs is primarily dependent on the load of Ag/LPS, since LPS priming in macrophages is a dose-dependent process. Priming of macrophages is induced by threshold LPS concentrations and, therefore, may take place during the initial stage of disease at the "gate of infection." Importantly, newly recruited phagocytes/APCs could be "educated" by already primed macrophages through the specific cytokine milieu produced by the earlier arrived APCs. Further investigation of the mechanism(s) controlling reciprocal production of IL-10 and IL-12 in LPS-primed macrophages and its potential role in modulation of differentiation of T cell precursors into functionally distinct Th1 and Th2 subsets of T lymphocytes is under progress in our laboratory.


    Acknowledgments
 
We thank Eleanor Zuvanich for expert technical assistance in preparation of L929 cells for TNF bioassay.


    Footnotes
 
1 This work was supported by National Institute of Health Grants POI CA54474 and R37AI23447. The support of the Kansas Masonic Foundation is also gratefully acknowledged. The work was done in partial fulfillment of the requirements for the "Mentorship Program" for R.B. in the Blue Valley School District, Overland Park, KS and for the Ph.D. degree for A.A. in United Laboratories, Inc., Manila, Philippines. Back

2 Current address: Dr. Arlene Alipio, United Laboratories, Inc., PO Box 3594, Manila, Philippines. Back

3 Address correspondence and reprint requests to Dr. Alexander Shnyra, The University of Kansas Medical Center, Department of Microbiology, Molecular Genetics and Immunology, Kansas City, KS 66160. Back

4 Abbreviations used in this paper: NO, nitric oxide; RT, reverse transcriptase. Back

Received for publication July 17, 1997. Accepted for publication December 16, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Morrison, D. C., J. L. Ryan. 1987. Endotoxins and disease mechanisms. Annu. Rev. Med. 38:417.[Medline]
  2. Akira, S., T. Kishimoto. 1992. Mechanisms of soluble mediators. Curr. Opin. Immunol. 4:307.[Medline]
  3. Freudenberg, M. A., Y. Yaegashi, P. Nielsen, Y. Kumazawa, M. Aguet, C. Galanos. 1996. Mechanism of sensitization to endotoxin by bacteria. E. Faist, and A. E. Baue, and F. W. Schildberg, eds. The Immune Consequences of Trauma, Shock and Sepsis: Mechanisms and Therapeutic Approaches 804.-815. Pabst Science Publishers, Lengerich.
  4. Johnston, C. A., S. E. Greisman. 1985. Mechanism of endotoxin tolerance. L. B. Hinshaw, ed. In Handbook of Endotoxin Vol. 2:359.-391. Elsevier, Amsterdam, New York, and Oxford.
  5. Beeson, P. B.. 1947. Tolerance to bacterial pyrogens. I. Factors influencing its development. J. Exp. Med. 86:29.[Abstract]
  6. Haslberger, A., T. Sayers, H. Reiter, J. Chung, E. Schutze. 1988. Reduced release of TNF and PCA from macrophages of tolerant mice. Circ. Shock 26:185.[Medline]
  7. Freudenberg, M. A., C. Galanos. 1988. Induction of tolerance to lipopolysaccharide (LPS)-D-galactosamine lethality by pre-treatment with LPS is mediated by macrophages. Infect. Immun. 56:1352.[Abstract/Free Full Text]
  8. Mathison, J. C., G. D. Virca, N. Wolfson, P. S. Tobias, K. Glaser, R. J. Ulevitch. 1990. Adaptation to bacterial lipopolysaccharide (LPS) controls LPS-induced tumor necrosis factor production in rabbit macrophages. J. Clin. Invest. 85:1108.
  9. Henricson, B. E., W. R. Benjamin, S. N. Vogel. 1990. Differential cytokine induction by doses of lipopolysaccharide and monophosphoryl lipid A that result in equivalent early endotoxin tolerance. Infect. Immun. 58:2429.[Abstract/Free Full Text]
  10. Erroi, A., G. Fantuzzi, M. Mengozzi, M. Sironi, S. F. Orencole, B. D. Clark, C. A. Dinarello, A. Isetta, P. Gnocchi, M. Giovarelli, and P. Ghezzi. Differential regulation of cytokine production in lipopolysaccharide tolerance in mice. Infect. Immun. 61:4356.
  11. Virca, G. D., S. Y. Kim, K. B. Glaser, R. J. Ulevitch. 1989. Lipopolysaccharide induces hyporesponsiveness to its own action in RAW 264.7 cells. J. Biol. Chem. 264:21951.[Abstract/Free Full Text]
  12. Fahmi, H., R. Chaby. 1993. Desensitization of macrophages to endotoxin effects is not correlated with a down-regulation of lipopolysaccharide-binding sites. Cell. Immunol. 150:219.[Medline]
  13. Cavaillon, J. M., C. Pitton, C. Fitting. 1994. Endotoxin tolerance is not a LPS-specific phenomenon: partial mimicry with IL-1, IL-10 and TGFß. J. Endotoxin Res. 1:21.
  14. Zhang, X., D. C. Morrison. 1993. Lipopolysaccharide-induced selective priming effects on TNF-{alpha} and nitric oxide production. J. Exp. Med. 177:511.[Abstract/Free Full Text]
  15. Zhang, X., D. C. Morrison. 1993. Lipopolysaccharide structure-function relationship in activation versus reprogramming of mouse peritoneal macrophages. J. Leukocyte Biol. 54:444.[Abstract]
  16. Hirohashi, N., D. C. Morrison. 1996. Low-dose lipopolysaccharide (LPS) pretreatment of mouse macrophages modulates LPS-dependent interleukin-6 production in vitro. Infect. Immun. 64:1011.[Abstract]
  17. Stuehr, D. J., C. F. Nathan. 1989. Nitric oxide: a macrophage product responsible for cytostasis and respiratory inhibition in tumor target cells. J. Exp. Med. 169:1543.[Abstract/Free Full Text]
  18. Mosmann, T. R., R. L. Coffman. 1989. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7:145.[Medline]
  19. Kamogawa, Y., L. E. Minasi, S. R. Carding, K. Bottomly, R. A. Flavell. 1993. The relationship of IL-4- and IFN-{gamma}-producing T cells studied by lineage ablation of IL-4 producing cells. Cell 75:985.[Medline]
  20. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotypes by CD4+ T cells. Annu. Rev. Immunol. 12:635.[Medline]
  21. Bradley, L. M., K. Yoshimoto, S. L. Swain. 1995. The cytokines IL-4, IFN-{gamma}, and IL-12 regulate the development of subsets of memory effector helper T cells in vitro. J. Immunol. 155:1713.[Abstract]
  22. Trinchieri, G.. 1993. Interleukin-12 and its role in the generation of Th1 cells. Immunol. Today 14:335.[Medline]
  23. Chehimi, J., G. Trinchieri. 1994. Interleukin-12: a bridge between innate resistance and adaptive immunity with a role in infection and acquired immunodeficiency. J. Clin. Immunol. 14:149.[Medline]
  24. Maruo, S., K. Toyo-oka, M. Oh-hora, X. G. Tai, H. Iwata, H. Takenaka, S. Yamada, S. Ono, T. Hamaoka, M. Kobayashi, M. Wysocka, G. Trinchieri, H. Fujiwara. 1996. IL-12 produced by antigen-presenting cells induces IL-2-independent proliferation of T helper cell clones. J. Immunol. 156:1748.[Abstract]
  25. Hsieh, C., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, K. M. Murphy. 1993. Listeria-induced Th1 development in {alpha}ß-TCR transgenic CD4+ T cells occurs through macrophage production of IL-12. Science 260:547.[Abstract/Free Full Text]
  26. Nakamura, T., R. K. Lee, S. Y. Nam, E. R. Podack, K. Bottomly, R. A. Flavell. 1997. Role of IL-4 and IFN-{gamma} in stabilizing the T helper cell type 1 and 2 phenotype. J. Immunol. 158:2648.[Abstract]
  27. Sieling, P. A., J. S. Abrams, M. Yamamura, P. Salgame, B. R. Bloom, T. H. Rea, R. L. Modlin. 1993. Immunosuppressive role of IL-10 and IL-4 in human infection. J. Immunol. 150:5501.[Abstract]
  28. Moore, K. W., A. O’Garra, R. de Waal Malefyt, P. Vieira, T. R. Mosmann. 1993. Interleukin-10. Annu. Rev. Immunol. 11:165.[Medline]
  29. Fultz, M. J., S. A. Barber, C. W. Dieffenbach, S. N. Vogel. 1993. Induction of IFN-{gamma} in macrophages by lipopolysaccharide. Int. Immunol. 5:1383.[Abstract/Free Full Text]
  30. McKnight, A. J., G. J. Zimmer, I. Fogelman, S. F. Wolf, A. K. Abbas. 1994. Effects of IL-12 on helper T cell-dependent immune responses in vivo. J. Immunol. 152:2172.[Abstract]
  31. Seder, R. A., R. Gazzinelli, A. Sher, W. E. Paul. 1993. Interleukin-12 acts directly on CD4+ T cells to enhance priming for interferon-{gamma} production and diminishes interleukin-4 inhibition of such priming. Proc. Natl. Acad. Sci. USA 90:10188.[Abstract/Free Full Text]
  32. Wysocka, M., M. Kubin, L. Q. Vieira, L. Ozmen, G. Garotta, P. Scott, G. Trinchieri. 1995. Interleukin-12 is required for interferon-{gamma} production and lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672.[Medline]
  33. Gazzinelli, R. T., S. Hieny, T. A. Wynn, S. Wolf, A. Sher. 1993. Interleukin 12 is required for the T-lymphocyte-independent induction of interferon gamma by an intracellular parasite and induces resistance in T-cell-deficient hosts. Proc. Natl. Acad. Sci. USA 90:6115.[Abstract/Free Full Text]
  34. Tripp, C. S., S. F. Wolf, E. R. Unanue. 1993. Interleukin-12 and tumor necrosis factor alpha are costimulators of interferon gamma production by natural killer cells in severe combined immunodeficiency mice with listeriosis, and interleukin 10 is a physiologic antagonist. Proc. Natl. Acad. Sci. USA 90:3725.[Abstract/Free Full Text]
  35. Fiorentino, D. F., A. Zlotnik, P. Vieira, T. R. Mosmann, M. Howard, K. W. Moore, A. O’Garra. 1991. IL-10 acts on the antigen-presenting cell to inhibit cytokine production by Th1 cells. J. Immunol. 146:3444.[Abstract]
  36. D’Andrea, A., M. Aste-Amezaga, N. M. Valiante, X. Ma, M. Kubin, and G. Trinchieri. Interleukin 10 (IL-10) inhibits human lymphocyte interferon gamma-production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells. J. Exp. Med. 178:1041.



This article has been cited by other articles:


Home page
J. Immunol.Home page
Q. Espinassous, E. Garcia-de-Paco, I. Garcia-Verdugo, M. Synguelakis, S. von Aulock, J.-M. Sallenave, A. N. J. McKenzie, and J. Kanellopoulos
IL-33 Enhances Lipopolysaccharide-Induced Inflammatory Cytokine Production from Mouse Macrophages by Regulating Lipopolysaccharide Receptor Complex
J. Immunol., July 15, 2009; 183(2): 1446 - 1455.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Chan, E. R. Bivins-Smith, M. S. Smith, P. M. Smith, and A. D. Yurochko
Transcriptome Analysis Reveals Human Cytomegalovirus Reprograms Monocyte Differentiation toward an M1 Macrophage
J. Immunol., July 1, 2008; 181(1): 698 - 711.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Chen, M. J. Cowan, J. D. Hasday, S. N. Vogel, and A. E. Medvedev
Tobacco Smoking Inhibits Expression of Proinflammatory Cytokines and Activation of IL-1R-Associated Kinase, p38, and NF-{kappa}B in Alveolar Macrophages Stimulated with TLR2 and TLR4 Agonists
J. Immunol., November 1, 2007; 179(9): 6097 - 6106.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
A. E. Medvedev, I. Sabroe, J. D. Hasday, and S. N. Vogel
Invited review: Tolerance to microbial TLR ligands: molecular mechanisms and relevance to disease
Innate Immunity, June 1, 2006; 12(3): 133 - 150.
[Abstract] [PDF]


Home page
Infect. Immun.Home page
M. Muthukuru, R. Jotwani, and C. W. Cutler
Oral Mucosal Endotoxin Tolerance Induction in Chronic Periodontitis
Infect. Immun., February 1, 2005; 73(2): 687 - 694.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
H. L. Rosenzweig, N. S. Lessov, D. C. Henshall, M. Minami, R. P. Simon, and M. P. Stenzel-Poore
Endotoxin Preconditioning Prevents Cellular Inflammatory Response During Ischemic Neuroprotection in Mice
Stroke, November 1, 2004; 35(11): 2576 - 2581.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S.-J. Yeo, J.-G. Yoon, S.-C. Hong, and A.-K. Yi
CpG DNA Induces Self and Cross-Hyporesponsiveness of RAW264.7 Cells in Response to CpG DNA and Lipopolysaccharide: Alterations in IL-1 Receptor-Associated Kinase Expression
J. Immunol., January 15, 2003; 170(2): 1052 - 1061.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Dobrovolskaia, A. E. Medvedev, K. E. Thomas, N. Cuesta, V. Toshchakov, T. Ren, M. J. Cody, S. M. Michalek, N. R. Rice, and S. N. Vogel
Induction of In Vitro Reprogramming by Toll-Like Receptor (TLR)2 and TLR4 Agonists in Murine Macrophages: Effects of TLR "Homotolerance" Versus "Heterotolerance" on NF-{kappa}B Signaling Pathway Components
J. Immunol., January 1, 2003; 170(1): 508 - 519.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
C. Broderick, R. M. Hoek, J. V. Forrester, J. Liversidge, J. D. Sedgwick, and A. D. Dick
Constitutive Retinal CD200 Expression Regulates Resident Microglia and Activation State of Inflammatory Cells during Experimental Autoimmune Uveoretinitis
Am. J. Pathol., November 1, 2002; 161(5): 1669 - 1677.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. J. Robertson, L. P. Erwig, J. Liversidge, J. V. Forrester, A. J. Rees, and A. D. Dick
Retinal Microenvironment Controls Resident and Infiltrating Macrophage Function during Uveoretinitis
Invest. Ophthalmol. Vis. Sci., July 1, 2002; 43(7): 2250 - 2257.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Willuweit, G. Sass, A. Schoneberg, U. Eisel, G. Tiegs, and M. Clauss
Chronic Inflammation and Protection from Acute Hepatitis in Transgenic Mice Expressing TNF in Endothelial Cells
J. Immunol., October 1, 2001; 167(7): 3944 - 3952.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. E. Medvedev, P. Henneke, A. Schromm, E. Lien, R. Ingalls, M. J. Fenton, D. T. Golenbock, and S. N. Vogel
Induction of Tolerance to Lipopolysaccharide and Mycobacterial Components in Chinese Hamster Ovary/CD14 Cells Is Not Affected by Overexpression of Toll-Like Receptors 2 or 4
J. Immunol., August 15, 2001; 167(4): 2257 - 2267.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Brewington, M. Chatterji, M. Zoubine, R. N. Miranda, M. Norimatsu, and A. Shnyra
IFN-{{gamma}}-Independent Autocrine Cytokine Regulatory Mechanism in Reprogramming of Macrophage Responses to Bacterial Lipopolysaccharide
J. Immunol., July 1, 2001; 167(1): 392 - 398.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Wysocka, S. Robertson, H. Riemann, J. Caamano, C. Hunter, A. Mackiewicz, L. J. Montaner, G. Trinchieri, and C. L. Karp
IL-12 Suppression During Experimental Endotoxin Tolerance: Dendritic Cell Loss and Macrophage Hyporesponsiveness
J. Immunol., June 15, 2001; 166(12): 7504 - 7513.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
O. Equils, E. Faure, L. Thomas, Y. Bulut, S. Trushin, and M. Arditi
Bacterial Lipopolysaccharide Activates HIV Long Terminal Repeat Through Toll-Like Receptor 4
J. Immunol., February 15, 2001; 166(4): 2342 - 2347.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Y.-Z. Wu, J.-H. Hong, H.-H. Huang, G. J. Dougherty, W. H. McBride, and C.-S. Chiang
Mechanisms mediating the effects of IL-3 gene expression on tumor growth
J. Leukoc. Biol., December 1, 2000; 68(6): 890 - 896.
[Abstract] [Full Text]


