| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Microbiology, Molecular Genetics, and Immunology, University of Kansas Medical Center, Kansas City, KS 66160
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and nitric
oxide (NO) responses in mouse peritoneal macrophages. Reciprocal
regulation of TNF- and NO production by LPS-primed and
LPS-stimulated macrophages was found to be dependent on the presence of
soluble secretory products released by the cells during the initial LPS
priming interaction. Pretreatment of naïve macrophages with
different mouse recombinant cytokines such as rIL-10, rIL-12, and
rIFN-
dose dependently and differentially regulated subsequent
LPS-induced production of TNF-, IL-6, and NO by cytokine-primed
cells. Analysis of IL-12 and IL-10 levels present in culture
supernatants of LPS-primed and LPS-stimulated macrophages revealed a
high degree of correlation between the profiles of TNF- and IL-12 as
well as NO and IL-10. Furthermore, LPS priming of macrophages in the
presence of anti-IL-12-neutralizing mAb attenuated TNF-
responses while at the same time up-regulated NO production. In
contrast, neutralization of endogenous IL-10 with anti-IL-10 mAb
resulted in considerable TNF- response at LPS priming doses under
conditions that would otherwise strongly inhibit TNF- production. We
also found that the initial LPS priming of naïve macrophages
differentially and dose dependently regulates expression of mRNAs for
IL-10, IL-12, and IFN- in LPS-primed macrophages. Collectively, our
data provide experimental support for the hypothesis that a cytokine
regulatory network, most probably autocrine, tightly controls the
reciprocal modulation of TNF- and NO responses in LPS-primed
macrophages. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-1, IL-6, IL-12, and antiinflammatory cytokines, e.g.,
IL-10. It is of importance that these cytokines can be both produced
and utilized by macrophages in processes known as autocrine regulatory
pathways. A unique property of endotoxin is that it can modulate in mammals a transient state of either hypersensitivity to itself, seen in animals with bacterial infections (3), or low responsiveness induced by a single or repeated injections of low LPS amounts in human volunteers and experimental animals (reviewed in 4 . The later phenomenon, referred as endotoxin tolerance, and its molecular mechanism(s) has been the subject of extensive studies, in large part due to its potential application for correction and/or prevention of the pathophysiologic sequelae associated with endotoxemia and Gram-negative sepsis. Unlike the early interpretation of endotoxin tolerance as a protection from the lethal effects of bacterial pyrogens (5), the current concept of this phenomenon implies that LPS unresponsiveness is controlled at the cellular level, and that the activity of macrophages may well be instrumental in the development of LPS tolerance (6, 7, 8). Control of macrophage LPS responsiveness may be of primary importance for the host and may function to limit the extent of the proinflammatory response to protect the host from excessive destructive processes during inflammation and infection. However, it is becoming increasingly apparent that the acquisition of an endotoxin refractory state is not derived from complete unresponsiveness of exhausted macrophages exposed to chronic LPS stimulus. Rather, this process is mediated by a highly orchestrated compensatory mechanism(s) controlling the balance of pro- and antiinflammatory cytokines in the host (9, 10). In this respect, it is attractive to hypothesize that some microbial pathogens, and probably malignant cells, may utilize a similar strategy to create an imbalance in the coordinated proinflammatory response of the immune system in an effort to circumvent host immunity.
Although the phenomenon of modulation of LPS responsiveness was
initially described in in vivo experiments, recent studies have
demonstrated that in vitro pretreatment of naïve macrophages
with LPS also results in modulation of a refractory state in
macrophages to subsequent activation with LPS (11, 12, 13). Furthermore, we
have recently demonstrated that in vitro pretreatment of macrophages
with LPS may result in a more complex process than a simple abrogation
of proinflammatory responses in the cells. In those studies, it was
shown that pretreatment of elicited mouse peritoneal macrophages with
different threshold LPS doses induces a complex of intracellular
reprogramming events resulting in a differential dose-dependent
secretory activity of macrophages upon restimulation with a secondary
effective LPS dose (14, 15, 16). This reprogramming is characterized
phenotypically by a biphasic enhancement/suppression of TNF-
responsiveness compared with a reciprocal suppression/enhancement of
nitric oxide (NO)4
secretion. Although we have suggested that reprogramming of macrophages
may represent a fundamental regulatory mechanism for governing the host
responses to LPS and, perhaps, controlling immunity to infection in
general, the exact biochemical and molecular mechanism(s) underlying
LPS-induced priming events in macrophages has not been well
defined.
The present study was undertaken to test experimentally our hypothesis that LPS-dependent priming of macrophages is mediated by a cytokine autocrine/paracrine regulatory network and, specifically, is dictated by a profile of pro- and antiinflammatory cytokines produced by the cells during the reprogramming stage.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C3Heb/FeJ mice of both sexes were purchased from The Jackson Laboratory (Bar Harbor, ME). Animals were maintained in the American Association for Accreditation of Laboratory Animal Care-certified Kansas University Medical Center animal facility under 12-h light/dark cycles with food and water provided ad libitum. Eight- to twelve-week-old mice were used for isolation of peritoneal macrophages.
Reagents
Phenol-extracted LPS from Escherichia coli O111:B4
was purchased from List Biologic Laboratories (Campbell, CA). Mouse
rIL-10 (sp. act. 5 x 105 U/mg) and mouse rIL-4 (sp.
act. 107 U/mg) were obtained from PharMingen (San Diego,
CA). Recombinant mouse IL-12 (sp. act. 5 x 105 U/mg)
was purchased from Genzyme (Cambridge, MA). Recombinant mouse IFN-
(sp. act. 1 x 106 U/mg) was a gift from Dr. S.
W. Russell (University of Kansas Medical Center, Kansas City, KS). The
endotoxin level in all recombinant cytokines used was less than 0.1 ng
per µg of cytokine according to an analysis performed by the producer
of the cytokines. Neutralizing rat anti-mouse IFN- mAb (IgG1;
clone XMG1.2) was obtained from PharMingen, neutralizing rat
anti-mouse IL-12 mAb (IgG2a; clone C17.8) was from Genzyme, and
neutralizing rat anti-mouse IL-10 mAb (IgG1; clone JES5-2A5) was
purchased from Biosource International (Camarillo, CA). According to
the manufacturer’s analysis, endotoxin contamination of all mAbs
utilized was less than 0.01 ng/µg of protein. Endotoxin-tested RPMI
1640 culture medium and heat-inactivated FBS (endotoxin content, less
than 0.6 endotoxin U/ml) was purchased from Sigma (St. Louis,
MO).
Isolation and culture of peritoneal macrophages
Macrophages were obtained from C3Heb/FeJ mice i.p. injected with 1.5 ml of 4% thioglycollate broth (Difco Laboratories, Detroit, MI) 4 days before cell isolation. Macrophages were harvested by peritoneal lavage with sterile HBSS and washed twice with the same solution by centrifugation at 800 x g for 10 min. Isolated cells were resuspended in serum-free RPMI 1640 culture medium supplemented with 100 U/ml of penicillin and 100 µg/ml of streptomycin, counted, and dispensed into either 24-well tissue culture plates (Costar, Cambridge, MA) or 6-well plates (Costar) at an approximate density of 1 x 106 and 5 x 106 cells per well, respectively. Cells were incubated in 5% CO2 humidified atmosphere of a CO2 incubator for 20 to 30 min at 37°C before nonadherent cells (primarily lymphocytes) were removed by washing with HBSS. An initial culturing of macrophages in the absence of FBS facilitated a selective attachment and spreading of peritoneal macrophages, while preventing lymphocytes and other cells from being attached to the culture surface. After monolayer cultures of macrophages were obtained, the cells were cultured and treated as described in the text in the presence of RPMI 1640 supplemented with 10% FBS unless otherwise indicated.
RNA isolation, cDNA synthesis, and semiquantitative analysis of cytokine mRNA levels by reverse transcriptase (RT)-PCR
Peritoneal macrophages cultured in six-well plates were primed
for 6 h at 37°C with O111:B4 LPS in a range of concentrations of
0.1 to 10 ng/ml. Total RNA was extracted from the cells by TRIzol
Reagent (Life Technologies, Grand Island, NY) following the
manufacturer’s procedure. Equal amounts of total RNA (0.8–1.0 µg)
corresponding to each priming dose were reverse transcribed using
oligo(dT)16 as a primer and a complete GeneAmp RNA PCR
Kit (Perkin-Elmer, Norwalk, CT). cDNA obtained after reverse
transcription was amplified using specific cytokine primers and
AmpliTaq DNA polymerase (Perkin-Elmer) following the protocols
provided. The primers used were mouse ß-actin (sense, residues
206–227, TGTGATGGTGGGAATGGGTCAG; antisense, residues 698–719,
TTTGATGTCACGCACGATTTCC), mouse IL-12 p40 (sense,
CAGAAGCTAACCATCTCCTGGTTTG; antisense,
TCCGGAGTAATTTGGTGCTTCACAC), mouse IL-10 (sense, residues 226–249,
GTGAAGACTTTCTTTCAAACAAAG; antisense, residues 476–499,
CTGCTCCACTGCCTTGCTCTTATT), mouse IFN-ß (sense, residues 16–36,
CTCCAGCTCCAAGAAAGGACG; antisense, residues 457–477,
GAAGTTTCTGGTAAGTCTTCG), and mouse IFN- (sense, residues 130–153,
TACTGCCACGGCACAGTCATTGAA; antisense, residues 511–534,
GCAGCGACTCCTTTTCCGCTTCCT). PCR amplification was performed using 30
cycles of 2 min of denaturation at 94°C, 2 min of annealing at
60°C, and 7 min of extension at 72°C. Samples were subjected to
electrophoresis on 1% agarose gels, stained with ethidium bromide, and
photographed.
Cytokine analysis
Cytokine production by macrophages was analyzed in culture
supernatants after a 24-h cell stimulation with LPS. TNF-
bioactivity in cell culture supernatants was measured by a cytotoxicity
assay on L929 cells essentially as described previously (16). A
specific ELISA was used for determination of IL-12, IL-6, and IL-10. A
mouse IL-10 ELISA Kit obtained from Genzyme was used for detection of
IL-10 (sensitivity of ELISA: 15 pg/ml). IL-6 was measured by ELISA
using a specific pair of anti-mouse IL-6 mAbs and recombinant mouse
IL-6 purchased from PharMingen (sensitivity of assay: 50 pg/ml).
Recombinant IL-12 and anti-mouse IL-12 mAbs were provided by
Genzyme and used for the determination of IL-12. Briefly, 96-well
plates (Immulon 1; Dynatech Laboratories, Chantilly, VA) were coated
overnight at 4°C with either 100 µl/well of capture anti-IL-6
or anti-IL-12 mAb at 1 µg/ml in 50 mM borate buffer, pH 8.5.
Nonspecific binding was blocked with PBS supplemented with 0.1%
Tween-20 and 10% FBS at 37°C for 1 h. Appropriately diluted
samples were added in triplicates together with a serial twofold
dilution of corresponding recombinant cytokine for the creation of a
standard curve. After incubation at 37°C for 2 h, plates were
washed with PBS/Tween-20 buffer, and 100 µl of corresponding
biotinylated mAbs at a concentration of 1 µg/ml were added to each
well and incubated for an additional hour at 37°C. After extensive
washing with PBS/Tween-20, horseradish peroxidase-conjugated avidin
(Pierce, Rockford, IL) was added to each well and incubated for 30 min
at 37°C. Finally, 3,3',5,5' Tetramethylbenzidine substrate solution
(Kirkegaard & Perry Laboratories, Gaithersburg, MD) was added and OD
was measured at 405 nm after 15 min of developing at room temperature.
Cytokine concentrations in test samples were calculated by comparison
with a corresponding standard curve. The sensitivity of IL-12 ELISA was
20 pg/ml.
NO assay
NO in 24-h conditioned culture supernatants was measured as amounts of nitrite, a stable product of NO decay, using Greiss reagent (17).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Previously, we have shown that priming of mouse
thioglycollate-elicited peritoneal macrophages with threshold LPS
concentrations results in a dose-dependent differential regulation of
TNF-, IL-6, and NO production by the cells (14, 15, 16). Thus, when
freshly isolated and otherwise naïve macrophages were primed
with low LPS concentrations for 6 h and then restimulated with 1
µg/ml of LPS for 24 h, a reciprocal regulation of TNF- and NO
responses in the cells was observed (Fig. 1
A). As a next step to
understanding the molecular mechanism of this phenomenon, we have
assessed the stability of modulated TNF- and NO responses in
macrophages. These experiments were conducted to test the hypothesis
that the commitment of macrophages to either the TNF- or NO
phenotype is entirely dependent on the reprogramming stage so that the
relative balance of TNF-/NO is maintained constant upon subsequent
stimulation with various effective concentrations. In these
experiments, three separate sets of peritoneal macrophages were primed
with either 100 pg/ml, 500 pg/ml, or 5 ng/ml of LPS for modulation of
either a TNF-- or NO-dominant type of response, respectively. Primed
macrophages were then washed and restimulated with various effective
concentrations of LPS in the range of concentrations of 20 to 2000
ng/ml. TNF- and NO levels in the cell culture supernatants were
determined after a 24-h stimulation with LPS and, thus, a pair of
TNF- and NO values corresponding to each effective LPS dose was
obtained. Figure 1B shows experimental curves reflecting a
relative balance of TNF- and NO produced by LPS-stimulated
macrophages that were primed with the three different LPS doses. The
data shown in Figure 1B strongly suggest that, regardless of
the secondary LPS dose used for stimulation of the cells, macrophages
primed with the same LPS pretreatment concentration express a similar
response in the sense that the relative balance of TNF- and NO
produced by the cells is maintained at the same level.
|
In an attempt to identify the role of soluble factors/mediators in
supernatants of LPS-primed macrophages that might be responsible for
modulation of macrophage phenotypes, two identical sets of
naïve peritoneal macrophages were obtained. One set of
macrophages was maintained in standard culture conditions of RPMI 1640
supplemented with 10% FBS, while another set of the cells was primed
with various LPS amounts for 6 h. Cell culture supernatants at
each LPS priming dose were individually collected and filtered to
remove cells and debris particles. The LPS concentrations in the
samples were then adjusted by adding stock LPS to generate culture
supernatants containing 1 µg/ml of LPS. Then, the supernatants were
transferred to unprimed naïve macrophages for a direct LPS
stimulation in the presence of secretory products produced by
LPS-primed cells. The data presented in Figure 2 would support the concept that
LPS-dependent TNF- and NO responses in unprimed macrophages may be
modulated by soluble factors present in supernatants from LPS-primed
cells.
|
To further ascertain the potential role of a cytokine regulatory
network in driving polarization of macrophage phenotypes, naïve
macrophages were primed with various concentrations of different
recombinant cytokines for 6 h before challenge with LPS. The
effects of this cytokine pretreatment on subsequent TNF-, IL-6, and
NO production by LPS-stimulated cells were then analyzed. In the
experiments presented in Figure 3, we
tested the effects of mouse rIFN- in the range of concentrations of
0.1 to 10 U/ml on the modulation of LPS-dependent activation of
naïve macrophages. Pretreatment with IFN- strongly
up-regulated TNF- (Fig. 3A) in a dose-dependent
fashion and NO (Fig. 3B) production by LPS-stimulated
macrophages. Interesting, the effect of IFN- pretreatment on
LPS-dependent IL-6 release was insignificant. A neutralizing
anti-IFN- mAb at a concentration of 1 µg/ml partially
inhibited the effects of IFN- pretreatment (Fig. 3A), whereas the control isotype-matched IgG had
little effect (data not shown). Although anti-IFN- mAbs and
other neutralizing anti-cytokine mAbs (see below) taken at
concentrations of 1 µg/ml only partially inhibited cytokine priming
effects, the use of this concentration was dictated by the findings
that higher Ab doses resulted in highly unacceptable background, e.g.,
detectable cytokine and NO levels in supernatants of cells exposed to
the cytokine/Ab mixture without LPS stimulation (data not shown).
Interesting, the presence of anti-cytokine Abs during stimulation
of the primed macrophages with LPS did not substantially affect
modulation of phenotypic responses, suggesting the pivotal role of
cytokine regulatory mechanism(s) operating during the priming
stage.
|
(Fig. 4A) and IL-6 (Fig. 4B) responses in the cells. However, IL-12
pretreatment was ineffective in modulation of the NO response (Fig. 4B). The specificity of IL-12 priming effects on
macrophages was confirmed by inhibition of its effects with
neutralizing anti-IL-12 mAb (Fig. 4A).
|
and IL-6 production in cytokine-primed cells and slightly up-regulated
NO release upon restimulation of macrophages with LPS (Fig. 5). In addition, rIL-10, added in
combinations with IL-12 or IFN- taken at their optimal priming
doses, was still capable of inhibiting in a dose-dependent manner the
priming effects of these cytokines on TNF- and NO production by
macrophages (data not shown).
|
Due to the common permissive/inhibitory relationship of cytokines
in the control of cellular production of each other, we next evaluated
the levels of IL-10, IL-12, and IFN- in 24-h supernatants of
LPS-primed and LPS-stimulated macrophages to assess the potential role
of these cytokines in modulation of TNF- and NO responses in
LPS-primed macrophages. Although a sensitive ELISA was performed to
measure the amounts of IFN- (detection limit 25 pg/ml) in culture
supernatants, no detectable levels of IFN- were found in the test
samples (data not shown). In contrast, priming with LPS differentially
and dose dependently regulated production of IL-10 and IL-12, which
were reciprocally regulated in LPS-primed macrophages (Fig. 6). In addition, data shown in Figure 6
indicate that the peak of IL-12 production approximately coincides with
the peak of TNF- production by LPS-primed macrophages, whereas the
profile of IL-10 release parallels the one for NO response (Fig. 1
A).
|
To further characterize the cytokine regulatory pathway(s)
involved in LPS-dependent priming of macrophages, we tested the
capacity of neutralizing anti-IL-10, anti-IL-12, and
anti-IFN- mAbs to influence the LPS-induced priming process. In
this set of experiments, macrophages were primed with LPS in the
presence of 20 µg/ml of each neutralizing mAb added alone. Then,
after extensive washing, cells were restimulated with an effective LPS
dose and the amounts of TNF- and NO were determined in culture
supernatants 24 h later. The data presented in Figure 7A show that neutralization of
IL-12 and IFN- during the LPS priming stage attenuated TNF-
production by LPS-stimulated macrophages. In contrast, neutralization
of IL-10 resulted in TNF- release at LPS priming concentrations that
otherwise strongly inhibited TNF- production by the cells. When the
effects of neutralizing mAbs on NO response of LPS-primed macrophages
were analyzed, we found that anti-IFN- and anti-IL-10 mAb
inhibited NO production by LPS-primed macrophages, whereas
neutralization of IL-12 boosted LPS-dependent NO responses in the cells
(Fig. 7B). These data would indicate the potential
role of IL-10, IL-12, and IFN- in modulation of both TNF- and NO
phenotypes in LPS-primed macrophages.
|
That macrophages were exposed to the tested
anti-cytokine-neutralizing mAbs only during the LPS priming stage
would suggest that polarization of the development of macrophage
phenotypes may occur during the priming stage and be mediated by an
LPS-activated cytokine network. To test this experimental hypothesis,
we analyzed cytokine levels in culture supernatants of macrophages that
were only primed with threshold LPS concentrations for 6 h.
However, we were unable to detect ELISA-measurable amounts of IL-10,
IL-12, TNF-, and IFN- in collected supernatants. We therefore
analyzed the differential expression of cytokine mRNA using RT-PCR. In
these experiments, naïve macrophages were primed with various
concentrations of LPS for 6 h before total cellular RNA was
isolated, reverse transcribed, and specifically amplified using primers
for different mouse cytokines. Data presented in Figure 8 show a differential dose-dependent
regulation of cytokine mRNA expression in LPS-primed macrophages.
Expression of IL-12 mRNA was found to be up-regulated at LPS priming
concentrations that overlapped with the LPS priming doses we previously
established to modulate an increased TNF- production in macrophages
(TNF- phenotype). In contrast, IL-10 mRNA, IFN-ß mRNA, and IFN-
mRNA were detectable only at high LPS priming doses of 1 to 10 ng/ml
and overlapped with LPS priming concentrations previously established
to preferentially induce the NO phenotype in macrophages.
Interestingly, analysis of expression of the TNF- message revealed
comparable levels of TNF- mRNA in macrophages primed with different
LPS reprogramming doses in the range of 0.1 to 10 ng/ml, suggesting a
posttranscriptional mechanism governing TNF- production by the
cells.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and NO phenotypes in macrophages may well depend on autocrine/paracrine
signals mediated via the release of specific soluble factors/mediators
by the cells during the LPS priming stage. To confirm the potential
role of cytokines in the modulation of LPS priming effects, we
evaluated LPS-dependent TNF- and NO responses in cytokine-primed
macrophages pretreated with different recombinant cytokines before
stimulation with LPS. Our data strongly suggest that an exposure of
naïve macrophages to individual cytokines such as IFN-,
IL-12, and IL-10 or a combination of these cytokines may differentially
modulate cell responsiveness to LPS. Therefore, among other regulatory
pathways, a cytokine network may well represent a potential
mechanism(s) controlling the bias of specific macrophage phenotypes
induced by LPS priming. Analysis of cell-derived IL-10 and IL-12
concentrations in culture supernatants of LPS-primed and LPS-stimulated
macrophages revealed a significant correlation between the levels of
IL-12 and TNF- as well as between the levels of IL-10 and NO. This
finding establishes a necessity between modulation of proinflammatory
TNF- phenotype of response and up-regulated production of IL-12 in
LPS-primed macrophages, whereas modulation of the NO phenotype may well
be associated with up-regulated production of IL-10 and its
antiinflammatory effects. Furthermore, neutralization of endogenously
produced IL-10 and IL-12 with anti-IL-10 and anti-IL-12 mAbs
significantly affected LPS-dependent responses in LPS-primed cells,
further suggesting the pivotal role of IL-12 and IL-10 in the
modulation of TNF- and NO phenotypes in macrophages. In addition, we
found differential and dose-dependent regulation of mRNA expression for
IL-12 and IL-10 in LPS-primed cells. Therefore, it is reasonable to
conclude that endogenously produced IL-12 may promote and control a
proinflammatory TNF- phenotype in LPS-primed macrophages by
up-regulating TNF- production and inhibiting NO release. In
contrast, cell-derived IL-10 may well control modulation of an NO
phenotype associated with antiinflammatory cell responses by
up-regulating NO release and limiting TNF- production in LPS-primed
macrophages. In addition, up-regulated expression of IFN-ß and
IFN- mRNAs in LPS-primed macrophages and recently reported
synergistic effects of these cytokines on LPS-dependent activation of
inducible NO synthase suggest the potential role of IFNs in the
modulation of the NO phenotype in LPS-primed macrophages.
Although IL-10 inhibits in vitro activation and NO production by
macrophages, our results suggest a potential regulatory role of IL-10
in the modulation of the NO phenotype in LPS-primed macrophages. It has
yet to be established whether IL-10 directly modulates the NO phenotype
in LPS-primed macrophages or whether this correlation is circumstantial
and other factors/cytokines play a key role in the complex regulatory
process controlling macrophage reprogramming. Additional experiments on
macrophages isolated from IL-10, IL-12, and IFN- knockout mice will
allow the dissection of the specific role of each of these cytokines in
the modulation of different phenotypes in LPS-primed macrophages.
However, experimental data available support our hypothesis that the
commitment of macrophages to either the TNF- or NO phenotype of the
LPS-dependent response occurs during the priming stage and is mediated
by a cytokine regulatory pathway(s) derived through a reciprocal
induction of IL-12 and IL-10.
Due to the crucial role of IL-10 and IL-12 in the polarization of T
cell responses, a reciprocal control of IL-12 and IL-10 production in
LPS-primed macrophages such as APCs may well be instrumental for
developing host immune responses in general. The adaptive response to
infections is characterized by the differentiation of Th cells into
either the Th1 or Th2 phenotype, which then favors cell-mediated
immunity and humoral responses, respectively (18, 19, 20, 21). Th1 development
is positively regulated by two major cytokines, IL-12 and IFN-, and,
in general, results in localization and cure of the infection (22, 23, 24, 25, 26).
In contrast, IL-10, an antiinflammatory cytokine produced by activated
macrophages/monocytes, synergizes with IL-4 in the induction of
Th2-type lymphocyte development and is found to be associated with
chronic, progressive infections (27, 28).
Macrophages can produce cytokines that are vital for T cell
development, such as IL-10 and IL-12, as well as some amounts of
IFN-, as suggested in earlier studies (29). Evidently, if a
reciprocal production of IL-12 and IL-10 in macrophages is achieved, it
would be expected to provide a cytokine microenvironment facilitating
development of either the Th1 or Th2 subset, respectively. We therefore
hypothesize that the plasticity of APC-derived cytokine production as
shown in the data presented here for macrophages, and controlled by
dose-dependent LPS priming of the cells, may dictate the outcome of
APC-T cell interactions. We speculate that, depending on the dominant
type of cytokine response, e.g., IL-12 or IL-10, acquired by
macrophages after priming with LPS, primed macrophages functioning as
APC would provide an accessory signal for the development of either the
Th1 or Th2 subset, respectively. Specifically, up-regulated production
of IL-12 can directly (30, 31, 32) or, most likely, via synergism with
TNF--dependent induction of IFN- (33, 34), control the
development of Th1 type. In contrast, macrophage phenotype
characterized by overproduction of IL-10 may well favor proliferation
of the Th2 type of T cells through a synergistic action with IL-4 (27, 28) and antagonistic effects on Th1-type cytokine production (35, 36).
Furthermore, the differential IL-10 and IL-12 production in LPS-primed
macrophages such as APCs is primarily dependent on the load of Ag/LPS,
since LPS priming in macrophages is a dose-dependent process. Priming
of macrophages is induced by threshold LPS concentrations and,
therefore, may take place during the initial stage of disease at the
"gate of infection." Importantly, newly recruited phagocytes/APCs
could be "educated" by already primed macrophages through the
specific cytokine milieu produced by the earlier arrived APCs. Further
investigation of the mechanism(s) controlling reciprocal production of
IL-10 and IL-12 in LPS-primed macrophages and its potential role in
modulation of differentiation of T cell precursors into functionally
distinct Th1 and Th2 subsets of T lymphocytes is under progress in our
laboratory.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Dr. Arlene Alipio, United Laboratories, Inc., PO Box 3594, Manila, Philippines.
3 Address correspondence and reprint requests to Dr. Alexander Shnyra, The University of Kansas Medical Center, Department of Microbiology, Molecular Genetics and Immunology, Kansas City, KS 66160.
4 Abbreviations used in this paper: NO, nitric oxide; RT, reverse transcriptase.
Received for publication July 17, 1997. Accepted for publication December 16, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and nitric oxide production. J. Exp. Med. 177:511.-producing T cells studied by lineage ablation of IL-4 producing cells. Cell 75:985.[Medline]
, and IL-12 regulate the development of subsets of memory effector helper T cells in vitro. J. Immunol. 155:1713.[Abstract]
ß-TCR transgenic CD4+ T cells occurs through macrophage production of IL-12. Science 260:547. in stabilizing the T helper cell type 1 and 2 phenotype. J. Immunol. 158:2648.[Abstract]
in macrophages by lipopolysaccharide. Int. Immunol. 5:1383. production and diminishes interleukin-4 inhibition of such priming. Proc. Natl. Acad. Sci. USA 90:10188. production and lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672.[Medline]
This article has been cited by other articles:
|
|
 |
|
  Q. Espinassous, E. Garcia-de-Paco, I. Garcia-Verdugo, M. Synguelakis, S. von Aulock, J.-M. Sallenave, A. N. J. McKenzie, and J. Kanellopoulos IL-33 Enhances Lipopolysaccharide-Induced Inflammatory Cytokine Production from Mouse Macrophages by Regulating Lipopolysaccharide Receptor Complex J. Immunol., July 15, 2009; 183(2): 1446 - 1455. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Chan, E. R. Bivins-Smith, M. S. Smith, P. M. Smith, and A. D. Yurochko Transcriptome Analysis Reveals Human Cytomegalovirus Reprograms Monocyte Differentiation toward an M1 Macrophage J. Immunol., July 1, 2008; 181(1): 698 - 711. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Chen, M. J. Cowan, J. D. Hasday, S. N. Vogel, and A. E. Medvedev Tobacco Smoking Inhibits Expression of Proinflammatory Cytokines and Activation of IL-1R-Associated Kinase, p38, and NF-{kappa}B in Alveolar Macrophages Stimulated with TLR2 and TLR4 Agonists J. Immunol., November 1, 2007; 179(9): 6097 - 6106. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Medvedev, I. Sabroe, J. D. Hasday, and S. N. Vogel Invited review: Tolerance to microbial TLR ligands: molecular mechanisms and relevance to disease Innate Immunity, June 1, 2006; 12(3): 133 - 150. [Abstract] [PDF]
|
|
|
|
 |
|
 M. Muthukuru, R. Jotwani, and C. W. Cutler Oral Mucosal Endotoxin Tolerance Induction in Chronic Periodontitis Infect. Immun., February 1, 2005; 73(2): 687 - 694. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. L. Rosenzweig, N. S. Lessov, D. C. Henshall, M. Minami, R. P. Simon, and M. P. Stenzel-Poore Endotoxin Preconditioning Prevents Cellular Inflammatory Response During Ischemic Neuroprotection in Mice Stroke, November 1, 2004; 35(11): 2576 - 2581. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Yeo, J.-G. Yoon, S.-C. Hong, and A.-K. Yi CpG DNA Induces Self and Cross-Hyporesponsiveness of RAW264.7 Cells in Response to CpG DNA and Lipopolysaccharide: Alterations in IL-1 Receptor-Associated Kinase Expression J. Immunol., January 15, 2003; 170(2): 1052 - 1061. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Dobrovolskaia, A. E. Medvedev, K. E. Thomas, N. Cuesta, V. Toshchakov, T. Ren, M. J. Cody, S. M. Michalek, N. R. Rice, and S. N. Vogel Induction of In Vitro Reprogramming by Toll-Like Receptor (TLR)2 and TLR4 Agonists in Murine Macrophages: Effects of TLR "Homotolerance" Versus "Heterotolerance" on NF-{kappa}B Signaling Pathway Components J. Immunol., January 1, 2003; 170(1): 508 - 519. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Broderick, R. M. Hoek, J. V. Forrester, J. Liversidge, J. D. Sedgwick, and A. D. Dick Constitutive Retinal CD200 Expression Regulates Resident Microglia and Activation State of Inflammatory Cells during Experimental Autoimmune Uveoretinitis Am. J. Pathol., November 1, 2002; 161(5): 1669 - 1677. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Robertson, L. P. Erwig, J. Liversidge, J. V. Forrester, A. J. Rees, and A. D. Dick Retinal Microenvironment Controls Resident and Infiltrating Macrophage Function during Uveoretinitis Invest. Ophthalmol. Vis. Sci., July 1, 2002; 43(7): 2250 - 2257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Willuweit, G. Sass, A. Schoneberg, U. Eisel, G. Tiegs, and M. Clauss Chronic Inflammation and Protection from Acute Hepatitis in Transgenic Mice Expressing TNF in Endothelial Cells J. Immunol., October 1, 2001; 167(7): 3944 - 3952. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Medvedev, P. Henneke, A. Schromm, E. Lien, R. Ingalls, M. J. Fenton, D. T. Golenbock, and S. N. Vogel Induction of Tolerance to Lipopolysaccharide and Mycobacterial Components in Chinese Hamster Ovary/CD14 Cells Is Not Affected by Overexpression of Toll-Like Receptors 2 or 4 J. Immunol., August 15, 2001; 167(4): 2257 - 2267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Brewington, M. Chatterji, M. Zoubine, R. N. Miranda, M. Norimatsu, and A. Shnyra IFN-{{gamma}}-Independent Autocrine Cytokine Regulatory Mechanism in Reprogramming of Macrophage Responses to Bacterial Lipopolysaccharide J. Immunol., July 1, 2001; 167(1): 392 - 398. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wysocka, S. Robertson, H. Riemann, J. Caamano, C. Hunter, A. Mackiewicz, L. J. Montaner, G. Trinchieri, and C. L. Karp IL-12 Suppression During Experimental Endotoxin Tolerance: Dendritic Cell Loss and Macrophage Hyporesponsiveness J. Immunol., June 15, 2001; 166(12): 7504 - 7513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Equils, E. Faure, L. Thomas, Y. Bulut, S. Trushin, and M. Arditi Bacterial Lipopolysaccharide Activates HIV Long Terminal Repeat Through Toll-Like Receptor 4 J. Immunol., February 15, 2001; 166(4): 2342 - 2347. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-Z. Wu, J.-H. Hong, H.-H. Huang, G. J. Dougherty, W. H. McBride, and C.-S. Chiang Mechanisms mediating the effects of IL-3 gene expression on tumor growth J. Leukoc. Biol., December 1, 2000; 68(6): 890 - 896. [Abstract] [Full Text]
|
|
|
|
|
|
M. Fujihara, S. Wakamoto, T. Ito, M. Muroi, T. Suzuki, H. Ikeda, and K. Ikebuchi Lipopolysaccharide-triggered desensitization of TNF-{alpha} mRNA expression involves lack of phosphorylation of I{kappa}B{alpha} in a murine macrophage-like cell line, P388D1 J. Leukoc. Biol., August 1, 2000; 68(2): 267 - 276. [Abstract] [Full Text]
|
|
|
|
|
|
A. E. Medvedev, K. M. Kopydlowski, and S. N. Vogel Inhibition of Lipopolysaccharide-Induced Signal Transduction in Endotoxin-Tolerized Mouse Macrophages: Dysregulation of Cytokine, Chemokine, and Toll-Like Receptor 2 and 4 Gene Expression J. Immunol., June 1, 2000; 164(11): 5564 - 5574. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. K. Hsu, R.-Y. Yang, Z. Pan, L. Yu, D. R. Salomon, W.-P. Fung-Leung, and F.-T. Liu Targeted Disruption of the Galectin-3 Gene Results in Attenuated Peritoneal Inflammatory Responses Am. J. Pathol., March 1, 2000; 156(3): 1073 - 1083. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Hirohashi, M.-G. Lei, and D. C. Morrison LPS pretreatment of mouse peritoneal macrophages differentially modulates TNF{alpha} and iNOS expression Innate Immunity, October 1, 1999; 5(5-6): 251 - 260. [Abstract] [PDF]
|
|
|
|
|
|
N. Rayhane, C. Fitting, and J.-M. Cavaillon Dissociation of IFN-{gamma} from IL-12 and IL-18 production during endotoxin tolerance Innate Immunity, October 1, 1999; 5(5-6): 319 - 324. [Abstract] [PDF]
|
|
|
|
|
|
K. Guyton, R. Bond, C. Romeo, R. Southern, J. Cochran, G. Teti, and J. A. Cook Endotoxin-induced cross-tolerance to Gram-positive sepsis Innate Immunity, June 1, 1999; 5(3): 119 - 126. [Abstract] [PDF]
|
|
|
|
|
|
H. Shimauchi, T. Ogawa, K. Okuda, Y. Kusumoto, and H. Okada Autoregulatory Effect of Interleukin-10 on Proinflammatory Cytokine Production by Porphyromonas gingivalis Lipopolysaccharide-Tolerant Human Monocytes Infect. Immun., May 1, 1999; 67(5): 2153 - 2159. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Allen, J. McHale, J. Smith, H. T. Cook, A. Karkar, D. O. Haskard, R. R. Lobb, and C. D. Pusey Endothelial Expression of VCAM-1 in Experimental Crescentic Nephritis and Effect of Antibodies to Very Late Antigen-4 or VCAM-1 on Glomerular Injury J. Immunol., May 1, 1999; 162(9): 5519 - 5527. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Tebo, H. S. Kim, J. Gao, D. A. Armstrong, and T. A. Hamilton Interleukin-10 Suppresses IP-10 Gene Transcription by Inhibiting the Production of Class I Interferon Blood, December 15, 1998; 92(12): 4742 - 4749. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
