|
|
||||||||
-Chain Gene Promoter1




*
Laboratory of Immunobiology, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892; and
Laboratory of Immune Cell Biology, National Cancer Institute, and
Experimental Immunology Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892
| Abstract |
|---|
|
|
|---|
subunit is
primarily responsible for regulating surface expression of TCRs.
Transcription of
is directed by a complex promoter that includes
two potential binding sites for the Ets family of transcription factors
at -52 (zEBS1) and -135 (zEBS2). Mutation of these two sites results
in a marked reduction of transcription from this promoter. Using
electrophoretic mobility shift analysis, Elf-1 was demonstrated to be
the Ets family member that binds to these sites. One site, zEBS1,
matches the optimal Elf-1 consensus sequence in eight of nine bases,
making it the best match of any known mammalian Elf-1 binding site. A
role for Elf-1 in TCR-
trans-activation was confirmed by
ectopic expression of Elf-1 in COS-7 cells. This resulted in an
increase in TCR-
promoter activity that mapped to zEBS1 and zEBS2.
Additional support for the involvement of Elf-1 in TCR-
trans-activation derives from the finding that a GAL4-Elf-1
fusion protein trans-activated TCR-
promoter constructs
that had been modified to contain GAL4 DNA binding sites. These results
demonstrate that Elf-1 plays an essential role in the
trans-activation of a constitutively expressed T
cell-specific gene, and that trans-activation occurs in the
context of the native promoter in both lymphoid and nonlymphoid cells.
Taken together with the existing literature, these data also suggest
that the requirement for inducible factors in Elf-1-mediated
trans-activation may decrease as the affinity and number of
Elf-1 sites increase. | Introduction |
|---|
|
|
|---|
subunit is synthesized in limiting amounts.
Because of this, the level of expression of
regulates the assembly
of complete receptors and ultimately the steady state cell surface
expression of TCRs (1; reviewed in 2 . The importance of regulated
transcription in normal T cell development is underscored by the
profound defects in thymocyte development exhibited by mice that either
overexpress or are deficient in expression of
(3, 4). In addition
to its role in receptor assembly,
is a key signal transducing
component of the TCR that couples TCR engagement to the activation of
protein tyrosine kinases. In fact,
is capable of activating T cells
independently of the other TCR components (5, 6, 7) and is itself a
substrate for activation-dependent tyrosine phosphorylation (8, 9) as
well as ubiquitination (10).
When the 5' region of the
gene was evaluated for elements
responsible for its tissue-specific expression, an extended promoter
was identified between -307 and +58 relative to the most 3' major site
of transcription initiation (11). This region includes at least two
distinct basal promoter elements that independently initiate
transcription from the
gene. Neither element contains a TATA box,
nor are they overly GC rich. One of these elements, designated Pz1,
extends from -69 to +58 and has equivalent activity in T cell and some
non-T cell lines. The other promoter element, Pz2, localizes to a 17-bp
stretch between -120 and -103. Pz2 demonstrates high basal activity
in T cells, but only marginal activity in non-T cell lines, and
constitutes the only example of a tissue-restricted promoter for a TCR
subunit. There are several potential binding sites for T cell-specific
transcription factors within the
promoter, including three GATA-3
binding sites (12, 13) between -268 and -247 and two canonical
Ets-family binding sites (14) at -135 and -52.
Members of the Ets proto-oncogene family share a high degree of
homology in their DNA binding domains. These DNA binding domains are
characterized by basic and
-helical subdomains that are homologous
to those of heat shock factors (14, 15, 16, 17). Ets family proteins bind to a
GGAA/T core motif, with the relative specificity of individual family
members dependent upon flanking sequences (14). T lymphocytes express
several different Ets proteins, some of which play a role in basal and
activation-dependent expression of T cell-specific genes, such as those
encoding IL-2, the IL-2R ß-chain, p56lck, the
TCR-
and TCR-ß chains, and CD4 (18, 19, 20, 21, 22, 23). Elf-1, a member of this
transcription factor family, is required for inducible T cell-specific
trans-activation of a number of genes (24, 25, 26, 27, 28, 29). The ability
of Elf-1 to mediate activation-dependent gene expression appears to be
due to both its release from the retinoblastoma gene product (Rb) after
activation and its interaction with other activation-dependent
transcription factors (24, 25, 26, 27, 28, 29, 30). This report demonstrates that Elf-1
interacts with the two Ets binding sites within the TCR-
gene
promoter and that this Elf-1 association is required for basal
expression from the TCR-
promoter.
