|
|
||||||||



*
Committee on Immunology and
Department of Molecular Genetics and Cell Biology, University of Chicago, Chicago, IL 60637
| Abstract |
|---|
|
|
|---|
B. Nevertheless, coexpression of ICAM-1 or B7-1 on
ProAd is required to induce detectable levels of IL-2 gene expression
in either Th1 clones or naive T cells. In Th1 clones, activation by
ProAd-ICAM induces very transient IL-2 mRNA expression that does not
result in detectable IL-2 secretion or T cell proliferation. In naive T
cells, the duration of IL-2 mRNA expression is longer, allowing for a
transient burst of IL-2 protein that is sufficient to drive the cells
into the cell cycle. In spite of this initial response, Ag presentation
by ProAd-ICAM is a tolerogenic signal to naive T cells, and responding
T cells undergo apoptosis 4 to 5 days poststimulation. These data
suggest that engagement of LFA-1 can provide sufficient costimulatory
signals to induce T cell activation and IL-2 gene expression, but
cannot protect against anergy induction or provide for T cell survival. | Introduction |
|---|
|
|
|---|
The best-defined costimulatory molecules are B7-1 and B7-2, which are ligands for CD28 (for review, see 2 . CD28 costimulation has been shown to play an important role in activation of many different T cell populations, to up-regulate expression of IL-2 and other effector molecules, to protect against the induction of T cell anergy, and to provide important survival signals to newly activated T cells. Many other receptor-ligand pairs have also been implicated in provided costimulatory signals to T cells. These include (receptor/ligand): LFA-1/ICAM-13 (3, 4, 5, 6, 7), CD2/CD48 (CD58) (8, 9, 10, 11), CD44/invariant chain-chondroitin sulfate (12), unknown/VAM-1 (13), unknown/heat-stable Ag (14), unknown/CD43 (15, 16), and TNFR/TNF family members such as CD70/CD27 (17, 18), CD40L/CD40 (19), 4-1BB/4-1BBL (20, 21), OX-40/OX-40L (22), and CD30/CD30L (23). However, none of these molecules induces all of the functions associated with CD28 signaling; each has some restriction either on the population of T cells that respond or on the specific activation events that can be induced. Nevertheless, the emerging view is that T cells encounter many different accessory molecules during interactions with different APC at different stages of T cell development and differentiation.
One of the important accessory molecules that mediates adhesion between T cells and APC is LFA-1. Adhesion mediated through LFA-1 is highly regulated during T cell activation through two distinct mechanisms (24, 25). First, LFA-1 undergoes a conformational change that has a higher affinity for ICAM-1 (26). Second, LFA-1 undergoes a signal-dependent release and reassociation with the cytoskeleton that results in LFA-1 clustering and a corresponding increase in avidity for ICAM-1 binding (27, 28). In addition to its role in adhesion, LFA-1 has been implicated in providing costimulation (3, 4) and in signal transduction (29, 30, 31). However, the relative importance of LFA-1 as a signaling molecule has been controversial, in part because in some studies it has been difficult to distinguish between direct effects on T cell signaling and indirect effects mediated through intercellular adhesion (32, 33, 34). For example, costimulation through CD28 can be provided on a surface separate from the TCR stimulus, an observation that has been used to argue that CD28 can transduce an independent signal to T cells. In contrast, although costimulation through ICAM-1/LFA-1 interactions has been shown to function in a similar fashion in some studies (5, 7), this has not generally been the case (32, 34) (L. P. and J. M., unpublished observation). Thus, it remains unclear whether ICAM-1/LFA-1 interactions are mediating their effect on T cell activation entirely through adhesion or through a combination of adhesion and costimulation. In addition, unlike costimulation by CD28, the ability of LFA-1 to costimulate T cells is restricted to a subset of T cells. For example, LFA-1 engagement appears to have a selective, functional effect on naive T cells and a limited, if any, effect on activated T cells (5, 6, 7, 13, 35).
In this study, we have compared the ability of ICAM-1/LFA-1 interactions to provide costimulation to naive T cells and to Th1 clones. In previous studies, we had found that Ag presentation by class II-positive, ICAM-1-positive transfectants does not induce Th1 T cell proliferation and rather induces T cell anergy (13). In this study, we have found that the same transfectants do induce proliferation from naive CD4-positive T cells, but, as in the Th1 clones, this is a tolerogenic signal, because these naive T cells ultimately die of apoptosis. Interestingly, the ability of ICAM-1 transfectants to selectively activate naive T cells does not appear to be a difference in the ability of naive T cells and Th1 clones to respond to LFA-1-mediated costimulation, but rather a difference in the kinetics of IL-2 gene expression.
| Materials and Methods |
|---|
|
|
|---|
A panel of transfectants in the fibrosarcoma, 6132A-PRO (Pro),
expressing I-Ad alone or in combination with B7-1 or ICAM-1 (13) and
the murine CD4-positive Th1 T cell clone, pGL2 (36), has been
described. All cell lines were maintained in DMEM supplemented with
10% FCS, 2 mM glutamine, 0.1 mM nonessential amino acids, 40 µg/ml
gentamicin, and 50 µM 2-ME. G418 (200 µg/ml) and/or MXH (250
µg/ml xanthine, 15 µg/ml hypoxanthine, and 6 µg/ml mycophenolic
acid) were added to the culture media for maintenance of the
transfectants. The pGL2 cells were maintained by weekly passage with
irradiated BALB/cJ splenocytes, 400 µg/ml OVA, 10 to 20 U/ml human
rIL-2, and 200 U/ml rIFN-
. CD4-positive T cells were purified from
lymph nodes of DO11.10 TCR transgenic mice (37, 38) by negative
selection. Class II-positive cells (using a mixture of mAbs M5/114,
25-9-17, and 3JP) and CD8-positive T cells (using mAb 2.43) were
depleted by complement lysis (1/10 dilution of guinea pig complement
from Accurate Chemical, Westbury, NY), followed by an equal number of
sheep anti-mouse- and sheep anti-rat-coated M450 Dynal magnetic
beads (Dynal, Oslo, Norway). Purity of CD4-positive T cells was
determined by flow cytometry and/or by the lack of proliferation to 10
µg/ml Con A (Sigma Chemical, St. Louis, MO).
Flow cytometry
The transfectants were monitored for class II expression by binding to the Ab MKD6 (American Type Culture Collection (ATCC), Rockville, MD), ICAM-1 expression by binding to the Ab YN-1.7.1 (ATCC), and B7-1 by binding to CTLA4Ig (Repligen, Cambridge, MA). Indirect immunofluorescence was performed with the appropriate FITC-coupled secondary Ab. CD4-positive lymph node T cells were analyzed for expression of the TCR transgene using the clonotypic mAb, KJ1-26 (39), generously provided by Dr. P. Marrack (National Jewish Center, Denver, CO), and for CD4, CD69, CD44, and CD25 (PharMingen, San Diego, CA). We have confirmed that the majority (9095%) of the transgenic TCR-positive cells from the DO11.10 transgenic mice have the cell surface phenotype of naive T cells (Ref. 37 and data not shown).
T cell assays
For T cell proliferation, 5 x 104 T cells were incubated with 5 x 104 mitomycin C-treated transfectants and various concentrations of Ag in a flat-bottom 96-well plate for 36 to 48 h. [3H]Thymidine was added to the cultures for an additional 18 h before wells were harvested. Cytokine production was determined by capture ELISA (PharMingen) from supernatants harvested from 24-well plates containing 3 x 105 CD4-positive lymph node T cells, 2.5 x 105 transfectants, and varying concentrations of Ag. In most experiments, Ag was a synthetic peptide corresponding to amino acids 323339 from chicken OVA. In some experiments, a tryptic digest of chicken OVA was used.
DAPI staining
CD4-positive lymph node T cells (0.30.5 x 106) were incubated in 24-well plates with an equal number of transfectants for 3, 4, or 5 days. After this incubation, cells were harvested and spun down and resuspended in 100 µl of PBS or complete media. Aliquots of cells (30 µl) were mixed with 10 µl of DAPI (4',6-diamidino-2-phenylindole; Sigma Chemical) at 1 µg/ml in PBT (PBS containing 1% Triton X-100). The cells were viewed by fluorescence microscopy using an Olympus BX-40 microscope with a 100-W Mercury lamp, a x40 Fluorite objective, N.A. 0.75 (Leco #1-UB527), and a UV filter cube (ex 330385 nm em 420 nm wide band pass, Leco #U-M536). Images were photographed using an Optronics cooled low-light video camera (Leco #DEI-470TB) with a x2 coupler (Leco #HR200-CMT) and printed on a Sony UP 1800 MD printer.
Western blot analysis
To assay for the presence of Bcl-XL, 2.5 to 10 x 106 purified CD4-positive lymph node T cells were incubated with 10 x 106 transfectants overnight in the presence and absence of Ag. Cells were harvested and lysates were prepared, as previously described (40). Briefly, cells were lysed with NET-N (100 mM NaCl, 1 mM EDTA, 20 mM Tris-HCl (pH 8), and 0.2% Nonidet P-40), nuclei were pelleted, and the supernatants were adjusted to 2% SDS, boiled, and loaded onto 12.5 polyacrylamide gels for electrophoresis. Proteins were transferred for at least 5 h at 150 mA to nitrocellulose for blotting. Blots were blocked for at least 3 h in 5% nonfat milk with 0.1% Tween and developed with rabbit antisera or mAb ascites directed against Bcl-XL (kindly provided by Dr. Craig Thompson, University of Chicago, Chicago, IL). Western blots were developed using enhanced chemiluminescence (Amersham, Arlington, Heights, IL).
cDNA and RT-PCR assays
Th1 clones or naive CD4-positive lymph node T cells (2.5 x
106) were stimulated with an equal number of
transfectants in the presence or absence of peptide Ag. RNA was
isolated using 1 ml of TRIzol reagent (Life Technologies, Gaithersburg,
MD), and an aliquot of the RNA was electrophoresed on a 1%
agarose/formaldehyde gel to determine quality and estimate quantity, as
determined by ETBr staining of the 28S and 18S ribosomal RNA bands.
Three to five micrograms of the extracted RNA were utilized to make
cDNA using random hexamer primers and Superscript II reverse
transcriptase (Life Technologies). The resulting cDNA was diluted 1/5
before use in PCR reactions. PCR was conducted essentially as described
(41). Briefly, 1 to 5 µl of diluted cDNA was added to a 100 µl
reaction mixture containing 10 mM Tris-HCl, 1.5 mM MgCl2,
50 mM KCl, pH 8.3, 0.4 µM sense and antisense primers, 0.1 mM dNTPs,
and 2.5 U Taq polymerase (Boehringer Mannheim, Indianapolis,
IN). In most experiments, a control cDNA was added to the reaction as a
positive control for the PCR reactions. Cycling conditions were 94°C
for 45 s, 60°C for 15 s, and 72°C for 45 s. The
total number of cycles was 41. The resulting product was
electrophoresed on a 2.5% agarose gel and stained with ethidium
bromide. The quantity of hypoxanthine phosphoribosyltransferase (HPRT)
PCR product in different samples was used to normalize the samples for
equivalent amounts of cDNA. The HPRT reactions were done in the
presence of a competitor cDNA to ensure linear amplification of PCR
products (41). In some experiments, samples were also normalized to the
amount of CD3
mRNA to ensure that equivalent amounts of T cell cDNA
were assayed.
Nuclear extracts and gel shifts
Th1 clones were stimulated with Ag presented by Pro
transfectants for 6 h. During this time, the majority of the
transfected cells are lysed by the cytolytic Th1 cells (42), and the
activated T cells have adhered to the plastic dish. Remaining
transfectants were washed away and the T cells were briefly trypsinized
before harvesting for assays. Only experiments that had greater than
75% recovery of total input T cells were considered for further
analysis. The extracts themselves were made according to McCormick et
al. (43) with few differences. Upon harvesting, the cells were
resuspended at 2.5 x 108/ml in 10 mM HEPES, 1.5
mM MgCl2, 10 mM KCl, 0.5 mM DTT, and 0.5 mM PMSF, and the
cells were lysed by the addition of 0.1% Nonidet P-40 for 15 min at
4°C. The nuclei were collected by centrifugation and extracted at
109 cell equivalents/ml in 20 mM HEPES, 1.5 mM
MgCl2, 520 mM NaCl, 0.1 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF,
0.1% Nonidet P-40, and 25% glycerol for 30 min at 4°C. Cellular
debris was pelleted, and supernatants were frozen and stored at
-80°C. Protein was quantitated in nuclear extracts using the Bio-Rad
(Richmond, CA) protein assay, and equivalent amounts of protein (510
µg) were used for each assay condition. The binding reactions were
performed as previously described (44, 45). Between 5 and 10 µg of
protein was used per reaction in a buffer containing 10 mM Tris (pH
7.5), 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 5% glycerol, and 4 µg
poly(dI:dC) (Pharmacia, Piscataway, NJ). The reactions were incubated
at room temperature for approximately 15 min with 10,000 cpm
double-stranded 32P-labeled oligonucleotides. After the
binding reactions, the samples were subsequently electrophoresed on 4%
polyacrylamide gels in the following buffer: 25 mM Tris, 190 mM
glycine, and 1 mM EDTA. The oligonucleotides used in these studies were
taken from the murine IL-2 gene (the 5'TT was added to the OCT site to
increase radiolabeling) and were monomers of the binding sites: NF-AT
(GCCCAAAGAGGAAAATTTGTTTCATACAG), OCT-1/2 (TTTATGTAAAACATCGTG), and
NF-
B (AGAGGGATTTCACCTAAATCC).
| Results |
|---|
|
|
|---|
To determine whether costimulation through interaction of ICAM-1
and LFA-1 mediated distinct effects in naive T cells and Th1 clones, we
assayed the ability of class II-positive transfectants in the
costimulation-negative tumor cell line (6132A-PRO) that do and do not
coexpress ICAM-1 or B7-1 to activate T cells (13). As predicted from
their lack of detectable expression of costimulatory molecules, class
II-positive transfectants (ProAd) do not stimulate Th1 T cell clones
(Fig. 1
A) or naive
CD4-positive T cells, purified from the lymph nodes of DO11.10 TCR
transgenic mice (Fig. 1
B). As a positive control, Ag
presentation by ProAd supertransfected with B7-1 (ProAd-B7) results in
efficient activation of both naive T cells and Th1 clones (Fig. 1
). In
contrast, Ag presentation by ProAd cells supertransfected with ICAM-1
(ProAd-ICAM) does not induce proliferation of Th1 clones, but does
stimulate proliferation of naive T cells (proliferation in this case is
measured by [3H]thymidine incorporation, but see below).
Ab blocking confirmed that ICAM-1 was mediating this effect through
interaction with LFA-1 (data not shown). Thus, consistent with previous
results (6, 7, 13), B7-1, but not ICAM-1, can function as a
costimulatory molecule for previously activated T cells and for Th1 T
cell clones. In contrast, Ag presentation in the context of either B7-1
or ICAM-1 is capable of stimulating entry of naive T cells into the
cell cycle.
|
Although in some experiments Ag presentation by ProAd-ICAM and
ProAd-B7 induced similar levels of thymidine incorporation in naive T
cells, in most cases Ag presentation by ProAd-ICAM was less efficient
than ProAd-B7 (See Fig. 1
B). The reduced responses
are not due to reduced numbers of responding T cells, because both
ProAd-B7 and ProAd-ICAM activated the majority of the cells in the
culture and induced similar levels of the T cell activation markers,
CD44 and CD69 (Table I
). Likewise,
propidium iodide staining indicated that similar numbers of T cells
were driven into cell cycle in cultures stimulated with ProAdB7-1 and
ProAd-ICAM (data not shown). Reduced proliferation following Ag
presentation by ProAd-ICAM did correlate with a 10-fold decrease in
IL-2 production compared with ProAd-B7 (Fig. 2
). This low level of IL-2 probably
accounts for the reduced expression of CD25 (Table I
) in the cultures
stimulated by ProAd-ICAM, as addition of 50 to 100 U/ml of exogenous
IL-2 up-regulated the level of CD25 expression to that seen in cultures
stimulated with ProAdB7-1. In contrast, addition of exogenous IL-2 to
cultures stimulated with ProAd-ICAM did not compensate for the
difference in proliferation compared with T cells stimulated with
ProAd-B7 (data not shown). Taken together, these data indicate that
costimulation through ICAM-1 can activate naive T cells, but this
activation is suboptimal, as evidenced both by reduced cytokine
production and reduced proliferation in the presence of excess
IL-2.
|
|
|
|
|
The ability of ProAd-ICAM transfectants to induce IL-2 production
and proliferation in naive T cells, but not Th1 clones, raised the
possibility that costimulation by ICAM-1 had a different effect on IL-2
gene regulation in these T cell populations. To test this possibility,
we assayed for IL-2 gene expression by RT-PCR. Naive T cells stimulated
with either ProAd-ICAM and ProAd-B7, but not ProAd, induced readily
detectable levels of IL-2 mRNA by 2 to 3 h after stimulation (Fig. 6
, AC). IL-2 mRNA
continued to accumulate in the naive T cells stimulated by ProAd-B7 and
was still present at maximum levels at 24 h (data not shown).
However, after 3 h, IL-2 mRNA decreased in the
ProAd-ICAM-stimulated T cells and was undetectable by 6 h. This
pattern of expression is consistent with the level of functional IL-2
protein secreted in these cultures (see above).
|
|
Two possible explanations can account for the ability of
ProAd-ICAM, but not ProAd, to induce T cells to produce IL-2 mRNA: 1)
ICAM-1/LFA-1 interactions function through intracellular adhesion and
stabilization of T cell:APC conjugates, allowing more efficient TCR
signaling; 2) ICAM-1/LFA-1 interactions function through costimulation,
modulating the nature of T cell signaling. The failure to detect IL-2
mRNA following Ag presentation by ProAd even in the presence of
cycloheximide suggests that TCR ligation alone is not sufficient to
induce IL-2 gene expression (see Fig. 7
). However, these data do not
indicate whether the TCR was engaged following Ag presentation by
ProAd. Previous studies had shown that Ag presentation by ProAd to Th1
clones results in the induction of T cell anergy, an event that
requires TCR occupancy (13). One caveat with the anergy induction
studies is that it is possible that the level of TCR signaling that is
necessary to induce anergy may be significantly less than that required
to induce IL-2 transcription or T cell proliferation (55). To address
this possible concern, we used gel-shift analysis to assay the
expression of two transcription factors, NF-AT and NF-
B, which
participate in the up-regulation of IL-2 gene expression. NF-AT is
composed of a constitutively expressed cytosolic factor that, upon a
sustained calcium signal, is translocated to the nucleus (56, 57),
where it assembles with a newly synthesized AP-1 family dimer to
generate a complete complex (58, 59). In contrast, activation of
NF-
B by displacement of the cytosolic inhibitor I
B requires a
large transient rise in intracellular calcium (57). Thus, expression of
these two factors is a stringent assay for effective TCR signaling and
the induction of both phases of a calcium response. Resting T cells do
not express any NF-AT, and expression of the intact NF-AT complex is
equivalently induced following activation by ProAd or ProAd-B7 (Fig. 8
). Resting T cells express a fast
migrating complex with the NF-
B probe, which most likely represents
the p50 homodimer, a negative regulator of IL-2 transcription (60).
Stimulation of Th1 cells with either ProAd or ProAd-B7 (Fig. 8
) induces
an equivalent increase in a slower migrating p50/p65 heterodimeric form
of NF-
B that is associated with up-regulation of IL-2 transcription
(60). Because OCT-1 is constitutively expressed in pGL2 cells (61),
equivalent detection of OCT-1 serves as a control for equivalent
amounts of nuclear extracts between samples. To confirm that Ag
presentation by ProAd results in sustained signaling in the Th1 cells,
nuclear extracts were prepared at different times following T cell
activation. As shown in Figure 9
, Ag
presentation by ProAd and ProAd-B7 induces similar levels of NF-AT at
2, 6, and 9 h, and high levels of NF-AT are still detected in
nuclear extracts 24 h after stimulation by ProAd and ProAd-B7
(data not shown). These results demonstrate that Ag presentation by
ProAd cells does activate Th1 clones, effectively transducing signals
through the TCR. This stimulation results in sufficient signals to
induce translocation and assembly of transcription factors involved in
IL-2 gene transcription, but without inducing detectable levels of IL-2
mRNA. These findings imply that additional signals may be provided
through ICAM-1/LFA-1 or B7-1/CD28 interactions that allow for the
induction of IL-2 gene expression.
|
|
| Discussion |
|---|
|
|
|---|
One issue that has been difficult to resolve is whether the ability of
ICAM-1/LFA-1 interactions to enhance T cell activation is mediated
through intracellular adhesion, allowing for more efficient TCR
signaling, or through LFA-1-linked signaling events that work in
concert with TCR signals. Studies that have attempted to measure the
adhesive contributions of ICAM-1/LFA-1 interactions to T cell
stimulation have suggested that this enhanced intracellular adhesion
can contribute to a one to two log shift in the Ag dose response (32).
In our experiments, this approaches the limit of detection between Ag
presentation to naive T cells by ProAd and ProAd-ICAM: typically a
minimum of 100-fold shift in the dose response (see Fig. 1
). One
concern with the naive T cells is that we have no indication that ProAd
engages the T cells; the cells do not transcribe IL-2 mRNA,
proliferate, nor induce cell surface activation markers. However, there
is clear data that ProAd can form functional conjugates with Th1
clones. Stimulation of pGL2 cells with ProAd induces T cell anergy (13)
and normal levels of NF-AT and NF-
B, two transcription factors that
regulate IL-2 gene expression (see Fig. 8
). Nevertheless, we cannot
detect any IL-2 mRNA produced in pGL2 cells stimulated with ProAd
cells, even following superinduction with cycloheximide. Thus, although
ProAd cells can form functional conjugates with Th1 cells and
effectively trigger the TCR, they do not stimulate IL-2 transcription.
The ability of ProAd-ICAM to induce IL-2 transcription suggests that
engagement of LFA-1 may provide additional signals that are not
mediated through TCR engagement alone.
IL-2 gene expression is regulated in many ways, including sequestration
of tissue-specific transcription factors in the cytoplasm (63),
up-regulation of transcription factor expression (64, 65, 66, 67), cooperative
binding of transcription factors to the IL-2 promoter/enhancer region
(68), transcriptional elongation (69), mRNA stabilization (70), and
translational control (53). In this study, we have shown that TCR
signaling following Ag presentation by ProAd in the absence of
costimulation cells results in the translocation and assembly of NF-AT
and NF-
B transcription factors. However, these events are not
sufficient to induce detectable levels of IL-2 mRNA expression. The
failure to detect IL-2 gene expression following TCR engagement differs
from the prevailing view that TCR signaling in the absence of
costimulation is sufficient to induce IL-2 transcription (71). For
example, anti-CD3 has been shown to fully induce IL-2 transcription
in T cell clones, as assayed through the use of reporter constructs and
transcription factor induction (69, 72), and this level of
transcription was not further increased when the Th1 cells were
stimulated in the presence of anti-CD28 mAbs (69). However, most of
the published experiments have utilized T cell tumors, which can differ
from normal cells in how they regulate IL-2 gene expression (73), or
have stimulated T cells with pharmacologic agents or with Abs as
ligands for CD3 or CD28, which can recruit effector molecules that are
not induced with natural ligands (74). In contrast, in our studies, we
have assayed normal T cells stimulated with natural ligands expressed
on the surface of live APC.
Coexpression of either ICAM-1 or B7-1 in the ProAd cells confers the ability to induce IL-2 gene expression, indicating that engagement of LFA-1 or CD28 can provide unique signals of their own that work in concert with TCR signals to up-regulate IL-2 gene transcription. The kinetics of IL-2 mRNA expression, the known ability of CD28 signaling to induce IL-2 mRNA stability (70), the selective superinduction of cycloheximide on ProAd-ICAM-stimulated T cells, and the demonstration that cycloheximide treatment can result in enhanced stabilization of IL-2 mRNA (49) raise the possibility that costimulation through either ICAM-1 or B7-1 induces IL-2 gene transcription, but only B7-1/CD28 interactions induce IL-2 mRNA stability. However, it is also possible that the rapid down-regulation of IL-2 gene expression following Ag presentation by ProAd-ICAM corresponds to the transient induction of a transcription factor, whose continued expression is necessary for sustained IL-2 transcription. Clearly, additional studies are necessary to determine the exact signals relayed through either the TCR or accessory/costimulatory molecules that regulate IL-2 gene expression.
Over the past decade, it has become clear that integrins play an
important role in the regulation of cell growth and differentiation.
Integrins were defined originally as adhesion molecules that mediate
contact between cells and between cells and the extracellular matrix,
but it is now clear that these proteins can function as bone fide cell
surface signaling molecules. The importance of integrins as signaling
molecules is understood better in nonlymphoid cells, where they play an
essential role in interactions with the extracellular matrix through
the formation of focal adhesions (for reviews, see Refs. 7579). This
focal adhesion signal is initiated by ligand binding of the integrin
receptor, which induces a conformational change releasing the cytosolic
domain of the ß-chain from the regulatory sequence of the
-chain.
The activated ß-chain now is free to recruit the cytoskeletal
components,
-actinin, talin, and vinculin and the tyrosine kinase,
FAK, to the plasma membrane. This leads to phosphorylation of paxillin
and actin polymerization, and through SH2/SH3 domain interactions, FAK
can recruit src family kinases, grb2, PI-3-kinase, and other
signaling components to the focal contact (80, 81, 82). Both the MAP-kinase
and ras downstream signaling pathways can be induced
following integrin-mediated cell signaling. In addition, small
GTP-binding proteins such as Rho, Rac, and CDC42 have been shown to
control the formation of focal adhesion complexes (83), and other
integrin-binding proteins, such as cytohesion (84) and
integrin-associated kinase (85), can regulate the affinity and/or
avidity of integrin/ligand interaction. The focal adhesion therefore
represents a large aggregate of receptors, signal-transduction
molecules, and structural proteins that can facilitate the activation
of signaling pathways and changes in cell-cell or cell-substrate
contacts.
The integrin ß-chain is well conserved among most family members,
including the LFA-1 ß-chain (ß2). Thus, signaling through LFA-1
could be mediated by a similar complex to that seen in focal contacts.
Consistent with this possibility, many of the cytoskeletal proteins
that are associated with focal adhesions have been shown to bind to the
cytosolic tail of the LFA-1 ß-chain, including talin,
-actinin,
vinculin, and FAK (86, 87, 88). In addition, it has been shown recently
that activation of FAK following engagement of ß1
integrins can costimulate IL-2 production in T cells (89). However, to
date, only talin and actin have been shown to be recruited to the T
cell:APC adhesion complex (90). One difference between signaling
through ß1 or ß3 integrins and signaling
through LFA-1 is the fate of the activated cells. Integrin signaling in
endothelial cells and fibroblasts is associated with an antiapoptotic
signal (91), whereas we have shown that Ag presentation by ProAd-ICAM
to naive T cells results in T cell death.
It is not clear whether the T cell death we have observed is actively induced by interaction between ICAM-1 and LFA-1 or is the result of the failure to induce essential survival factors. Activation-induced cell death is a well-recognized phenomenon in T cells (92) and is mediated primarily by fas following restimulation of previously activated T cells (93, 94) or TNF (95, 96). Damle et al. (97) has shown that coimmobilization of ICAM-1 with anti-TCR Abs can enhance activation-induced cell death, but it is not clear whether this is mediated by signaling through LFA-1 or by enhanced TCR signaling. In most cases, activation-induced cell death is restricted to previously stimulated T cells and occurs with 24 h of T cell stimulation. The cell death that we have observed differs in that it occurs in naive T cells and takes 4 to 5 days. This is more similar to superantigen-induced cell death in vivo, in which peripheral naive T cells initially proliferate and then die (98, 99). Mice lacking ICAM-1 lose the proliferative phase of this response, but not the cell death phase, suggesting that cell death is not mediated through engagement of LFA-1 (100). However, these studies do not exclude the possibility that LFA-1 interactions with the alternative ligand, ICAM-2, may be important for superantigen-induced cell death. Superantigen-induced cell death is also mediated by fas (93, 94) and/or TNF (95) and is likely to be dependent on persistence of Ag and repeated stimulation of T cells (101). In this regard, the ability to induce cell death in naive T cells is similar to other models of activation-induced cell death, in which the initial exposure to superantigen induces T cell activation and secondary exposures of the now activated T cells lead to cell death (99). This scenario probably does not take place when we stimulate the naive T cells with ProAd-ICAM, because the mitomycin C-treated Pro cell transfectants do not survive in cell culture for more than 1 to 2 days, well before the T cells begin to apoptose.
Alternatively, the ability of ProAd-ICAM to induce T cell death may
result from the failure to induce essential survival factors. Our
finding that ProAd-B7-stimulated T cells induced increased levels of
Bcl-XL, whereas ProAd-ICAM-stimulated T cells did not (see
Fig. 5
), is consistent with this possibility. Bcl-XL is an
important T cell survival factor, and its absence has been implicated
in the eventual death of activated T cells isolated from CD28-deficient
mice (102, 103). Thus, it may be more likely that T cell death
following Ag presentation by ProAd-ICAM is by neglect rather than
induction by LFA-1 signaling. At present, we cannot distinguish these
possibilities on the naive T cells because T cells stimulated by ProAd
die rapidly without apparent activation.
Overall, our results underscore the complex role that accessory molecules play in the activation, maintenance, and down-regulation of an immune response. Thus, costimulation may not be merely an on or off event, but rather there may be a spectrum of T cell responses, and each response may depend on constellation of individual accessory molecules and cytokines present in the environment as well as the activation status of the T cell itself. While this spectrum may include easily documented on or off signals, we imagine that the gray area of T cell activation will be important for our understanding of T cell responses and the way in which costimulatory molecules can affect them.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jim Miller, MGCB, University of Chicago, 920 E. 58th Street, Chicago, IL 60637. E-mail address: ![]()
3 Abbreviations used in this paper: ICAM, intercellular adhesion molecule; DAPI, 4', 6-diamidino-2-phenylindole; ETBr, ethidium bromide; FAK, focal adhesion kinase. ![]()
Received for publication July 14, 1997. Accepted for publication December 8, 1997.
| References |
|---|
|
|
|---|
1 activation. Proc. Natl. Acad. Sci. USA 90:7099.
ß TCR transgenic system. Proc. Natl. Acad. Sci. USA 89:6065.
B subunit regulation in nontransformed CD4+ T lymphocytes. Science 256:1452.
B-like response element. J. Biol. Chem. 266:14179.
Lß2 integrin/LFA-1 binding to ICAM-1 induced by cytohesin-1, a cytoplasmic regulatory molecule. Cell 86:233.[Medline]
Lß2 are involved in endoplasmic reticulum retention, dimerization, and cytoskeletal association. J. Immunol. 155:1252.[Abstract]
This article has been cited by other articles:
![]() |
B. Graf, T. Bushnell, and J. Miller LFA-1-Mediated T Cell Costimulation through Increased Localization of TCR/Class II Complexes to the Central Supramolecular Activation Cluster and Exclusion of CD45 from the Immunological Synapse J. Immunol., August 1, 2007; 179(3): 1616 - 1624. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sanchez-Lockhart and J. Miller Engagement of CD28 Outside of the Immunological Synapse Results in Up-Regulation of IL-2 mRNA Stability but Not IL-2 Transcription. J. Immunol., April 15, 2006; 176(8): 4778 - 4784. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Jenkinson, N. A. Williams, and D. J. Morgan The Role of Intercellular Adhesion Molecule-1/LFA-1 Interactions in the Generation of Tumor-Specific CD8+ T Cell Responses J. Immunol., March 15, 2005; 174(6): 3401 - 3407. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Blank, I. Brown, A. K. Kacha, M. A. Markiewicz, and T. F. Gajewski ICAM-1 Contributes to but Is Not Essential for Tumor Antigen Cross-Priming and CD8+ T Cell-Mediated Tumor Rejection In Vivo J. Immunol., March 15, 2005; 174(6): 3416 - 3420. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Jenks, B. J. Eisfelder, and J. Miller LFA-1 co-stimulation inhibits Th2 differentiation by down-modulating IL-4 responsiveness Int. Immunol., March 1, 2005; 17(3): 315 - 323. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sanchez-Lockhart, E. Marin, B. Graf, R. Abe, Y. Harada, C. E. Sedwick, and J. Miller Cutting Edge: CD28-Mediated Transcriptional and Posttranscriptional Regulation of IL-2 Expression Are Controlled through Different Signaling Pathways J. Immunol., December 15, 2004; 173(12): 7120 - 7124. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kandula and C. Abraham LFA-1 on CD4+ T Cells Is Required for Optimal Antigen-Dependent Activation In Vivo J. Immunol., October 1, 2004; 173(7): 4443 - 4451. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-C. Huang, S.-T. Chan, T.-L. Yang, C.-C. Tzeng, and C.-C. Chen Inhibition of ICAM-1 gene expression, monocyte adhesion and cancer cell invasion by targeting IKK complex: molecular and functional study of novel {alpha}-methylene-{gamma}-butyrolactone derivatives Carcinogenesis, October 1, 2004; 25(10): 1925 - 1934. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-C. Chen, M.-P. Chow, W.-C. Huang, Y.-C. Lin, and Y.-J. Chang Flavonoids Inhibit Tumor Necrosis Factor-{alpha}-Induced Up-Regulation of Intercellular Adhesion Molecule-1 (ICAM-1) in Respiratory Epithelial Cells through Activator Protein-1 and Nuclear Factor-{kappa}B: Structure-Activity Relationships Mol. Pharmacol., September 1, 2004; 66(3): 683 - 693. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Tskvitaria-Fuller, A. L. Rozelle, H. L. Yin, and C. Wulfing Regulation of Sustained Actin Dynamics by the TCR and Costimulation as a Mechanism of Receptor Localization J. Immunol., September 1, 2003; 171(5): 2287 - 2295. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gardby, J. Wrammert, K. Schon, L. Ekman, T. Leanderson, and N. Lycke Strong Differential Regulation of Serum and Mucosal IgA Responses as Revealed in CD28-Deficient Mice Using Cholera Toxin Adjuvant J. Immunol., January 1, 2003; 170(1): 55 - 63. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chirathaworn, J. E. Kohlmeier, S. A. Tibbetts, L. M. Rumsey, M. A. Chan, and S. H. Benedict Stimulation Through Intercellular Adhesion Molecule-1 Provides a Second Signal for T Cell Activation J. Immunol., June 1, 2002; 168(11): 5530 - 5537. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bertry-Coussot, B. Lucas, C. Danel, L. Halbwachs-Mecarelli, J.-F. Bach, L. Chatenoud, and P. Lemarchand Long-Term Reversal of Established Autoimmunity upon Transient Blockade of the LFA-1/Intercellular Adhesion Molecule-1 Pathway J. Immunol., April 1, 2002; 168(7): 3641 - 3648. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Smits, E. C. de Jong, J. H. N. Schuitemaker, T. B. H. Geijtenbeek, Y. van Kooyk, M. L. Kapsenberg, and E. A. Wierenga Intercellular Adhesion Molecule-1/LFA-1 Ligation Favors Human Th1 Development J. Immunol., February 15, 2002; 168(4): 1710 - 1716. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sirim, L. Zeitlmann, B. Kellersch, C. S. Falk, D. J. Schendel, and W. Kolanus Calcium Signaling through the beta 2-Cytoplasmic Domain of LFA-1 Requires Intracellular Elements of the T Cell Receptor Complex J. Biol. Chem., November 9, 2001; 276(46): 42945 - 42956. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Abraham and J. Miller Molecular Mechanisms of IL-2 Gene Regulation Following Costimulation Through LFA-1 J. Immunol., November 1, 2001; 167(9): 5193 - 5201. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bechard, A. Scherpereel, H. Hammad, T. Gentina, A. Tsicopoulos, M. Aumercier, J. Pestel, J.-P. Dessaint, A.-B. Tonnel, and P. Lassalle Human Endothelial-Cell Specific Molecule-1 Binds Directly to the Integrin CD11a/CD18 (LFA-1) and Blocks Binding to Intercellular Adhesion Molecule-1 J. Immunol., September 15, 2001; 167(6): 3099 - 3106. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Palmer, L. Farrokh-Siar, J. Maguire van Seventer, and G. A. van Seventer IL-12 Decreases Activation-Induced Cell Death in Human Naive Th Cells Costimulated by Intercellular Adhesion Molecule-1. I. IL-12 Alters Caspase Processing and Inhibits Enzyme Function J. Immunol., July 15, 2001; 167(2): 749 - 758. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-T. Ni, M. J. Deeths, and M. F. Mescher LFA-1-Mediated Costimulation of CD8+ T Cell Proliferation Requires Phosphatidylinositol 3-Kinase Activity J. Immunol., June 1, 2001; 166(11): 6523 - 6529. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Gaglia, E. A. Greenfield, A. Mattoo, A. H. Sharpe, G. J. Freeman, and V. K. Kuchroo Intercellular Adhesion Molecule 1 Is Critical for Activation of CD28-Deficient T Cells J. Immunol., December 1, 2000; 165(11): 6091 - 6098. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Maeda, M. Towatari, H. Kosugi, and H. Saito Up-regulation of costimulatory/adhesion molecules by histone deacetylase inhibitors in acute myeloid leukemia cells Blood, December 1, 2000; 96(12): 3847 - 3856. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Jelley-Gibbs, N. M. Lepak, M. Yen, and S. L. Swain Two Distinct Stages in the Transition from Naive CD4 T Cells to Effectors, Early Antigen-Dependent and Late Cytokine-Driven Expansion and Differentiation J. Immunol., November 1, 2000; 165(9): 5017 - 5026. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Jenks and J. Miller Inhibition of IL-4 Responses After T Cell Priming in the Context of LFA-1 Costimulation Is Not Reversed by Restimulation in the Presence of CD28 Costimulation J. Immunol., January 1, 2000; 164(1): 72 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-M. Dosch, R. K. Cheung, W. Karges, M. Pietropaolo, and D. J. Becker Persistent T Cell Anergy in Human Type 1 Diabetes J. Immunol., December 15, 1999; 163(12): 6933 - 6940. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Liwski and T. D. G. Lee Nematode Infection Enhances Survival of Activated T Cells by Modulating Accessory Cell Function J. Immunol., November 1, 1999; 163(9): 5005 - 5012. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bertolino, M.-C. Trescol-Biemont, J. Thomas, B. F. de St Groth, M. Pihlgren, J. Marvel, and C. Rabourdin-Combe Death by neglect as a deletional mechanism of peripheral tolerance Int. Immunol., August 1, 1999; 11(8): 1225 - 1238. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-T. Ni, M. J. Deeths, W. Li, D. L. Mueller, and M. F. Mescher Signaling Pathways Activated by Leukocyte Function-Associated Ag-1-Dependent Costimulation J. Immunol., May 1, 1999; 162(9): 5183 - 5189. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Abraham, J. Griffith, and J. Miller The Dependence for Leukocyte Function-Associated Antigen-1/ICAM-1 Interactions in T Cell Activation Cannot Be Overcome by Expression of High Density TCR Ligand J. Immunol., April 15, 1999; 162(8): 4399 - 4405. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Sedwick, M. M. Morgan, L. Jusino, J. L. Cannon, J. Miller, and J. K. Burkhardt TCR, LFA-1, and CD28 Play Unique and Complementary Roles in Signaling T Cell Cytoskeletal Reorganization J. Immunol., February 1, 1999; 162(3): 1367 - 1375. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Ragazzo, M. E. Ozaki, L. Karlsson, P. A. Peterson, and S. R. Webb Costimulation via lymphocyte function-associated antigen 1 in the absence of CD28 ligation promotes anergy of naive CD4+ T cells PNAS, January 2, 2001; 98(1): 241 - 246. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |