HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Colonna, M. Articles by Rolink, A. Search for Related Content PubMed PubMed Citation Articles by Colonna, M. Articles by Rolink, A.

Cutting Edge: Human Myelomonocytic Cells Express an Inhibitory Receptor for Classical and Nonclassical MHC Class I Molecules¹

Marco Colonna^2,*, Jacqueline Samaridis^*, Marina Cella^*, Lena Angman^*, Rachel L. Allen, Chris A. O’Callaghan, Rod Dunbar, Graham S. Ogg, Vincenzo Cerundolo and Antonius Rolink^*

^* Basel Institute for Immunology, Basel, Switzerland; Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, United Kingdom

	Abstract

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Leukocyte activation can be negatively regulated by inhibitory receptors specific for MHC class I molecules. While one inhibitory receptor, Ig-like transcript 2 (ILT2), is expressed by all lymphoid and myelomonocytic cell types, other receptors display a more selective tissue distribution. Here we characterize an inhibitory receptor, termed ILT4, which is selectively expressed in monocytes, macrophages, and dendritic cells (DCs), binds classical class I molecules and the nonclassical class I molecules HLA-G, and transduces negative signals that can inhibit early signaling events triggered by stimulatory receptors. ILT4 may control inflammatory responses and cytotoxicity mediated by myelomonocytic cells and may modulate their Ag-presenting functions, focusing immune responses to microbial challenges and avoiding autoreactivity.

	Introduction

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Natural killer (NK) cells display cell surface receptors that monitor expression of class I molecules on neighboring cells and deliver a negative signal that blocks NK cell-mediated cytotoxicity of class I-bearing normal cells (1). Inhibitory MHC class I receptors belong to either the Ig-superfamily (Ig-SF),³ named killer cell inhibitory receptors, or to the C-type lectin superfamily (2, 3). Both types of receptors display cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). Upon receptor engagement with class I molecules, ITIMs are tyrosine phosphorylated and recruit protein tyrosine phosphatases, which appear to be the major cytosolic mediators of NK cell inhibition (4).

Recently, new families of Ig-SF receptors have been identified that are homologous to killer cell inhibitory receptors in their extracellular domains and display cytoplasmic ITIMs (reviewed in 5 . Interestingly, these receptors are not expressed just in NK cells but also in other cell types involved in the immune response. One of these receptors, Ig-like transcript (ILT) 2, is expressed on NK and T cell subsets, B lymphocytes, and myelomonocytic cells and is specific for MHC class I molecules (6, 7, 8). Other receptors show a more restricted pattern of expression. ILT3 is expressed only in myelomonocytic cells and inhibits cell activation, but its ligand specificity is unknown (9). ILT4 and ILT5 have also been cloned from cDNA derived from myelomonocytic cells and are predicted to encode glycoproteins characterized by an extracellular region of 4 Ig-SF domains and a cytoplasmic tail containing 3 or 4 ITIMs, respectively (8, 9). However, no information is available on their ligands and their function in myelomonocytic cells.

Here we show that ILT4 is selectively expressed on myelomonocytic cells, binds both classical and nonclassical class I molecules with broad specificity, recruits SHP-1 protein tyrosine phosphatase, and mediates a negative signal that inhibits early signaling events. ILT5 also delivers inhibitory signals but apparently does not interact with any of the class I molecules available for testing. Thus, activation of myelomonocytic cells appears to be negatively regulated by a variety of inhibitory receptors with distinct ligands, some of which are still unknown.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Cells

NK cells, EBV-transformed B cell lines, monocytes, macrophages, dendritic cells (DCs), MHC class I-deficient 721.221 cells, and HLA-A*0301-, -B*2705, -Cw*0301, -Cw*0501, and -G1 transfectants of 721.221 were obtained and cultured as previously reported (8, 9). Peripheral B cells were cultured and activated in the presence of CD40L-transfected J558L mouse myeloma cells (10).

Transfections

ILT4 and ILT5 cDNAs were subcloned into pFLAG-CMV-1 (Kodak, Rochester, NY) and transfected either transiently in COS7 cells or stably in rat basophilic leukemia (RBL) cells, as described (8). ILT4 and ILT5 cell surface expression was checked by FACS analysis after staining with the anti-FLAG peptide M2 mAb (Kodak).

Production of ILT4, ILT5, and MHC class I soluble proteins

The extracellular regions of ILT4 and ILT5 were produced as soluble proteins containing the myc epitope and a polyhistidine metal-binding domain at the carboxyl terminus of the protein, using the pSecTag system (Invitrogen, Carlsbad, CA). Streptavidin-PE (SAV-PE)-conjugated HLA-A2, -B8, -B27, and -B35 tetramers were produced as previously described (11).

Binding assays

HLA class I-transfected and -untransfected 721.221 cells were incubated with soluble ILT4 or ILT5, and binding was detected by FACS analysis, using the anti-myc epitope 9E10 mAb and/or an anti-oligohistidine mAb (Invitrogen), followed by PE-labeled goat anti-mouse IgG Ab (Southern Biotechnology, Birmingham, AL). ILT4- and ILT5-transfected COS7 cells and untransfected cells were incubated with PE-conjugated HLA-A2, -B8, -B27, and -B35 tetramers for 1 h at 4°C and analyzed by FACS.

Serotonin release

ILT4- and ILT5-transfected and untransfected RBL cells were pulsed with [³H]hydroxytryptamine (NEN, Boston, MA) and plated in 96-well flat-bottom plates precoated with 20 µg/ml of mouse anti-TNP IgE (PharMingen) alone or in combination with either 20 µg/ml of the anti-FLAG M2 mAb or 20 µg/ml of control IgG1 mAb (mouse anti-human CD38, PharMingen, San Diego, CA). In another set of experiments, [³H]hydroxytryptamine-pulsed cells were plated in 96-well flat-bottom plates containing either HLA-class I-transfected or untransfected 721.221 cells coated with TNP and mouse anti-TNP IgE. Serotonin release was measured as described (8). To coat cells with TNP-IgE, cells were first incubated with glutamyl-glutamic-ether-phosphatidylethanolamine (Glu2-EPE)-conjugated TNP (kindly provided by Dr. Weltzien, Max Planck Institute, Freiburg, Germany) (12) and then with mouse anti-TNP IgE (20 µg/ml).

Immunoprecipitations and immunoblottings

ILT4 was immunoprecipitated from ¹²⁵I surface-labeled ILT4-transfected RBL cells with anti-FLAG M2 mAb and analyzed by standard SDS-PAGE under reducing conditions. In immunoblotting experiments, ILT4 was immunoprecipitated with anti-FLAG M2 mAb from ILT4-transfected RBL cells either stimulated with pervanadate or unstimulated as described (8). Precipitates were resolved by SDS-PAGE under nonreducing conditions, transferred to nitrocellulose membranes, and immunoblotted with anti-SHP-1, anti-SHP-2 (Santa Cruz Biotechnology), or with anti-SHIP (kindly provided by Dr. Mark Coggeshall, Ohio State University, Columbus, OH) rabbit antisera as previously described (8).

RT-PCR and oligonucleotide primers

An 800-bp fragment of ILT4 fragment was amplified from different RNAs by RT-PCR, as previously described (6). Amplification primers were as follows: sense, ACCCCCTGGACATCCTGATCAC; antisense, TGGAGTCTGCGTACCCTCC. Amplified ILT4 cDNA fragments were separated by electrophoresis, transferred to a nylon membrane, and hybridized with the ILT4-specific ³²P-labeled oligonucleotide GGATGTTGGAAATCAGCCTT. In control experiments, a 300-bp cDNA fragment of ß-actin was amplified by RT-PCR from the same RNAs (6).

Production of anti-ILT4 mAbs and FACS analysis

Ten-wk-old Wistar rats were immunized three times with ILT4-transfected RBL cells. 42D1 mAb was selected by flow cytometry for staining ILT4-transfected RBL cells, as compared with ILT5-transfected and untransfected RBL cells.

Measurement of cytosolic calcium

Cells were loaded with Indo-1 AM (Sigma, St. Louis, MO) and then incubated for 5 min on ice with the anti-ILT4 mAb 42D1. The IV.3 mAb specific for FcRII (HB217, American Type Culture Collection, Rockville, MD) or the 3.8B1 mAb (mouse anti-human HLA-DR (9)) were added, and incubation was continued for 15 min on ice. After washing with RPMI 1640-5%FCS, cells were shifted to 37°C for 15 min followed by addition of 10 µg of a cross-linking Ab (goat anti-mouse IgG+IgM (H+L, cross-reactive with rat Ig; Jackson ImmunoResearch Laboratories, West Grove, PA). Cells were analyzed on a flow cytofluorometer as described (9).

	Results and Discussion

Top Abstract Introduction Materials and Methods Results and Discussion References

 
ILT4 binds MHC class I molecules

To test whether ILT4 interacts with HLA-class I molecules, we analyzed binding of a soluble ILT4 protein to class I transfectants in 721.221 cells by flow cytometry. As shown in Figure 1A, ILT4 bound to HLA-A and -B molecules, and to the non classical class I molecule HLA-G1; no binding was detected with HLA-Cw3, -Cw5-transfected or untransfected cells. To further demonstrate interaction between ILT4 and class I molecules, we tested whether soluble class I molecules bind to ILT4-transfected cells. Soluble HLA-A*0201, -B*0801, -B*2705, and -B*3501 tetramers complexed either with influenza- or HIV-derived viral peptides (11) bound ILT4-transfected COS cells (Fig. 1B) but not untransfected COS cells (data not shown). We also tested whether a soluble ILT5 protein binds to class I transfectants (data not shown) and whether class I tetramers bind ILT5-transfected COS cells (Fig. 1C). However, no significant binding of ILT5 with class I molecules was detected in any of these assays. These data demonstrate that ILT4 (but not ILT5) binds HLA-class I molecules, apparently with a broad specificity for both classical and nonclassical class I molecules.

View larger version (38K): [in this window] [in a new window]   FIGURE 1. A, ILT4 soluble protein binds HLA-A*0301, -B*2705, and -G1 transfectants, but not HLA-Cw*0301, -Cw*0501 and untransfected 721.221 cells. Cells were incubated either with (bold profiles) or without (shaded profiles) a soluble ILT4 fusion protein, followed by an anti-myc epitope or an anti-oligohistidine mAb and by PE-labeled goat anti-mouse IgG Ab. Binding was analyzed by FACS analysis. The level of class I expression on transfectants was determined by FACS analysis with W6/32 mAb and did not correlate with binding of ILT4. A soluble ILT5 fusion protein did not bind to any of the class I transfectants (data not shown). B, HLA-class I soluble proteins bind ILT4-transfected COS cells. ILT4 transiently transfected COS cells were incubated with soluble HLA-A*0201, -B*0801, -B*2705, and -B*3501 labeled with SAV-PE. Binding was assessed by FACS analysis. SAV-PE clone was used as negative control. ILT4 expression on transfected COS cells was determined in the same experiment by FACS analysis using the anti-FLAG peptide mAb (M2). C, HLA-class I tetramers did not bind to ILT5-transfected COS cells.

To determine whether ILT4 can inhibit cell activation triggered via a stimulatory receptor, ILT4 was stably expressed as an amino-terminal FLAG peptide fusion protein in RBL cells, which release serotonin upon engagement of the Fc receptor for IgE (FcRI) (8). As shown in Figure 2A, secretion of serotonin triggered via the FcRI was inhibited when ILT4 was coengaged, using the anti-FLAG peptide Ab immobilized on plastic to mimic the ILT4 ligand. Similar results were obtained using ILT5-transfected RBL cells, indicating that ILT5 delivers an inhibitory signal as well. To demonstrate that ILT4 delivers a negative signal when engaged with its physiologic class I ligands, ILT4-transfected RBL cells were incubated with either class I-transfected or untransfected 721.221 cells coated with TNP and mouse anti-TNP IgE. As shown in Figure 2B, serotonin secretion was reduced when ILT4-RBL cells were incubated with TNP-IgE-coated cells expressing either HLA-A*0301 or HLA-B*2705, but not HLA-Cw*0301. In contrast, no inhibition of serotonin release was observed by incubating ILT5-transfected-RBL cells with TNP-IgE-coated class I transfectants, confirming that ILT5 does not interact with class I molecules, at least those used in these assays.

View larger version (35K): [in this window] [in a new window]   FIGURE 2. Engagement of ILT4 by Ab or class I ligands inhibits IgE-induced serotonin release in ILT4-transfected RBL cells. A, ILT4-, ILT5-transfected and control RBL cells were stimulated with purified mouse IgE (20 µg/ml) alone and in combination either with the M2 mAb (20 µg/ml) or with the anti-ILT4 42D1 mAb (20 µg/ml) or with an IgG1 control Ab (20 µg/ml) immobilized on plastic (for description of 42D1 mAb see Fig. 4 and 5). B, ILT4-, ILT5-transfected and untransfected RBL cells were conjugated with either HLA-A*0301, or HLA-B*2705-, or HLA-Cw*0301-transfected or untransfected 721.221 cells, coated with TNP and mouse anti-TNP IgE. Serotonin release is expressed as percentage of maximum serotonin release obtained with mouse anti TNP-IgE (A) or TNP-IgE coated 721.221 cells (B).

ILT4 is an 95-kDa molecule associated with SHP-1 phosphatase

Since the cytoplasmic tail of ILT4 contains 3 tyrosine-based motifs similar to those that recruit SHP-1 phosphatase in ILT2 (7, 8), we determined whether ILT4 also recruits phosphatases. ILT4 was immunoprecipitated from ¹²⁵I-labeled ILT4-transfected RBL cells using the M2 mAb as a broad band of 95 kDa under reducing conditions (Fig. 3, upper panel). The heterogeneity of ILT4 was most likely due to different degrees of glycosylation. ILT4 was then immunoprecipitated from unlabeled ILT4-transfected RBL cells either unstimulated or stimulated with pervanadate. Immunoprecipitates were immunoblotted with anti-SHP-1, anti-SHP-2, and anti-SHIP Abs. As shown in Figure 3 (lower panel), ILT4 was constitutively associated with SHP-1, and this association was increased after treatment with pervanadate, whereas no association was detected with SHP-2 or SHIP (data not shown).

View larger version (28K): [in this window] [in a new window]   FIGURE 3. ILT4 is a 95-kDa glycoprotein associated with SHP-1. Top panel, ILT4 tagged with an N-terminal FLAG peptide is immunoprecipitated from 125I-labeled ILT4-transfected RBL cells with the M2 mAb as a 95-kDa band in SDS-PAGE under reducing conditions. No bands were detected using a control IgG1 mAb as immunoprecipitating Ab. Bottom panel, ILT4 is associated with SHP-1. ILT4-transfected RBL cells were incubated for 10 min at 37°C either with medium alone or with pervanadate. ILT4 was then immunoprecipitated with the M2 mAb, and immunoprecipitates were separated by SDS-PAGE and immunoblotted with anti-SHP-1 Ab. Whole cell lysates were included as a positive control. SHP-1 association with ILT4 is increased after cell stimulation with pervanadate.

The precise pattern of expression of ILT4 was determined by RT-PCR. An ILT4 cDNA fragment was clearly detected in PBMC, monocytes, macrophages derived from purified monocytes, immature DCs, and DCs stimulated either with bacterial products, inflammatory cytokines, or via CD40-CD40L interactions to induce maturation (Fig. 4, top panel). Strong expression was also detected in the bone marrow cells. No expression was found in NK cells, T cells, EBV-transformed B cell lines (Fig. 4, top panel), peripheral B cells, or neutrophils (data not shown). To determine whether ILT4 is capable of an inhibitory function in myelomonocytic cells, we produced an anti-ILT4 mAb, using ILT4-transfected RBL cells as immunogen. Anti-ILT4 42D1 mAb stained monocytes and DCs, but not purified peripheral B cells, NK cells (Fig. 4, bottom panel), and T cells (data not shown), confirming the expression pattern previously demonstrated by RT-PCR. Using the 42D1 mAb as ligand for ILT4, we tested whether coengagement of ILT4 can inhibit Ca²⁺ mobilization triggered via the FcRII (13) and HLA-DR (9). Co-cross-linking of ILT4 with FcRII (Fig. 5) or HLA-DR (data not shown) induced a clear reduction of the increased [Ca²⁺]_i triggered through these receptors in DCs. These results demonstrate that engagement of ILT4 can negatively modulate signaling in myelomonocytic cells.

View larger version (46K): [in this window] [in a new window]   FIGURE 4. ILT4 cDNA is expressed in myelomonocytic cells. Top panel, An ILT4 cDNA fragment is detectable by RT-PCR in PBMCs, monocytes, macrophages, immature (VIId and XId), and mature DCs (TNF-, LPS, CD40L), and bone marrow cells, whereas no bands are detectable in NK cells, B cell lines, and T cells. Bottom panel, 42D1 mAb, which is specific for ILT4, stains peripheral blood monocytes (A) and DCs (B), whereas no reactivity is observed on peripheral activated B cells (C) (10), and NK polyclonal cells (D). Shaded profiles illustrate staining with an isotype-matched control Ab.

View larger version (42K): [in this window] [in a new window]   FIGURE 5. Intracellular Ca2+ mobilization is induced in DCs by the IV.3 mAb specific for the stimulatory isoform of the FcRII (upper panel). Cross-linking of FcRII with ILT4 abolishes Ca2+ mobilization (lower panel).

Our results show that ILT4 is selectively expressed in myelomonocytic cells, binds MHC class I molecules, and inhibits early signaling events triggered via stimulatory receptors. At present, it is not known which cellular functions are controlled by ILT4. ILT4 may modulate one or several of the antigen presenting functions mediated by myelomonocytic cells, such as antigen uptake and presentation, migratory capacity, cytokine production, and costimulatory function (14). ILT4 may also control inflammatory responses mediated by monocyte-macrophages, such as oxidative burst, or inhibit their cytotoxicity, enabling them to recognize tumor cells that have lost expression of self-class I molecules (15, 16). It is noteworthy that ILT4 binds HLA-G, a nonclassical class I molecule selectively expressed in the trophoblast, a tissue of fetal origin devoid of HLA-A and -B molecules that separates the developing embryo from the mother. The recognition of HLA-G by ILT4 may play a role in maternal tolerance against the fetal semiallograft.

	Acknowledgments

 
We thank Mark Dessing and Annette Pickert (Basel Institute for Immunology) for expert technical advice in FACS and Ca²⁺ mobilization analyses; Daniel Geraghty and Charles T. Lutz for the kind gift of HLA-class I transfectants; Peter Lane for CD40L-transfected J558L cells; Mark Coggeshall for Abs; Dr. Weltzien for Glu2-EPE-conjugated TNP; and Siamak Bahram, Kerry S. Campbell, Susan Gilfillan (Basel Institute for Immunology) for reviewing the manuscript.

	Footnotes

 
¹ The Basel Institute for Immunology was founded and is supported by Hoffmann-La Roche, Basel, Switzerland.

² Address correspondence and reprint requests to Marco Colonna, Basel Institute for Immunology, 487 Grenzacherstrasse, CH-4005 Basel, Switzerland. E-mail address:

³ Abbreviations used in this paper: Ig-SF, Ig-superfamily; DC, dendritic cells; ILT, Ig-like transcript; ITIM, immunoreceptor tyrosine-based inhibitory motif; RBL, rat basophilic leukemia; PE, phycoerythrin; SAV-PE, streptavidin-PE; TNP, 2,4,6 trinitrophenyl; SHP, SH2-containing protein tyrosine phosphatase; SHIP, SH2-containing inositol phosphatase.

Received for publication December 1, 1997. Accepted for publication January 29, 1998.

	References

Top Abstract Introduction Materials and Methods Results and Discussion References

 

1. Ljunggren, H. G., K. Karre. 1990. In search of the "missing self": MHC molecules and NK cell recognition. Immunol. Today 11:237.[Medline]
2. Yokoyama, W. M., W. E. Seaman. 1993. The Ly-49 and NKR-P1 gene families encoding lectin-like receptors on natural killer cells: the NK gene complex. Annu. Rev. Immunol. 11:613.[Medline]
3. Lanier, L. L.. 1997. Natural killer cells: from no receptors to too many. Immunity 6:371.[Medline]
4. Vivier, E., M. Daeron. 1997. Immunoreceptor tyrosine-based inhibition motifs. Immunol. Today 18:286.[Medline]
5. Yokoyama, W. M.. 1997. What goes up must come down: the emerging spectrum of inhibitory receptors. J. Exp. Med. 186:1803.[Free Full Text]
6. Samaridis, J., M. Colonna. 1996. Cloning of novel immunoglobulin superfamily receptors expressed on human myeloid and lymphoid cells: structural evidence for new stimulatory and inhibitory pathways. Eur. J. Immunol. 27:660.
7. Cosman, D., N. Fanger, L. Borges, M. Kubin, W. Chin, L. Peterson, M. L. Hsu. 1997. A novel immunoglobulin superfamily receptor for cellular and viral MHC class I molecules. Immunity 7:273.[Medline]
8. Colonna, M., F. Navarro, T. Bellón, M. Llano, P. García, J. Samaridis, L. Angman, M. Cella, M. López-Botet. 1997. A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J. Exp. Med. 186:1809.[Abstract/Free Full Text]
9. Cella, M., C. Dohring, J. Samaridis, M. Dessing, M. Brockhaus, A. Lanzavecchia, M. Colonna. 1997. A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cells involved in antigen processing. J. Exp. Med. 185:1743.[Abstract/Free Full Text]
10. Lane, P., C. Burdet, F. McConnell, A. Lanzavecchia, E. Padovan. 1995. CD40 ligand-independent B cell activation revealed by CD40 ligand-deficient T cell clones: evidence for distinct activation requirements for antibody formation and B cell proliferation. Eur. J. Immunol. 6:1788.
11. Altman, J. D., P. A. H. Moss, P. J. R. Goulder, D. H. Barouch, M. G. McHeyzer-Williams, J. I. Bell, A. J. McMichael, M. M. Davis. 1996. Phenotypic analysis of antigen-specific T lymphocytes. Science 274:94.[Abstract/Free Full Text]
12. Weltzien, H. U., H. P. Matthiessen, M. Meyer-Delius, F. Zimmermann, E. Rude. 1984. Acidic "peptidophospholipids," a new class of hapten-bearing cell surface modifying reagents. Mol. Immunol. 21:801.[Medline]
13. Kiener, P. A., B. M. Rankin, A. L. Burkhardt, G. L. Schieven, L. K. Gilliland, R. B. Rowley, J. B. Bolen, J. A. Ledbetter. 1993. Cross-linking of Fc gamma receptor I (Fc gamma RI) and receptor II (Fc gamma RII) on monocytic cells activates a signal transduction pathway common to both Fc receptors that involves the stimulation of p72 Syk protein tyrosine kinase. J. Biol. Chem. 268:24442.[Abstract/Free Full Text]
14. Cella, M., F. Sallusto, A. Lanzavecchia. 1997. Origin, maturation and antigen presenting function of dendritic cells. Curr. Opin. Immunol. 9:10.[Medline]
15. Philip, R., L. B. Epstein. 1986. Tumour necrosis factor as immunomodulator and mediator of monocyte cytotoxicity induced by itself, gamma-interferon and interleukin-1. Nature 323:86.[Medline]
16. Ortaldo, J. R., L. H. Mason, B. J. Mathieson, S. M. Liang, D. A. Flick, R. B. Herberman. 1986. Mediation of mouse natural cytotoxic activity by tumour necrosis factor. Nature 321:700.[Medline]

This article has been cited by other articles:

				C. Y. Tan, Y. S. Chong, A. Loganath, Y. H. Chan, J. Ravichandran, C. G. Lee, and S. S. Chong Possible Gene-Gene Interaction of KIR2DL4 With its Cognate Ligand HLA-G in Modulating Risk for Preeclampsia Reproductive Sciences, December 1, 2009; 16(12): 1135 - 1143. [Abstract] [PDF]

				S. Flajollet, I. Poras, E. D. Carosella, and P. Moreau RREB-1 Is a Transcriptional Repressor of HLA-G J. Immunol., December 1, 2009; 183(11): 6948 - 6959. [Abstract] [Full Text] [PDF]

				R. Bahri, A. Naji, C. Menier, B. Charpentier, E. D. Carosella, N. Rouas-Freiss, and A. Durrbach Dendritic Cells Secrete the Immunosuppressive HLA-G Molecule upon CTLA4-Ig Treatment: Implication in Human Renal Transplant Acceptance J. Immunol., December 1, 2009; 183(11): 7054 - 7062. [Abstract] [Full Text] [PDF]

				D. Li, L. Wang, L. Yu, E. C. Freundt, B. Jin, G. R. Screaton, and X.-N. Xu Ig-Like Transcript 4 Inhibits Lipid Antigen Presentation through Direct CD1d Interaction J. Immunol., January 15, 2009; 182(2): 1033 - 1040. [Abstract] [Full Text] [PDF]

				Y. Sun, J. Liu, P. Gao, Y. Wang, and C. Liu Expression of Ig-Like Transcript 4 Inhibitory Receptor in Human Non-small Cell Lung Cancer Chest, October 1, 2008; 134(4): 783 - 788. [Abstract] [Full Text] [PDF]

				P. Moreau, L. Contu, F. Alba, S. Lai, R. Simoes, S. Orru, C. Carcassi, M. Roger, M. Rabreau, and E. D. Carosella HLA-G Gene Polymorphism in Human Placentas: Possible Association of G*0106 Allele with Preeclampsia and Miscarriage Biol Reprod, September 1, 2008; 79(3): 459 - 467. [Abstract] [Full Text] [PDF]

				G. Vlad, V. D. D'Agati, Q.-Y. Zhang, Z. Liu, E. K. Ho, T. Mohanakumar, M. A. Hardy, R. Cortesini, and N. Suciu-Foca Immunoglobulin-Like Transcript 3-Fc Suppresses T-Cell Responses to Allogeneic Human Islet Transplants in hu-NOD/SCID Mice Diabetes, July 1, 2008; 57(7): 1878 - 1886. [Abstract] [Full Text] [PDF]

				S. Liang, V. Ristich, H. Arase, J. Dausset, E. D. Carosella, and A. Horuzsko Modulation of dendritic cell differentiation by HLA-G and ILT4 requires the IL-6--STAT3 signaling pathway PNAS, June 17, 2008; 105(24): 8357 - 8362. [Abstract] [Full Text] [PDF]

				E. D. Carosella, B. Favier, N. Rouas-Freiss, P. Moreau, and J. LeMaoult Beyond the increasing complexity of the immunomodulatory HLA-G molecule Blood, May 15, 2008; 111(10): 4862 - 4870. [Abstract] [Full Text] [PDF]

				N. Tedla, C.-W. Lee, L. Borges, C. L. Geczy, and J. P. Arm Differential expression of leukocyte immunoglobulin-like receptors on cord blood-derived human mast cell progenitors and mature mast cells J. Leukoc. Biol., February 1, 2008; 83(2): 334 - 343. [Abstract] [Full Text] [PDF]

				D. J. Lee, P. A. Sieling, M. T. Ochoa, S. R. Krutzik, B. Guo, M. Hernandez, T. H. Rea, G. Cheng, M. Colonna, and R. L. Modlin LILRA2 Activation Inhibits Dendritic Cell Differentiation and Antigen Presentation to T Cells J. Immunol., December 15, 2007; 179(12): 8128 - 8136. [Abstract] [Full Text] [PDF]

				A. Naji, S. Le Rond, A. Durrbach, I. Krawice-Radanne, C. Creput, M. Daouya, J. Caumartin, J. LeMaoult, E. D. Carosella, and N. Rouas-Freiss CD3+CD4low and CD3+CD8low are induced by HLA-G: novel human peripheral blood suppressor T-cell subsets involved in transplant acceptance Blood, December 1, 2007; 110(12): 3936 - 3948. [Abstract] [Full Text] [PDF]

				M. Lichterfeld, D. G. Kavanagh, K. L. Williams, B. Moza, S. K. Mui, T. Miura, R. Sivamurthy, R. Allgaier, F. Pereyra, A. Trocha, et al. A viral CTL escape mutation leading to immunoglobulin-like transcript 4 mediated functional inhibition of myelomonocytic cells J. Exp. Med., November 26, 2007; 204(12): 2813 - 2824. [Abstract] [Full Text] [PDF]

				U. Feger, E. Tolosa, Y.-H. Huang, A. Waschbisch, T. Biedermann, A. Melms, and H. Wiendl HLA-G expression defines a novel regulatory T-cell subset present in human peripheral blood and sites of inflammation Blood, July 15, 2007; 110(2): 568 - 577. [Abstract] [Full Text] [PDF]

				N. Suciu-Foca, N. Feirt, Q.-Y. Zhang, G. Vlad, Z. Liu, H. Lin, C.-C. Chang, E. K. Ho, A. I. Colovai, H. Kaufman, et al. Soluble Ig-Like Transcript 3 Inhibits Tumor Allograft Rejection in Humanized SCID Mice and T Cell Responses in Cancer Patients J. Immunol., June 1, 2007; 178(11): 7432 - 7441. [Abstract] [Full Text] [PDF]

				O. A. Huynh, T. Hampartzoumian, J. P. Arm, J. Hunt, L. Borges, M. Ahern, M. Smith, C. L. Geczy, H. P. McNeil, and N. Tedla Down-regulation of leucocyte immunoglobulin-like receptor expression in the synovium of rheumatoid arthritis patients after treatment with disease-modifying anti-rheumatic drugs Rheumatology, May 1, 2007; 46(5): 742 - 751. [Abstract] [Full Text] [PDF]

				A. Masuda, A. Nakamura, T. Maeda, Y. Sakamoto, and T. Takai Cis binding between inhibitory receptors and MHC class I can regulate mast cell activation J. Exp. Med., April 16, 2007; 204(4): 907 - 920. [Abstract] [Full Text] [PDF]

				J. Giustiniani, A. Marie-Cardine, and A. Bensussan A Soluble Form of the MHC Class I-Specific CD160 Receptor Is Released from Human Activated NK Lymphocytes and Inhibits Cell-Mediated Cytotoxicity J. Immunol., February 1, 2007; 178(3): 1293 - 1300. [Abstract] [Full Text] [PDF]

				M. Shiroishi, K. Kuroki, L. Rasubala, K. Tsumoto, I. Kumagai, E. Kurimoto, K. Kato, D. Kohda, and K. Maenaka Structural basis for recognition of the nonclassical MHC molecule HLA-G by the leukocyte Ig-like receptor B2 (LILRB2/LIR2/ILT4/CD85d) PNAS, October 31, 2006; 103(44): 16412 - 16417. [Abstract] [Full Text] [PDF]

				M. Shiroishi, M. Kajikawa, K. Kuroki, T. Ose, D. Kohda, and K. Maenaka Crystal Structure of the Human Monocyte-activating Receptor, "Group 2" Leukocyte Ig-like Receptor A5 (LILRA5/LIR9/ILT11) J. Biol. Chem., July 14, 2006; 281(28): 19536 - 19544. [Abstract] [Full Text] [PDF]

				V. Cirulli, J. Zalatan, M. McMaster, R. Prinsen, D. R. Salomon, C. Ricordi, B. E. Torbett, P. Meda, and L. Crisa The Class I HLA Repertoire of Pancreatic Islets Comprises the Nonclassical Class Ib Antigen HLA-G. Diabetes, May 1, 2006; 55(5): 1214 - 1222. [Abstract] [Full Text] [PDF]

				S. Kim-Schulze, L. Scotto, G. Vlad, F. Piazza, H. Lin, Z. Liu, R. Cortesini, and N. Suciu-Foca Recombinant Ig-Like Transcript 3-Fc Modulates T Cell Responses via Induction of Th Anergy and Differentiation of CD8+ T Suppressor Cells. J. Immunol., March 1, 2006; 176(5): 2790 - 2798. [Abstract] [Full Text] [PDF]

				S. Le Rond, C. Azema, I. Krawice-Radanne, A. Durrbach, C. Guettier, E. D. Carosella, and N. Rouas-Freiss Evidence to Support the Role of HLA-G5 in Allograft Acceptance through Induction of Immunosuppressive/ Regulatory T Cells. J. Immunol., March 1, 2006; 176(5): 3266 - 3276. [Abstract] [Full Text] [PDF]

				G. Penna, A. Roncari, S. Amuchastegui, K. C. Daniel, E. Berti, M. Colonna, and L. Adorini Expression of the inhibitory receptor ILT3 on dendritic cells is dispensable for induction of CD4+Foxp3+ regulatory T cells by 1,25-dihydroxyvitamin D3 Blood, November 15, 2005; 106(10): 3490 - 3497. [Abstract] [Full Text] [PDF]

				H. Wiendl, U. Feger, M. Mittelbronn, C. Jack, B. Schreiner, C. Stadelmann, J. Antel, W. Brueck, R. Meyermann, A. Bar-Or, et al. Expression of the immune-tolerogenic major histocompatibility molecule HLA-G in multiple sclerosis: implications for CNS immunity Brain, November 1, 2005; 128(11): 2689 - 2704. [Abstract] [Full Text] [PDF]

				T. Gonen-Gross, H. Achdout, T. I. Arnon, R. Gazit, N. Stern, V. Horejsi, D. Goldman-Wohl, S. Yagel, and O. Mandelboim The CD85J/Leukocyte Inhibitory Receptor-1 Distinguishes between Conformed and {beta}2-Microglobulin-Free HLA-G Molecules J. Immunol., October 15, 2005; 175(8): 4866 - 4874. [Abstract] [Full Text] [PDF]

				A. Gonzalez-Hernandez, J. LeMaoult, A. Lopez, E. Alegre, J. Caumartin, S. L. Rond, M. Daouya, P. Moreau, and E. D. Carosella Linking Two Immuno-Suppressive Molecules: Indoleamine 2,3 Dioxygenase Can Modify HLA-G Cell-Surface Expression Biol Reprod, September 1, 2005; 73(3): 571 - 578. [Abstract] [Full Text] [PDF]

				K. Kuroki, N. Tsuchiya, M. Shiroishi, L. Rasubala, Y. Yamashita, K. Matsuta, T. Fukazawa, M. Kusaoi, Y. Murakami, M. Takiguchi, et al. Extensive polymorphisms of LILRB1 (ILT2, LIR1) and their association with HLA-DRB1 shared epitope negative rheumatoid arthritis Hum. Mol. Genet., August 15, 2005; 14(16): 2469 - 2480. [Abstract] [Full Text] [PDF]

				A. Merlo, C. Tenca, F. Fais, L. Battini, E. Ciccone, C. E. Grossi, and D. Saverino Inhibitory Receptors CD85j, LAIR-1, and CD152 Down-Regulate Immunoglobulin and Cytokine Production by Human B Lymphocytes Clin. Vaccine Immunol., June 1, 2005; 12(6): 705 - 712. [Abstract] [Full Text] [PDF]

				C. Tenca, A. Merlo, E. Merck, E. E. M. Bates, D. Saverino, R. Simone, D. Zarcone, G. Trinchieri, C. E. Grossi, and E. Ciccone CD85j (Leukocyte Ig-Like Receptor-1/Ig-Like Transcript 2) Inhibits Human Osteoclast-Associated Receptor-Mediated Activation of Human Dendritic Cells J. Immunol., June 1, 2005; 174(11): 6757 - 6763. [Abstract] [Full Text] [PDF]

				C. S. Clements, L. Kjer-Nielsen, L. Kostenko, H. L. Hoare, M. A. Dunstone, E. Moses, K. Freed, A. G. Brooks, J. Rossjohn, and J. McCluskey Crystal structure of HLA-G: A nonclassical MHC class I molecule expressed at the fetal-maternal interface PNAS, March 1, 2005; 102(9): 3360 - 3365. [Abstract] [Full Text] [PDF]

				M. Vales-Gomez, M. Shiroishi, K. Maenaka, and H. T. Reyburn Genetic Variability of the Major Histocompatibility Complex Class I Homologue Encoded by Human Cytomegalovirus Leads to Differential Binding to the Inhibitory Receptor ILT2 J. Virol., February 15, 2005; 79(4): 2251 - 2260. [Abstract] [Full Text] [PDF]

				H. Nuckel, V. Rebmann, J. Durig, U. Duhrsen, and H. Grosse-Wilde HLA-G expression is associated with an unfavorable outcome and immunodeficiency in chronic lymphocytic leukemia Blood, February 15, 2005; 105(4): 1694 - 1698. [Abstract] [Full Text] [PDF]

				S. Pascolo, F. Ginhoux, N. Laham, S. Walter, O. Schoor, J. Probst, P. Rohrlich, F. Obermayr, P. Fisch, O. Danos, et al. The non-classical HLA class I molecule HFE does not influence the NK-like activity contained in fresh human PBMCs and does not interact with NK cells Int. Immunol., February 1, 2005; 17(2): 117 - 122. [Abstract] [Full Text] [PDF]

				R. H. McIntire, P. J. Morales, M. G. Petroff, M. Colonna, and J. S. Hunt Recombinant HLA-G5 and -G6 drive U937 myelomonocytic cell production of TGF-{beta}1 J. Leukoc. Biol., December 1, 2004; 76(6): 1220 - 1228. [Abstract] [Full Text] [PDF]

				C. Renne, E. Ramos Lopez, S. A. Steimle-Grauer, P. Ziolkowski, M. A. Pani, C. Luther, K. Holzer, A. Encke, R. A. Wahl, W. O. Bechstein, et al. Thyroid Fetal Male Microchimerisms in Mothers with Thyroid Disorders: Presence of Y-Chromosomal Immunofluorescence in Thyroid-Infiltrating Lymphocytes Is More Prevalent in Hashimoto's Thyroiditis and Graves' Disease Than in Follicular Adenomas J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5810 - 5814. [Abstract] [Full Text] [PDF]

				J. S. Manavalan, S. Kim-Schulze, L. Scotto, A. J. Naiyer, G. Vlad, P. C. Colombo, C. Marboe, D. Mancini, R. Cortesini, and N. Suciu-Foca Alloantigen specific CD8+CD28- FOXP3+ T suppressor cells induce ILT3+ ILT4+ tolerogenic endothelial cells, inhibiting alloreactivity Int. Immunol., August 1, 2004; 16(8): 1055 - 1068. [Abstract] [Full Text] [PDF]

				J. LeMaoult, I. Krawice-Radanne, J. Dausset, and E. D. Carosella HLA-G1-expressing antigen-presenting cells induce immunosuppressive CD4+ T cells PNAS, May 4, 2004; 101(18): 7064 - 7069. [Abstract] [Full Text] [PDF]

				I. Shiratori, K. Ogasawara, T. Saito, L. L. Lanier, and H. Arase Activation of Natural Killer Cells and Dendritic Cells upon Recognition of a Novel CD99-like Ligand by Paired Immunoglobulin-like Type 2 Receptor J. Exp. Med., February 17, 2004; 199(4): 525 - 533. [Abstract] [Full Text] [PDF]

				N. Lee and D. E. Geraghty HLA-F Surface Expression on B Cell and Monocyte Cell Lines Is Partially Independent from Tapasin and Completely Independent from TAP J. Immunol., November 15, 2003; 171(10): 5264 - 5271. [Abstract] [Full Text] [PDF]

				D. Belkin, M. Torkar, C. Chang, R. Barten, M. Tolaini, A. Haude, R. Allen, M. J. Wilson, D. Kioussis, and J. Trowsdale Killer Cell Ig-Like Receptor and Leukocyte Ig-Like Receptor Transgenic Mice Exhibit Tissue- and Cell-Specific Transgene Expression J. Immunol., September 15, 2003; 171(6): 3056 - 3063. [Abstract] [Full Text] [PDF]

				A. Ishitani, N. Sageshima, N. Lee, N. Dorofeeva, K. Hatake, H. Marquardt, and D. E. Geraghty Protein Expression and Peptide Binding Suggest Unique and Interacting Functional Roles for HLA-E, F, and G in Maternal-Placental Immune Recognition J. Immunol., August 1, 2003; 171(3): 1376 - 1384. [Abstract] [Full Text] [PDF]

				M. Shiroishi, K. Tsumoto, K. Amano, Y. Shirakihara, M. Colonna, V. M. Braud, D. S. J. Allan, A. Makadzange, S. Rowland-Jones, B. Willcox, et al. Human inhibitory receptors Ig-like transcript 2 (ILT2) and ILT4 compete with CD8 for MHC class I binding and bind preferentially to HLA-G PNAS, July 22, 2003; 100(15): 8856 - 8861. [Abstract] [Full Text] [PDF]

				L. Borges, M. Kubin, and T. Kuhlman LIR9, an immunoglobulin-superfamily-activating receptor, is expressed as a transmembrane and as a secreted molecule Blood, February 15, 2003; 101(4): 1484 - 1486. [Abstract] [Full Text] [PDF]

				N. Tedla, C. Bandeira-Melo, P. Tassinari, D. E. Sloane, M. Samplaski, D. Cosman, L. Borges, P. F. Weller, and J. P. Arm Activation of human eosinophils through leukocyte immunoglobulin-like receptor 7 PNAS, February 4, 2003; 100(3): 1174 - 1179. [Abstract] [Full Text] [PDF]

				P. Moreau, G. Mouillot, P. Rousseau, C. Marcou, J. Dausset, and E. D. Carosella HLA-G gene repression is reversed by demethylation PNAS, February 4, 2003; 100(3): 1191 - 1196. [Abstract] [Full Text] [PDF]

				E. C. Ibrahim, Y. Allory, F. Commo, B. Gattegno, P. Callard, and P. Paul Altered Pattern of Major Histocompatibility Complex Expression in Renal Carcinoma: Tumor-Specific Expression of the Nonclassical Human Leukocyte Antigen-G Molecule Is Restricted to Clear Cell Carcinoma While Up-Regulation of Other Major Histocompatibility Complex Antigens Is Primarily Distributed in All Subtypes of Renal Carcinoma Am. J. Pathol., February 1, 2003; 162(2): 501 - 508. [Abstract] [Full Text] [PDF]

				A. F. Ryan, R. L. Grendell, D. E. Geraghty, and T. G. Golos A Soluble Isoform of the Rhesus Monkey Nonclassical MHC Class I Molecule Mamu-AG Is Expressed in the Placenta and the Testis J. Immunol., July 15, 2002; 169(2): 673 - 683. [Abstract] [Full Text] [PDF]

				N. Tedla, K. Gibson, H. P. McNeil, D. Cosman, L. Borges, and J. P. Arm The Co-Expression of Activating and Inhibitory Leukocyte Immunoglobulin-Like Receptors in Rheumatoid Synovium Am. J. Pathol., February 1, 2002; 160(2): 425 - 431. [Abstract] [Full Text] [PDF]

				M. Urosevic, J. Willers, B. Mueller, W. Kempf, G. Burg, and R. Dummer HLA-G protein up-regulation in primary cutaneous lymphomas is associated with interleukin-10 expression in large cell T-cell lymphomas and indolent B-cell lymphomas Blood, January 15, 2002; 99(2): 609 - 617. [Abstract] [Full Text] [PDF]

				N. Kim, M. Takami, J. Rho, R. Josien, and Y. Choi A Novel Member of the Leukocyte Receptor Complex Regulates Osteoclast Differentiation J. Exp. Med., January 14, 2002; 195(2): 201 - 209. [Abstract] [Full Text] [PDF]

				R. L. Allen, T. Raine, A. Haude, J. Trowsdale, and M. J. Wilson Cutting Edge: Leukocyte Receptor Complex-Encoded Immunomodulatory Receptors Show Differing Specificity for Alternative HLA-B27 Structures J. Immunol., November 15, 2001; 167(10): 5543 - 5547. [Abstract] [Full Text] [PDF]

				F. Canavez, N. T. Young, L. A. Guethlein, R. Rajalingam, S. I. Khakoo, B. P. Shum, and P. Parham Comparison of Chimpanzee and Human Leukocyte Ig-Like Receptor Genes Reveals Framework and Rapidly Evolving Genes J. Immunol., November 15, 2001; 167(10): 5786 - 5794. [Abstract] [Full Text] [PDF]

				E. C. Ibrahim, N. Guerra, M.-J. T. Lacombe, E. Angevin, S. Chouaib, E. D. Carosella, A. Caignard, and P. Paul Tumor-specific Up-Regulation of the Nonclassical Class I HLA-G Antigen Expression in Renal Carcinoma Cancer Res., September 1, 2001; 61(18): 6838 - 6845. [Abstract] [Full Text] [PDF]

				M. Urosevic, M. O. Kurrer, J. Kamarashev, B. Mueller, W. Weder, G. Burg, R. A. Stahel, R. Dummer, and A. Trojan Human Leukocyte Antigen G Up-Regulation in Lung Cancer Associates with High-Grade Histology, Human Leukocyte Antigen Class I Loss and Interleukin-10 Production Am. J. Pathol., September 1, 2001; 159(3): 817 - 824. [Abstract] [Full Text] [PDF]

				B. Riteau, C. Menier, I. Khalil-Daher, S. Martinozzi, M. Pla, J. Dausset, E. D. Carosella, and N. Rouas-Freiss HLA-G1 co-expression boosts the HLA class I-mediated NK lysis inhibition Int. Immunol., February 1, 2001; 13(2): 193 - 201. [Abstract] [Full Text] [PDF]

				I. I. Slukvin, D. P. Lunn, D. I. Watkins, and T. G. Golos Placental expression of the nonclassical MHC class I molecule Mamu-AG at implantation in the rhesus monkey PNAS, August 1, 2000; 97(16): 9104 - 9109. [Abstract] [Full Text] [PDF]

				N. Fournier, L. Chalus, I. Durand, E. Garcia, J.-J. Pin, T. Churakova, S. Patel, C. Zlot, D. Gorman, S. Zurawski, et al. FDF03, a Novel Inhibitory Receptor of the Immunoglobulin Superfamily, Is Expressed by Human Dendritic and Myeloid Cells J. Immunol., August 1, 2000; 165(3): 1197 - 1209. [Abstract] [Full Text] [PDF]

				M. Onno, C. Pangault, G. Le Friec, V. Guilloux, P. Andre, and R. Fauchet Modulation of HLA-G Antigens Expression by Human Cytomegalovirus: Specific Induction in Activated Macrophages Harboring Human Cytomegalovirus Infection J. Immunol., June 15, 2000; 164(12): 6426 - 6434. [Abstract] [Full Text] [PDF]

				C.-C. Chen, V. Hurez, J. S. Brockenbrough, H. Kubagawa, and M. D. Cooper Paternal monoallelic expression of the paired immunoglobulin-like receptors PIR-A and PIR-B PNAS, June 8, 1999; 96(12): 6868 - 6872. [Abstract] [Full Text] [PDF]

				L. Meyaard, J. Hurenkamp, H. Clevers, L. L. Lanier, and J. H. Phillips Leukocyte-Associated Ig-Like Receptor-1 Functions as an Inhibitory Receptor on Cytotoxic T Cells J. Immunol., May 15, 1999; 162(10): 5800 - 5804. [Abstract] [Full Text] [PDF]

				L. L. Lanier Natural killer cells fertile with receptors for HLA-G? PNAS, May 11, 1999; 96(10): 5343 - 5345. [Full Text] [PDF]

				P. Moreau, F. Adrian-Cabestre, C. Menier, V. Guiard, L. Gourand, J. Dausset, E. D. Carosella, and P. Paul IL-10 selectively induces HLA-G expression in human trophoblasts and monocytes Int. Immunol., May 1, 1999; 11(5): 803 - 811. [Abstract] [Full Text] [PDF]

				S. Rajagopalan and E. O. Long A Human Histocompatibility Leukocyte Antigen (HLA)-G-specific Receptor Expressed on All Natural Killer Cells J. Exp. Med., April 5, 1999; 189(7): 1093 - 1100. [Abstract] [Full Text] [PDF]

				D. S.J. Allan, M. Colonna, L. L. Lanier, T. D. Churakova, J. S. Abrams, S. A. Ellis, A. J. McMichael, and V. M. Braud Tetrameric Complexes of Human Histocompatibility Leukocyte Antigen (HLA)-G Bind to Peripheral Blood Myelomonocytic Cells J. Exp. Med., April 5, 1999; 189(7): 1149 - 1156. [Abstract] [Full Text] [PDF]

				P. Paul, F. A. Cabestre, F.-A. Le Gal, I. Khalil-Daher, C. Le Danff, M. Schmid, S. Mercier, M.-F. Avril, J. Dausset, J.-G. Guillet, et al. Heterogeneity of HLA-G Gene Transcription and Protein Expression in Malignant Melanoma Biopsies Cancer Res., April 1, 1999; 59(8): 1954 - 1960. [Abstract] [Full Text] [PDF]

				J. M. Lu-Kuo, D. M. Joyal, K. F. Austen, and H. R. Katz gp49B1 Inhibits IgE-initiated Mast Cell Activation through Both Immunoreceptor Tyrosine-based Inhibitory Motifs, Recruitment of src Homology 2 Domain-containing Phosphatase-1, and Suppression of Early and Late Calcium Mobilization J. Biol. Chem., February 26, 1999; 274(9): 5791 - 5796. [Abstract] [Full Text] [PDF]

				C. S. Chang, L. Brossay, M. Kronenberg, and K. P. Kane The Murine Nonclassical Class I Major Histocompatibility Complex-like CD1.1 Molecule Protects Target Cells from Lymphokine-activated Killer Cell Cytolysis J. Exp. Med., February 1, 1999; 189(3): 483 - 491. [Abstract] [Full Text] [PDF]

				S. Agrawal, J. Marquet, G. J. Freeman, A. Tawab, P. L. Bouteiller, P. Roth, W. Bolton, G. Ogg, L. Boumsell, and A. Bensussan Cutting Edge: MHC Class I Triggering by a Novel Cell Surface Ligand Costimulates Proliferation of Activated Human T Cells J. Immunol., February 1, 1999; 162(3): 1223 - 1226. [Abstract] [Full Text] [PDF]

				H. Kubagawa, C.-C. Chen, Le Hong Ho, T. Shimada, L. Gartland, C. Mashburn, T. Uehara, J. V. Ravetch, and M. D. Cooper Biochemical Nature and Cellular Distribution of the Paired Immunoglobulin-like Receptors, PIR-A and PIR-B J. Exp. Med., January 18, 1999; 189(2): 309 - 318. [Abstract] [Full Text] [PDF]

				H. Nakajima, J. Samaridis, L. Angman, and M. Colonna Cutting Edge: Human Myeloid Cells Express an Activating ILT Receptor (ILT1) That Associates with Fc Receptor {gamma}-Chain J. Immunol., January 1, 1999; 162(1): 5 - 8. [Abstract] [Full Text] [PDF]

				T. Ulyanova, D. D. Shah, and M. L. Thomas Molecular Cloning of MIS, a Myeloid Inhibitory Siglec, That Binds Protein-tyrosine Phosphatases SHP-1 and SHP-2 J. Biol. Chem., April 20, 2001; 276(17): 14451 - 14458. [Abstract] [Full Text] [PDF]

				N. Lila, N. Rouas-Freiss, J. Dausset, A. Carpentier, and E. D. Carosella Soluble HLA-G protein secreted by allo-specific CD4+ T cells suppresses the allo-proliferative response: A CD4+ T cell regulatory mechanism PNAS, October 9, 2001; 98(21): 12150 - 12155. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Colonna, M. Articles by Rolink, A. Search for Related Content PubMed PubMed Citation Articles by Colonna, M. Articles by Rolink, A.