| Materials and Methods |
|---|
|
|
|---|
Jurkat and COS-7 cells were maintained as previously described (11, 31). Restriction enzymes were purchased from either New England Biolabs (Beverly, MA) or Pharmacia/LKB (Piscataway, NJ). Anti-human Elf-1 mAbs, 6G7 and 5A3, were provided by Dr. Jeffrey M. Leiden (University of Chicago, Chicago, IL) and recognize NH2- and COOH-terminal epitopes of Elf-1, respectively (J. M. Leiden, unpublished observations). Anti-human Ets-1 (SC-350) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
Plasmids and oligonucleotides
The human Elf-1 expression vector pcDElf-1 (25) was provided by
W. Leonard (National Heart, Lung, and Blood Institute,
National Institutes of Health, Bethesda, MD). TCR-
promoter
constructs from -307 to +58 and from -69 to +58 have been described
previously (11). The Ets element mutants FL
zEBS1 and FL
zEBS2 were
generated by PCR. To generate FL
zEBS1, a sense oligonucleotide with
a 6-bp mutation (indicated in boldface) in the -52 Ets binding site
(CCATGATCAGGGGAGGTAGCTGCAG) and a 3' antisense
oligonucleotide (TATATAAGCTTTCCCTCAGAAAGAGGCTGGG) were used in PCR
with -307/+58 DNA as a template. Similarly, an antisense
oligonucleotide containing the same mutation
(ACCTCCCCTGATCATGGAGGACTGTGGGGCC) and a 5' sense
oligonucleotide (TATATCTCGAGCCATCGAGAACTTGTATTTGCC) were used
for amplification. Products were purified, combined, and reamplified
with the 5' sense and 3' antisense oligonucleotides. The resulting
fragment was cloned into pGL-2 Basic after digestion with
HindIII and XhoI. FL
zEBS2 was generated in the
same manner with a sense oligonucleotide that contained a mutation in
zEBS2 (mutation in boldface; CCAGGGCATATGGCCTGTGAACCGAAAGGG)
and an antisense oligonucleotide with the same mutation
(CACAGGCCATATGCCCTGGAGGTTTGAGGGTTTG). The same design
used to make FL
zEBS1 was used to make FL
zEBS1+2, except with
FL
zEBS2 as the original PCR template. Pz1
zEBS1 was generated
using a sense oligonucleotide with a point mutation in zEBS1 (indicated
in boldface; TATATCTCGAGGGCCCCACAGTCCTCCACTTGCTGGGG) and
the already described 3' oligonucleotide primer. The GAL4-VP16
expression construct (32) was provided by V. Seyfert (National Cancer
Institute, National Institutes of Health). G5BCAT-SP (33) was provided
by G. Chinnadurai (St. Louis University Medical Center, St. Louis, MO),
and pSG424 (32) was provided by M. Ptashne (Harvard University, Boston,
MA). To generate GAL4-ELF, an EcoRV site was placed into
pSG424 by cloning a double-stranded oligonucleotide with an
EcoRV site into the BamHI/KpnI sites
of the pSG424 polylinker. This construct was designated pSG424.RV.
Elf-1 was excised from pcDElf-1 by digestion with EcoRV and
XbaI and cloned into the EcoRV and
XbaI sites of pSG424.RV.
The double-stranded oligonucleotides used in electrophorectic mobility
shift assays (EMSAs)3 were as
follows (the Ets site motif is underlined, and mutations of this site
are in boldface): TCR-
-66/-33,
5'-TCGAGACAGTCCTCCACTTCCTGGGGAGGTAGCTGCA-3'; -66/-33
mutation (-66/-33 Ets M),
5'-AGACAGTCCTCCATGATCAGGGGAGGTAGCTGCA-3'; TCR-
-147/-119,
5'-TCGAGAACCTCCAGGGCTTCCTGCCTGTGAACCA-3';
-147/-119 mutation (-147/-119 Ets M),
5'-TCGAGAACCTCCAGGGCATATGGCCTGTGAACCA-3'; E74,
5'-AGCTTCTCTAGCTGAATAACCGGAAGTAACTCATCG-3' (22);
MSV-LTR, 5'-AGCTTCTCGGAGAGCGGAAGCGCGCG-3' (22); and
polyoma virus enhancer activator 3 (PEA3),
5'-AGCTTCGAGCAGGAAGTTCGG-3' (22). Oligonucleotides were synthesized
on an Applied Biosystems model 392 synthesizer (Foster City,
CA).
Luciferase and chloramphenicol acetyltransferase (CAT) assays
All plasmids were purified by double banding over cesium chloride; 15 µg of reporter construct was used in all transfection assays, except as noted. One microgram of a ß-galactosidase construct driven by the CMV promoter was used in all studies to control for transfection efficiency. Luciferase and CAT assays were performed 24 h after transfection as previously described (11, 31). Relative luciferase activity was calculated as the luciferase activity of the indicated constructs normalized to an empty vector control (pGL-2 Basic) as described previously (11).
Electrophoretic mobility shift assays
Binding reaction mixtures (20 µl) contained 6 µg of Jurkat nuclear extracts, 25,000 cpm of probe, 2 µg of poly(dI-dC) in 10 mM Tris-HCl (pH 7.5), 10 mM HEPES, 50 mM KCl, 2.5 mM DTT, 0.5 mM EDTA, and 12% glycerol. Following incubation on ice for 30 min, DNA-protein complexes were resolved on 5% polyacrylamide gels (acrylamide/bis-acrylamide, 29/1) run in Tris-borate buffer (22.3 mM Tris, 22.3 mM boric acid, and 0.5 mM EDTA) at 140 V for 2.5 h at room temperature. In some experiments 1 µl of specific Ab or 1 µl of unlabeled oligonucleotide competitor was incubated with protein for 15 min on ice before the addition of probe. After an additional 15-min incubation, samples were resolved on gels as described above. Samples that had been incubated with either of the anti-human Elf-1 Abs were resolved on polyacrylamide gels in the cold.
| Results |
|---|
|
|
|---|
promoter
The
promoter (-307/+58) includes two minimal promoter
elements, Pz1(-69/+58) and Pz2 (-120/-103), both of which can direct
basal levels of transcription (11) (Fig. 1
A). Two potential Ets
family binding sites are located at positions -52 (zEBS1) and -135
(zEBS2); zEBS1 is located within Pz1, and zEBS2 is located 15 bases
upstream of Pz2 (Fig. 1
A). To assess the significance
of zEBS1 on transcription from Pz1, zEBS1 was mutated in a construct
that contained only the Pz1 promoter (Pz1
zEBS1). Transient
expression in Jurkat cells demonstrated that mutation of zEBS1 resulted
in a 75% reduction in Pz1 activity (Fig. 1
B),
suggesting that a factor that binds to this site is required for Pz1
activity.
|
promoter (-307/+58), one or both elements
were mutated to generate FL
zEBS1, FL
zEBS2, and FL
zEBS1+2,
respectively. While mutation of either zEBS1 or zEBS2 had no effect on
promoter activity in Jurkat cells, mutation of both zEBS1 and zEBS2
resulted in an 80% decrease in
promoter activity (Fig. 1
gene
transcription is substantially dependent upon an Ets element, and that
either zEBS1 or zEBS2 is capable of supporting transcription from the
TCR-
promoter. Elf-1 binds to both zEBS1 and zEBS2
To identify proteins that bind zEBS1, EMSAs were performed. Using
Jurkat nuclear extracts and a 32P-labeled
double-stranded oligonucleotide probe encompassing zEBS1 (-66 to
-33), a single prominent complex, C1, was observed (Fig. 2
A, first
lane). C1 was competed by an unlabeled zEBS1
oligonucleotide, but not by an oligonucleotide in which zEBS1 was
mutated (-66/-33 Ets M) or by a zEBS2 oligonucleotide that had a
mutated Ets site (-147/-119 Ets M). This demonstrates that C1 arises
due to specific binding to zEBS1. DNA binding by Ets family proteins is
dependent on the core consensus sequence, with specificity imparted by
flanking nucleotide sequences (14). Therefore, in EMSAs,
competition using oligonucleotides that bind particular family members
with high affinity may be used to discriminate among Ets family members
(22). Because resting T cells express Ets-1, Ets-2, and Elf-1,
canonical binding sites for these proteins were used as competitors for
the formation of C1. As shown (Fig. 2
B), a known high
affinity binding site for Elf-1 (E74) competed for formation of C1 even
more efficiently than did an unlabeled zEBS1-containing
oligonucleotide. Consensus binding sites for Ets-1 (MSV-LTR) and Ets-2
(MSV-LTR and polyomavirus enhancer activator 3 (PEA3) were at least
10-fold less efficient at competition than unlabeled zEBS1. These data
suggest that Elf-1 is the Ets family member that binds to zEBS1. To
establish that Elf-1 was present in the C1 complex, supershift analyses
were performed with two mAbs with specificities for different regions
of human Elf-1 (Fig. 2
C). Addition of either Ab
resulted in a complete supershift of C1, while the formation and
mobility of C1 were unaffected by Abs to Ets-1, Fli-1, or NF-AT (data
not shown). These findings establish Elf-1 as the Ets family member
that interacts with zEBS1.
|
|
promoter
Because Jurkat cells express substantial levels of Elf-1, ectopic
expression of Elf-1 would not be expected to appreciably affect
transcription from the TCR-
promoter in these cells, and in fact, no
up-regulation was observed in transient transfection assays (data not
shown). To determine whether Elf-1 can support
promoter activity in
T cells, a fusion protein, GAL4-ELF, containing the DNA binding domain
of GAL4 (amino acids 1147) and the entire human Elf-1 protein (amino
acids 1619), was assayed for its ability to activate two TCR-
promoter constructs containing engineered GAL4 binding sites
(Pz1.2xGAL4 and FL.GAL4). Pz1.2xGAL4 consists of the Pz1 promoter
region (-69/+58) with a mutated zEBS1 and two GAL4 binding sites
immediately upstream of -69 (Fig. 4
).
Coexpression of the GAL4-Elf-1 fusion protein in Jurkat cells resulted
in trans-activation of Pz1.2xGAL4 in a dose-dependent manner
(Fig. 4
, A and B). FL.GAL4 includes a full
promoter (-307/+58) in which zEBS1 was destroyed by point
mutation, and zEBS2 replaced with a GAL4 DNA binding site. This
promoter was similarly trans-activated by the GAL4-Elf-1
fusion (Fig. 4
B). No increase was seen with reporter
constructs that did not contain a GAL4 binding site (Fig. 4
B
and data not shown). These data indicate that Elf-1 can mediate
trans-activation of the
promoter.
|
promoter more efficiently
than the TATA box containing G5BCAT-SP promoter. Our results using a
GAL4-ELF fusion protein together with the findings that Elf-1 is the
Ets family member that normally binds to both zEBS1 and zEBS2 support a
role for Elf-1 in regulating TCR-
gene transcription.
|
promoter, Elf-1 was ectopically expressed in COS-7 cells, which
have low endogenous levels of Elf-1 compared with Jurkat cells (B.
L. Rellahan and A. M. Weissman, unpublished observations). No
reproducible Elf-1-mediated enhancement was seen in TCR-
promoter
constructs with either only one or no intact Elf-1 sites (Fig. 5
promoter (Fig. 5
promoter in nonlymphoid cells and, together with previous data,
establishes a role for Elf-1 in regulating basal transcription from the
TCR-
promoter.
|
| Discussion |
|---|
|
|
|---|
gene is directed by a TATA-less
promoter that extends from +58 to -307 relative to the most 3' major
site of transcription initiation (11). The contributions of two binding
sites in this region for the Ets family of transcription factors
(designated zEBS1 and zEBS2) were assessed for their ability to
regulate TCR-
promoter expression. We found that in Jurkat cells,
one Ets binding site must be intact for efficient transcription from
the TCR-
promoter. Elimination of both Ets binding sites resulted in
a marked reduction in TCR-
promoter expression. Multiple lines of
evidence suggest that Elf-1 is the Ets family member that regulates the
TCR-
promoter through zEBS1 and zEBS2. First, an EMSA supershift
analysis demonstrated that Elf-1 physically interacts with both zEBS1
and zEBS2. Second, ectopic expression of Elf-1 in COS-7 cells resulted
in an increase in TCR-
promoter activity that mapped to zEBS1 and
zEBS2. Finally, a GAL4-Elf-1 fusion protein efficiently enhanced
transcription from the TCR-
promoter in Jurkat cells when directed
to the
promoter through either one or two tandem GAL4 binding
sites. Taken together, these data indicate that Elf-1 regulates TCR-
promoter activity.
It has been proposed that the ability of Ets family members to mediate
trans-activation depends on interactions with other DNA
binding proteins (36). Elf-1 has been demonstrated to functionally
interact with inducible transcription factors such as activating
protein-1, NF-
B, and NF-AT (24, 25, 27, 28) and physically associate
with HMG-I(Y), Jun family members, and the NF-
B proteins, p50 and
c-Rel (29, 37, 38). Determination of the optimal consenus
sequence for Elf-1 binding has made it clear that a number of Elf-1
binding sites, particularly those in inducible promoters and enhancers,
are of relatively low affinity (39). This together with the
aforementioned transcription factor interactions suggest that the in
vivo binding of Elf-1 to DNA is stabilized by the formation of
transcriptionally active multiprotein complexes (29, 36, 37, 38, 39).
Elf-1 is expressed in thymocytes, and its expression pattern is
unaffected by T cell activation (30, 35). TCR-
, unlike other Elf-1
targets, is constitutively expressed in all T cell lineages and
throughout much of T cell development. Furthermore, the TCR-
promoter can be trans-activated by Elf-1 in nonlymphoid
cells. The latter property may be due to the presence of two TCR-
Elf-1 sites, one of which (zEBS1: CCAGGAAGT) is the best match (eight
of nine bases) with the optimal Elf-1 consensus sequence (consensus:
CCCGGAAGT) of all known Elf-1 sites, suggesting that it is among the
highest affinity Elf-1 binding sites yet identified (39) (Fig. 6
). The assignment of relative affinities
of Elf-1 binding sites based on consensus sequence homology (39) is
supported by EMSA experiments in which Elf-1 had an approximately
10-fold higher affinity for zEBS1 compared with zEBS2 (data not shown),
the latter being a six of nine match with the consensus sequence
(39).
|
promoter does not require acute activation. Consistent with
this, binding of Elf-1 to zEBS1 has been observed in nuclear extracts
from both unactivated and activated human peripheral blood T cells (our
unpublished observations). Whether the ability of Elf-1 to mediate
activation of the TCR-
promoter requires other interacting
transcription factors remains to be determined. The ubiquitously
expressed transcription factor Sp1 is one likely candidate. Sp1 binds
to sites downstream from both zEBS1 and zEBS2 (B. L. Rellahan and
A. M. Weissman, unpublished observations) and is known to
cooperate with Ets-1 in regulating tissue-specific promoters (40, 41).
However, the presence of two high affinity Elf-1 sites (eight of nine
and six of nine matches) in close proximity to each other makes it also
reasonable to speculate that Elf-1 might bind the TCR-
promoter in
vivo without a requirement for other stabilizing factors. The
requirement for both zEBS1 and zEBS2 for TCR-
promoter activity in
COS-7 cells suggests that under certain conditions, interactions
between these sites may play a role in mediating
trans-activation.
As already noted, the zEBS1 Elf-1 binding site in the TCR-
promoter
is an eight of nine base pair match with the optimal Elf-1 consensus
sequence. In comparison, genes whose expression is dependent on T cell
activation generally have sites that match the consensus sequence at
fewer nucleotides than zEBS1 and therefore are presumably of lower
affinity (Fig. 6
). In particular, the Elf-1 sites within the IL-2R
subunit (29), IL-3 (27), and granulocyte-macrophage CSF (28) genes
match the consensus sequence in six, six, and five of nine bases,
respectively (39), and the two IL-2 gene Elf-1 sites match the
consensus sequence in only four of nine bases (25). The developmentally
regulated TdT and CD4 genes have Elf-1 sites that are better matches
than the T cell activation-dependent genes (35, 42). Both CD4 and TdT
are trans-activated by Elf-1 through single Elf-1 sites that
are seven of nine matches with the consensus sequence (39) and share an
eight-base core sequence with zEBS1 (CAGGAAGT). Each of these genes is
transcribed constitutively during specific stages of thymocyte
development (35), and in mature cells CD4 expression defines a
subpopulation of T lymphocytes (2). Despite the fact that the TdT Elf-1
site is a close match to the Elf-1 consensus site, ectopic Elf-1
expression is not sufficient to mediate trans-activation
through an unmodified TdT promoter in nonlymphoid cells (35). However,
placing a concatamer of three Elf-1 sites upstream of the TdT promoter
allowed trans-activation by Elf-1 in nonlymphoid cells
(35).
This requirement for multiple Elf-1 binding sites in nonlymphoid cells,
seen with the TdT promoter, is consistent with our observations that
both Elf-1 sites in the TCR-
promoter are required for
trans-activation in COS-7 cells. This suggests that the
presence of multiple Elf-1 binding sites may overcome requirements for
stabilizing cofactors or may compensate for lower functional levels of
Elf-1. Notably, in addition to TCR-
and the IL-2 gene, the HIV-2
(24, 43) and Human T-cell leukemia virus type I (HTLV-1) (26) enhancers
both have two Elf-1 binding sites. Both of these viral enhancers
exhibit one Elf-1 binding site that is a good match with the consensus
(seven of nine match) and one that is only a five of nine base pair
match. This is analogous to the TCR-
promoter and in contrast to the
IL-2 gene, whose two sites are only a four of nine base match with the
consensus. Moreover, the HIV-2 PUB2 site shares the common eight-base
core sequence with zEBS1, CD4, and TdT. It is of note that the murine
TCR-
promoter also exhibits two Elf-1 binding sites in analogous
locations to those found in the human gene (44). Murine zEBS1 has one
nucleotide change compared with its human counterpart, resulting in a
seven of nine base match with the consensus sequence. Strikingly,
murine zEBS2 exhibits two nucleotide changes compared with human zEBS2.
This results in murine zEBS2 having the identical nine-base core
sequence found in human zEBS1 (Fig. 6
).
One view of the existing data, which elaborates on those of others (35, 39), is that Elf-1 activation of genes is regulated by the number and
the affinity of cognate sites for this factor within a given promoter
or enhancer. Genes that are acutely regulated as a consequence of
cellular activation have relatively low affinity Elf-1 binding sites,
minimizing their potential to be activated by constitutive levels of
available Elf-1, and they require additional factors to stabilize Elf-1
binding. Genes that are developmentally regulated exhibit sites that
are better matches with the consensus sequence and therefore are likely
to have higher affinities for Elf-1. The TCR-
gene, which is
expressed constitutively throughout most of T cell development and is
not known to be acutely regulated, has multiple Elf-1 sites, including
one of apparently high affinity. The extent to which interactions
between neighboring Elf-1 sites function to sustain Elf-1-mediated
trans-activation of TCR-
or alter the requirement for
other interacting DNA binding proteins remains to be determined.
Finally, while this study establishes a role for Elf-1 in expression
from the TCR-
promoter, the fact that the tissue distribution of
TCR-
is more restricted than that of Elf-1 itself suggests that
other factors also contribute to the restricted expression of this TCR
component.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Barbara L. Rellahan, Laboratory of Immunobiology, Center for Biologics Evaluation and Research, Food and Drug Administration, Building 29B, Room 5E16, HFM 564, 1401 Rockville Pike, Rockville, MD 20892. E-mail address: ![]()
3 Abbreviations used in this paper: EMSA, electrophoretic mobility shift assay; MSV-LTR, Moloney murine sarcoma virus-long terminal repeat; CAT, chloramphenicol acetyltransferase; NF-AT, nuclear factor of activated T cells; TdT, terminal deoxynucleotidyl transferase. ![]()
Received for publication July 24, 1997. Accepted for publication November 18, 1997.
| References |
|---|
|
|
|---|
chain in the expression of the T cell antigen receptor: genetic reconstitution studies. EMBO J. 8:3651.[Medline]
chain of the T cell antigen receptor complex. Science 261:918.
and
transgenes on early
/ß T cell development. J. Exp. Med. 179:1485.
chain is sufficient to couple to receptor-associated signal transduction pathways. Cell 64:891.[Medline]
family proteins. Proc. Natl. Acad. Sci. USA 88:8905.
chain is tyrosine phosphorylated upon activation. J. Biol. Chem. 263:18225.
subunit: identification of a tissue-restricted promoter. J. Exp. Med. 180:1529.
-gene enhancer. Science 250:814.
and ß genes. Mol. Cell. Biol. 10:5486.
-chain gene expression: potential role of physical interactions between Elf-1, HMG-I(Y), and NF-
B family proteins. Mol. Cell. Biol. 15:1786.[Abstract]
and two newly defined ets-related proteins. Genes Dev. 6:2502.
chain promoter is a composite element that binds Stat5, Elf-1, HMG-I(Y) and a GATA family protein. EMBO J. 15:5627.[Medline]
B regulatory elements. J. Virol. 66:5479.
gene. Int. Immunol. 7:1627.This article has been cited by other articles:
![]() |
C. L. Gorman, A. I. Russell, Z. Zhang, D. Cunninghame Graham, A. P. Cope, and T. J. Vyse Polymorphisms in the CD3Z Gene Influence TCR{zeta} Expression in Systemic Lupus Erythematosus Patients and Healthy Controls J. Immunol., January 15, 2008; 180(2): 1060 - 1070. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-T. Juang, L. Sumibcay, M. Tolnay, Y. Wang, V. C. Kyttaris, and G. C. Tsokos Elf-1 Binds to GGAA Elements on the FcR{gamma} Promoter and Represses Its Expression J. Immunol., October 1, 2007; 179(7): 4884 - 4889. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tenbrock, Y.-T. Juang, V. C. Kyttaris, and G. C. Tsokos Altered signal transduction in SLE T cells Rheumatology, October 1, 2007; 46(10): 1525 - 1530. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tenbrock, V. C. Kyttaris, M. Ahlmann, J. M. Ehrchen, M. Tolnay, H. Melkonyan, C. Mawrin, J. Roth, C. Sorg, Y.-T. Juang, et al. The Cyclic AMP Response Element Modulator Regulates Transcription of the TCR {zeta}-Chain J. Immunol., November 1, 2005; 175(9): 5975 - 5980. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-b. Ji, A. Gupta, S. Okamoto, M. D. Blum, L. Tan, M. B. Goldring, E. Lacy, A. L. Roy, and C. Terhorst T Cell-specific Expression of the Murine CD3delta Promoter J. Biol. Chem., November 27, 2002; 277(49): 47898 - 47906. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-T. Juang, K. Tenbrock, M. P. Nambiar, M. F. Gourley, and G. C. Tsokos Defective Production of Functional 98-kDa Form of Elf-1 Is Responsible for the Decreased Expression of TCR {zeta}-Chain in Patients with Systemic Lupus Erythematosus J. Immunol., November 15, 2002; 169(10): 6048 - 6055. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. Rodriguez, A. H. Zea, K. S. Culotta, J. Zabaleta, J. B. Ochoa, and A. C. Ochoa Regulation of T Cell Receptor CD3zeta Chain Expression by L-Arginine J. Biol. Chem., June 7, 2002; 277(24): 21123 - 21129. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-T. Juang, E. E. Solomou, B. Rellahan, and G. C. Tsokos Phosphorylation and O-Linked Glycosylation of Elf-1 Leads to Its Translocation to the Nucleus and Binding to the Promoter of the TCR {zeta}-Chain J. Immunol., March 15, 2002; 168(6): 2865 - 2871. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Karantzoulis-Fegaras, H. Antoniou, S.-L. M. Lai, G. Kulkarni, C. D'Abreo, G. K. T. Wong, T. L. Miller, Y. Chan, J. Atkins, Y. Wang, et al. Characterization of the Human Endothelial Nitric-oxide Synthase Promoter J. Biol. Chem., January 29, 1999; 274(5): 3076 - 3093. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |