| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Molecular Biology, Princeton University, Princeton, NJ 08544
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß T cells, most
CD1 isotypes share the unusual property of being recognized by a high
frequency of naturally autoreactive ß T cells. In the case of
mouse CD1.1 and its human counterpart CD1d, a significant fraction of
the autoreactive T cells express semi-invariant TCRs. CD1.1-specific T
cells have a restricted tissue distribution and very promptly secrete a
large panel of potent cytokines, including IL-4 and IFN-
, upon
primary activation through their TCR, suggesting that they might
regulate some immune responses in these tissues. We show here that
their autorecognition of mouse CD1.1 is highly dependent upon the cell
type in which CD1.1 is expressed. For example, some of these T cells
only respond to CD1.1 expressed by splenic dendritic cells, some
respond preferentially to cortical thymocytes, and others respond to
splenic B cells. Tissue specificity of CD1.1 recognition is also
observed with various cell lines transfected with CD1.1 cDNA. These
results show that different CD1.1 self Ags are expressed in different
tissues and can be specifically recognized by autoreactive T cells.
They suggest that CD1.1 may be naturally associated with a variety of
self ligands that overlap only partially in different cell types. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 and 2 domains, has revealed the existence of
two conserved subfamilies (1, 2). The CD1d family is represented in
humans, mice, rats, and rabbits, and the CD1a,b,c,e family is
represented in humans and sheep, but not in mice or rats. The
observation that CD1 and MHC map to two paralogous regions of the
genome suggests that they arose as a result of a chromosomal
duplication that included the entire ancestor locus (3, 4). In contrast
to classical MHC molecules, however, CD1 proteins are nonpolymorphic
and are conserved across species. Therefore, they are not targets of
either allogeneic responses or transplantation rejection, nor do CD1
molecules appear to act as restricting elements for responses to
conventional Ags (5).
There is evidence, however, that human CD1b can sample the endosomal
compartment using a targeting sequence encoded in its cytoplasmic tail
(6, 7) and present unconventional Ags, such as mycobacterial cell wall
mycolic acid and lipoarabinomannans (5, 8, 9), to ß T cells.
Screening of a random peptide phage display library indicated that
mouse CD1.1, the homologue of human CD1d, could bind synthetic peptides
of 14 to 24 amino acids with a defined hydrophobic motif and present
them to ß T cells (10). The crystal structure of CD1.1 revealed an
MHC-like fold with a large hydrophobic Ag binding groove, which
appeared to be empty in the protein sample produced in insect cells
(11). Structure analysis suggested that although CD1.1 may be stably
expressed as an empty surface molecule (10, 12), it should be capable,
in theory, of accommodating ligands such as small peptides or
lipids.
Although recent evidence points to the potential role of CD1 in
presenting foreign Ags to T cells, many CD1-restricted T cells appear
to be autoreactive (5, 13, 14). Whether this unusual finding reflects
biases in culture conditions or some inherent property of the CD1
system is unclear and the answer may vary according to particular CD1
isotypes. However, recent studies in the mouse have uncovered an entire
subset of CD1-autoreactive T cells (15), a large fraction of which
express TCRs made of an invariant V14-J281 -chain and
polyclonal ß-chains belonging mainly to the Vß8 family (16, 17, 18). A
similar subset using V24-JQ and Vß11 exists in humans (16, 19, 20, 21, 22). Such cells do not seem to require exposure to pathogens or
foreign Ags to expand, as they are found in normal numbers in germfree
animals and can be generated in fetal thymic organ culture or in fetal
liver cell suspension culture (14, 15, 23). Both the mouse and human
subsets coexpress receptors of the NK lineage and have a CD4-positive
or CD4/CD8 double-negative (CD8 in humans) phenotype (14). They
are absent in mice with targeted inactivation of CD1 (24, 25, 26) (S.-H.
Park, J. H. Roark, and A. Bendelac, manuscript in preparation).
Other CD1-autoreactive T cells that do not have restriction of TCR -
or ß-chain usage and may not coexpress NK receptors have also been
found among the residual CD4 T cells of MHC class II
KO3 mice (27). The frequency
of CD1 autoreactivity in this population was also high, reaching 8%,
compared with the 1% MHC class II autoreactive cells in mainstream CD4
T cells. Overall, the size of the CD1.1-autoreactive T cell population
is quite significant, ranging from 0.5 to 2% of the lymphocyte
population in the spleen to 20 to 40% in the liver or bone marrow
(14). It is likely therefore that CD1 recognition by naturally
autoreactive cells, which are numerous and secrete large amounts of
influential cytokines, is bound to regulate the outcome of some
important immune responses.
In this report we set out to investigate the natural CD1 ligands
recognized by CD1-autoreactive mouse T cells. Combined results from two
previous studies had suggested that CD1 autorecognition by different T
cells depended upon the type and the genetic background of the
CD1-expressing cell (15, 27). However, it was not clear whether
differences in T cell recognition were related to the expression of
modified versions of the same protein, such as, for example,
CD1/glycolipid complexes, or to a range of other possible factors.
These included the expression of different membrane levels of CD1 by
various cell types, as Abs were not available to monitor surface
expression; CD1 gene polymorphism, as CD1 sequences were not available
in the relevant mouse strains; and differential expression and
recognition of CD1 isotypes, as the mouse CD1 locus encodes two genes,
CD1.1 and CD1.2, with different patterns of mRNA expression (28).
Although CD1.1 and CD1.2 are 95% identical, their products can
nevertheless be distinguished by T cells (S.-H. Park and A. Bendelac,
manuscript in preparation). To address these confounding factors, we
first generated CD1-specific mAbs (52)
to define the levels of CD1 surface expression by different cell types
using flow cytometry. We also took advantage of the existence of a
natural CD1.2 mutant mouse strain, C57BL/6, in which we identified a
mutation that predicts the absence of surface expression, thus
considerably reducing the complexity of the system. Second, we derived
a panel of CD1-autoreactive T hybridomas from splenic or thymic cells
to study their CD1.1 recognition on various freshly purified
CD1.1-presenting cell types as well as on a panel of CD1.1-transfected
tumor lines. To our surprise, we found that a significant fraction of
CD1-autoreactive hybridomas, whether using a semi-invariant
V14-J281/Vß8 TCR or other diverse TCRs, displayed individual
and unique patterns of CD1.1 reactivity. These results demonstrate that
different CD1 ligands are recognized by individual T cell clones and
may suggest that CD1.1 is naturally associated with a set of self
ligands that varies considerably from one tissue to the other.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C57BL/6.ß2 M-/- (29) (backcrossed 10 times to B6), C57BL/6.MHC II-/- (30, 31) (I-Aßb-/-; backcrossed eight times to B6), and C57BL/6.TAP1-/- (32) (backcrossed four times to B6), were maintained under specific pathogen-free conditions in our barrier facility. Other mouse strains were purchased from The Jackson Laboratory (Bar Harbor, ME), except NOD, which was obtained from Taconic Farms (Germantown, NY). CD1-congenic mice, referred to as B10.NOD-CD1 and NOD.B6-CD1 here, were gifts from Drs. Linda Wicker and Larry Peterson (Merck Research Laboratories, Rahway, NJ) and correspond to B10.NOD-H2g7Idd10 and NOD.B6-Idd3Idd10, respectively (as CD1 maps to the Idd10 locus) (33).
CD1.1 and CD1.2 cloning and sequencing
CD1.1 and CD1.2 cDNAs were PCR amplified using the following set of specific primers: CD1.1–5', AAGCGCAGAAGTCGGAGCCG; CD1.1–3', GCAGGTACGCACATTTGCAGTTGTG; CD1.2–5', AGCAGAGTAAAGTGCAGAAGTCGG; and CD1.2–3', CCTCACTCCGGCACATACATG. Amplified products were subcloned into the PCR3 expression vector (Invitrogen, San Diego, CA), and sequences from multiple subclones were determined using the Sequenase 2.0 kit (Amersham, Arlington Heights, IL). Sequencing was also performed on total PCR products using the dsDNA cycling sequencing system (Life Technologies, Gaithersburg, MD) and on genomic DNA.
Anti-CD1 mAbs
A large panel of anti-CD1 mAbs was generated and is described in detail elsewhere (52). Briefly, the mAb-secreting hybridomas were generated by fusion with the Sp2/0 myeloma of spleen cells from rats repeatedly immunized with various CD1.1-transfected cell lines or with mouse thymocytes. CD1 specificity was established by the appropriate pattern of staining of transfected cell lines, by the lack of staining of cells from CD1 KO mice, and by immunoprecipitation. All mAbs, except 15F7, cross-reacted with CD1.2, as judged by staining of RBL cells transfected with a B6 CD1.2 cDNA in which the frameshift mutation had been corrected. The mAbs 19G11 and 15F7 used in this study are rat IgG2bs that were purified over protein G-Sepharose and conjugated with biotin or were used pure in cell culture assays at a final concentration of 2 µg/ml.
CD1.1 transfected lines
The human C1R B cell (34), the rat RBL basophil leukemia (35), and the B6 mouse C57SV fibroblast (36) lines were transfected with 10 to 30 µg of linearized CD1.1 vector by the electroporation method using a Gene Pulser (Bio-Rad, Hercules, CA), and stable transfectants were selected by G418 treatment and cell sorting. By flow cytometry, transfected cells were found to express approximately 10 times more CD1.1 per cell than thymocytes.
T cell hybridoma generation
A new panel of T cell hybridomas was generated by fusion of
cells stimulated for 4 days by anti-CD3 with
BW5147ß-, as previously described (16). To
enrich for CD1 specificity, the cell populations were obtained from
C57BL/6.I-Aßb-deficient mice and depleted of HSA-positive
and CD8-positive thymocytes with Ab and complement, and B220-positive
and CD8-positive splenocytes by panning on Ab-coated plates, as
previously described (37). Hypoxanthine-aminopterin-thymidine-resistant
hybridomas were screened for IL-2 production upon stimulation with a
1/1 mixture of B6 spleen and thymus cells, and positive hybridomas were
subcloned. CD1 specificity was determined by blocking IL-2 production
with an anti-CD1 mAb. Hybridomas expressing the canonical invariant
V14-J281 TCR -chain were identified by PCR with primers for
V14 and J281 as previously described (16).
Cell preparations and FACS analysis/sorting
Cells were stained for three-color FACS analysis with directly conjugated Abs obtained from PharMingen (San Diego, CA; RM4–5 anti-CD4, 53.6.7 anti-CD8, RA3–6B2 anti-B220, M1/69 anti-HSA, and 2.4G2 anti-Fc receptor) or made in the laboratory (33D1 anti-dendritic cell (DC)-specific surface marker). CD1.1 was surface stained with 19G11-biotin followed by streptavidin-PE (Caltag, San Francisco, CA). FACS analyses were performed on a FACScan (Becton Dickinson, Mountain View, CA). FACS sorting was performed using a Vantage (Becton Dickinson, Lincoln Park, NJ) equipped with dual (argon and dye) lasers.
Cell subset enrichment
For DC enrichment, spleen cell suspensions (20 x 106 cells/ml in culture medium, as described below) were allowed to adhere on plastic culture dishes (Falcon 3025, Becton Dickinson Labware) for 2 h at 37°C in a 5% CO2 incubator. Nonadherent cells were then removed with several washes and vigorous pipetting, and adherent cells were reincubated overnight. Cells that detached during the second culture period were recovered after centrifugation over a 50% Percoll gradient and contained >95% DC identified by morphology, expression of 33D1, and lack of staining with 2.4G2 (38). Splenic B cells, T cells, and thymocyte CD4+CD8+, CD4+CD8-, and CD8+CD4- subsets were obtained by cell sorting after staining spleen cells with anti-B220-FITC and CD5-PE or staining thymocytes with anti-CD4-FITC and CD8-PE. HSAhigh and HSAlow single-positive thymocytes were sorted after staining thymocyte suspensions with anti-CD4-PE, CD8-APC, and HSA-FITC. B cell-depleted spleen cells were obtained after panning (1 spleen equivalent in 10 ml of PBS-0.1% BSA) for 30 min at 4°C over plates (Falcon 1013) coated with goat anti-µ Ab (Southern Biotechnology Associates, Birmingham, AL) and were <5% B220 positive.
Ag stimulation of T cell hybridomas
Unirradiated whole thymocytes or splenocytes, purified cellular fractions (5 x 105 cells, except DC used at 3 x 105 cells, per well), or CD1.1-transfected cell lines (5 x 104 cells) were incubated in flat-bottom microwells in the presence of 5 x 104 hybridoma T cells in a final volume of 0.2 ml of a 1/1 mixture of Click’s medium and RPMI (Biofluids, Rockville, MD) enriched with 10% heat-inactivated FCS, glutamine, antibiotics, and 5 x 10-5 M 2-ME. The IL-2 content of supernatants collected after an incubation period of 20 h was measured using the CTLL bioassay as previously described (39).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In earlier studies, we found that three hybridomas derived from normal thymic NK1 T cells reacted to B6 thymocytes but only moderately to splenocytes (15, 39). Independently, Cardell et al. derived seven CD1-specific hybridomas from the residual splenic CD4 cells of MHC II KO mice, and these reacted well to spleen cells, although no analysis of their reactivity to thymocytes was presented (27). Interestingly, two out of seven hybridomas did not recognize spleen cells from µMT KO (B cell-less) mice, and five of seven failed to respond to spleen cells from at least one genetically different strain of mouse. Although these observations could be explained by differential expression of CD1.1 vs CD1.2 in different cell types and/or by some degree of polymorphism, a more intriguing possibility raised by Cardell et al. was that such autoreactive T cells recognized modified CD1 molecules, for example associated with as yet undefined, tissue-specific coligands.
We set out to distinguish between these possibilities and determine
whether CD1-autoreactive ß TCRs may indeed recognize modified CD1
molecules. First, we sequenced CD1.1 and CD1.2 in some relevant mouse
strains and discovered that the B6 strain harbors a frameshift mutation
at the beginning of the fourth exon encoding the 3 domain of CD1.2,
which is predicted to abolish surface expression (Fig. 1
).
|
).
More detailed studies defined a hierarchy of CD1.1 expression with
DC > B cells = double-positive thymocytes >
single-positive thymocytes > mature peripheral T cells (see
Footnote 4).
|
Tissue-specific recognition of CD1.1
To examine this possibility, we derived a new series of hybridomas
by fusing both thymic and splenic CD8-negative T cells obtained from
B6.MHC II-/- mice with BW5147ß-.
Hypoxanthine-aminopterin-thymidine-resistant hybrids were screened for
IL-2 secretion upon stimulation with a 1/1 mixture of thymocytes and
splenocytes, and CD1-specific clones were identified by blocking their
response with anti-CD1 mAbs. Nine of these new clones and three
previously described ones (DN32.D3, DN32.F3, and 431.A11, derived from
B6 thymic NK1 T cells) (15, 16) were used for further studies. Although
some of the T cell hybridomas used the same invariant V14-J281
TCR -chain (Table I, left
column), they differed in their TCR ß-chain usage (15, 16) (data not shown).
|
). Four of 12 (DN32.D3, DN32.F3,
TA.H1, and 431.A11) responded mainly to thymocytes (producing 7–36
times more IL-2 than with splenocytes), one (1C8.DC1) responded mainly
to splenocytes (producing 16 times more IL-2 than with splenocytes),
and seven responded to both thymocytes and splenocytes (IL-2 values
within a threefold range). Thus, the results obtained with the extended
T hybridoma panel demonstrated that spleen cells could be as good or
even better CD1.1-presenting cells than thymocytes for some
CD1.1-autoreactive T cells and confirmed that for other
CD1.1-autoreactive T cells, thymocytes were the best stimulators,
implying the existence of qualitative differences in CD1.1 presentation
by different cell types. We confirmed that CD1.2 recognition is not
involved in the B6 system by showing that autoreactive T cells were
inhibited to respond to B6 thymocytes or splenocytes by blocking with
15F7 (Table I), a CD1.1-specific mAb (see Footnote 4). Since the panel of T hybridomas included cells derived from thymus cells and others derived from spleen cells, it was possible to examine whether the tissue specificity of recognition correlated with the tissue of origin. Although a large proportion (58%) of hybrids reacted to both splenic and thymic cells, it is striking to note that all four thymocyte-specific clones (DN32.D3, DN32.F3, TA.H1, and 431.A11) were derived from the thymus, and that 1C8.DC1, the single spleen cell-specific clone, was derived from the spleen. In other words, no spleen-specific hybrid was found among thymus-derived CD1.1-autoreactive cells, and conversely, no thymus-specific hybrid was found in the spleen cell-derived population. Although the dataset is relatively limited, it is strengthened by the fact that the CD1.1-autoreactive hybrids used in this study were selected with an unbiased screening assay testing for responsiveness to either thymic or splenic cells. The results suggest, therefore, that CD1.1-autoreactive cells that reside in a particular tissue may have accumulated or expanded in response to local CD1.1 presentation.
Fine tissue specificity of CD1.1-responding hybridomas
To investigate the basis of this tissue specificity, we purified
some of the major cell types in thymic and splenic populations and
compared their ability to stimulate eight of the hybridomas. To our
surprise, the level of specificity increased further, in that six
patterns now emerged (Table II). One
hybridoma, 1C8.DC1, which predominantly responded to spleen cells,
reacted only to purified DC, secreting up to 1500 U of IL-2, and was
blind to other cell types, including splenic B cells or T cells, or to
cortical or medullary thymocytes. DN32.D3 responded to cortical
thymocytes, and although no reactivity was initially detected against
whole spleen cells, a minimal response was obtained after removal of B
cells, and exposure to purified splenic DC revealed a good response,
equivalent to that against cortical thymocytes. 431.A11 responded to
cortical thymocytes, but also exhibited some variable degree of
reactivity to SP thymocytes. Purified immature
(HSAhigh) SP thymocytes, which constitute 20
to 80% of SP cells and have not yet modulated CD1.1 expression (see
Footnote 4), appeared to stimulate 431.A11 as efficiently as the DP
cells, whereas they failed to stimulate DN32.D3 (Table III). Again, despite the lack of a strong
response to whole spleen cells, reactivity of 431.A11 to DC could be
revealed after exposure to purified DC (Table II). A fourth pattern of
specificity was revealed for TB.H1 and TC.B11, which responded strongly
to B cells and DC and poorly to cortical thymocytes (Table II). TB.A7
and TB.D7 also had a unique pattern of specificity, including DC, B
cells, and cortical thymocytes. TA.H1, like 431.A11, responded to DC
and cortical thymocytes, but poorly to B cells (Table II); however,
unlike 431.A11, its recognition of CD1.1 was independent of the mouse
genetic background (data not shown and see Fig. 3), implying that TA.H1 recognizes a
sixth distinct CD1.1 ligand. Testing of these hybridomas against a
panel of mouse, rat, and human cell lines transfected with CD1.1
confirmed the high level of tissue specificity, in that TA.H1 reacted
to none, 431.A11 only responded to mouse fibroblast line C57SV, DN32.D3
responded to C57SV and also to the rat basophil leukemia cell RBL, and
1C8.DC1, TB.A7, TB.D7, and TC.B11 responded to the human C1R B cell
line in addition to C57SV and RBL (Table IV). In summary, we obtained evidence for
up to six distinct CD1.1 Ags by simply testing eight CD1.1-specific T
cell hybridomas against a limited sample of CD1.1-presenting cell
types.
|
|
|
|
).
Again, this difference was not related to polymorphism of the CD1 genes
themselves. We took advantage of the existence of reciprocal B6/B10 and
NOD congenics for the Idd10 locus, which encompasses CD1
(33). Figure 3 shows that 431.A11 recognized thymocytes with the B10,
but not the NOD, genetic background regardless of the origin of
CD1. TAP-independent recognition of CD1.1
The results described above strongly suggested that most CD1.1
molecules expressed at the cell membrane are recognized in association
with a set of coligands. The results shown in Table I demonstrate,
however, that all 12 CD1-specific hybridomas, whether using the
invariant V14 TCR -chain or other TCRs, recognized CD1.1
expressed by fresh thymocytes or splenocytes equivalently in the
presence or the absence of TAP. This correlates with the fact that
surface expression of CD1.1 by TAP-deficient cells is equivalent to
that of TAP-sufficient cells (12, 27, 40, 41). By comparison,
recognition of ß2m-deficient cells, which express
low to undetectable CD1.1, was completely abolished. The results
confirm and extend previous observations (12, 27, 40, 41), clearly
indicating that the peptide pool contributed by TAP does not influence
T cell recognition of CD1.1, either because CD1.1 is protected from
binding peptides in the endoplasmic reticulum or because TAP does not
transport peptides with the size or sequence required to bind CD1.1
efficiently. Conversely, the fact that TAP-deficient cells, which
express much less classical MHC class I molecules but similar amounts
of CD1.1 on their surface, did not induce a higher level of activation
of the CD1.1 autoreactive hybrids is noteworthy. It suggests that the
CD1.1-autoreactive hybridomas, including those derived from NK1 T cells
that express Ly49 receptors, are not susceptible to MHC class
I-mediated inhibition of activation. This finding correlates with our
observation that Ly49 receptor expression is lost upon fusion of NK1 T
cells with BW5147 ß- (data not shown).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
14 TCR -chain by mainstream developing thymocytes is
sufficient to impart the NK1 phenotype and the IL-4 secretion potential
(42). The expression of NK receptors appears to be a late, separate
event in the thymic maturation process that requires expression of the
common cytokine receptor -chain (43). In mice deficient for the
common -chain, a typical IL-4 producer V14/Vß8 population is
found in the thymus, but is arrested at a pre-NK1 stage where it does
not express NK receptors such as NK1.1 and Ly49. It is not found in the
periphery, possibly because the lack of inhibitory NK receptors, which
may be necessary to keep the TCR autoreactivity in check, prevents
escape from negative selection. The control of NK1 T cell activation
may therefore be a complex phenomenon that results from the balance
between positive signals such as those mediated by TCR autorecognition
of CD1 and possibly also by NK receptors such as NK1.1 (44) and by
negative signals such as those transduced by members of the Ly49 family
upon binding to MHC class I molecules. Thresholds and balance between
these signaling pathways may be set in the thymic environment or, as
suggested for true NK cells, may be flexible and calibrated in
different tissue environments (45). By showing that CD1.1 is constitutively expressed by peripheral APCs, notably splenic B cells and DC, and that the level of expression is stimulatory to a large fraction of CD1-specific T cell hybridomas, the present results suggest that a significant population of T cells residing in peripheral tissues may be constitutively triggered through their CD1-autoreactive TCRs. This is supported by the fact that all resident CD1.1-autoreactive cells were found to respond prominently to their own tissue of origin, whereas in some cases they did not respond to CD1.1-expressing cells of other tissues. Thus, resident CD1.1-autoreactive cells may have expanded or accumulated in response to previous local stimuli. Autoreactive responses may be down-regulated through the MHC class I-specific, inhibitory NK receptors expressed by many of these CD1-autoreactive cells, since engagement of MHC-specific inhibitory receptors can inhibit TCR-mediated activation (46, 47, 48). In addition, we have found that none of the T hybridomas used in this study expressed such NK receptors as NK1.1, Ly49A, C, or I (not shown) even though many originated from the fusion of T cells that did express these receptors. A similar observation was recently reported by Shimamura et al. (18). Together, these results suggest that the latent autoreactivity of NK1 T cells may be revealed in hybridomas, not because of inherent differences in activation thresholds, but because they have lost the suppressor arm of the activation control.
Key to understanding the biology of CD1 is the question of the nature of the CD1 ligands recognized by T cells. There is evidence that CD1.1 may be expressed on the membrane as a stable empty molecule and also that it may bind hydrophobic peptides with a putative anchoring motif (10, 11, 12). In addition, sequence analysis has revealed two remarkable features that may govern crucial aspects of intracellular trafficking and Ag presentation. First, the intracytoplasmic tail of CD1.1 displays an endosomal targeting signal similar to that of human CD1b (6), and second, the CD1.1 leader peptide itself (14) displays the canonical CD1.1 binding motif elucidated by Castano et al. (10). These observations have led us to propose a model where the head (leader peptide) and the tail of CD1.1 play a role that is similar in essence to that of the C- and the N-termini of the invariant chain involved in the MHC class II pathway, protecting the groove from Ag loading in the endoplasmic reticulum and driving CD1.1 to sample Ags in the endosomal compartment (14). The model is compatible with the idea that CD1.1 may be expressed and recognized in association with a variety of self as well as foreign hydrophobic ligands of peptidic or lipidic nature.
The results presented in this paper support the existence of such ligands. Indeed, cell type specificity of antigenic recognition by T cells usually reflects the recognition of tissue-specific peptides (49), but might also be related to the presence of distinct lipid Ags (5, 7, 8, 9). Another possibility is the existence of variably glycosylated residues in CD1 that would alter the interaction with some TCRs, although it seems unlikely that they could generate such a high level of diversity. Costimulatory ligands differentially expressed on various cell types could also account for tissue specificity of activation, but they are unlikely to account for the present results for several reasons. Firstly, T hybridomas are notoriously less dependent than fresh cells on costimulation for activation (50); secondly, the level of diversity observed would require the existence and differential expression of several costimulatory ligands/receptors by both CD1.1-presenting cells and T hybrids; finally, since known costimulatory ligands and receptors are conserved and sometimes even work across species (51), they would not account for the fact that the 431.A11 hybrid only responds to CD1.1-expressing cells of a particular C57/C58 genetic background. The differential expression of MHC-specific inhibitory receptors by T hybridomas is also unlikely, since they do not seem to express most receptors encoded in the NK complex, and many of the cell types used in this study have the same MHC genotype. In addition TAP-deficient CD1.1-expressing cells stimulate T hybrids to the same extent as wild-type cells.
Thus, despite the fact that no successful elution of putative CD1-bound
ligands has been reported to date, the explanation for the phenomenon
of tissue specificity reported in this paper may well reside in the
demonstrated ability of CD1.1 to bind synthetic peptides or in its
putative ability to bind lipids. Furthermore, the fact that tissue
specificity of recognition is also observed with T hybridomas using the
invariant V14-J281 TCR -chain suggests that fine specificity
differences can be imparted solely by the TCR ß-chain.
Although there is no indication at the moment as to the nature of a putative, enigmatic set of natural peptides or lipids, the cross-species conservation of the CD1d isotype and of semi-invariant CD1-autoreactive TCRs suggests that these ligands share at least some conserved features. In addition, the high level of tissue specificity demonstrated by our experiments suggests that the ligands expressed in some cell types only partially overlap. Tissue specificity may be more apparent in those cell types that express relatively lower amounts of CD1.1, because ligands would compete for CD1.1 binding, whereas DC that express higher levels of CD1.1 also seem to express a fuller set of CD1 ligands.
It remains unclear whether tissue-specific CD1 ligands elicit distinct functional subsets of autoreactive T cells, or whether their diversity has little functional significance but is merely a reflection of the fact that the self Ags associated with CD1 only partially overlap in different tissues. In any case, the results presented in this paper suggest that CD1.1 is naturally associated with self ligands and therefore imply that it might also present foreign ligands. Future studies aiming at identifying these putative self and foreign ligands associated with CD1.1 should provide major insights into the biology of the CD1 system and the pathway of immune regulation by CD1-autoreactive T cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Albert Bendelac, Department of Molecular Biology, Princeton University, Washington Rd., Princeton, NJ 08544. E-mail address:
3 Abbreviations used in this paper: KO, knockout; NOD, nonobese diabetic; HSA, heat-stable Ag; DC, dendritic cells; PE, phycoerythrin; high, high level; low, low level.
4 J. H. Roark, S.-H. Park, J. Jayawardena, U. Kavita, M. Shannon, and A. Bendelac. CD1.1 expression by mouse Ag presenting cells and marginal zone B cells. Submitted for publication.
Received for publication September 17, 1997. Accepted for publication November 26, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß+ T cells. Nature 372:691.[Medline]
chain is used by a unique subset of MHC class I-specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 180:1097.14 TCR chain in NK1.1+ T cell populations. Int. Immunol. 7:1157.14-J281 rearrangements in NK1+ T cells. Eur. J. Immunol. 27:1576.[Medline]
/ß T cells demonstrates preferential use of several Vß genes and an invariant TCR chain. J. Exp. Med. 178:1./ß CD4–8- subset. J. Exp. Med. 177:1763.24-JQ/Vß11 T cell receptor is expressed in all individuals by clonally expanded CD4–8- T cells. J. Exp. Med. 180:1171.24+ CD4-CD8- T cells. J. Exp. Med. 186:109.ß T cell receptors in transporters associated with antigen presentation-1 null and thymus leukemia antigen positive mice. J. Exp. Med. 184:1579. production by natural killer (NK) cells and NK1.1+ T cells upon NKR-P1 cross-linking. J. Exp. Med. 183:2391.This article has been cited by other articles:
|
|
 |
|
  S.-B. Jeon, H. J. Yoon, S.-H. Park, I.-H. Kim, and E. J. Park Sulfatide, A Major Lipid Component of Myelin Sheath, Activates Inflammatory Responses As an Endogenous Stimulator in Brain-Resident Immune Cells J. Immunol., December 1, 2008; 181(11): 8077 - 8087. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Cheng, A. Ueno, S. Cho, J. S. Im, S. Golby, S. Hou, S. A. Porcelli, and Y. Yang Efficient Activation of V{alpha}14 Invariant NKT Cells by Foreign Lipid Antigen Is Associated with Concurrent Dendritic Cell-Specific Self Recognition J. Immunol., March 1, 2007; 178(5): 2755 - 2762. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Shimizu, A. Goto, M. Fukui, M. Taniguchi, and S.-i. Fujii Tumor Cells Loaded with {alpha}-Galactosylceramide Induce Innate NKT and NK Cell-Dependent Resistance to Tumor Implantation in Mice J. Immunol., March 1, 2007; 178(5): 2853 - 2861. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Raghuraman, Y. Geng, and C.-R. Wang IFN-beta-Mediated Up-Regulation of CD1d in Bacteria-Infected APCs J. Immunol., December 1, 2006; 177(11): 7841 - 7848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. I. Zimmer, A. Colmone, K. Felio, H. Xu, A. Ma, and C.-R. Wang A Cell-Type Specific CD1d Expression Program Modulates Invariant NKT Cell Development and Function J. Immunol., February 1, 2006; 176(3): 1421 - 1430. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Geng, P. Laslo, K. Barton, and C.-R. Wang Transcriptional Regulation of CD1D1 by Ets Family Transcription Factors J. Immunol., July 15, 2005; 175(2): 1022 - 1029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Bezbradica, A. K. Stanic, N. Matsuki, H. Bour-Jordan, J. A. Bluestone, J. W. Thomas, D. Unutmaz, L. Van Kaer, and S. Joyce Distinct Roles of Dendritic Cells and B Cells in Va14Ja18 Natural T Cell Activation In Vivo J. Immunol., April 15, 2005; 174(8): 4696 - 4705. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. O. A. Yu, J. S. Im, A. Molano, Y. Dutronc, P. A. Illarionov, C. Forestier, N. Fujiwara, I. Arias, S. Miyake, T. Yamamura, et al. Modulation of CD1d-restricted NKT cell responses by using N-acyl variants of {alpha}-galactosylceramides PNAS, March 1, 2005; 102(9): 3383 - 3388. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Oh, S. Kim, S.-H. Park, H. Gu, D. Roopenian, D. H. Chung, Y. S. Kim, and D.-S. Lee Direct Regulatory Role of NKT Cells in Allogeneic Graft Survival Is Dependent on the Quantitative Strength of Antigenicity J. Immunol., February 15, 2005; 174(4): 2030 - 2036. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Rauch, J. Gumperz, C. Robinson, M. Skold, C. Roy, D. C. Young, M. Lafleur, D. B. Moody, M. B. Brenner, C. E. Costello, et al. Structural Features of the Acyl Chain Determine Self-phospholipid Antigen Recognition by a CD1d-restricted Invariant NKT (iNKT) Cell J. Biol. Chem., November 28, 2003; 278(48): 47508 - 47515. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. K. Stanic, R. Shashidharamurthy, J. S. Bezbradica, N. Matsuki, Y. Yoshimura, S. Miyake, E. Y. Choi, T. D. Schell, L. Van Kaer, S. S. Tevethia, et al. Another View of T Cell Antigen Recognition: Cooperative Engagement of Glycolipid Antigens by Va14Ja18 Natural TCR J. Immunol., November 1, 2003; 171(9): 4539 - 4551. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Xu, T. Chun, A. Colmone, H. Nguyen, and C.-R. Wang Expression of CD1d Under the Control of a MHC Class Ia Promoter Skews the Development of NKT Cells, But Not CD8+ T Cells J. Immunol., October 15, 2003; 171(8): 4105 - 4112. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Cernadas, M. Sugita, N. van der Wel, X. Cao, J. E. Gumperz, S. Maltsev, G. S. Besra, S. M. Behar, P. J. Peters, and M. B. Brenner Lysosomal Localization of Murine CD1d Mediated by AP-3 Is Necessary for NK T Cell Development J. Immunol., October 15, 2003; 171(8): 4149 - 4155. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. K. Stanic, A. D. De Silva, J.-J. Park, V. Sriram, S. Ichikawa, Y. Hirabyashi, K. Hayakawa, L. Van Kaer, R. R. Brutkiewicz, and S. Joyce Defective presentation of the CD1d1-restricted natural Va14Ja18 NKT lymphocyte antigen caused by beta -D-glucosylceramide synthase deficiency PNAS, February 18, 2003; 100(4): 1849 - 1854. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Grubor-Bauk, A. Simmons, G. Mayrhofer, and P. G. Speck Impaired Clearance of Herpes Simplex Virus Type 1 From Mice Lacking CD1d or NKT Cells Expressing the Semivariant V{alpha}14-J{alpha}281 TCR J. Immunol., February 1, 2003; 170(3): 1430 - 1434. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Sfondrini, D. Besusso, M. T. Zoia, M. Rodolfo, A. M. Invernizzi, M. Taniguchi, T. Nakayama, M. P. Colombo, S. Menard, and A. Balsari Absence of the CD1 Molecule Up-Regulates Antitumor Activity Induced by CpG Oligodeoxynucleotides in Mice J. Immunol., July 1, 2002; 169(1): 151 - 158. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Benlagha, T. Kyin, A. Beavis, L. Teyton, and A. Bendelac A Thymic Precursor to the NK T Cell Lineage Science, April 19, 2002; 296(5567): 553 - 555. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Ikarashi, R. Mikami, A. Bendelac, M. Terme, N. Chaput, M. Terada, T. Tursz, E. Angevin, F. A. Lemonnier, H. Wakasugi, et al. Dendritic Cell Maturation Overrules H-2D-mediated Natural Killer T (NKT) Cell Inhibition: Critical Role for B7 in CD1d-dependent NKT Cell Interferon {gamma} Production J. Exp. Med., October 15, 2001; 194(8): 1179 - 1186. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Matsuda, L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, and M. Kronenberg Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor beta repertoire and small clone size PNAS, October 5, 2001; (2001) 221445298. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Trobonjaca, F. Leithauser, P. Moller, H. Bluethmann, Y. Koezuka, H. R. MacDonald, and J. Reimann MHC-II-Independent CD4+ T Cells Induce Colitis in Immunodeficient RAG-/- Hosts J. Immunol., March 15, 2001; 166(6): 3804 - 3812. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Viret, O. Lantz, X. He, A. Bendelac, and C. A. Janeway Jr. A NK1.1+ Thymocyte-Derived TCR {beta}-Chain Transgene Promotes Positive Selection of Thymic NK1.1+ {alpha}{beta} T Cells J. Immunol., September 15, 2000; 165(6): 3004 - 3014. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Apostolou, A. Cumano, G. Gachelin, and P. Kourilsky Evidence for Two Subgroups of CD4-CD8- NKT Cells with Distinct TCR{alpha}{beta} Repertoires and Differential Distribution in Lymphoid Tissues J. Immunol., September 1, 2000; 165(5): 2481 - 2490. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Burdin, L. Brossay, M. Degano, H. Iijima, M. Gui, I. A. Wilson, and M. Kronenberg Structural requirements for antigen presentation by mouse CD1 PNAS, August 29, 2000; 97(18): 10156 - 10161. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. D. D'Souza, A. M. Cooper, A. A. Frank, S. Ehlers, J. Turner, A. Bendelac, and I. M. Orme A Novel Nonclassic beta 2-Microglobulin-Restricted Mechanism Influencing Early Lymphocyte Accumulation and Subsequent Resistance to Tuberculosis in the Lung Am. J. Respir. Cell Mol. Biol., August 1, 2000; 23(2): 188 - 193. [Abstract] [Full Text]
|
|
|
|
|
|
M. Skold, N. N. Faizunnessa, C.-R. Wang, and S. Cardell CD1d-Specific NK1.1+ T Cells with a Transgenic Variant TCR J. Immunol., July 1, 2000; 165(1): 168 - 174. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Molano, S.-H. Park, Y.-H. Chiu, S. Nosseir, A. Bendelac, and M. Tsuji Cutting Edge: The IgG Response to the Circumsporozoite Protein Is MHC Class II-Dependent and CD1d-Independent: Exploring the Role of GPIs in NK T Cell Activation and Antimalarial Responses J. Immunol., May 15, 2000; 164(10): 5005 - 5009. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Matsuura, M. Kinebuchi, H.-Z. Chen, S. Katabami, T. Shimizu, Y. Hashimoto, K. Kikuchi, and N. Sato NKT Cells in the Rat: Organ-Specific Distribution of NK T Cells Expressing Distinct V{alpha}14 Chains J. Immunol., March 15, 2000; 164(6): 3140 - 3148. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Wang, T. Chun, and C.-R. Wang Comparative Contribution of CD1 on the Development of CD4+ and CD8+ T Cell Compartments J. Immunol., January 15, 2000; 164(2): 739 - 745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Zeng, G. Gazit, S. Dejbakhsh-Jones, S. P. Balk, S. Snapper, M. Taniguchi, and S. Strober Heterogeneity of NK1.1+ T Cells in the Bone Marrow: Divergence from the Thymus J. Immunol., November 15, 1999; 163(10): 5338 - 5345. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Hong and L. Van Kaer Immune Privilege: Keeping an Eye on Natural Killer T Cells J. Exp. Med., November 1, 1999; 190(9): 1197 - 1200. [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yamada, I. Kurimoto, and J. W. Streilein Role of CD4+ T Cells in Immunobiology of Orthotopic Corneal Transplants in Mice Invest. Ophthalmol. Vis. Sci., October 1, 1999; 40(11): 2614 - 2621. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-H. Park, D. Guy-Grand, F. A. Lemonnier, C.-R. Wang, A. Bendelac, and B. Jabri Selection and Expansion of CD8{alpha}/{alpha}1 T Cell Receptor {alpha}/{beta}1 Intestinal Intraepithelial Lymphocytes in the Absence of Both Classical Major Histocompatibility Complex Class I and Nonclassical CD1 Molecules J. Exp. Med., September 20, 1999; 190(6): 885 - 890. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Tomura, W.-G. Yu, H.-J. Ahn, M. Yamashita, Y.-F. Yang, S. Ono, T. Hamaoka, T. Kawano, M. Taniguchi, Y. Koezuka, et al. A Novel Function of V{alpha}14+CD4+NKT Cells: Stimulation of IL-12 Production by Antigen-Presenting Cells in the Innate Immune System J. Immunol., July 1, 1999; 163(1): 93 - 101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Behar, C. C. Dascher, M. J. Grusby, C.-R. Wang, and M. B. Brenner Susceptibility of Mice Deficient in CD1D or TAP1 to Infection with Mycobacterium tuberculosis J. Exp. Med., June 21, 1999; 189(12): 1973 - 1980. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Benlagha, A. Weiss, A. Beavis, L. Teyton, and A. Bendelac In Vivo Identification of Glycolipid Antigen-specific T Cells Using Fluorescent CD1d Tetramers J. Exp. Med., June 6, 1999; 191(11): 1895 - 1904. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Eberl, R. Lees, S. T. Smiley, M. Taniguchi, M. J. Grusby, and H. R. MacDonald Tissue-Specific Segregation of CD1d-Dependent and CD1d-Independent NK T Cells J. Immunol., June 1, 1999; 162(11): 6410 - 6419. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-H. Chen, B. Wang, T. Chun, L. Zhao, S. Cardell, S. M. Behar, M. B. Brenner, and C.-R. Wang Expression of CD1d2 on Thymocytes Is Not Sufficient for the Development of NK T Cells in CD1d1-Deficient Mice J. Immunol., April 15, 1999; 162(8): 4560 - 4566. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Chang, L. Brossay, M. Kronenberg, and K. P. Kane The Murine Nonclassical Class I Major Histocompatibility Complex-like CD1.1 Molecule Protects Target Cells from Lymphokine-activated Killer Cell Cytolysis J. Exp. Med., February 1, 1999; 189(3): 483 - 491. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-H. Chiu, J. Jayawardena, A. Weiss, D. Lee, S.-H. Park, A. Dautry-Varsat, and A. Bendelac Distinct Subsets of CD1d-restricted T Cells Recognize Self-antigens Loaded in Different Cellular Compartments J. Exp. Med., January 4, 1999; 189(1): 103 - 110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Behar, T. A. Podrebarac, C. J. Roy, C. R. Wang, and M. B. Brenner Diverse TCRs Recognize Murine CD1 J. Immunol., January 1, 1999; 162(1): 161 - 167. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Brossay, M. Chioda, N. Burdin, Y. Koezuka, G. Casorati, P. Dellabona, and M. Kronenberg CD1d-mediated Recognition of an alpha -Galactosylceramide by Natural Killer T Cells Is Highly Conserved through Mammalian Evolution J. Exp. Med., October 19, 1998; 188(8): 1521 - 1528. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Matsuda, L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, and M. Kronenberg Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor beta repertoire and small clone size PNAS, October 23, 2001; 98(22): 12636 - 12641. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
