| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Division of Immunobiology, University of Bonn, Bonn, Germany
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß dimers (2, 11, 12). Peptide-free class II molecules
are stabilized by association with Ii, and aggregation is prevented
(13, 14, 15, 16). A segment encoded by exon 3 of the Ii gene is
indispensable for the formation of the MHC class II/Ii complex
(17, 18, 19). Fragments of processed Ii are called class II-associated Ii
peptides (CLIP), the sequences of which are encoded by exon 3. The
sequence of CLIP is contained in the class II binding site (CBS) of Ii.
CLIP were found associated with various MHC class II allotypes
(reviewed in 20 . The x-ray crystal structure of CLIP bound to
HLA-DR3 revealed that a number of residues in the sequence 91–99
(groove binding site) interact with specific pockets of the MHC class
II peptide-binding groove, whereas the N terminus of the Ii fragment is
disordered in the crystal (21). Studies on proteolytic fragments of Ii
suggest that the CBS also binds to the Ag-binding groove of class II
dimers and that CLIP is a naturally occurring degradation intermediate
(22, 23, 24, 25). The affinities of CLIP for different MHC allotypes can vary
over several orders of magnitude (26). This could indicate that the
affinity of CLIP regulates the binding of antigenic peptides. Release
of CLIP from MHC class II dimers for which it has a high affinity
requires the accessory molecule HLA-DM (27, 28, 29). Allotypes showing a
high off rate for CLIP apparently do not depend on the catalytic
function of DM for dissociation, although the acquisition of antigenic
peptides might be facilitated by DM (30, 31, 32). In these cases, the
acidic conditions in the MHC class II loading compartments might be
sufficient for dissociation. The strong binding of Ii to different
class II allo- and isotypes even across species barriers suggests a
highly conserved interaction between Ii and class II dimers (33). Thus,
it is conceivable that contacts adjacent to the polymorphic class II
groove are responsible for stabilizing the binding of Ii to MHC class
II molecules. Here, we demonstrate both allotype-dependent and promiscuous binding of rIi polypeptides mediated by different Ii sequences to MHC class II dimers. A membrane proximal region of Ii mediates binding to three DR allotypes, whereas the groove-binding segment of Ii replaced by an antigenic sequence leads to allotype-dependent association of class II dimers.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
DNAs for transferrin receptor (TFR), rIi, and DR chains were expressed under SV40 promoter control in the pcEXV3 or pSV51 expression vector (7, 34). For construction of TFR-CBS, bp 237–416 of the murine Ii31 cDNA, encoding Ii amino acids (aa) 80–139, was excised by AluI digestion. Maintaining the reading frame, this Ii fragment was inserted into the Eco47III restriction site at the 585-bp position of the human TFR cDNA.
For construction of the deletion mutant 
Ii80-93, bp 233 to 272 of
the human Ii33 cDNA (pSV51-huIi) was removed by digestion with
FspI, followed by religation. In Ii105-157, the segment
bp 309 to 465 was excised using NcoI. The cDNA/genomic DNA
fusion construct for Ii81-127 has been described previously (17).
QASLALSYRLNMFTP is a peptide derived from the major outer membrane
protein of Chlamydia trachomatis (MOMP). The aa 81–87
(PKSAKPV) of Ii were designated the promiscuous binding site (PBSite).
To obtain rIi MOMP, rIi spacer 1, rIi PBSite, and rIi spacer 2, the aa
shown in Figure 1
were introduced in
Ii81-127. For construction of rIi MOMP and rIi PBSite, the two
oligonucleotides
5'AGCTTCAAGCAAGTTTGGCTCTCTCTTACAGACTGAATATGTTCACTCCCA
and 5'AGCTTCCGAAATCTGCCAAACCTGTGCTGCAGA were hybridized with their
complementary strands, thereby generating HindIII overlaps,
and ligated into the HindIII restriction site of Ii81-127
(at position bp 4717 of the genomic sequence; Fig. 2). Due to the cloning procedure, there
is an additional C-terminal KL and LQKL that connects MOMP and Ii aa
81–87, respectively, to Ii aa 128. In the constructs rIi spacer 1 and
rIi spacer 2, the oligonucleotides coding for MOMP and for PBSite were
inserted in the inverse orientation, thereby encoding a nonrelated
sequence with the same number of aa. Oligonucleotides encoding aa
17–31 of the influenza virus matrix protein (MAT) sequence were
introduced into genomic Ii DNA. The small fragment between the
restriction sites HindIII (bp 4717 in exon 2) and
NcoI (bp 4945 in exon 3) was replaced by the
oligonucleotides
AGCTTTCGGGCCCGCTGAAGGCGGAGATCG/ACGCAGCGCCTCGAGGACGTGTC.
This resulted in replacement of aa 81–101 of Ii by MAT aa 17–31, with
alanine or threonine at residue 89 of rIiMAT.
|
|
COS1 (CRL-1650; American Type Culture Collection (ATCC), Rockville, MD) and COS7 (CRL-1651; ATCC) cells were cultivated in high glucose DMEM supplemented with 10% FCS, 100 µg/ml penicillin, 100 U/ml streptomycin, 1 mM sodium pyruvate, 10 mM HEPES, and 2 mM L-glutamine. Transient transfections were performed by DEAE-mediated DNA transfer (10 µg DNA/3 x 106 COS1 cells; 24 h), electroporation (210 V/1.2 mF, 25 µg DNA/6 x 106 COS1 cells; 72 h), and liposome-aided transfer (1 µg DNA/5 x 105 COS7 cells; 48 h) as described (35, 36, 37).
Metabolic radiolabeling of proteins and immunoprecipitation
After incubation of cells for 1 h at 37°C in
methionine-free RPMI 1640, newly synthesized proteins were labeled for
10 min with 50 µCi [35S]methionine (Amersham,
Braunschweig, Germany) in methionine-free RPMI (supplemented with 10%
dialysed FCS, 1 mM sodium pyruvate, 2 mM glutamine, and 10 mM HEPES).
The cells were lysed with 1% Nonidet P-40 in Tris-buffered saline in
the presence of protease inhibitors (1 µM PMSF and 0.024 trypsin
inhibitor units of aprotinin per ml). Lysates were precleared by a 2-h
incubation with Sepharose CL4B. To reduce background in some
experiments, the lysates were first adjusted to pH 5 by the addition of
acetic acid. Acid-precipitated proteins were spun down by
centrifugation. The supernatant was neutralized and further cleared by
addition of Sepharose CL4B. mAbs used for immunoprecipitation were PA1
(TFR, a gift from Dr. G. Moldenhauer, Heidelberg, Germany), P4H5
(-Ii peptide RPMSMDNMLLGPVKNVTK; 38 , VicY1 (-human Ii; 39 , In1 (-murine Ii; 40 , ISCR3, and I251SB (-HLA-DR
chains; Refs. 41 and 42) For immunoprecipitation, mAbs were added to
the cell lysates in the presence of 10 µl protein A-Sepharose CL4B.
After overnight incubation, precipitates were washed three times in
0.25% Nonidet P-40 in Tris-buffered saline (pH 6.8).
Gel electrophoresis
Immunoprecipitates were boiled in reducing sample buffer for 4 min and analyzed on 10 to 15% SDS polyacrylamide gradient gels or 13% SDS polyacrylamide gels (17). For two-dimensional nonequilibrated pH gradient electrophoresis (NEPHGE), protein A-Sepharose pellets were incubated for 1 h at room temperature in NEPHGE sample buffer (9.5 M urea, 2% Nonidet P-40, 2% ampholines (pH 3.5–10), and 50 mM DTT), and the proteins were separated according to their charge using 4% polyacrylamide rod gels (first dimension). The rod gels were then incubated for 2 h in reducing sample buffer. In the second dimension, the proteins were separated according to molecular mass in 13% SDS-polyacrylamide gels.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In an attempt to localize contact sites of Ii that stabilize the
interaction of the groove-binding segment to class II polypeptides, we
inserted a sequence of Ii that contains the previously identified CBS
to the luminal domain of another type II membrane protein, the TFR. The
segment of the Ii cDNA encoding aa 80–139 was ligated into the TFR
cDNA (Fig. 3A). This Ii
sequence contains the CBS (aa 81–109) and an adjacent stretch of 30 aa
that provides an epitope recognized by the mAb P4H5. This recombinant
TFR-CBS forms S-S-linked dimers, and its N-linked glycan
side chains acquire Endo H resistance upon intracellular transport (G.
Reuter and N. Koch, unpublished observations). To explore the binding
properties of the recombinant TFR to HLA-DR molecules, various
combinations of TFR-CBS, TFR, and Ii constructs were transiently
coexpressed with DR and -ß cDNAs in COS cells (Fig. 3B). Since some DR allotypes were reported to bind
TFR-derived sequences, we used the DR3 allele, because no TFR peptides
had been eluted from this allotype (43). Cells were radiolabeled,
lysed, and immunoprecipitated with mAbs specific for DR, TFR, or Ii.
The mAb against TFR immunoprecipitates TFR and TFR-CBS (Fig. 3B). The 60-aa Ii segment increases the size of
TFR-CBS compared with TFR. The Ii-specific mAb P4H5 does not bind to
TFR, but immunoisolates TFR-CBS. This demonstrates that the Ii segment
is positioned in a site accessible for the mAb P4H5. Immunoprecipitates
of DR molecules reveal that large amounts of TFR-CBS, similar to the
amounts of Ii in the first lane, are coisolated. Precipitation with Ii
or TFR Abs do not exhibit class II bands, because the TFR-CBS is in
large excess. This result is also obtained with wild-type Ii (data not
shown).
|
An N-terminal deletion of the class II binding sequence of Ii abrogates association with class II molecules
We studied whether the sequences flanking the groove-binding
segment (aa 91–99) influence Ii/class II association. With two
available restriction sites, sequences adjacent to the groove-binding
segment of Ii were deleted (Fig. 4A). In Ii80-93, the
truncated anchor positions Met91 and Met93, in addition to the deleted
aa 80–90, could impair binding to class II dimers. The deletion in
Ii105-157 starts exactly beyond the sequence of CLIP (aa 81–104).
Ii80-93 or Ii105-157 was coexpressed with DR cDNAs and
immunoprecipitated with anti-Ii or anti-DR mAbs. Since
Ii80-93 comigrates with the DR ß-chain in one-dimensional
SDS-PAGE, the immunoprecipitates were analyzed in two-dimensional
NEPHGE/SDS-PAGE (Fig. 4B). The anti-Ii
immunoprecipitates show that the recombinant Ii and wild-type Ii are
expressed at a high level. Class II is not detected because of the
excess of Ii. DR precipitates reveal that wild-type Ii is
coprecipitated (Fig. 4B, top), whereas Ii80–93 is
not detected in DR precipitates (Fig. 4B, middle).
This result was verified by endoglycosidase H digestion and
one-dimensional separation of the immunoprecipitates, in which
Ii80-93 and DRß have different m.w.s according to the differing
number of digested N-glycan side chains (data not shown). In contrast
to the recombinant Ii lacking aa 80–93, the mutant Ii105-157 is
coisolated with MHC class II molecules from cotransfectants (Fig. 4B, bottom).
|
The lack of association of Ii80-93 to DR molecules could
suggest that residues N-terminal to the groove-binding motif of Ii are
important for the association with MHC class II molecules. We
investigated whether in the absence of the groove-binding segment
reintroduction of N-terminal residues would restore binding to class
II. Fig. 2
shows a schematic representation of a recombinant Ii (rIi
PBSite) in which aa 81–87 were introduced into Ii81-127. These two
deletion constructs and DR cDNAs were coexpressed in COS cells. rIi
PBSites was coprecipitated with DR1; while consistent with our previous
results, Ii81-127 could not be coisolated (Fig. 5A, left) (17). Ii
immunoprecipitates show that the Ii derivatives were strongly expressed
(Fig. 5A, right). Ii precipitates usually do not show
class II bands. To examine the specificity of aa 81–87 binding, a
construct with an unrelated spacer sequence of the same length (rIi
spacer 2) was generated. Transient expression with DR1 and
immunoprecipitation with anti-DR Abs revealed that rIi spacer 2 did
not bind to class II dimers, which supports the specific binding of rIi
PBSite to DR molecules. This result indicates that aa 81–87 mediate
binding of an Ii mutant, which lacks the groove-binding segment, to
class II molecules.
|
, B and C). Again,
Ii81-127 did not coprecipitate with DR. This result demonstrates
promiscuous binding of rIi PBSite to three DR allotypes. Class II binding of a mutant Ii is mediated by an antigenic sequence
Ii thus appears to harbor a promiscuous allotype-independent site
in addition to an allotype-dependent class II binding site.
Allotype-dependent binding of CLIP has been demonstrated, but a basis
for the allotype-independent binding of Ii has not been defined. To
monitor DR allele-specific binding of Ii, we introduced antigenic
sequences into Ii81-127. At first, we studied whether association of
a rIi, with the groove-binding segment replaced by an antigenic
sequence, to DR dimers is possible. The sequence of MOMP,
QASLALSYRLNMFTP, binds to DR3 (44). Ii81-127 lacking the CBS was
used to introduce the sequence of MOMP (compare Figs. 1 and 2).
Coexpression of this chimeric Ii with DR3 molecules and subsequent
immunoisolation of DR molecules show coisolation of rIi MOMP (Fig. 6). As a control, rIi spacer 1, with an
unrelated sequence of the same length as MOMP, does not coprecipitate
with DR3. Immunoprecipitation of Ii indicates equivalent expression of
both rIi. Class II is not detected in the Ii precipitates.
|
To determine allotype-dependent binding, we introduced the
sequence of MAT into Ii. MAT is a peptide comprising aa 17–31 of
influenza virus matrix protein. The MAT peptide
17SGPLKAEIAQRLEDV31 has been
shown to bind to DR1, while the A in position 25 replaced by a T leads
to binding to DR4 (45). Both sequences were cloned into Ii81-101
(Figs. 1 and 2) and expressed in COS cells with either DR1 or DR4 (Fig. 7). Immunoprecipitation demonstrates that
rIi MAT A is coprecipitated with DR1, whereas the mutation of
Ala25 to Thr almost completely abrogates binding to DR1.
Conversely, rIiMAT T binds to DR4, whereas rIi MAT A does not. This
shows that the binding of the rIi MAT constructs is DR allele specific
and that an allotype-independent binding sequence is missing in these
constructs. The expression of the recombinant Ii is similar in all
samples (Fig. 7, bottom). Class II is not visible in Ii
precipitates.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Consistent with our findings, almost identical binding characteristics were found for the Ii76-91 peptide to four murine alleles, whereas the binding of CLIP differed according to the individual allotypes (47). These authors in addition reported that the groove-binding peptide inhibits binding of antigenic peptides. In contrast, the Ii76-91 peptide enhances binding of two different HEL peptides.
Peptides containing aa 81–87 of Ii possibly bind to the 1 domain of
MHC class II dimers, as their binding site seems to overlap with the
Staphylococcus enterotoxin B contact region (48, 49). The
interactions of these Ii-derived peptides and of intact Ii with class
II seem to involve the same class II domain, as the peptide binding can
be inhibited by soluble Ii (49). Possible contact residues on the 1
domain were suggested to be Asp17, Glu21,
and/or Asp35 of DR (48). These residues were proposed to
interact with Lys83 and/or Lys86 of human Ii.
These residues are highly conserved between mice and humans, and there
are putative acidic counterparts for the lysine residues in the 1
domain of H2-A, H2-E, DR, DP, and DQ. The interaction of these
class II residues with the lysine-rich PBSite could thus have a
stabilizing effect on Ii binding irrespective of the class II
allele. A binding domain containing residues 81–87 of Ii might not be
formed by a peptide of the same sequence. This could explain why a
strong binding of the free peptide to class II molecules was not
observed (48). The aa 81–87 sequence could be part of a larger motif
that is destroyed by Ii degradation.
Presumably, there are several contact sites of Ii and class II in the
(ßIi)3 complex. A recombinant, soluble Ii lacking the
N-terminal part up to aa 117 augmented antigenic peptide binding of DR
dimers, suggesting that the C-terminal part of Ii also interacts with
class II molecules (24). Recently, it was shown that the
membrane-proximal region and the sequence from which CLIP is derived
are extended in the Ii trimer (50). This open structure could allow
binding to the class II groove. Our result that aa 80–139 of Ii fused
into the TFR sequence 107 aa from the transmembrane domain permits
binding to class II polypeptides suggests that this open structure is
retained in the TFR-CBS. Presumably other sequences of Ii are not
essential for class II interaction.
The interaction between class II and aa residues 81–87 of the CBS suggests how Ii release could be controlled. The acquisition of peptides by class II dimers is postponed until a final step of Ii degradation, when the CLIP sequence is proteolytically separated from the highly conserved 22 aa between the transmembrane domain and the CBS. The stepwise release of Ii from MHC class II molecules is initiated by cleavage at a position C-terminal to the groove-binding motif (51). The Ii fragment LIP is still associated with class II dimers (52) and might dissociate from the nonameric complex. The trimer could be more accessible to proteases and to HLA-DM than the nonamer (28). If LIP is not removed by DM, further cleavage at residues 80–87 and C-terminal trimming of the fragment yields CLIP bound to MHC class II dimers. This degradation step might impair interactions of the proline-lysine-rich motif of CLIP with class II polypeptides. The allotype-dependent binding of aa 91–99 then could determine whether accessory molecules such as HLA-DM are necessary for CLIP release.
The promiscuous binding of Ii to class II molecules may facilitate the assembly of the nonameric class II/Ii complex in the endoplasmic reticulum and could postpone the binding of antigenic sequences to MHC class II vesicles. In this compartment, CLIP governs the acquisition of peptides by class II dimers as has been demonstrated with H2-M-deficient mice (53, 54, 55). It remains to be shown whether CLIP modulates an immune response as a consequence of the MHC polymorphism.
Positioning of an antigenic sequence into Ii might be useful for raising cellular vaccines. A similar strategy recently was described (56). In this report, a T cell epitope from hemagglutinin was used for insertion into Ii beyond aa 90. This construct contains the PBSite that we identified. A transfectant containing this chimeric Ii was efficiently recognized by a hemagglutinin-specific T cell clone. By comparison, we introduced the antigenic sequence of MAT into an Ii deletion mutant that lacks the PBSite and obtained DR allotype-dependent binding of MAT to class II molecules. This result suggests binding of the recombinant MAT to the class II peptide-binding groove. Our finding that an Ii sequence adjacent to the groove-binding segment stabilizes binding of Ii to class II molecules is consistent with a recent publication (57). In this report, antigenic sequences introduced into Ii mediate resistance of the DR1/Ii complex to SDS treatment. This result is consistent with binding of the antigenic sequence into the peptide binding cleft of class II molecules.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Norbert Koch, Abteilung Immunbiologie, Universität Bonn, Römerstrasse 164, D53117 Bonn, Germany. E-mail address:
3 Abbreviations used in this paper: Ii, invariant chain; CLIP, class II-associated Ii peptides; CBS, class II binding site of Ii; PBSite, promiscuous binding site of Ii; aa, amino acids; TFR, transferrin receptor; MOMP, peptide from major outer membrane protein of C. trachomatis; MAT, peptide from influenza virus matrix protein; NEPHGE, nonequilibrated pH gradient electrophoresis.
Received for publication September 15, 1997. Accepted for publication December 5, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß dimers and facilitates peptide loading. Cell 82:155.[Medline]
This article has been cited by other articles:
|
|
 |
|
  J. Neumann and N. Koch A novel domain on HLA-DR{beta} chain regulates the chaperone role of the invariant chain J. Cell Sci., October 15, 2006; 119(20): 4207 - 4214. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-M. van Santen, C. Benoist, and D. Mathis Number of T Reg Cells That Differentiate Does Not Increase upon Encounter of Agonist Ligand on Thymic Epithelial Cells J. Exp. Med., November 15, 2004; 200(10): 1221 - 1230. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Ye, P. W. Finn, R. Sweeney, E. K. Bikoff, and R. J. Riese MHC Class II-Associated Invariant Chain Isoforms Regulate Pulmonary Immune Responses J. Immunol., February 1, 2003; 170(3): 1473 - 1480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. S. Patil, A. Pashine, M. P. Belmares, W. Liu, B. Kaneshiro, J. Rabinowitz, H. McConnell, and E. D. Mellins Rheumatoid Arthritis (RA)-Associated HLA-DR Alleles Form Less Stable Complexes with Class II-Associated Invariant Chain Peptide Than Non-RA-Associated HLA-DR Alleles J. Immunol., December 15, 2001; 167(12): 7157 - 7168. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Bischof, W. Wienhold, C. Wirblich, G. Malcherek, O. Zevering, A. M. Kruisbeek, and A. Melms Specific treatment of autoimmunity with recombinant invariant chains in which CLIP is replaced by self-epitopes PNAS, September 26, 2001; (2001) 221220998. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Carstens, D. K. Newman, H. Bohlen, A. Konig, and N. Koch Invariant chains with the class II binding site replaced by a sequence from influenza virus matrix protein constrain low-affinity sequences to MHC II presentation Int. Immunol., November 1, 2000; 12(11): 1561 - 1568. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. S. Arneson, M. Peterson, and A. J. Sant The MHC Class II Molecule I-Ag7 Exists in Alternate Conformations That Are Peptide Dependent J. Immunol., August 15, 2000; 165(4): 2059 - 2067. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. B. Ashman and J. Miller A Role for the Transmembrane Domain in the Trimerization of the MHC Class II-Associated Invariant Chain J. Immunol., September 1, 1999; 163(5): 2704 - 2712. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. P. Thayer, L. Ignatowicz, D. A. Weber, and P. E. Jensen Class II-Associated Invariant Chain Peptide-Independent Binding of Invariant Chain to Class II MHC molecules J. Immunol., February 1, 1999; 162(3): 1502 - 1509. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Chen, C. Thoburn, and A. D. Hess Characterization of the Pathogenic Autoreactive T Cells in Cyclosporine-Induced Syngeneic Graft-Versus-Host Disease J. Immunol., December 15, 1998; 161(12): 7040 - 7046. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Neumann, N. Schach, and N. Koch Glycosylation Signals That Separate the Trimerization from the MHC Class II-binding Domain Control Intracellular Degradation of Invariant Chain J. Biol. Chem., April 13, 2001; 276(16): 13469 - 13475. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Bischof, W. Wienhold, C. Wirblich, G. Malcherek, O. Zevering, A. M. Kruisbeek, and A. Melms Specific treatment of autoimmunity with recombinant invariant chains in which CLIP is replaced by self-epitopes PNAS, October 9, 2001; 98(21): 12168 - 12173. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, DR without Ii was transfected. Positions of the DR 