Home page
J. Leukoc. Biol.Home page
M. Fujihara, S. Wakamoto, T. Ito, M. Muroi, T. Suzuki, H. Ikeda, and K. Ikebuchi
Lipopolysaccharide-triggered desensitization of TNF-{alpha} mRNA expression involves lack of phosphorylation of I{kappa}B{alpha} in a murine macrophage-like cell line, P388D1
J. Leukoc. Biol., August 1, 2000; 68(2): 267 - 276.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
A. E. Medvedev, K. M. Kopydlowski, and S. N. Vogel
Inhibition of Lipopolysaccharide-Induced Signal Transduction in Endotoxin-Tolerized Mouse Macrophages: Dysregulation of Cytokine, Chemokine, and Toll-Like Receptor 2 and 4 Gene Expression
J. Immunol., June 1, 2000; 164(11): 5564 - 5574.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. K. Hsu, R.-Y. Yang, Z. Pan, L. Yu, D. R. Salomon, W.-P. Fung-Leung, and F.-T. Liu
Targeted Disruption of the Galectin-3 Gene Results in Attenuated Peritoneal Inflammatory Responses
Am. J. Pathol., March 1, 2000; 156(3): 1073 - 1083.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
N. Hirohashi, M.-G. Lei, and D. C. Morrison
LPS pretreatment of mouse peritoneal macrophages differentially modulates TNF{alpha} and iNOS expression
Innate Immunity, October 1, 1999; 5(5-6): 251 - 260.
[Abstract] [PDF]


Home page
Innate ImmunityHome page
N. Rayhane, C. Fitting, and J.-M. Cavaillon
Dissociation of IFN-{gamma} from IL-12 and IL-18 production during endotoxin tolerance
Innate Immunity, October 1, 1999; 5(5-6): 319 - 324.
[Abstract] [PDF]


Home page
Innate ImmunityHome page
K. Guyton, R. Bond, C. Romeo, R. Southern, J. Cochran, G. Teti, and J. A. Cook
Endotoxin-induced cross-tolerance to Gram-positive sepsis
Innate Immunity, June 1, 1999; 5(3): 119 - 126.
[Abstract] [PDF]


Home page
Infect. Immun.Home page
H. Shimauchi, T. Ogawa, K. Okuda, Y. Kusumoto, and H. Okada
Autoregulatory Effect of Interleukin-10 on Proinflammatory Cytokine Production by Porphyromonas gingivalis Lipopolysaccharide-Tolerant Human Monocytes
Infect. Immun., May 1, 1999; 67(5): 2153 - 2159.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. R. Allen, J. McHale, J. Smith, H. T. Cook, A. Karkar, D. O. Haskard, R. R. Lobb, and C. D. Pusey
Endothelial Expression of VCAM-1 in Experimental Crescentic Nephritis and Effect of Antibodies to Very Late Antigen-4 or VCAM-1 on Glomerular Injury
J. Immunol., May 1, 1999; 162(9): 5519 - 5527.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. M. Tebo, H. S. Kim, J. Gao, D. A. Armstrong, and T. A. Hamilton
Interleukin-10 Suppresses IP-10 Gene Transcription by Inhibiting the Production of Class I Interferon
Blood, December 15, 1998; 92(12): 4742 - 4749.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shnyra, A.
Right arrow Articles by Morrison, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shnyra, A.
Right arrow Articles by Morrison, D. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS