The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zuckerman, L. A.
Right arrow Articles by Miller, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zuckerman, L. A.
Right arrow Articles by Miller, J.
The Journal of Immunology, 1998, 160: 3259-3268.
Copyright © 1998 by The American Association of Immunologists

Functional Consequences of Costimulation by ICAM-1 on IL-2 Gene Expression and T Cell Activation1

Linda A. Zuckerman*,{dagger}, Lara Pullen{dagger} and Jim Miller2,*,{dagger}

* Committee on Immunology and {dagger} Department of Molecular Genetics and Cell Biology, University of Chicago, Chicago, IL 60637


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LFA-1 is a well-recognized adhesion molecule, but its role in providing costimulatory signals to T cells has remained controversial. We have compared the ability of class II-positive transfectants that do and do not coexpress ICAM-1 (ProAd and ProAd-ICAM) to activate Ag-specific Th1 clones and naive CD4-positive T cells isolated from TCR transgenic mice. Ag presentation by ProAd to Th1 clones can induce calcium-dependent signaling events after engagement of the TCR, as evidenced by the nuclear localization of the transcription factors NF-AT and NF-{kappa}B. Nevertheless, coexpression of ICAM-1 or B7-1 on ProAd is required to induce detectable levels of IL-2 gene expression in either Th1 clones or naive T cells. In Th1 clones, activation by ProAd-ICAM induces very transient IL-2 mRNA expression that does not result in detectable IL-2 secretion or T cell proliferation. In naive T cells, the duration of IL-2 mRNA expression is longer, allowing for a transient burst of IL-2 protein that is sufficient to drive the cells into the cell cycle. In spite of this initial response, Ag presentation by ProAd-ICAM is a tolerogenic signal to naive T cells, and responding T cells undergo apoptosis 4 to 5 days poststimulation. These data suggest that engagement of LFA-1 can provide sufficient costimulatory signals to induce T cell activation and IL-2 gene expression, but cannot protect against anergy induction or provide for T cell survival.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The surface of an APC contains accessory molecules that seem to be critical for the initiation of a T cell response (for review, see 1 . These accessory molecules serve as ligands for receptors on the surface of T cells and provide two important functions: they provide adhesion to allow for the formation of stable T cell:APC conjugates, and they can provide discrete signals that work in concert with the TCR-signaling apparatus to promote T cell activation and differentiation (costimulation). All proteins that interact between the two cells will provide some contribution to intracellular adhesion. In contrast, only a subset of the accessory molecules has been clearly documented to provide effective costimulatory functions. Dissecting the specific contribution of each of these accessory molecules has been compounded by a number of issues, including the plethora of candidate molecules, the apparent functional redundancy of some of these molecules, the ability of some accessory molecules to impart both positive and negative effects under different conditions, the differences in specific requirements of accessory molecules for different subpopulations of T cells, and the relative import of accessory molecules on different readouts of T cell activation.

The best-defined costimulatory molecules are B7-1 and B7-2, which are ligands for CD28 (for review, see 2 . CD28 costimulation has been shown to play an important role in activation of many different T cell populations, to up-regulate expression of IL-2 and other effector molecules, to protect against the induction of T cell anergy, and to provide important survival signals to newly activated T cells. Many other receptor-ligand pairs have also been implicated in provided costimulatory signals to T cells. These include (receptor/ligand): LFA-1/ICAM-13 (3, 4, 5, 6, 7), CD2/CD48 (CD58) (8, 9, 10, 11), CD44/invariant chain-chondroitin sulfate (12), unknown/VAM-1 (13), unknown/heat-stable Ag (14), unknown/CD43 (15, 16), and TNFR/TNF family members such as CD70/CD27 (17, 18), CD40L/CD40 (19), 4-1BB/4-1BBL (20, 21), OX-40/OX-40L (22), and CD30/CD30L (23). However, none of these molecules induces all of the functions associated with CD28 signaling; each has some restriction either on the population of T cells that respond or on the specific activation events that can be induced. Nevertheless, the emerging view is that T cells encounter many different accessory molecules during interactions with different APC at different stages of T cell development and differentiation.

One of the important accessory molecules that mediates adhesion between T cells and APC is LFA-1. Adhesion mediated through LFA-1 is highly regulated during T cell activation through two distinct mechanisms (24, 25). First, LFA-1 undergoes a conformational change that has a higher affinity for ICAM-1 (26). Second, LFA-1 undergoes a signal-dependent release and reassociation with the cytoskeleton that results in LFA-1 clustering and a corresponding increase in avidity for ICAM-1 binding (27, 28). In addition to its role in adhesion, LFA-1 has been implicated in providing costimulation (3, 4) and in signal transduction (29, 30, 31). However, the relative importance of LFA-1 as a signaling molecule has been controversial, in part because in some studies it has been difficult to distinguish between direct effects on T cell signaling and indirect effects mediated through intercellular adhesion (32, 33, 34). For example, costimulation through CD28 can be provided on a surface separate from the TCR stimulus, an observation that has been used to argue that CD28 can transduce an independent signal to T cells. In contrast, although costimulation through ICAM-1/LFA-1 interactions has been shown to function in a similar fashion in some studies (5, 7), this has not generally been the case (32, 34) (L. P. and J. M., unpublished observation). Thus, it remains unclear whether ICAM-1/LFA-1 interactions are mediating their effect on T cell activation entirely through adhesion or through a combination of adhesion and costimulation. In addition, unlike costimulation by CD28, the ability of LFA-1 to costimulate T cells is restricted to a subset of T cells. For example, LFA-1 engagement appears to have a selective, functional effect on naive T cells and a limited, if any, effect on activated T cells (5, 6, 7, 13, 35).

In this study, we have compared the ability of ICAM-1/LFA-1 interactions to provide costimulation to naive T cells and to Th1 clones. In previous studies, we had found that Ag presentation by class II-positive, ICAM-1-positive transfectants does not induce Th1 T cell proliferation and rather induces T cell anergy (13). In this study, we have found that the same transfectants do induce proliferation from naive CD4-positive T cells, but, as in the Th1 clones, this is a tolerogenic signal, because these naive T cells ultimately die of apoptosis. Interestingly, the ability of ICAM-1 transfectants to selectively activate naive T cells does not appear to be a difference in the ability of naive T cells and Th1 clones to respond to LFA-1-mediated costimulation, but rather a difference in the kinetics of IL-2 gene expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells

A panel of transfectants in the fibrosarcoma, 6132A-PRO (Pro), expressing I-Ad alone or in combination with B7-1 or ICAM-1 (13) and the murine CD4-positive Th1 T cell clone, pGL2 (36), has been described. All cell lines were maintained in DMEM supplemented with 10% FCS, 2 mM glutamine, 0.1 mM nonessential amino acids, 40 µg/ml gentamicin, and 50 µM 2-ME. G418 (200 µg/ml) and/or MXH (250 µg/ml xanthine, 15 µg/ml hypoxanthine, and 6 µg/ml mycophenolic acid) were added to the culture media for maintenance of the transfectants. The pGL2 cells were maintained by weekly passage with irradiated BALB/cJ splenocytes, 400 µg/ml OVA, 10 to 20 U/ml human rIL-2, and 200 U/ml rIFN-{gamma}. CD4-positive T cells were purified from lymph nodes of DO11.10 TCR transgenic mice (37, 38) by negative selection. Class II-positive cells (using a mixture of mAbs M5/114, 25-9-17, and 3JP) and CD8-positive T cells (using mAb 2.43) were depleted by complement lysis (1/10 dilution of guinea pig complement from Accurate Chemical, Westbury, NY), followed by an equal number of sheep anti-mouse- and sheep anti-rat-coated M450 Dynal magnetic beads (Dynal, Oslo, Norway). Purity of CD4-positive T cells was determined by flow cytometry and/or by the lack of proliferation to 10 µg/ml Con A (Sigma Chemical, St. Louis, MO).

Flow cytometry

The transfectants were monitored for class II expression by binding to the Ab MKD6 (American Type Culture Collection (ATCC), Rockville, MD), ICAM-1 expression by binding to the Ab YN-1.7.1 (ATCC), and B7-1 by binding to CTLA4Ig (Repligen, Cambridge, MA). Indirect immunofluorescence was performed with the appropriate FITC-coupled secondary Ab. CD4-positive lymph node T cells were analyzed for expression of the TCR transgene using the clonotypic mAb, KJ1-26 (39), generously provided by Dr. P. Marrack (National Jewish Center, Denver, CO), and for CD4, CD69, CD44, and CD25 (PharMingen, San Diego, CA). We have confirmed that the majority (90–95%) of the transgenic TCR-positive cells from the DO11.10 transgenic mice have the cell surface phenotype of naive T cells (Ref. 37 and data not shown).

T cell assays

For T cell proliferation, 5 x 104 T cells were incubated with 5 x 104 mitomycin C-treated transfectants and various concentrations of Ag in a flat-bottom 96-well plate for 36 to 48 h. [3H]Thymidine was added to the cultures for an additional 18 h before wells were harvested. Cytokine production was determined by capture ELISA (PharMingen) from supernatants harvested from 24-well plates containing 3 x 105 CD4-positive lymph node T cells, 2.5 x 105 transfectants, and varying concentrations of Ag. In most experiments, Ag was a synthetic peptide corresponding to amino acids 323–339 from chicken OVA. In some experiments, a tryptic digest of chicken OVA was used.

DAPI staining

CD4-positive lymph node T cells (0.3–0.5 x 106) were incubated in 24-well plates with an equal number of transfectants for 3, 4, or 5 days. After this incubation, cells were harvested and spun down and resuspended in 100 µl of PBS or complete media. Aliquots of cells (30 µl) were mixed with 10 µl of DAPI (4',6-diamidino-2-phenylindole; Sigma Chemical) at 1 µg/ml in PBT (PBS containing 1% Triton X-100). The cells were viewed by fluorescence microscopy using an Olympus BX-40 microscope with a 100-W Mercury lamp, a x40 Fluorite objective, N.A. 0.75 (Leco #1-UB527), and a UV filter cube (ex 330–385 nm em 420 nm wide band pass, Leco #U-M536). Images were photographed using an Optronics cooled low-light video camera (Leco #DEI-470TB) with a x2 coupler (Leco #HR200-CMT) and printed on a Sony UP 1800 MD printer.

Western blot analysis

To assay for the presence of Bcl-XL, 2.5 to 10 x 106 purified CD4-positive lymph node T cells were incubated with 10 x 106 transfectants overnight in the presence and absence of Ag. Cells were harvested and lysates were prepared, as previously described (40). Briefly, cells were lysed with NET-N (100 mM NaCl, 1 mM EDTA, 20 mM Tris-HCl (pH 8), and 0.2% Nonidet P-40), nuclei were pelleted, and the supernatants were adjusted to 2% SDS, boiled, and loaded onto 12.5 polyacrylamide gels for electrophoresis. Proteins were transferred for at least 5 h at 150 mA to nitrocellulose for blotting. Blots were blocked for at least 3 h in 5% nonfat milk with 0.1% Tween and developed with rabbit antisera or mAb ascites directed against Bcl-XL (kindly provided by Dr. Craig Thompson, University of Chicago, Chicago, IL). Western blots were developed using enhanced chemiluminescence (Amersham, Arlington, Heights, IL).

cDNA and RT-PCR assays

Th1 clones or naive CD4-positive lymph node T cells (2.5 x 106) were stimulated with an equal number of transfectants in the presence or absence of peptide Ag. RNA was isolated using 1 ml of TRIzol reagent (Life Technologies, Gaithersburg, MD), and an aliquot of the RNA was electrophoresed on a 1% agarose/formaldehyde gel to determine quality and estimate quantity, as determined by ETBr staining of the 28S and 18S ribosomal RNA bands. Three to five micrograms of the extracted RNA were utilized to make cDNA using random hexamer primers and Superscript II reverse transcriptase (Life Technologies). The resulting cDNA was diluted 1/5 before use in PCR reactions. PCR was conducted essentially as described (41). Briefly, 1 to 5 µl of diluted cDNA was added to a 100 µl reaction mixture containing 10 mM Tris-HCl, 1.5 mM MgCl2, 50 mM KCl, pH 8.3, 0.4 µM sense and antisense primers, 0.1 mM dNTPs, and 2.5 U Taq polymerase (Boehringer Mannheim, Indianapolis, IN). In most experiments, a control cDNA was added to the reaction as a positive control for the PCR reactions. Cycling conditions were 94°C for 45 s, 60°C for 15 s, and 72°C for 45 s. The total number of cycles was 41. The resulting product was electrophoresed on a 2.5% agarose gel and stained with ethidium bromide. The quantity of hypoxanthine phosphoribosyltransferase (HPRT) PCR product in different samples was used to normalize the samples for equivalent amounts of cDNA. The HPRT reactions were done in the presence of a competitor cDNA to ensure linear amplification of PCR products (41). In some experiments, samples were also normalized to the amount of CD3{delta} mRNA to ensure that equivalent amounts of T cell cDNA were assayed.

Nuclear extracts and gel shifts

Th1 clones were stimulated with Ag presented by Pro transfectants for 6 h. During this time, the majority of the transfected cells are lysed by the cytolytic Th1 cells (42), and the activated T cells have adhered to the plastic dish. Remaining transfectants were washed away and the T cells were briefly trypsinized before harvesting for assays. Only experiments that had greater than 75% recovery of total input T cells were considered for further analysis. The extracts themselves were made according to McCormick et al. (43) with few differences. Upon harvesting, the cells were resuspended at 2.5 x 108/ml in 10 mM HEPES, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, and 0.5 mM PMSF, and the cells were lysed by the addition of 0.1% Nonidet P-40 for 15 min at 4°C. The nuclei were collected by centrifugation and extracted at 109 cell equivalents/ml in 20 mM HEPES, 1.5 mM MgCl2, 520 mM NaCl, 0.1 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, 0.1% Nonidet P-40, and 25% glycerol for 30 min at 4°C. Cellular debris was pelleted, and supernatants were frozen and stored at -80°C. Protein was quantitated in nuclear extracts using the Bio-Rad (Richmond, CA) protein assay, and equivalent amounts of protein (5–10 µg) were used for each assay condition. The binding reactions were performed as previously described (44, 45). Between 5 and 10 µg of protein was used per reaction in a buffer containing 10 mM Tris (pH 7.5), 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 5% glycerol, and 4 µg poly(dI:dC) (Pharmacia, Piscataway, NJ). The reactions were incubated at room temperature for approximately 15 min with 10,000 cpm double-stranded 32P-labeled oligonucleotides. After the binding reactions, the samples were subsequently electrophoresed on 4% polyacrylamide gels in the following buffer: 25 mM Tris, 190 mM glycine, and 1 mM EDTA. The oligonucleotides used in these studies were taken from the murine IL-2 gene (the 5'TT was added to the OCT site to increase radiolabeling) and were monomers of the binding sites: NF-AT (GCCCAAAGAGGAAAATTTGTTTCATACAG), OCT-1/2 (TTTATGTAAAACATCGTG), and NF-{kappa}B (AGAGGGATTTCACCTAAATCC).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Costimulation through either B7-1 or ICAM-1 results in Ag-specific thymidine incorporation by naive CD4-positive T cells, but not Th1 clones

To determine whether costimulation through interaction of ICAM-1 and LFA-1 mediated distinct effects in naive T cells and Th1 clones, we assayed the ability of class II-positive transfectants in the costimulation-negative tumor cell line (6132A-PRO) that do and do not coexpress ICAM-1 or B7-1 to activate T cells (13). As predicted from their lack of detectable expression of costimulatory molecules, class II-positive transfectants (ProAd) do not stimulate Th1 T cell clones (Fig. 1GoA) or naive CD4-positive T cells, purified from the lymph nodes of DO11.10 TCR transgenic mice (Fig. 1GoB). As a positive control, Ag presentation by ProAd supertransfected with B7-1 (ProAd-B7) results in efficient activation of both naive T cells and Th1 clones (Fig. 1Go). In contrast, Ag presentation by ProAd cells supertransfected with ICAM-1 (ProAd-ICAM) does not induce proliferation of Th1 clones, but does stimulate proliferation of naive T cells (proliferation in this case is measured by [3H]thymidine incorporation, but see below). Ab blocking confirmed that ICAM-1 was mediating this effect through interaction with LFA-1 (data not shown). Thus, consistent with previous results (6, 7, 13), B7-1, but not ICAM-1, can function as a costimulatory molecule for previously activated T cells and for Th1 T cell clones. In contrast, Ag presentation in the context of either B7-1 or ICAM-1 is capable of stimulating entry of naive T cells into the cell cycle.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 1. Costimulation through either B7-1 or ICAM-1 can induce proliferation of naive CD4-positive T cells. ProAd (triangles), ProAd-ICAM (squares), or ProAd-B7 (circles) were cocultured with the Th1 T cell clone, pGL2 (A), or with CD4-positive lymph node T cells purified from DO11.10 TCR transgenic mice (B) in the presence of varying concentrations of OVA peptide for 48 h. Thymidine incorporation was measured during the last 18 h of the assay. Data are represented as cpm x 10-3. Similar results on the ability of the Pro transfectants to activate Th1 clones have been published (13) and are shown here for comparison.

 
Activation of naive CD4-positive T cells following Ag presentation by ProAd-ICAM leads to cell death, rather than clonal expansion

Although in some experiments Ag presentation by ProAd-ICAM and ProAd-B7 induced similar levels of thymidine incorporation in naive T cells, in most cases Ag presentation by ProAd-ICAM was less efficient than ProAd-B7 (See Fig. 1GoB). The reduced responses are not due to reduced numbers of responding T cells, because both ProAd-B7 and ProAd-ICAM activated the majority of the cells in the culture and induced similar levels of the T cell activation markers, CD44 and CD69 (Table IGo). Likewise, propidium iodide staining indicated that similar numbers of T cells were driven into cell cycle in cultures stimulated with ProAdB7-1 and ProAd-ICAM (data not shown). Reduced proliferation following Ag presentation by ProAd-ICAM did correlate with a 10-fold decrease in IL-2 production compared with ProAd-B7 (Fig. 2Go). This low level of IL-2 probably accounts for the reduced expression of CD25 (Table IGo) in the cultures stimulated by ProAd-ICAM, as addition of 50 to 100 U/ml of exogenous IL-2 up-regulated the level of CD25 expression to that seen in cultures stimulated with ProAdB7-1. In contrast, addition of exogenous IL-2 to cultures stimulated with ProAd-ICAM did not compensate for the difference in proliferation compared with T cells stimulated with ProAd-B7 (data not shown). Taken together, these data indicate that costimulation through ICAM-1 can activate naive T cells, but this activation is suboptimal, as evidenced both by reduced cytokine production and reduced proliferation in the presence of excess IL-2.


View this table:
[in this window]
[in a new window]
 
Table I. Costimulation with either B7-1 or ICAM-1 up-regulates T cell activation markers

 


View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 2. Costimulation through B7-1 or ICAM-1 can induce IL-2 secretion from naive CD4+ T cells. ProAd (triangles), ProAd-ICAM (squares), or ProAd-B7 (circles) were cocultured with CD4-positive lymph node T cells purified from DO11.10 TCR transgenic mice in the presence of varying concentrations of OVA peptide. A, [3H]Thymidine incorporation is shown as in Figure 1Go for comparison for 48 h. B, Culture supernatant was removed at various times from the T cells stimulated with 20 µg/ml OVA peptide, and assayed for IL-2 by capture ELISA. C, Culture supernatant was removed on day 3 from T cells stimulated with various concentrations of OVA peptide and assayed for IL-2 by capture ELISA.

 
The inability of ProAd-ICAM to fully activate naive T cells is most dramatically seen when cells are recovered from culture. T cells stimulated with Ag presented by ProAd rapidly die within 1 to 2 days. In contrast, T cells stimulated with ProAd-ICAM and ProAd-B7 equivalently undergo blastogenesis and entry into the cell cycle. However, 3 to 5 days following stimulation, cultures stimulated with ProAd-B7 begin to expand, while T cells stimulated with ProAd-ICAM undergo a rapid demise, and by day 7, no viable cells are recoverable (Fig. 3Go). This is illustrated by staining T cells with the nuclear stain, DAPI. After 3 days, T cells stimulated with ProAd-B7 and ProAd-ICAM are indistinguishable; both populations have similar cell number, and the cells appear to be healthy (Fig. 4Go). In contrast, after 5 days, T cells stimulated with ProAd-B7 remain intact, while T cells stimulated with ProAd-ICAM have condensed and fragmented nuclei, characteristic of cells undergoing apoptosis (Fig. 4Go).



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 3. Naive CD4-positive T cells do not clonally expand following Ag presentation by ProAd-ICAM cells. CD4-positive T cells purified from the DO11.10 TCR Tg mouse were cocultured with an equal number of ProAd-ICAM (squares) or ProAd-B7 (circles) in the presence of Ag, and the number of viable cells in the well was determined by trypan blue exclusion at various times after initiation of culture. A, 1 x 106 T cells were stimulated with 50 µg/ml tryptic digest of OVA (equivalent to 2 µg/ml OVA peptide); B, 0.3 x 106 T cells were stimulated with 2 µg/ml OVA peptide without (open symbols) and with (filled symbols) 100 U/ml rIL-2.

 


View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 4. Naive CD4-positive T cells undergo apoptosis on day 5 following Ag presentation by ProAd-ICAM cells. ProAd-ICAM (left panels) or ProAd-B7 (right panels) was cocultured with an equal number of CD4-positive T cells purified from the DO11.10 TCR Tg mouse in the presence of 20 µg/ml OVA peptide for 3 days (top panels) or 5 days (bottom panels), after which the cells were harvested and stained with the nuclear stain DAPI for the presence of apoptotic nuclei. The T cells remain viable 3 days following Ag presentation by ProAd-B7 or ProAd-ICAM transfectants, but by day 5, many apoptotic cells are visible in the cultures stimulated with ProAd-ICAM. Shown are representative fields at x40 magnification.

 
A number of factors have been implicated in promoting T cell survival, including IL-2 (46, 47, 48) and other cytokines and members of the Bcl-2 family, especially Bcl-XL (40). Addition of 50 to 100 U/ml of exogenous IL-2 to naive T cells stimulated with ProAd-ICAM can provide some T cell survival, but does not provide for clonal expansion (Fig. 3GoB). Addition of excess IL-2 to cultures stimulated with ProAd-B7 does not enhance clonal expansion, indicating that IL-2 is not limiting in these cultures. We do not know whether the increased number of T cells in the cultures stimulated with ProAd-ICAM with exogenous IL-2 results from increased survival of individual cells or a shift in the balance of cell division and cell death. Nevertheless, this finding suggests that other factors independent of reduced IL-2 production are required to protect activated naive T cells from cell death. Consistent with this idea, we found that while ProAd-B7-stimulated T cells induced increased levels of Bcl-XL, ProAd-ICAM-stimulated T cells did not (Fig. 5Go). Together these data suggest that Ag presentation in the presence of ICAM-1 and the absence of B7 can induce T cell activation and entry into the cell cycle, but this stimulation leads to T cell death rather than clonal expansion.



View larger version (68K):
[in this window]
[in a new window]
 
FIGURE 5. ProAd-B7, and not ProAd-ICAM, induces Bcl-XL in naive CD4+ T cells. Naive CD4-positive T cells (2.5 x 106 in A, and 10 x 106 in B) were stimulated with 20 µg/ml OVA peptide presented by 10 x 106 transfectants for 24 h. Cytoplasmic lysates were analyzed by Western blot for the induction of Bcl-XL using polyclonal antisera in A and a mAb in B. As controls, lysates from ProAd-B7 cells in the absence of T cells (APC alone) and T cells cultured with ProAd-B7 in the absence of Ag were analyzed in parallel in B. The positions of m.w. markers and of Bcl-XL (arrow) are indicated.

 
Costimulation through ICAM-1 induces IL-2 transcription, but not accumulation of IL-2 mRNA

The ability of ProAd-ICAM transfectants to induce IL-2 production and proliferation in naive T cells, but not Th1 clones, raised the possibility that costimulation by ICAM-1 had a different effect on IL-2 gene regulation in these T cell populations. To test this possibility, we assayed for IL-2 gene expression by RT-PCR. Naive T cells stimulated with either ProAd-ICAM and ProAd-B7, but not ProAd, induced readily detectable levels of IL-2 mRNA by 2 to 3 h after stimulation (Fig. 6Go, A–C). IL-2 mRNA continued to accumulate in the naive T cells stimulated by ProAd-B7 and was still present at maximum levels at 24 h (data not shown). However, after 3 h, IL-2 mRNA decreased in the ProAd-ICAM-stimulated T cells and was undetectable by 6 h. This pattern of expression is consistent with the level of functional IL-2 protein secreted in these cultures (see above).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. Kinetics of IL-2 mRNA induction in naive CD4-positive T cells. ProAd (A), ProAd-ICAM (B), or ProAd-B7 (C) were cocultured with CD4-positive T cells from the DO11.10 TCR Tg in the presence of 20 µg/ml OVA peptide for the indicated times. Cultures were harvested, and total mRNA was extracted and assayed for IL-2 gene expression by RT-PCR analysis. The top band in the ETBr-stained gel is the product derived from the control plasmid (C), and the bottom band is the wild-type IL-2 gene product (IL-2).

 
Interestingly, a small, but detectable, burst of IL-2 mRNA is also seen in Th1 clones stimulated with ProAd-ICAM at 2 h (Fig. 7GoA). In comparison, ProAd-B7-stimulated T cell clones induced much higher levels of IL-2 mRNA at 2 h, and the message was detectable for up to 7 h poststimulation (Fig. 7GoB). To enhance the low level of IL-2 mRNA detected, we added the protein synthesis inhibitor, cycloheximide, to the T cell activation cultures. Cycloheximide-mediated superinduction of gene expression has been attributed both to transcriptional and posttranscriptional events and can dramatically increase the level of cytokine mRNA (49, 50, 51, 52, 53, 54). The low level of IL-2 mRNA expressed in Th1 clones (Fig. 7GoC) and in naive T cells (data not shown) following stimulation by ProAd-ICAM was increased significantly by superinduction with cycloheximide. In contrast, addition of cycloheximide had no effect on IL-2 mRNA levels following presentation by ProAd-B7 (Fig. 7GoD), and, notably, did not reveal IL-2 mRNA expression in ProAd-stimulated Th1 clones (Fig. 7GoC) or naive T cells (data not shown). Thus, it appears that costimulation through ICAM-1/LFA-1 interactions can initiate IL-2 transcription in both naive T cells and Th1 clones; however, only the naive T cells accumulate enough mRNA to produce functional levels of IL-2 protein that are sufficient to induce T cell proliferation.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 7. Kinetics of IL-2 mRNA induction in the Th1 clone, pGL2. A and B, ProAd-ICAM (A) or ProAd-B7 (B) transfectants were cocultured with an equal number of pGL2 in the presence of 20 µg/ml OVA peptide for the indicated times. C, ProAd, ProAd-ICAM, and ProAd-B7 were cocultured with pGL2 in the presence or absence of 20 µg/ml OVA peptide. As indicated, CHX at 100 µg/ml (+) or at 500 µg/ml (++) was added at 2 h and the cultures were harvested at 4 h. D, ProAd-B7 was cocultured with pGL2 with 20 µg/ml of OVA peptide, and CHX was or was not added at 2 h and the cultures were harvested at 4 h. In all cases, total mRNA was extracted at the end of the culture and assayed for IL-2 gene expression by RT-PCR analysis. The top band in the ETBr-stained gel is product from the control plasmid (C); the bottom band is from the wild-type IL-2 product (IL-2). Note that there was no control plasmid in the reactions shown in A and B.

 
Ag presentation by ProAd does induce TCR-mediated signal transduction in Th1 clones

Two possible explanations can account for the ability of ProAd-ICAM, but not ProAd, to induce T cells to produce IL-2 mRNA: 1) ICAM-1/LFA-1 interactions function through intracellular adhesion and stabilization of T cell:APC conjugates, allowing more efficient TCR signaling; 2) ICAM-1/LFA-1 interactions function through costimulation, modulating the nature of T cell signaling. The failure to detect IL-2 mRNA following Ag presentation by ProAd even in the presence of cycloheximide suggests that TCR ligation alone is not sufficient to induce IL-2 gene expression (see Fig. 7Go). However, these data do not indicate whether the TCR was engaged following Ag presentation by ProAd. Previous studies had shown that Ag presentation by ProAd to Th1 clones results in the induction of T cell anergy, an event that requires TCR occupancy (13). One caveat with the anergy induction studies is that it is possible that the level of TCR signaling that is necessary to induce anergy may be significantly less than that required to induce IL-2 transcription or T cell proliferation (55). To address this possible concern, we used gel-shift analysis to assay the expression of two transcription factors, NF-AT and NF-{kappa}B, which participate in the up-regulation of IL-2 gene expression. NF-AT is composed of a constitutively expressed cytosolic factor that, upon a sustained calcium signal, is translocated to the nucleus (56, 57), where it assembles with a newly synthesized AP-1 family dimer to generate a complete complex (58, 59). In contrast, activation of NF-{kappa}B by displacement of the cytosolic inhibitor I{kappa}B requires a large transient rise in intracellular calcium (57). Thus, expression of these two factors is a stringent assay for effective TCR signaling and the induction of both phases of a calcium response. Resting T cells do not express any NF-AT, and expression of the intact NF-AT complex is equivalently induced following activation by ProAd or ProAd-B7 (Fig. 8Go). Resting T cells express a fast migrating complex with the NF-{kappa}B probe, which most likely represents the p50 homodimer, a negative regulator of IL-2 transcription (60). Stimulation of Th1 cells with either ProAd or ProAd-B7 (Fig. 8Go) induces an equivalent increase in a slower migrating p50/p65 heterodimeric form of NF-{kappa}B that is associated with up-regulation of IL-2 transcription (60). Because OCT-1 is constitutively expressed in pGL2 cells (61), equivalent detection of OCT-1 serves as a control for equivalent amounts of nuclear extracts between samples. To confirm that Ag presentation by ProAd results in sustained signaling in the Th1 cells, nuclear extracts were prepared at different times following T cell activation. As shown in Figure 9Go, Ag presentation by ProAd and ProAd-B7 induces similar levels of NF-AT at 2, 6, and 9 h, and high levels of NF-AT are still detected in nuclear extracts 24 h after stimulation by ProAd and ProAd-B7 (data not shown). These results demonstrate that Ag presentation by ProAd cells does activate Th1 clones, effectively transducing signals through the TCR. This stimulation results in sufficient signals to induce translocation and assembly of transcription factors involved in IL-2 gene transcription, but without inducing detectable levels of IL-2 mRNA. These findings imply that additional signals may be provided through ICAM-1/LFA-1 or B7-1/CD28 interactions that allow for the induction of IL-2 gene expression.



View larger version (67K):
[in this window]
[in a new window]
 
FIGURE 8. Ag presentation by ProAd induces NF-AT and NF-{kappa}B DNA-binding activity. Th1 clones were cocultured with an equal number of ProAd or ProAd-B7 cells in the presence of 100 µg/ml tryptic digest of OVA (equivalent to 4 µg/ml OVA peptide) for 6 h. Gel mobility shift assays were performed on nuclear extracts with the following probes, NF-AT, NF-{kappa}B, and OCT-1. Free probe indicates the mobility of the probe in the absence of any protein. Resting pGL2 cells were not stimulated with Ag and APC. Similar results were obtained using ProAd-ICAM cells as APC. Interestingly, we did not observe OCT-2 induction even with ProAd-B7 stimulation, although pGL2 cells do induce OCT-2 following activation by conventional APC (61). Although OCT-2 is not necessary for IL-2 gene transcription (104), these data suggest that some other signaling event, not provided by Pro cell transfectants, is necessary for induction of this transcription factor in T cells. Note that in this experiment fivefold less Ag was used than in the IL-2 mRNA analyses shown in Figures 6Go and 7Go.

 


View larger version (81K):
[in this window]
[in a new window]
 
FIGURE 9. Kinetics of NF-AT induction. The presence of NF-AT in nuclear extracts was detected at various times following Ag presentation by ProAd and ProAd-B7 with 50 µg/ml tryptic digest of OVA (equivalent to 2 µg/ml OVA peptide). In this experiment, T cells and APC were not separated before cell lysis, and nuclear extracts from ProAd in the absence of T cells (APC alone) were analyzed in parallel. The position of the NF-AT/DNA complex and the free probe is indicated on the right.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this work, we have shown that Ag presentation in the context of ICAM-1 and the absence of B7 can induce naive T cell activation, as evidenced by up-regulation of activation markers, induction of IL-2 transcription, and entry into the cell cycle. However, this activation does not appear to be complete; IL-2 mRNA does not accumulate, and [3H]thymidine incorporation in the face of activation of the entire T cell population is reduced. Furthermore, naive T cells stimulated by ProAd-ICAM cells ultimately die of apoptosis. Interestingly, Ag presentation in the context of ICAM-1 can result in the induction of IL-2 gene transcription from both naive CD4-positive T cells and Th1 clones. In the Th1 clones, IL-2 mRNA does not accumulate to sufficient quantities to induce detectable levels of IL-2 protein. The subsequent failure to secrete IL-2 and to drive proliferation may account for the induction of anergy in Th1 clones following Ag presentation by ProAd-ICAM cells (13, 62). In contrast, naive T cells stimulated with ProAd-ICAM induce IL-2 mRNA, which is present for at least 5 h. This short burst of IL-2 mRNA allows for the secretion of functional levels of IL-2 protein that are sufficient to induce naive T cells to enter the cell cycle. These differences in the temporal regulation of the IL-2 message expression may account for the different biologic responses observed between naive T cells and Th1 clones following costimulation through LFA-1/ICAM-1 interactions.

One issue that has been difficult to resolve is whether the ability of ICAM-1/LFA-1 interactions to enhance T cell activation is mediated through intracellular adhesion, allowing for more efficient TCR signaling, or through LFA-1-linked signaling events that work in concert with TCR signals. Studies that have attempted to measure the adhesive contributions of ICAM-1/LFA-1 interactions to T cell stimulation have suggested that this enhanced intracellular adhesion can contribute to a one to two log shift in the Ag dose response (32). In our experiments, this approaches the limit of detection between Ag presentation to naive T cells by ProAd and ProAd-ICAM: typically a minimum of 100-fold shift in the dose response (see Fig. 1Go). One concern with the naive T cells is that we have no indication that ProAd engages the T cells; the cells do not transcribe IL-2 mRNA, proliferate, nor induce cell surface activation markers. However, there is clear data that ProAd can form functional conjugates with Th1 clones. Stimulation of pGL2 cells with ProAd induces T cell anergy (13) and normal levels of NF-AT and NF-{kappa}B, two transcription factors that regulate IL-2 gene expression (see Fig. 8Go). Nevertheless, we cannot detect any IL-2 mRNA produced in pGL2 cells stimulated with ProAd cells, even following superinduction with cycloheximide. Thus, although ProAd cells can form functional conjugates with Th1 cells and effectively trigger the TCR, they do not stimulate IL-2 transcription. The ability of ProAd-ICAM to induce IL-2 transcription suggests that engagement of LFA-1 may provide additional signals that are not mediated through TCR engagement alone.

IL-2 gene expression is regulated in many ways, including sequestration of tissue-specific transcription factors in the cytoplasm (63), up-regulation of transcription factor expression (64, 65, 66, 67), cooperative binding of transcription factors to the IL-2 promoter/enhancer region (68), transcriptional elongation (69), mRNA stabilization (70), and translational control (53). In this study, we have shown that TCR signaling following Ag presentation by ProAd in the absence of costimulation cells results in the translocation and assembly of NF-AT and NF-{kappa}B transcription factors. However, these events are not sufficient to induce detectable levels of IL-2 mRNA expression. The failure to detect IL-2 gene expression following TCR engagement differs from the prevailing view that TCR signaling in the absence of costimulation is sufficient to induce IL-2 transcription (71). For example, anti-CD3 has been shown to fully induce IL-2 transcription in T cell clones, as assayed through the use of reporter constructs and transcription factor induction (69, 72), and this level of transcription was not further increased when the Th1 cells were stimulated in the presence of anti-CD28 mAbs (69). However, most of the published experiments have utilized T cell tumors, which can differ from normal cells in how they regulate IL-2 gene expression (73), or have stimulated T cells with pharmacologic agents or with Abs as ligands for CD3 or CD28, which can recruit effector molecules that are not induced with natural ligands (74). In contrast, in our studies, we have assayed normal T cells stimulated with natural ligands expressed on the surface of live APC.

Coexpression of either ICAM-1 or B7-1 in the ProAd cells confers the ability to induce IL-2 gene expression, indicating that engagement of LFA-1 or CD28 can provide unique signals of their own that work in concert with TCR signals to up-regulate IL-2 gene transcription. The kinetics of IL-2 mRNA expression, the known ability of CD28 signaling to induce IL-2 mRNA stability (70), the selective superinduction of cycloheximide on ProAd-ICAM-stimulated T cells, and the demonstration that cycloheximide treatment can result in enhanced stabilization of IL-2 mRNA (49) raise the possibility that costimulation through either ICAM-1 or B7-1 induces IL-2 gene transcription, but only B7-1/CD28 interactions induce IL-2 mRNA stability. However, it is also possible that the rapid down-regulation of IL-2 gene expression following Ag presentation by ProAd-ICAM corresponds to the transient induction of a transcription factor, whose continued expression is necessary for sustained IL-2 transcription. Clearly, additional studies are necessary to determine the exact signals relayed through either the TCR or accessory/costimulatory molecules that regulate IL-2 gene expression.

Over the past decade, it has become clear that integrins play an important role in the regulation of cell growth and differentiation. Integrins were defined originally as adhesion molecules that mediate contact between cells and between cells and the extracellular matrix, but it is now clear that these proteins can function as bone fide cell surface signaling molecules. The importance of integrins as signaling molecules is understood better in nonlymphoid cells, where they play an essential role in interactions with the extracellular matrix through the formation of focal adhesions (for reviews, see Refs. 75–79). This focal adhesion signal is initiated by ligand binding of the integrin receptor, which induces a conformational change releasing the cytosolic domain of the ß-chain from the regulatory sequence of the {alpha}-chain. The activated ß-chain now is free to recruit the cytoskeletal components, {alpha}-actinin, talin, and vinculin and the tyrosine kinase, FAK, to the plasma membrane. This leads to phosphorylation of paxillin and actin polymerization, and through SH2/SH3 domain interactions, FAK can recruit src family kinases, grb2, PI-3-kinase, and other signaling components to the focal contact (80, 81, 82). Both the MAP-kinase and ras downstream signaling pathways can be induced following integrin-mediated cell signaling. In addition, small GTP-binding proteins such as Rho, Rac, and CDC42 have been shown to control the formation of focal adhesion complexes (83), and other integrin-binding proteins, such as cytohesion (84) and integrin-associated kinase (85), can regulate the affinity and/or avidity of integrin/ligand interaction. The focal adhesion therefore represents a large aggregate of receptors, signal-transduction molecules, and structural proteins that can facilitate the activation of signaling pathways and changes in cell-cell or cell-substrate contacts.

The integrin ß-chain is well conserved among most family members, including the LFA-1 ß-chain (ß2). Thus, signaling through LFA-1 could be mediated by a similar complex to that seen in focal contacts. Consistent with this possibility, many of the cytoskeletal proteins that are associated with focal adhesions have been shown to bind to the cytosolic tail of the LFA-1 ß-chain, including talin, {alpha}-actinin, vinculin, and FAK (86, 87, 88). In addition, it has been shown recently that activation of FAK following engagement of ß1 integrins can costimulate IL-2 production in T cells (89). However, to date, only talin and actin have been shown to be recruited to the T cell:APC adhesion complex (90). One difference between signaling through ß1 or ß3 integrins and signaling through LFA-1 is the fate of the activated cells. Integrin signaling in endothelial cells and fibroblasts is associated with an antiapoptotic signal (91), whereas we have shown that Ag presentation by ProAd-ICAM to naive T cells results in T cell death.

It is not clear whether the T cell death we have observed is actively induced by interaction between ICAM-1 and LFA-1 or is the result of the failure to induce essential survival factors. Activation-induced cell death is a well-recognized phenomenon in T cells (92) and is mediated primarily by fas following restimulation of previously activated T cells (93, 94) or TNF (95, 96). Damle et al. (97) has shown that coimmobilization of ICAM-1 with anti-TCR Abs can enhance activation-induced cell death, but it is not clear whether this is mediated by signaling through LFA-1 or by enhanced TCR signaling. In most cases, activation-induced cell death is restricted to previously stimulated T cells and occurs with 24 h of T cell stimulation. The cell death that we have observed differs in that it occurs in naive T cells and takes 4 to 5 days. This is more similar to superantigen-induced cell death in vivo, in which peripheral naive T cells initially proliferate and then die (98, 99). Mice lacking ICAM-1 lose the proliferative phase of this response, but not the cell death phase, suggesting that cell death is not mediated through engagement of LFA-1 (100). However, these studies do not exclude the possibility that LFA-1 interactions with the alternative ligand, ICAM-2, may be important for superantigen-induced cell death. Superantigen-induced cell death is also mediated by fas (93, 94) and/or TNF (95) and is likely to be dependent on persistence of Ag and repeated stimulation of T cells (101). In this regard, the ability to induce cell death in naive T cells is similar to other models of activation-induced cell death, in which the initial exposure to superantigen induces T cell activation and secondary exposures of the now activated T cells lead to cell death (99). This scenario probably does not take place when we stimulate the naive T cells with ProAd-ICAM, because the mitomycin C-treated Pro cell transfectants do not survive in cell culture for more than 1 to 2 days, well before the T cells begin to apoptose.

Alternatively, the ability of ProAd-ICAM to induce T cell death may result from the failure to induce essential survival factors. Our finding that ProAd-B7-stimulated T cells induced increased levels of Bcl-XL, whereas ProAd-ICAM-stimulated T cells did not (see Fig. 5Go), is consistent with this possibility. Bcl-XL is an important T cell survival factor, and its absence has been implicated in the eventual death of activated T cells isolated from CD28-deficient mice (102, 103). Thus, it may be more likely that T cell death following Ag presentation by ProAd-ICAM is by neglect rather than induction by LFA-1 signaling. At present, we cannot distinguish these possibilities on the naive T cells because T cells stimulated by ProAd die rapidly without apparent activation.

Overall, our results underscore the complex role that accessory molecules play in the activation, maintenance, and down-regulation of an immune response. Thus, costimulation may not be merely an on or off event, but rather there may be a spectrum of T cell responses, and each response may depend on constellation of individual accessory molecules and cytokines present in the environment as well as the activation status of the T cell itself. While this spectrum may include easily documented on or off signals, we imagine that the gray area of T cell activation will be important for our understanding of T cell responses and the way in which costimulatory molecules can affect them.


    Acknowledgments
 
We thank Steve Hurst and Terry Barrett for providing the DO11.10 TCR transgenic line; Julie Auger and Marisa Naujokas for help in flow cytometry; Mary Crane for detection of apoptotic cells by DAPI staining; Steve Reiner for RT-PCR primers and control template; and Clara Abraham, Scott Jenks, and Marisa Naujokas for helpful discussions and comments on the manuscript.


    Footnotes
 
1 L.A.Z. was supported by National Institutes of Health Interdisciplinary Training Program in Immunology (AI-107090). Animal care, peptide and oligonucleotide synthesis, and flow cytometry were supported by Cancer Research Center (CA-14599). This work was supported by National Institutes of Health Grants AI-35294 and DK-49799 (to J.M). Back

2 Address correspondence and reprint requests to Dr. Jim Miller, MGCB, University of Chicago, 920 E. 58th Street, Chicago, IL 60637. E-mail address: Back

3 Abbreviations used in this paper: ICAM, intercellular adhesion molecule; DAPI, 4', 6-diamidino-2-phenylindole; ETBr, ethidium bromide; FAK, focal adhesion kinase. Back

Received for publication July 14, 1997. Accepted for publication December 8, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Dubey, C., M. Croft. 1996. Accessory molecule regulation of naive CD4 T cell activation. Immunol. Res. 15:114.[Medline]
  2. Lenschow, D., T. Walunas, J. Bluestone. 1996. CD28/B7 system of T cell costimulation. Annu. Rev. Immunol. 14:233.[Medline]
  3. Van Seventer, G. A., Y. Shimizu, K. J. Horgan, S. Shaw. 1990. The LFA-1 ligand ICAM-1 provides an important costimulatory signal for T cell receptor-mediated activation of resting T cells. J. Immunol. 144:4579.[Abstract]
  4. Van Seventer, G. A., W. Newman, Y. Shimizu, T. B. Nutman, Y. Tanaka, K. J. Horgan, T. V. Gopal, E. Ennis, D. O’Sullivan, H. Grey, S. Shaw. 1991. Analysis of T cell stimulation by superantigen plus major histocompatibility complex class II molecules or by CD3 monoclonal antibody: costimulation by purified adhesion ligands VCAM-1, ICAM-1, but not ELAM-1. J. Exp. Med. 174:901.[Abstract/Free Full Text]
  5. Fischer, H., A. Gjorloff, G. Hedlund, H. Hedman, K. Lundgren, T. Kalland, H. O. Sjogren, M. Dohlsten. 1992. Stimulation of human naive and memory T helper cells with bacterial superantigen: naive CD4+45RA+ T cells require a costimulatory signal mediated through the LFA-1/ICAM-1 pathway. J. Immunol. 148:1993.[Abstract]
  6. Damle, N. K., K. Klussman, P. S. Linsley, A. Aruffo. 1992. Differential costimulatory effects of adhesion molecules B7, ICAM-1, LFA-3 and VCAM-1 on resting and antigen primed CD4+ lymphocytes. J. Immunol. 148:1985.[Abstract]
  7. Dubey, C., M. Croft, S. L. Swain. 1995. Costimulatory requirements of naive CD4+ T cells: ICAM-1 or B7-1 can costimulate naive CD4+ T cell activation but both are required for optimal response. J. Immunol. 155:45.[Abstract]
  8. Meuer, S., R. Hussey, M. Fabbi, D. Fox, O. Acuto, K. Fitzgerald, J. Hodgdon, J. Protentis, S. Schlossman, E. Reinherz. 1984. An alternative pathway of T-cell activation: a functional role for the 50 kD T11 sheep erythrocyte receptor protein. Cell 36:897.[Medline]
  9. Parra, E., A. Wingren, G. Hedlund, M. Bjorklund, H. Sjogren, T. Kalland, D. Sansom, M. Dohlsten. 1994. Costimulation of human CD4+ T lymphocytes with B7 and lymphocyte function-associated antigen-3 results in distinct cell activation profiles. J. Immunol. 153:2479.[Abstract]
  10. Boussiotis, V., G. Freeman, J. Griffin, G. Gray, J. Gribben, L. Nadler. 1994. CD2 is involved in maintenance and reversal of human alloantigen-specific clonal anergy. J. Exp. Med. 180:1665.[Abstract/Free Full Text]
  11. Parra, E., M. Varga, G. Hedlund, T. Kalland, M. Dohlsten. 1997. Costimulation by B7-1 and LFA3 targets distinct nuclear factors that bind to the interleukin-2 promoter: B7-1 negatively regulates LFA-3-induced NF-AT DNA binding. Mol. Cell. Biol. 17:1314.[Abstract]
  12. Naujokas, M., M. Morin, M. Anderson, M. Peterson, J. Miller. 1993. The chondroitin sulfate form of invariant chain can enhance stimulation of T cell responses through interaction with CD44. Cell 74:257.[Medline]
  13. Zuckerman, L. A., A. J. Sant, J. Miller. 1995. Identification of a unique costimulatory activity for murine Th1 T cell clones. J. Immunol. 154:4503.[Abstract]
  14. Liu, Y., B. Jones, A. Aruffo, K. M. Sullivan, P. S. Linsely, Jr C. A. Janeway. 1992. Heat-stable antigen is a costimulatory molecule for CD4 T cell growth. J. Exp. Med. 175:437.[Abstract/Free Full Text]
  15. Sanchez-Mateos, P., M. Campenero, M. del Pozo, F. Sanchez-Madrid. 1995. Regulatory role of CD43 leukosialin on integrin-mediated T cell adhesion to endothelial and extracellular matrix ligands and its polar redistribution to a cellular uropod. Blood 86:2228.[Abstract/Free Full Text]
  16. Sperling, A., J. Green, R. Mosley, P. Smith, R. DiPaolo, J. Klein, J. Bluestone, C. Thompson. 1995. CD43 is a murine T cell costimulatory receptor that functions independently of CD28. J. Exp. Med. 182:139.[Abstract/Free Full Text]
  17. Kobata, T., K. Agematsu, J. Kameoka, S. Schlossman, C. Morimoto. 1994. CD27 is a signal-transducing molecule involved in CD45RA+ naive T cell costimulation. J. Immunol. 153:5422.[Abstract]
  18. Hintzen, R., S. Lens, K. Lammers, H. Kuipe, M. Beckmann, R. van Lier. 1995. Engagement of CD27 with its ligand CD70 provides a second signal for T cell activation. J. Immunol. 154:2612.[Abstract]
  19. Blotta, M., J. Marshall, R. DeKruyff, D. Umetsu. 1996. Cross-linking of the CD40 ligand on human CD4+ T lymphocytes generates a costimulatory signal that up-regulates IL-4 synthesis. J. Immunol. 156:3133.[Abstract]
  20. DeBenedette, M., N. Chu, K. Pollok, J. Hurtado, W. Wade, B. Kwon, T. Watts. 1995. Role of 4-1BB ligand in costimulation of T lymphocyte growth and its up-regulation on M12 B lymphomas by cAMP. J. Exp. Med. 181:985.[Abstract/Free Full Text]
  21. Hurtado, J., S. Kim, K. Pollok, Z. Lee, B. Kwon. 1995. Potential role of 4-1BB in T cell activation: comparison with the costimulatory molecule CD28. J. Immunol. 155:3360.[Abstract]
  22. Godfrey, W., F. Fagnoni, M. Harara, D. Buck, E. Engleman. 1994. Identification of a human OX-40 ligand, a costimulator of CD4+ T cells with homology to tumor necrosis factor. J. Exp. Med. 180:757.[Abstract/Free Full Text]
  23. Del Prete, G., M. De Carli, M. D’Elios, C. Daniel, F. Almerigogna, M. Alderson, C. Smith, E. Thomas, S. Romagnani. 1995. CD30-mediated signaling promotes the development of human T helper type 2-like T cells. J. Exp. Med. 182:1655.[Abstract/Free Full Text]
  24. Dustin, M. L., T. A. Springer. 1989. T-cell receptor cross-linking transiently stimulates adhesiveness through LFA-1. Nature 341:619.[Medline]
  25. Lub, M., Y. van Kooyk, C. Figdor. 1995. Ins and outs of LFA-1. Immunol. Today 16:479.[Medline]
  26. Lollo, B., K. Chan, E. Hanson, V. Moy, A. Brian. 1993. Direct evidence for two affinity states for lymphocyte function associated antigen 1 on activated T cells. J. Biol. Chem. 268:21693.[Abstract/Free Full Text]
  27. Kucik, D., M. Dustin, J. Miller, E. Brown. 1996. Adhesion-activating phorbol ester increases the mobility of leukocyte integrin LFA-1 in cultured lymphocytes. J. Clin. Invest. 97:2139.[Medline]
  28. Lub, M., Y. van Kooyk, S. van Vliet, C. Figdor. 1997. Dual role of the actin cytoskeleton in regulating cell adhesion mediated by the integrin lymphocyte function-associated molecule-1. Mol. Biol. Cell 8:341.[Abstract]
  29. Van Seventer, G. A., E. Bonvini, H. Yamada, A. Conti, S. Stringfellow, C. H. June, S. Shaw. 1992. Costimulation of T cell receptor/CD3-mediated activation of resting human CD4+ T cells by leukocyte function-associated antigen-1 ligand intercellular adhesion molecule-1 involves prolonged inositol phospholipid hydrolysis and sustained increase of intracellular Ca2+ levels. J. Immunol. 149:3872.[Abstract]
  30. Kanner, S., L. Grosmaire, J. Ledbetter, N. Damle. 1993. ß2-integrin LFA-1 signaling through phospholipase C-{gamma}1 activation. Proc. Natl. Acad. Sci. USA 90:7099.[Abstract/Free Full Text]
  31. Petruzzelli, L., M. Takami, R. Herrera. 1996. Adhesion through the interaction of lymphocyte function adhesion antigen-1 with intracellular adhesion molecule-1 induces tyrosine phosphorylation of p130-cas and its association with c-CrkII. J. Biol. Chem. 271:7796.[Abstract/Free Full Text]
  32. Kuhlman, P., V. T. Moy, B. A. Lollo, A. A. Brian. 1991. The accessory function of murine intercellular adhesion molecule-1 in T lymphocyte activation: contributions of adhesion and co-activation. J. Immunol. 146:1773.[Abstract]
  33. Ybarrondo, B., A. O’Rourke, A. Brian, M. Mescher. 1994. Contribution of lymphocyte function associated-1/intercellular adhesion molecule-1 binding to the adhesion/signaling cascade of cytotoxic T lymphocyte activation. J. Exp. Med. 179:359.[Abstract/Free Full Text]
  34. Berg, N. N., H. L. Ostergaard. 1995. Characterization of intercellular adhesion molecule-1 (ICAM-1)-augmented degranulation by cytotoxic T cells: ICAM-1 and anti-CD3 must be co-localized for optimal adhesion and stimulation. J. Immunol. 155:1694.[Abstract]
  35. Cai, Z., A. Brunmark, M. Jackson, D. Loh, P. Peterson, J. Sprent. 1996. Transfected Drosophila cells as a probe for defining the minimal requirements for stimulating unprimed CD8+ T cells. Proc. Natl. Acad. Sci. USA 93:14736.[Abstract/Free Full Text]
  36. Gajewski, T. F., M. Pinnas, T. Wong, F. W. Fitch. 1991. Murine Th1 and Th2 clones proliferate optimally in response to distinct antigen-presenting cell populations. J. Immunol. 146:1750.[Abstract]
  37. Hsieh, C., A. Heimberger, J. Gold, A. O’Garra. 1992. Differential regulation of T helper phenotype development by IL-4 and 10 in an {alpha}ß TCR transgenic system. Proc. Natl. Acad. Sci. USA 89:6065.[Abstract/Free Full Text]
  38. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo. Science 250:1720.[Abstract/Free Full Text]
  39. Haskins, K., R. Kubo, J. White, M. Pigeon, J. Kappler, P. Marrack. 1983. The major histocompatibility complex-restricted antigen receptor on T cells. I. Isolation with a monoclonal antibody. J. Exp. Med. 157:1149.[Abstract/Free Full Text]
  40. Boise, L. H., A. J. Minn, P. J. Noel, C. H. June, M. A. Accavitti, T. Lindsten, C. B. Thompson. 1995. CD28 costimulation can promote T cell survival by enhancing the expression of Bcl-XL. Immunity 3:87.[Medline]
  41. Reiner, S. L., S. Zheng, D. B. Corry, R. M. Locksley. 1993. Constructing polycompetitor cDNAs for quantitative PCR. J. Immunol. Methods 165:37.[Medline]
  42. Go, C., D. Lancki, F. Fitch, J. Miller. 1993. Anergized Th1 T cell clones retain their cytolytic ability. J. Immunol. 150:367.[Abstract]
  43. McCormick, L., R. J. Roller, B. Roizman. 1992. Characterization of a herpes simplex virus sequence which binds a cellular protein as either a single-stranded or double-stranded DNA or RNA. J. Virol. 66:3435.[Abstract/Free Full Text]
  44. Fried, M., D. M. Crothers. 1981. Equilibria and kinetics of lac repressor-operator interactions by polyacrylamide gel electrophoresis. Nucleic Acids Res. 9:6505.[Abstract/Free Full Text]
  45. Garner, M. M., A. Revzin. 1981. A gel electrophoresis method for quantifying the binding proteins to specific DNA regions: application to components of the Escherichia coli lactose operon regulatory system. Nucleic Acids Res. 9:3047.[Abstract/Free Full Text]
  46. Boise, L., A. Minn, C. June, T. Lindsten, C. Thompson. 1995. Growth factors can enhance lymphocyte survival without committing the cell to undergo cell division. Proc. Natl. Acad. Sci. USA 92:5491.[Abstract/Free Full Text]
  47. Mueller, D., S. Seiffert, W. Fang, T. Behrens. 1996. Differential regulation of bcl-2 and bcl-x by CD3, CD28, and the IL-2 receptor in cloned CD4+ helper T cells: a model for the long-term survival of memory cells. J. Immunol. 156:1764.[Abstract]
  48. Zhang, X., L. Giangreco, H. Broome, C. Dargan, S. Swain. 1995. Control of CD4 effector fate: transforming growth factor beta 1 and interleukin 2 synergize to prevent apoptosis and promote effector expansion. J. Exp. Med. 182:699.[Abstract/Free Full Text]
  49. Shaw, J., K. Meerovitch, R. C. Bleackley, V. Paetkau. 1988. Mechanisms regulating the level of IL-2 mRNA in T lymphocytes. J. Immunol. 140:2243.[Abstract]
  50. Zubiaga, A., E. Munoz, B. Huber. 1991. Superinduction of IL-2 gene transcription in the presence of cycloheximide. J. Immunol. 146:3857.[Abstract]
  51. Edwards, D., L. Mahadevan. 1992. Protein synthesis inhibitors differentially superinduce c-fos and c-jun by three distinct mechanisms: lack of evidence for labile repressors. EMBO J. 11:2415.[Medline]
  52. Curatola, A., M. Nadal, R. Schneider. 1995. Rapid degradation of AU-rich element (ARE) mRNAs is activated by ribosome transit and blocked by secondary structure at any position 5' to the ARE. Mol. Cell. Biol. 15:6331.[Abstract]
  53. Gerez, L., G. Arad, S. Efrat, M. Ketzinel, R. Kaempfer. 1995. Post-transcriptional regulation of human interleukin-2 gene expression at processing of precursor transcripts. J. Biol. Chem. 270:19569.[Abstract/Free Full Text]
  54. Zinck, R., M. Cahill, M. Kracht, C. Sachsenmaier, R. Hipskind, A. Nordheim. 1995. Protein synthesis inhibitors reveal differential regulation of mitogen-activated protein kinase and stress-activated protein kinase pathways that converge on Elk-1. Mol. Cell. Biol. 15:4930.[Abstract]
  55. Rabinowitz, J., C. Beeson, C. Wulfing, K. Tate, P. Allen, M. Davis, H. McConnell. 1996. Altered T cell receptor ligands trigger a subset of early T cell signals. Immunity 5:125.[Medline]
  56. Timmerman, L., N. Clipstone, S. Ho, J. Northrop, G. Crabtree. 1996. Rapid shuttling of NF-AT in discrimination of Ca2+ signals and immunosuppression. Nature 383:837.[Medline]
  57. Dolmetsch, R., R. Lewis, C. Goodnow, J. Healy. 1997. Differential activation of transcription factors induced by Ca2+ response amplitude and duration. Nature 386:856.
  58. Boise, L., B. Petryniak, X. Mao, C. June, C. Wang, T. Lindsten, R. Bravo, K. Kovary, J. Leiden, C. Thompson. 1993. The NFAT-1 DNA binding complex in activated T cells contains Fra-1 and JunB. Mol. Cell. Biol. 13:1911.[Abstract/Free Full Text]
  59. Jain, J., P. G. McCaffrey, V. E. Valge-Archer, A. Rao. 1992. Nuclear factor of activated T cells contains Fos and Jun. Nature 356:801.[Medline]
  60. Kang, S., A. Tran, M. Grilli, M. Lenardo. 1992. NF-{kappa}B subunit regulation in nontransformed CD4+ T lymphocytes. Science 256:1452.[Abstract/Free Full Text]
  61. Go, C., J. Miller. 1992. Differential induction of transcription factors for the IL-2 gene during anergy induction and restimulation. J. Exp. Med. 175:1327.[Abstract/Free Full Text]
  62. DeSilva, D. R., K. B. Urdahl, M. K. Jenkins. 1991. Clonal anergy is induced in vitro by T cell receptor occupancy in the absence of proliferation. J. Immunol. 147:3261.[Abstract]
  63. Rao, A., C. Luo, P. Hogan. 1997. Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 15:707.[Medline]
  64. Fraser, J. D., B. A. Irving, G. R. Crabtree, A. Weiss. 1991. Regulation of interleukin-2 gene enhancer activity by the T cell accessory molecule CD28. Science 251:313.[Abstract/Free Full Text]
  65. Verweij, C., M. Geerts, L. Aarden. 1991. Activation of interleukin-2 gene transcription via the T-cell surface molecule CD28 is mediated through an NF-{kappa}B-like response element. J. Biol. Chem. 266:14179.[Abstract/Free Full Text]
  66. Civil, A., M. Geerts, L. Aarden, C. Verweij. 1992. Evidence for a role of CD28RE as a response element for distinct mitogenic T cell activation signals. Eur. J. Immunol. 22:3041.[Medline]
  67. Rincon, M., R. A. Flavell. 1994. AP-1 transcriptional activity requires both T-cell receptor-mediated and co-stimulatory signals in primary T lymphocytes. EMBO J. 13:4370.[Medline]
  68. Rothenberg, E., S. Ward. 1996. A dynamic assembly of diverse transcription factors integrates activation and cell type information for interleukin-2 gene regulation. Proc. Natl. Acad. Sci. USA 93:9358.[Abstract/Free Full Text]
  69. Umlauf, S. W., B. Beverly, O. Lantz, R. H. Schwartz. 1995. Regulation of interleukin 2 gene expression by CD28 costimulation in mouse T-cell clones: both nuclear and cytoplasmic RNAs are regulated with complex kinetics. Mol. Cell. Biol. 15:3197.[Abstract]
  70. Lindsten, T., C. H. June, J. A. Ledbetter, G. Stella, C. Thompson. 1989. Regulation of lymphokine messenger RNA stability by a surface-mediated T cell activation pathway. Science 244:339.[Abstract/Free Full Text]
  71. Jain, J., C. Loh, A. Rao. 1995. Transcriptional regulation of the IL-2 gene. Curr. Opin. Immunol. 7:333.[Medline]
  72. Lederer, J. A., J. S. Liou, M. D. Todd, L. H. Glimcher, A. H. Lichtman. 1994. Regulation of cytokine gene expression in T-helper subsets. J. Immunol. 152:77.[Abstract]
  73. Hughes, C., J. Pober. 1996. Transcriptional regulation of the interleukin-2 gene in normal human peripheral blood T cells. J. Biol. Chem. 271:5369.[Abstract/Free Full Text]
  74. Nunes, J., Y. Collette, A. Truneh, D. Olive, D. Cantrell. 1994. The role of p21ras in CD28 signal transduction: triggering of CD28 with antibodies, but not the ligand B7-1, activates p21ras. J. Exp. Med. 180:1067.[Abstract/Free Full Text]
  75. Craig, S., R. Johnson. 1996. Assembly of focal adhesions: progress, paradigms, and portents. Curr. Opin. Cell Biol. 8:74.[Medline]
  76. Dedhar, S., G. Hannigan. 1996. Integrin cytoplasmic interactions and bidirectional transmembrane signaling. Curr. Opin. Cell Biol. 8:657.[Medline]
  77. Jockusch, B., P. Bubeck, K. Giehl, M. Kroemker, J. Moschner, M. Rothkegel, M. Rudiger, K. Schluter, G. Stanke, J. Winkler. 1995. The molecular architecture of focal adhesions. Annu. Rev. Cell Dev. Biol. 11:379.[Medline]
  78. Parsons, J.. 1996. Integrin-mediated signaling: regulation by protein tyrosine kinases and small GTP-binding proteins. Curr. Opin. Cell Biol. 8:146.[Medline]
  79. Yamada, K., B. Geiger. 1996. Molecular interactions in cell adhesion complexes. Curr. Opin. Cell Biol. 9:76.
  80. Miyamoto, S., H. Treamoto, O. Coso, J. Gutkind, P. Burbelo, S. Akiyama, K. Yamada. 1995. Integrin function: molecular hierarchies of cytoskeletal and signaling molecules. J. Cell Biol. 131:791.[Abstract/Free Full Text]
  81. Chen, H., P. Appeddu, H. Isoda, J. Guan. 1996. Phosphorylation of tyrosine 397 in focal adhesion kinase is required for binding phosphatidylinositol 3-kinase. J. Biol. Chem. 271:26329.[Abstract/Free Full Text]
  82. Schlaepfer, D., S. Hanks, T. Hunter, P. van der Geer. 1994. Integrin-mediated signal transduction linked to Ras pathway by GRB2 binding to focal adhesion kinase. Nature 372:786.[Medline]
  83. Nobes, C., A. Hall. 1995. Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81:53.[Medline]
  84. Kolanus, W., W. Nagel, B. Schiller, L. Zeitlmann, S. Godar, H. Stockinger, B. Seed. 1996. {alpha}Lß2 integrin/LFA-1 binding to ICAM-1 induced by cytohesin-1, a cytoplasmic regulatory molecule. Cell 86:233.[Medline]
  85. Hannigan, G., C. Leung-Hagesteijn, L. Fitz-Gibbon, M. Coppolino, G. Radeva, J. Filmus, B. J.C. Bell, S. Dedhar. 1996. Regulation of cell adhesion and anchorage dependent growth by a new ß1 integrin linked protein kinase. Nature 379:91.[Medline]
  86. Schaller, M., C. Otey, J. Hildebrand, J. Parsons. 1995. Focal adhesion kinase and paxillin bind to peptides mimicking ß integrin cytoplasmic domains. J. Cell Biol. 130:1181.[Abstract/Free Full Text]
  87. Sharma, C., R. Ezzell, M. Arnaout. 1995. Direct interaction of filamin (ABP-280) with the ß2-integrin subunit CD18. J. Immunol. 154:3461.[Abstract]
  88. Pardi, R., G. Bossi, L. Inverardi, E. Rovida, J. Bender. 1995. Conserved regions in the cytoplasmic domains of the leukocyte integrin {alpha}Lß2 are involved in endoplasmic reticulum retention, dimerization, and cytoskeletal association. J. Immunol. 155:1252.[Abstract]
  89. Maguire, J., K. Danahey, L. Burkly, G. van Seventer. 1995. T cell receptor- and ß1 integrin-mediated signals synergize to induce tyrosine phosphorylation of focal adhesion kinase (pp125FAK) in human T cells. J. Exp. Med. 182:2079.[Abstract/Free Full Text]
  90. Podack, E., A. Kupfer. 1991. T-cell effector functions: mechanisms for delivery of cytotoxicity and help. Annu. Rev. Cell Biol. 7:479.
  91. Ruoslahti, E., J. Reed. 1994. Anchorage dependence, integrins, and apoptosis. Cell 77:477.[Medline]
  92. Russell, J.. 1995. Activation-induced death of mature T cells in the regulation of immune responses. Curr. Opin. Immunol. 7:382.[Medline]
  93. Ettinger, R., D. Panka, J. Wang, B. Stanger, S. Ju, A. Marshak-Rothstein. 1995. Fas ligand mediated cytotoxicity is directly responsible for apoptosis of normal CD4+ T cells responding to a bacterial superantigen. J. Immunol. 154:4302.[Abstract]
  94. Parijs, L., A. Ibraghhimov, A. Abbas. 1996. The roles of costimulation and fas in T cell apoptosis and peripheral tolerance. Immunity 4:321.[Medline]
  95. Vella, A. T., J. E. McCormack, P. S. Linsley, J. W. Kappler, P. Marrack. 1995. Lipopolysaccharide interferes with the induction of peripheral T cell death. Immunity 2:261.[Medline]
  96. Sytwu, H., R. Liblau, H. McDevitt. 1996. The roles of Fas/Apo-1 (CD95) and TNF in antigen-induced programmed cell death in T cell receptor transgenic mice. Immunity 5:7.[Medline]
  97. Damle, N. K., K. Klussman, G. Leytze, A. Aruffo, P. S. Linsley, J. A. Ledbetter. 1993. Costimulation with integrin ligands intercellular adhesion molecule-1 or vascular cell adhesion molecule-1 augments activation-induced death of antigen-specific CD4+ lymphocytes. J. Immunol. 151:2368.[Abstract]
  98. Webb, S., C. Morris, J. Sprent. 1990. Extrathymic tolerance of mature T cells: clonal elimination as a consequence of immunity. Cell 63:1249.[Medline]
  99. MacDonald, H. R., S. Baschierei, R. K. Lees. 1991. Clonal expansion precedes anergy and death of Vß8+ peripheral T cells responding to staphylococcal enterotoxin B in vivo. Eur. J. Immunol. 21:1963.[Medline]
  100. Gonzola, J., C. Martinez-A., T. Springer, J. Guiterrez-Ramos. 1995. ICAM-1 is required for T cell proliferation but not for anergy or apoptosis induced by Staphylococcus aureus enterotoxin B in vivo. Int. Immunol. 7:1691.
  101. Glickstein, L., B. Huber. 1995. Karoushi: death by overwork in the immune system. J. Immunol. 155:522.[Medline]
  102. Noel, P., L. Boise, J. Green, C. Thompson. 1996. CD28 costimulation prevents cell death during primary T cell activation. J. Immunol. 157:636.[Abstract]
  103. Sperling, A., J. Auger, B. Ehst, I. Rulifson, C. Thompson, J. Bluestone. 1996. CD28/B7 interactions deliver a unique signal to naive T cells that regulates cell survival, but not early proliferation. J. Immunol. 157:3909.[Abstract]
  104. Corcoran, L. M., M. Karvelas. 1994. Oct-2 is required early in T-cell independent B-cell activation for G1 progression and for proliferation. Immunity 1:635.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
B. Graf, T. Bushnell, and J. Miller
LFA-1-Mediated T Cell Costimulation through Increased Localization of TCR/Class II Complexes to the Central Supramolecular Activation Cluster and Exclusion of CD45 from the Immunological Synapse
J. Immunol., August 1, 2007; 179(3): 1616 - 1624.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Sanchez-Lockhart and J. Miller
Engagement of CD28 Outside of the Immunological Synapse Results in Up-Regulation of IL-2 mRNA Stability but Not IL-2 Transcription.
J. Immunol., April 15, 2006; 176(8): 4778 - 4784.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. R. Jenkinson, N. A. Williams, and D. J. Morgan
The Role of Intercellular Adhesion Molecule-1/LFA-1 Interactions in the Generation of Tumor-Specific CD8+ T Cell Responses
J. Immunol., March 15, 2005; 174(6): 3401 - 3407.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Blank, I. Brown, A. K. Kacha, M. A. Markiewicz, and T. F. Gajewski
ICAM-1 Contributes to but Is Not Essential for Tumor Antigen Cross-Priming and CD8+ T Cell-Mediated Tumor Rejection In Vivo
J. Immunol., March 15, 2005; 174(6): 3416 - 3420.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. A. Jenks, B. J. Eisfelder, and J. Miller
LFA-1 co-stimulation inhibits Th2 differentiation by down-modulating IL-4 responsiveness
Int. Immunol., March 1, 2005; 17(3): 315 - 323.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Sanchez-Lockhart, E. Marin, B. Graf, R. Abe, Y. Harada, C. E. Sedwick, and J. Miller
Cutting Edge: CD28-Mediated Transcriptional and Posttranscriptional Regulation of IL-2 Expression Are Controlled through Different Signaling Pathways
J. Immunol., December 15, 2004; 173(12): 7120 - 7124.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Kandula and C. Abraham
LFA-1 on CD4+ T Cells Is Required for Optimal Antigen-Dependent Activation In Vivo
J. Immunol., October 1, 2004; 173(7): 4443 - 4451.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
W.-C. Huang, S.-T. Chan, T.-L. Yang, C.-C. Tzeng, and C.-C. Chen
Inhibition of ICAM-1 gene expression, monocyte adhesion and cancer cell invasion by targeting IKK complex: molecular and functional study of novel {alpha}-methylene-{gamma}-butyrolactone derivatives
Carcinogenesis, October 1, 2004; 25(10): 1925 - 1934.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C.-C. Chen, M.-P. Chow, W.-C. Huang, Y.-C. Lin, and Y.-J. Chang
Flavonoids Inhibit Tumor Necrosis Factor-{alpha}-Induced Up-Regulation of Intercellular Adhesion Molecule-1 (ICAM-1) in Respiratory Epithelial Cells through Activator Protein-1 and Nuclear Factor-{kappa}B: Structure-Activity Relationships
Mol. Pharmacol., September 1, 2004; 66(3): 683 - 693.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Tskvitaria-Fuller, A. L. Rozelle, H. L. Yin, and C. Wulfing
Regulation of Sustained Actin Dynamics by the TCR and Costimulation as a Mechanism of Receptor Localization
J. Immunol., September 1, 2003; 171(5): 2287 - 2295.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Gardby, J. Wrammert, K. Schon, L. Ekman, T. Leanderson, and N. Lycke
Strong Differential Regulation of Serum and Mucosal IgA Responses as Revealed in CD28-Deficient Mice Using Cholera Toxin Adjuvant
J. Immunol., January 1, 2003; 170(1): 55 - 63.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Chirathaworn, J. E. Kohlmeier, S. A. Tibbetts, L. M. Rumsey, M. A. Chan, and S. H. Benedict
Stimulation Through Intercellular Adhesion Molecule-1 Provides a Second Signal for T Cell Activation
J. Immunol., June 1, 2002; 168(11): 5530 - 5537.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Bertry-Coussot, B. Lucas, C. Danel, L. Halbwachs-Mecarelli, J.-F. Bach, L. Chatenoud, and P. Lemarchand
Long-Term Reversal of Established Autoimmunity upon Transient Blockade of the LFA-1/Intercellular Adhesion Molecule-1 Pathway
J. Immunol., April 1, 2002; 168(7): 3641 - 3648.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. H. Smits, E. C. de Jong, J. H. N. Schuitemaker, T. B. H. Geijtenbeek, Y. van Kooyk, M. L. Kapsenberg, and E. A. Wierenga
Intercellular Adhesion Molecule-1/LFA-1 Ligation Favors Human Th1 Development
J. Immunol., February 15, 2002; 168(4): 1710 - 1716.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Sirim, L. Zeitlmann, B. Kellersch, C. S. Falk, D. J. Schendel, and W. Kolanus
Calcium Signaling through the beta 2-Cytoplasmic Domain of LFA-1 Requires Intracellular Elements of the T Cell Receptor Complex
J. Biol. Chem., November 9, 2001; 276(46): 42945 - 42956.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Abraham and J. Miller
Molecular Mechanisms of IL-2 Gene Regulation Following Costimulation Through LFA-1
J. Immunol., November 1, 2001; 167(9): 5193 - 5201.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Bechard, A. Scherpereel, H. Hammad, T. Gentina, A. Tsicopoulos, M. Aumercier, J. Pestel, J.-P. Dessaint, A.-B. Tonnel, and P. Lassalle
Human Endothelial-Cell Specific Molecule-1 Binds Directly to the Integrin CD11a/CD18 (LFA-1) and Blocks Binding to Intercellular Adhesion Molecule-1
J. Immunol., September 15, 2001; 167(6): 3099 - 3106.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. M. Palmer, L. Farrokh-Siar, J. Maguire van Seventer, and G. A. van Seventer
IL-12 Decreases Activation-Induced Cell Death in Human Naive Th Cells Costimulated by Intercellular Adhesion Molecule-1. I. IL-12 Alters Caspase Processing and Inhibits Enzyme Function
J. Immunol., July 15, 2001; 167(2): 749 - 758.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-T. Ni, M. J. Deeths, and M. F. Mescher
LFA-1-Mediated Costimulation of CD8+ T Cell Proliferation Requires Phosphatidylinositol 3-Kinase Activity
J. Immunol., June 1, 2001; 166(11): 6523 - 6529.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. L. Gaglia, E. A. Greenfield, A. Mattoo, A. H. Sharpe, G. J. Freeman, and V. K. Kuchroo
Intercellular Adhesion Molecule 1 Is Critical for Activation of CD28-Deficient T Cells
J. Immunol., December 1, 2000; 165(11): 6091 - 6098.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Maeda, M. Towatari, H. Kosugi, and H. Saito
Up-regulation of costimulatory/adhesion molecules by histone deacetylase inhibitors in acute myeloid leukemia cells
Blood, December 1, 2000; 96(12): 3847 - 3856.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. M. Jelley-Gibbs, N. M. Lepak, M. Yen, and S. L. Swain
Two Distinct Stages in the Transition from Naive CD4 T Cells to Effectors, Early Antigen-Dependent and Late Cytokine-Driven Expansion and Differentiation
J. Immunol., November 1, 2000; 165(9): 5017 - 5026.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Jenks and J. Miller
Inhibition of IL-4 Responses After T Cell Priming in the Context of LFA-1 Costimulation Is Not Reversed by Restimulation in the Presence of CD28 Costimulation
J. Immunol., January 1, 2000; 164(1): 72 - 78.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-M. Dosch, R. K. Cheung, W. Karges, M. Pietropaolo, and D. J. Becker
Persistent T Cell Anergy in Human Type 1 Diabetes
J. Immunol., December 15, 1999; 163(12): 6933 - 6940.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. S. Liwski and T. D. G. Lee
Nematode Infection Enhances Survival of Activated T Cells by Modulating Accessory Cell Function
J. Immunol., November 1, 1999; 163(9): 5005 - 5012.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
P. Bertolino, M.-C. Trescol-Biemont, J. Thomas, B. F. de St Groth, M. Pihlgren, J. Marvel, and C. Rabourdin-Combe
Death by neglect as a deletional mechanism of peripheral tolerance
Int. Immunol., August 1, 1999; 11(8): 1225 - 1238.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-T. Ni, M. J. Deeths, W. Li, D. L. Mueller, and M. F. Mescher
Signaling Pathways Activated by Leukocyte Function-Associated Ag-1-Dependent Costimulation
J. Immunol., May 1, 1999; 162(9): 5183 - 5189.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Abraham, J. Griffith, and J. Miller
The Dependence for Leukocyte Function-Associated Antigen-1/ICAM-1 Interactions in T Cell Activation Cannot Be Overcome by Expression of High Density TCR Ligand
J. Immunol., April 15, 1999; 162(8): 4399 - 4405.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. E. Sedwick, M. M. Morgan, L. Jusino, J. L. Cannon, J. Miller, and J. K. Burkhardt
TCR, LFA-1, and CD28 Play Unique and Complementary Roles in Signaling T Cell Cytoskeletal Reorganization
J. Immunol., February 1, 1999; 162(3): 1367 - 1375.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Ragazzo, M. E. Ozaki, L. Karlsson, P. A. Peterson, and S. R. Webb
Costimulation via lymphocyte function-associated antigen 1 in the absence of CD28 ligation promotes anergy of naive CD4+ T cells
PNAS, January 2, 2001; 98(1): 241 - 246.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zuckerman, L. A.
Right arrow Articles by Miller, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zuckerman, L. A.
Right arrow Articles by Miller, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS