The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rellahan, B. L.
Right arrow Articles by Weissman, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rellahan, B. L.
Right arrow Articles by Weissman, A. M.
The Journal of Immunology, 1998, 160: 2794-2801.
Copyright © 1998 by The American Association of Immunologists

Elf-1 Regulates Basal Expression from the T Cell Antigen Receptor {zeta}-Chain Gene Promoter1

Barbara L. Rellahan2,*, Jane P. Jensen{dagger}, Thomas K. Howcroft{ddagger}, Dinah S. Singer{ddagger}, Ezio Bonvini* and Allan M. Weissman{dagger}

* Laboratory of Immunobiology, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892; and {dagger} Laboratory of Immune Cell Biology, National Cancer Institute, and {ddagger} Experimental Immunology Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In mature T cells, limited synthesis of the TCR-{zeta} subunit is primarily responsible for regulating surface expression of TCRs. Transcription of {zeta} is directed by a complex promoter that includes two potential binding sites for the Ets family of transcription factors at -52 (zEBS1) and -135 (zEBS2). Mutation of these two sites results in a marked reduction of transcription from this promoter. Using electrophoretic mobility shift analysis, Elf-1 was demonstrated to be the Ets family member that binds to these sites. One site, zEBS1, matches the optimal Elf-1 consensus sequence in eight of nine bases, making it the best match of any known mammalian Elf-1 binding site. A role for Elf-1 in TCR-{zeta} trans-activation was confirmed by ectopic expression of Elf-1 in COS-7 cells. This resulted in an increase in TCR-{zeta} promoter activity that mapped to zEBS1 and zEBS2. Additional support for the involvement of Elf-1 in TCR-{zeta} trans-activation derives from the finding that a GAL4-Elf-1 fusion protein trans-activated TCR-{zeta} promoter constructs that had been modified to contain GAL4 DNA binding sites. These results demonstrate that Elf-1 plays an essential role in the trans-activation of a constitutively expressed T cell-specific gene, and that trans-activation occurs in the context of the native promoter in both lymphoid and nonlymphoid cells. Taken together with the existing literature, these data also suggest that the requirement for inducible factors in Elf-1-mediated trans-activation may decrease as the affinity and number of Elf-1 sites increase.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The ability of T cells to recognize foreign Ags is dependent on cell surface expression of the multisubunit TCR. Cell surface expression of TCRs, in turn, requires the proper assembly of complete receptors in the endoplasmic reticulum. While most TCR components are synthesized in excess and are degraded either in the endoplasmic reticulum or in lysosomes, the TCR-{zeta} subunit is synthesized in limiting amounts. Because of this, the level of expression of {zeta} regulates the assembly of complete receptors and ultimately the steady state cell surface expression of TCRs (1; reviewed in 2 . The importance of regulated {zeta} transcription in normal T cell development is underscored by the profound defects in thymocyte development exhibited by mice that either overexpress or are deficient in expression of {zeta} (3, 4). In addition to its role in receptor assembly, {zeta} is a key signal transducing component of the TCR that couples TCR engagement to the activation of protein tyrosine kinases. In fact, {zeta} is capable of activating T cells independently of the other TCR components (5, 6, 7) and is itself a substrate for activation-dependent tyrosine phosphorylation (8, 9) as well as ubiquitination (10).

When the 5' region of the {zeta} gene was evaluated for elements responsible for its tissue-specific expression, an extended promoter was identified between -307 and +58 relative to the most 3' major site of transcription initiation (11). This region includes at least two distinct basal promoter elements that independently initiate transcription from the {zeta} gene. Neither element contains a TATA box, nor are they overly GC rich. One of these elements, designated Pz1, extends from -69 to +58 and has equivalent activity in T cell and some non-T cell lines. The other promoter element, Pz2, localizes to a 17-bp stretch between -120 and -103. Pz2 demonstrates high basal activity in T cells, but only marginal activity in non-T cell lines, and constitutes the only example of a tissue-restricted promoter for a TCR subunit. There are several potential binding sites for T cell-specific transcription factors within the {zeta} promoter, including three GATA-3 binding sites (12, 13) between -268 and -247 and two canonical Ets-family binding sites (14) at -135 and -52.

Members of the Ets proto-oncogene family share a high degree of homology in their DNA binding domains. These DNA binding domains are characterized by basic and {alpha}-helical subdomains that are homologous to those of heat shock factors (14, 15, 16, 17). Ets family proteins bind to a GGAA/T core motif, with the relative specificity of individual family members dependent upon flanking sequences (14). T lymphocytes express several different Ets proteins, some of which play a role in basal and activation-dependent expression of T cell-specific genes, such as those encoding IL-2, the IL-2R ß-chain, p56lck, the TCR-{alpha} and TCR-ß chains, and CD4 (18, 19, 20, 21, 22, 23). Elf-1, a member of this transcription factor family, is required for inducible T cell-specific trans-activation of a number of genes (24, 25, 26, 27, 28, 29). The ability of Elf-1 to mediate activation-dependent gene expression appears to be due to both its release from the retinoblastoma gene product (Rb) after activation and its interaction with other activation-dependent transcription factors (24, 25, 26, 27, 28, 29, 30). This report demonstrates that Elf-1 interacts with the two Ets binding sites within the TCR-{zeta} gene promoter and that this Elf-1 association is required for basal expression from the TCR-{zeta} promoter.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cells and reagents

Jurkat and COS-7 cells were maintained as previously described (11, 31). Restriction enzymes were purchased from either New England Biolabs (Beverly, MA) or Pharmacia/LKB (Piscataway, NJ). Anti-human Elf-1 mAbs, 6G7 and 5A3, were provided by Dr. Jeffrey M. Leiden (University of Chicago, Chicago, IL) and recognize NH2- and COOH-terminal epitopes of Elf-1, respectively (J. M. Leiden, unpublished observations). Anti-human Ets-1 (SC-350) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Plasmids and oligonucleotides

The human Elf-1 expression vector pcDElf-1 (25) was provided by W. Leonard (National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD). TCR-{zeta} promoter constructs from -307 to +58 and from -69 to +58 have been described previously (11). The Ets element mutants FL{Delta}zEBS1 and FL{Delta}zEBS2 were generated by PCR. To generate FL{Delta}zEBS1, a sense oligonucleotide with a 6-bp mutation (indicated in boldface) in the -52 Ets binding site (CCATGATCAGGGGAGGTAGCTGCAG) and a 3' antisense oligonucleotide (TATATAAGCTTTCCCTCAGAAAGAGGCTGGG) were used in PCR with -307/+58 DNA as a template. Similarly, an antisense oligonucleotide containing the same mutation (ACCTCCCCTGATCATGGAGGACTGTGGGGCC) and a 5' sense oligonucleotide (TATATCTCGAGCCATCGAGAACTTGTATTTGCC) were used for amplification. Products were purified, combined, and reamplified with the 5' sense and 3' antisense oligonucleotides. The resulting fragment was cloned into pGL-2 Basic after digestion with HindIII and XhoI. FL{Delta}zEBS2 was generated in the same manner with a sense oligonucleotide that contained a mutation in zEBS2 (mutation in boldface; CCAGGGCATATGGCCTGTGAACCGAAAGGG) and an antisense oligonucleotide with the same mutation (CACAGGCCATATGCCCTGGAGGTTTGAGGGTTTG). The same design used to make FL{Delta}zEBS1 was used to make FL{Delta}zEBS1+2, except with FL{Delta}zEBS2 as the original PCR template. Pz1{Delta}zEBS1 was generated using a sense oligonucleotide with a point mutation in zEBS1 (indicated in boldface; TATATCTCGAGGGCCCCACAGTCCTCCACTTGCTGGGG) and the already described 3' oligonucleotide primer. The GAL4-VP16 expression construct (32) was provided by V. Seyfert (National Cancer Institute, National Institutes of Health). G5BCAT-SP (33) was provided by G. Chinnadurai (St. Louis University Medical Center, St. Louis, MO), and pSG424 (32) was provided by M. Ptashne (Harvard University, Boston, MA). To generate GAL4-ELF, an EcoRV site was placed into pSG424 by cloning a double-stranded oligonucleotide with an EcoRV site into the BamHI/KpnI sites of the pSG424 polylinker. This construct was designated pSG424.RV. Elf-1 was excised from pcDElf-1 by digestion with EcoRV and XbaI and cloned into the EcoRV and XbaI sites of pSG424.RV.

The double-stranded oligonucleotides used in electrophorectic mobility shift assays (EMSAs)3 were as follows (the Ets site motif is underlined, and mutations of this site are in boldface): TCR-{zeta} -66/-33, 5'-TCGAGACAGTCCTCCACTTCCTGGGGAGGTAGCTGCA-3'; -66/-33 mutation (-66/-33 Ets M), 5'-AGACAGTCCTCCATGATCAGGGGAGGTAGCTGCA-3'; TCR-{zeta} -147/-119, 5'-TCGAGAACCTCCAGGGCTTCCTGCCTGTGAACCA-3'; -147/-119 mutation (-147/-119 Ets M), 5'-TCGAGAACCTCCAGGGCATATGGCCTGTGAACCA-3'; E74, 5'-AGCTTCTCTAGCTGAATAACCGGAAGTAACTCATCG-3' (22); MSV-LTR, 5'-AGCTTCTCGGAGAGCGGAAGCGCGCG-3' (22); and polyoma virus enhancer activator 3 (PEA3), 5'-AGCTTCGAGCAGGAAGTTCGG-3' (22). Oligonucleotides were synthesized on an Applied Biosystems model 392 synthesizer (Foster City, CA).

Luciferase and chloramphenicol acetyltransferase (CAT) assays

All plasmids were purified by double banding over cesium chloride; 15 µg of reporter construct was used in all transfection assays, except as noted. One microgram of a ß-galactosidase construct driven by the CMV promoter was used in all studies to control for transfection efficiency. Luciferase and CAT assays were performed 24 h after transfection as previously described (11, 31). Relative luciferase activity was calculated as the luciferase activity of the indicated constructs normalized to an empty vector control (pGL-2 Basic) as described previously (11).

Electrophoretic mobility shift assays

Binding reaction mixtures (20 µl) contained 6 µg of Jurkat nuclear extracts, 25,000 cpm of probe, 2 µg of poly(dI-dC) in 10 mM Tris-HCl (pH 7.5), 10 mM HEPES, 50 mM KCl, 2.5 mM DTT, 0.5 mM EDTA, and 12% glycerol. Following incubation on ice for 30 min, DNA-protein complexes were resolved on 5% polyacrylamide gels (acrylamide/bis-acrylamide, 29/1) run in Tris-borate buffer (22.3 mM Tris, 22.3 mM boric acid, and 0.5 mM EDTA) at 140 V for 2.5 h at room temperature. In some experiments 1 µl of specific Ab or 1 µl of unlabeled oligonucleotide competitor was incubated with protein for 15 min on ice before the addition of probe. After an additional 15-min incubation, samples were resolved on gels as described above. Samples that had been incubated with either of the anti-human Elf-1 Abs were resolved on polyacrylamide gels in the cold.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Ets family binding sites zEBS1 and zEBS2 are required for transcription from the TCR-{zeta} promoter

The {zeta} promoter (-307/+58) includes two minimal promoter elements, Pz1(-69/+58) and Pz2 (-120/-103), both of which can direct basal levels of transcription (11) (Fig. 1GoA). Two potential Ets family binding sites are located at positions -52 (zEBS1) and -135 (zEBS2); zEBS1 is located within Pz1, and zEBS2 is located 15 bases upstream of Pz2 (Fig. 1GoA). To assess the significance of zEBS1 on transcription from Pz1, zEBS1 was mutated in a construct that contained only the Pz1 promoter (Pz1{Delta}zEBS1). Transient expression in Jurkat cells demonstrated that mutation of zEBS1 resulted in a 75% reduction in Pz1 activity (Fig. 1GoB), suggesting that a factor that binds to this site is required for Pz1 activity.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 1. The binding sites zEBS1 and zEBS2 are required for transcription from the TCR-{zeta} chain promoter. A, Schematic representation of the TCR-{zeta} promoter region. The relative location and sequence of the Ets-binding sites, zEBS1 and zEBS2, in the TCR-{zeta} chain promoter are shown. The positions of the core promoters (Pz1 (|og) and Pz2 ()) are indicated. Major sites of transcription initiation are indicated with arrows. B, Evaluation of the role of zEBS1 in Pz1 activity. C, Assessment of the role of zEBS1 and zEBS2 in transcription from the full TCR-{zeta} promoter region. Shown are the relative luciferase activities for the promoter constructs that are schematized to the left of each graph. The data in each panel are derived from triplicate points from a representative experiment; error bars indicate ±SD.

 
To determine the role of the two Ets binding sites in transcription from the full-length {zeta} promoter (-307/+58), one or both elements were mutated to generate FL{Delta}zEBS1, FL{Delta}zEBS2, and FL{Delta}zEBS1+2, respectively. While mutation of either zEBS1 or zEBS2 had no effect on promoter activity in Jurkat cells, mutation of both zEBS1 and zEBS2 resulted in an 80% decrease in {zeta} promoter activity (Fig. 1GoC). These data suggest that TCR-{zeta} gene transcription is substantially dependent upon an Ets element, and that either zEBS1 or zEBS2 is capable of supporting transcription from the TCR-{zeta} promoter.

Elf-1 binds to both zEBS1 and zEBS2

To identify proteins that bind zEBS1, EMSAs were performed. Using Jurkat nuclear extracts and a 32P-labeled double-stranded oligonucleotide probe encompassing zEBS1 (-66 to -33), a single prominent complex, C1, was observed (Fig. 2GoA, first lane). C1 was competed by an unlabeled zEBS1 oligonucleotide, but not by an oligonucleotide in which zEBS1 was mutated (-66/-33 Ets M) or by a zEBS2 oligonucleotide that had a mutated Ets site (-147/-119 Ets M). This demonstrates that C1 arises due to specific binding to zEBS1. DNA binding by Ets family proteins is dependent on the core consensus sequence, with specificity imparted by flanking nucleotide sequences (14). Therefore, in EMSAs, competition using oligonucleotides that bind particular family members with high affinity may be used to discriminate among Ets family members (22). Because resting T cells express Ets-1, Ets-2, and Elf-1, canonical binding sites for these proteins were used as competitors for the formation of C1. As shown (Fig. 2GoB), a known high affinity binding site for Elf-1 (E74) competed for formation of C1 even more efficiently than did an unlabeled zEBS1-containing oligonucleotide. Consensus binding sites for Ets-1 (MSV-LTR) and Ets-2 (MSV-LTR and polyomavirus enhancer activator 3 (PEA3) were at least 10-fold less efficient at competition than unlabeled zEBS1. These data suggest that Elf-1 is the Ets family member that binds to zEBS1. To establish that Elf-1 was present in the C1 complex, supershift analyses were performed with two mAbs with specificities for different regions of human Elf-1 (Fig. 2GoC). Addition of either Ab resulted in a complete supershift of C1, while the formation and mobility of C1 were unaffected by Abs to Ets-1, Fli-1, or NF-AT (data not shown). These findings establish Elf-1 as the Ets family member that interacts with zEBS1.



View larger version (76K):
[in this window]
[in a new window]
  		FIGURE 2. Elf-1 is the Ets family member that binds to zEBS1. EMSAs used the32P-labeled -66/-33 (zEBS1) probe and 6 µg of Jurkat nuclear extract. A and B show competition analysis with the indicated unlabeled double-stranded oligonucleotides. -66/-33 Ets M and -147/-119 Ets M are oligonucleotides that have a mutated Ets binding site. In A, 100 ng of competitor oligonucleotide was used; in B, competitors were used at either 10 or 100 ng as indicated. C, Supershift analysis of the C1 complex using either of two mAbs that recognize distinct epitopes in human Elf-1 (5A3 and 6G7) or no Ab (none).

 
Parallel studies were performed on the upstream Ets site, zEBS2, using a 32P-labeled double-stranded zEBS2-containing oligonucleotide probe (bases -147 to -119). As with zEBS1, a single prominent complex (C2) was observed that was competed by unlabeled zEBS2 but not by a mutated -147 to -119 oligonucleotide in which the Ets consensus sequence was altered (-147/-119 Ets M; Fig. 3Go). Competition studies again suggested that Elf-1 was binding zEBS2, since the E74 and zEBS1 (-66 to -33) oligonucleotides both competed at least as efficiently as unlabeled zEBS2 (Fig. 3Go and data not shown). However, a canonical Ets-1 binding site (MSV-LTR) also inhibited formation of C2, although to a lesser extent than E74 and zEBS1 (Fig. 3Go and data not shown). To determine whether Elf-1 or Ets-1 was binding to zEBS2 in EMSA, Abs specific for Ets-1 or Elf-1 were evaluated in supershift assays. Two different anti-Elf-1 mAbs completely supershifted C2 (Fig. 3Go), whereas the anti-Ets-1 Ab affected neither the formation nor the mobility of C2. Thus, like C1, the C2 complex contains Elf-1.



View larger version (69K):
[in this window]
[in a new window]
  		FIGURE 3. Elf-1 is the Ets family member that binds to zEBS2.EMSAs used the 32P-labeled -147/-119 (zEBS2) probe and 6 µg of Jurkat nuclear extract. Competition analysis was performed with 100 ng of the indicated cold oligonucleotide competitor. The -147/-119 Ets M oligonucleotide competitor has a mutation in the zEBS2 site. Supershift analysis was performed with either of two anti-human Elf-1 mAbs (5A3 and 6G7), an anti-Ets-1 antiserum, or no Ab.

 
Elf-1 trans-activates the TCR-{zeta} promoter

Because Jurkat cells express substantial levels of Elf-1, ectopic expression of Elf-1 would not be expected to appreciably affect transcription from the TCR-{zeta} promoter in these cells, and in fact, no up-regulation was observed in transient transfection assays (data not shown). To determine whether Elf-1 can support {zeta} promoter activity in T cells, a fusion protein, GAL4-ELF, containing the DNA binding domain of GAL4 (amino acids 1–147) and the entire human Elf-1 protein (amino acids 1–619), was assayed for its ability to activate two TCR-{zeta} promoter constructs containing engineered GAL4 binding sites (Pz1.2xGAL4 and FL.GAL4). Pz1.2xGAL4 consists of the Pz1 promoter region (-69/+58) with a mutated zEBS1 and two GAL4 binding sites immediately upstream of -69 (Fig. 4Go). Coexpression of the GAL4-Elf-1 fusion protein in Jurkat cells resulted in trans-activation of Pz1.2xGAL4 in a dose-dependent manner (Fig. 4Go, A and B). FL.GAL4 includes a full {zeta} promoter (-307/+58) in which zEBS1 was destroyed by point mutation, and zEBS2 replaced with a GAL4 DNA binding site. This promoter was similarly trans-activated by the GAL4-Elf-1 fusion (Fig. 4GoB). No increase was seen with reporter constructs that did not contain a GAL4 binding site (Fig. 4GoB and data not shown). These data indicate that Elf-1 can mediate trans-activation of the {zeta} promoter.



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 4. A GAL4-ELF-1 fusion protein trans-activates the full {zeta}-chain promoter and Pz1. A and B Jurkat cells were cotransfected with 7.5 µg of the indicated promoter construct and 1 to 10 µg of the GAL4-ELF-1 expression plasmid as indicated. Fold activation was calculated by dividing the luciferase activity of cells transfected with the GAL4-ELF-1 expression plasmid by the luciferase activity of cells transfected with the pSG424.RV control vector. Transfections had a total of 17.5 µg of DNA (A) or 12.5 µg of DNA (B), with differences being made up with the pSG424.RV vector. The data shown are representative of three independent experiments.

 
It has been suggested that activation domains differ in their ability to function with distinct core promoters (34), and there is evidence to suggest Elf-1 may be more efficient at activating Inr-containing promoters than promoters that only have a TATA box (35). To investigate whether there was selectivity in the ability of the GAL4-ELF fusion protein to activate GAL4 binding site-containing promoters, the trans-activation of a synthetic promoter construct G5BCAT-SP by GAL4-ELF was assessed. In G5BCAT-SP, transcription of the CAT gene is under the control of an E1b TATA box with several upstream Sp1 and GAL4 binding sites (33) (illustrated in Table IGo). Interestingly, although GAL4-ELF trans-activated G5BCAT-SP in Jurkat cells, the up-regulation was three- to fivefold less than that seen with Pz1.2xGAL, despite the fact that G5BCAT-SP has three additional GAL4 binding sites (Table IGo). To ensure that G5BCAT-SP could be activated through its GAL4 binding sites in Jurkat cells, an expression plasmid (GAL4-VP16) encoding the GAL4-DNA binding domain and the acidic activation domain of the strong viral activator, VP16 (34), was evaluated for its ability to activate both Pz1.2xGAL4 and G5BCAT-SP. As shown (Table IGo), both constructs were substantially up-regulated by GAL4-VP16, although the up-regulation of G5BCAT-SP by GAL4-VP16 was higher than that seen for Pz1.2xGAL. These data indicate that the observed difference in the ability of GAL4-ELF to activate Pz1.2xGAL4 compared with G5BCAT-SP is not due to an inability of G5BCAT-SP to be activated in Jurkat cells. Therefore, these data suggest that there is selectivity in the ability of GAL-ELF to activate GAL4 binding site-containing promoters and that Elf-1 is able to trans-activate the TCR-{zeta} promoter more efficiently than the TATA box containing G5BCAT-SP promoter. Our results using a GAL4-ELF fusion protein together with the findings that Elf-1 is the Ets family member that normally binds to both zEBS1 and zEBS2 support a role for Elf-1 in regulating TCR-{zeta} gene transcription.


View this table:
[in this window]
[in a new window]
  		Table I. GAL4-ELF preferentially activates the TCR-{zeta} promoter compared with an E1b TATA promoter construct

 
To determine whether Elf-1 could directly augment the activity of the TCR-{zeta} promoter, Elf-1 was ectopically expressed in COS-7 cells, which have low endogenous levels of Elf-1 compared with Jurkat cells (B. L. Rellahan and A. M. Weissman, unpublished observations). No reproducible Elf-1-mediated enhancement was seen in TCR-{zeta} promoter constructs with either only one or no intact Elf-1 sites (Fig. 5Go and data not shown). However, overexpression of Elf-1 did result in a consistent three- to fourfold up-regulation of expression from the full-length wild-type TCR-{zeta} promoter (Fig. 5Go). These findings indicate that Elf-1 can activate the TCR-{zeta} promoter in nonlymphoid cells and, together with previous data, establishes a role for Elf-1 in regulating basal transcription from the TCR-{zeta} promoter.



View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 5. Elf-1 trans-activation of TCR-{zeta} in COS-7 requires zEBS1 and zEBS2. COS-7 cells were transfected with 7.5 µg of the indicated TCR-{zeta} promoter constructs and 7.5 µg of a Elf-1 expression vector (pcDELF-1) or the control vector (pCDNA-1). Shown is the mean relative luciferase activity from five independent experiments ± SE.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Transcription from the TCR-{zeta} gene is directed by a TATA-less promoter that extends from +58 to -307 relative to the most 3' major site of transcription initiation (11). The contributions of two binding sites in this region for the Ets family of transcription factors (designated zEBS1 and zEBS2) were assessed for their ability to regulate TCR-{zeta} promoter expression. We found that in Jurkat cells, one Ets binding site must be intact for efficient transcription from the TCR-{zeta} promoter. Elimination of both Ets binding sites resulted in a marked reduction in TCR-{zeta} promoter expression. Multiple lines of evidence suggest that Elf-1 is the Ets family member that regulates the TCR-{zeta} promoter through zEBS1 and zEBS2. First, an EMSA supershift analysis demonstrated that Elf-1 physically interacts with both zEBS1 and zEBS2. Second, ectopic expression of Elf-1 in COS-7 cells resulted in an increase in TCR-{zeta} promoter activity that mapped to zEBS1 and zEBS2. Finally, a GAL4-Elf-1 fusion protein efficiently enhanced transcription from the TCR-{zeta} promoter in Jurkat cells when directed to the {zeta} promoter through either one or two tandem GAL4 binding sites. Taken together, these data indicate that Elf-1 regulates TCR-{zeta} promoter activity.

It has been proposed that the ability of Ets family members to mediate trans-activation depends on interactions with other DNA binding proteins (36). Elf-1 has been demonstrated to functionally interact with inducible transcription factors such as activating protein-1, NF-{kappa}B, and NF-AT (24, 25, 27, 28) and physically associate with HMG-I(Y), Jun family members, and the NF-{kappa}B proteins, p50 and c-Rel (29, 37, 38). Determination of the optimal consenus sequence for Elf-1 binding has made it clear that a number of Elf-1 binding sites, particularly those in inducible promoters and enhancers, are of relatively low affinity (39). This together with the aforementioned transcription factor interactions suggest that the in vivo binding of Elf-1 to DNA is stabilized by the formation of transcriptionally active multiprotein complexes (29, 36, 37, 38, 39).

Elf-1 is expressed in thymocytes, and its expression pattern is unaffected by T cell activation (30, 35). TCR-{zeta}, unlike other Elf-1 targets, is constitutively expressed in all T cell lineages and throughout much of T cell development. Furthermore, the TCR-{zeta} promoter can be trans-activated by Elf-1 in nonlymphoid cells. The latter property may be due to the presence of two TCR-{zeta} Elf-1 sites, one of which (zEBS1: CCAGGAAGT) is the best match (eight of nine bases) with the optimal Elf-1 consensus sequence (consensus: CCCGGAAGT) of all known Elf-1 sites, suggesting that it is among the highest affinity Elf-1 binding sites yet identified (39) (Fig. 6Go). The assignment of relative affinities of Elf-1 binding sites based on consensus sequence homology (39) is supported by EMSA experiments in which Elf-1 had an approximately 10-fold higher affinity for zEBS1 compared with zEBS2 (data not shown), the latter being a six of nine match with the consensus sequence (39).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 6. Comparison of Elf-1 binding sites. Shown is a comparison of published Elf-1 binding sites. A single asterisk and a double asterisk are used to denote identical sequences from two different genes. The 8-bp sequence that is shared between the noninducible and viral genes is underlined.

 
Our results indicate that Elf-1-mediated trans-activation of the TCR-{zeta} promoter does not require acute activation. Consistent with this, binding of Elf-1 to zEBS1 has been observed in nuclear extracts from both unactivated and activated human peripheral blood T cells (our unpublished observations). Whether the ability of Elf-1 to mediate activation of the TCR-{zeta} promoter requires other interacting transcription factors remains to be determined. The ubiquitously expressed transcription factor Sp1 is one likely candidate. Sp1 binds to sites downstream from both zEBS1 and zEBS2 (B. L. Rellahan and A. M. Weissman, unpublished observations) and is known to cooperate with Ets-1 in regulating tissue-specific promoters (40, 41). However, the presence of two high affinity Elf-1 sites (eight of nine and six of nine matches) in close proximity to each other makes it also reasonable to speculate that Elf-1 might bind the TCR-{zeta} promoter in vivo without a requirement for other stabilizing factors. The requirement for both zEBS1 and zEBS2 for TCR-{zeta} promoter activity in COS-7 cells suggests that under certain conditions, interactions between these sites may play a role in mediating trans-activation.

As already noted, the zEBS1 Elf-1 binding site in the TCR-{zeta} promoter is an eight of nine base pair match with the optimal Elf-1 consensus sequence. In comparison, genes whose expression is dependent on T cell activation generally have sites that match the consensus sequence at fewer nucleotides than zEBS1 and therefore are presumably of lower affinity (Fig. 6Go). In particular, the Elf-1 sites within the IL-2R {alpha} subunit (29), IL-3 (27), and granulocyte-macrophage CSF (28) genes match the consensus sequence in six, six, and five of nine bases, respectively (39), and the two IL-2 gene Elf-1 sites match the consensus sequence in only four of nine bases (25). The developmentally regulated TdT and CD4 genes have Elf-1 sites that are better matches than the T cell activation-dependent genes (35, 42). Both CD4 and TdT are trans-activated by Elf-1 through single Elf-1 sites that are seven of nine matches with the consensus sequence (39) and share an eight-base core sequence with zEBS1 (CAGGAAGT). Each of these genes is transcribed constitutively during specific stages of thymocyte development (35), and in mature cells CD4 expression defines a subpopulation of T lymphocytes (2). Despite the fact that the TdT Elf-1 site is a close match to the Elf-1 consensus site, ectopic Elf-1 expression is not sufficient to mediate trans-activation through an unmodified TdT promoter in nonlymphoid cells (35). However, placing a concatamer of three Elf-1 sites upstream of the TdT promoter allowed trans-activation by Elf-1 in nonlymphoid cells (35).

This requirement for multiple Elf-1 binding sites in nonlymphoid cells, seen with the TdT promoter, is consistent with our observations that both Elf-1 sites in the TCR-{zeta} promoter are required for trans-activation in COS-7 cells. This suggests that the presence of multiple Elf-1 binding sites may overcome requirements for stabilizing cofactors or may compensate for lower functional levels of Elf-1. Notably, in addition to TCR-{zeta} and the IL-2 gene, the HIV-2 (24, 43) and Human T-cell leukemia virus type I (HTLV-1) (26) enhancers both have two Elf-1 binding sites. Both of these viral enhancers exhibit one Elf-1 binding site that is a good match with the consensus (seven of nine match) and one that is only a five of nine base pair match. This is analogous to the TCR-{zeta} promoter and in contrast to the IL-2 gene, whose two sites are only a four of nine base match with the consensus. Moreover, the HIV-2 PUB2 site shares the common eight-base core sequence with zEBS1, CD4, and TdT. It is of note that the murine TCR-{zeta} promoter also exhibits two Elf-1 binding sites in analogous locations to those found in the human gene (44). Murine zEBS1 has one nucleotide change compared with its human counterpart, resulting in a seven of nine base match with the consensus sequence. Strikingly, murine zEBS2 exhibits two nucleotide changes compared with human zEBS2. This results in murine zEBS2 having the identical nine-base core sequence found in human zEBS1 (Fig. 6Go).

One view of the existing data, which elaborates on those of others (35, 39), is that Elf-1 activation of genes is regulated by the number and the affinity of cognate sites for this factor within a given promoter or enhancer. Genes that are acutely regulated as a consequence of cellular activation have relatively low affinity Elf-1 binding sites, minimizing their potential to be activated by constitutive levels of available Elf-1, and they require additional factors to stabilize Elf-1 binding. Genes that are developmentally regulated exhibit sites that are better matches with the consensus sequence and therefore are likely to have higher affinities for Elf-1. The TCR-{zeta} gene, which is expressed constitutively throughout most of T cell development and is not known to be acutely regulated, has multiple Elf-1 sites, including one of apparently high affinity. The extent to which interactions between neighboring Elf-1 sites function to sustain Elf-1-mediated trans-activation of TCR-{zeta} or alter the requirement for other interacting DNA binding proteins remains to be determined. Finally, while this study establishes a role for Elf-1 in expression from the TCR-{zeta} promoter, the fact that the tissue distribution of TCR-{zeta} is more restricted than that of Elf-1 itself suggests that other factors also contribute to the restricted expression of this TCR component.


   Acknowledgments
 
The authors thank J. M. Leiden for supplying the 6G7 and 5A3 mAbs, W. J. Leonard for pcDElf-1, M. Ptashne for pSG424, G. Chinnadurai for G5BCAT-SP, and V. Seyfert for the GAL4-VP16 expression plasmid. The authors acknowledge W. J. Leonard, R. Brown, J. Laborda, and P. Middelstadt for invaluable discussions and review of this manuscript.


   Footnotes
 
1 This work was supported in part by a National Research Council Associateship (to B.L.R.). Back

2 Address correspondence and reprint requests to Dr. Barbara L. Rellahan, Laboratory of Immunobiology, Center for Biologics Evaluation and Research, Food and Drug Administration, Building 29B, Room 5E16, HFM 564, 1401 Rockville Pike, Rockville, MD 20892. E-mail address: Back

3 Abbreviations used in this paper: EMSA, electrophoretic mobility shift assay; MSV-LTR, Moloney murine sarcoma virus-long terminal repeat; CAT, chloramphenicol acetyltransferase; NF-AT, nuclear factor of activated T cells; TdT, terminal deoxynucleotidyl transferase. Back

Received for publication July 24, 1997. Accepted for publication November 18, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Weissman, A. M., S. J. Frank, D. G. Orloff, M. Mercep, J. D. Ashwell, R. D. Klausner. 1989. Role of the {zeta} chain in the expression of the T cell antigen receptor: genetic reconstitution studies. EMBO J. 8:3651.[Medline]
  2. Ashwell, J. D., A. M. Weissman. 1995. T cell antigen receptor genes, gene products and co-receptors. R. R. Rich, and T. A. Fleisher, and B. D. Schwartz, and W. T. Shearer, and W. Strober, eds. Clinical Immunology Principles and Practice 69. Mosby-Year Book, St. Louis.
  3. Love, P. E., E. W. Shores, M. D. Johnson, M. L. Tremblay, E. J. Lee, A. Grinberg, S. P. Huang, A. Singer, H. Westphal. 1993. T cell development in mice that lack the {zeta} chain of the T cell antigen receptor complex. Science 261:918.[Abstract/Free Full Text]
  4. Love, P. E., E. W. Shores, E. J. Lee, A. Grinberg, T. I. Munitz, H. Westphal, A. Singer. 1994. Differential effects of {zeta} and {eta} transgenes on early {alpha}/ß T cell development. J. Exp. Med. 179:1485.[Abstract/Free Full Text]
  5. Irving, B. A., A. Weiss. 1991. The cytoplasmic domain of the T cell receptor {zeta} chain is sufficient to couple to receptor-associated signal transduction pathways. Cell 64:891.[Medline]
  6. Letourneur, F., R. D. Klausner. 1991. T-cell and basophil activation through the cytoplasmic tail of T-cell-receptor {zeta} family proteins. Proc. Natl. Acad. Sci. USA 88:8905.[Abstract/Free Full Text]
  7. Romeo, C., B. Seed. 1991. Cellular immunity to HIV activated by CD4 fused to T cell or Fc receptor polypeptides. Cell 64:1037.[Medline]
  8. Samelson, L. E., M. D. Patel, A. M. Weissman, J. B. Harford, R. D. Klausner. 1986. Antigen activation of murine T cells induces tyrosine phosphorylation of a polypeptide associated with the T cell antigen receptor. Cell 46:1083.[Medline]
  9. Baniyash, M., P. Garcia-Morales, E. Luong, L. E. Samelson, R. D. Klausner. 1988. The T cell antigen receptor {zeta} chain is tyrosine phosphorylated upon activation. J. Biol. Chem. 263:18225.[Abstract/Free Full Text]
  10. Cenciarelli, C., D. Hou, K.-C. Hsu, B. L. Rellahan, D. L. Wiest, H. T. Smith, V. A. Fried, A. M. Weissman. 1992. Activation-induced ubiquitination of the T cell antigen receptor. Science 257:795.[Abstract/Free Full Text]
  11. Rellahan, B. L., J. P. Jensen, A. M. Weissman. 1994. Transcriptional regulation of the T cell antigen receptor {zeta} subunit: identification of a tissue-restricted promoter. J. Exp. Med. 180:1529.[Abstract/Free Full Text]
  12. Ko, L. J., J. D. Engel. 1993. DNA-binding specificities of the GATA transcription factor family. Mol. Cell. Biol. 13:4011.[Abstract/Free Full Text]
  13. Merika, M., S. H. Orkin. 1993. DNA-binding specificity of GATA family transcription factors. Mol. Cell. Biol. 13:3999.[Abstract/Free Full Text]
  14. Wang, C. Y., B. Petryniak, I. C. Ho, C. B. Thompson, J. M. Leiden. 1992. Evolutionarily conserved Ets family members display distinct DNA binding specificities. J. Exp. Med. 175:1391.[Abstract/Free Full Text]
  15. Seth, A., T. S. Papas. 1990. The c-ets-1 proto-oncogene has oncogenic activity and is positively autoregulated. Oncogene 5:1761.[Medline]
  16. Macleod, K., D. Leprince, D. Stehelin. 1992. The ets gene family. Trends Biochem. Sci. 17:251.[Medline]
  17. Landsman, D., A. P. Wolffe. 1995. Common sequence and structural features in the heat-shock factor and Ets families of DNA-binding domains. Trends Biochem. Sci. 20:225.[Medline]
  18. Ho, I. C., N. K. Bhat, L. R. Gottschalk, T. Lindsten, C. B. Thompson, T. S. Papas, J. M. Leiden. 1990. Sequence-specific binding of human Ets-1 to the T cell receptor {alpha}-gene enhancer. Science 250:814.[Abstract/Free Full Text]
  19. Salmon, P., A. Giovane, B. Wasylyk, and D. Klatzmann. Characterization of the human CD4 gene promoter: transcription from the CD4 gene core promoter is tissue-specific and is activatedby Ets proteins. Proc. Natl. Acad. Sci. USA 90:7739.
  20. Leung, S., S. McCracken, J. Ghysdael, N. G. Miyamoto. 1993. Requirement of an ETS-binding element for transcription of the human lck type I promoter. Oncogene 8:989.[Medline]
  21. Gottschalk, L. R., J. M. Leiden. 1990. Identification and functional characterization of the human T-cell receptor ß gene transcriptional enhancer: common nuclear proteins interact with the transcriptional regulatory elements of the T-cell receptor {alpha} and ß genes. Mol. Cell. Biol. 10:5486.[Abstract/Free Full Text]
  22. Lin, J. X., N. K. Bhat, S. John, W. S. Queale, W. J. Leonard. 1993. Characterization of the human interleukin-2 receptor ß-chain gene promoter: regulation of promoter activity by ets gene products. Mol. Cell. Biol. 13:6201.[Abstract/Free Full Text]
  23. Romano-Spica, V., P. Georgiou, H. Suzuki, T. S. Papas, N. K. Bhat. 1995. Role of ETS1 in IL-2 gene expression. J. Immunol. 154:2724.[Abstract]
  24. Leiden, J. M., C. Y. Wang, B. Petryniak, D. M. Markovitz, G. J. Nabel, C. B. Thompson. 1992. A novel Ets-related transcription factor, Elf-1, binds to human immunodeficiency virus type 2 regulatory elements that are required for inducible trans activation in T cells. J. Virol. 66:5890.[Abstract/Free Full Text]
  25. Thompson, C. B., C. Y. Wang, I. C. Ho, P. R. Bohjanen, B. Petryniak, C. H. June, S. Miesfeldt, L. Zhang, G. J. Nabel, B. Karpinski, J. M. Leiden. 1992. cis-acting sequences required for inducible interleukin-2 enhancer function bind a novel Ets-related protein, Elf-1. Mol. Cell. Biol. 12:1043.[Abstract/Free Full Text]
  26. Clark, N. M., M. J. Smith, J. M. Hilfinger, D. M. Markovitz. 1993. Activation of the human T-cell leukemia virus type I enhancer is mediated by binding sites for Elf-1 and the pets factor. J. Virol. 67:5522.[Abstract/Free Full Text]
  27. Gottschalk, L. R., D. M. Giannola, S. G. Emerson. 1993. Molecular regulation of the human IL-3 gene: inducible T cell-restricted expression requires intact AP-1 and Elf-1 nuclear protein binding sites. J. Exp. Med. 178:1681.[Abstract/Free Full Text]
  28. Wang, C. Y., A. G. Bassuk, L. H. Boise, C. B. Thompson, R. Bravo, J. M. Leiden. 1994. Activation of the granulocyte-macrophage colony-stimulating factor promoter in T cells requires cooperative binding of Elf-1 and AP-1 transcription factors. Mol. Cell. Biol. 14:1153.[Abstract/Free Full Text]
  29. John, S., R. B. Reeves, J. X. Lin, R. Child, J. M. Leiden, C. B. Thompson, W. J. Leonard. 1995. Regulation of cell-type-specific interleukin-2 receptor {alpha}-chain gene expression: potential role of physical interactions between Elf-1, HMG-I(Y), and NF-{kappa}B family proteins. Mol. Cell. Biol. 15:1786.[Abstract]
  30. Wang, C. Y., B. Petryniak, C. B. Thompson, W. G. Kaelin, J. M. Leiden. 1993. Regulation of the Ets-related transcription factor Elf-1 by binding to the retinoblastoma protein. Science 260:1330.[Abstract/Free Full Text]
  31. Howcroft, T. K., L. A. Palmer, J. Brown, B. Rellahan, F. Kashanchi, J. N. Brady, D. S. Singer. 1995. HIV Tat represses transcription through Sp1-like elements in the basal promoter. Immunity 3:127.[Medline]
  32. Sadowski, I., J. Ma, S. Triezenberg, M. Ptashne. 1988. GAL4-VP16 is an unusually potent transcriptional activator. Nature 335:563.[Medline]
  33. Kamine, J., T. Subramanian, G. Chinnadurai. 1991. Sp1-dependent activation of a synthetic promoter by human immunodeficiency virus type 1 Tat protein. Proc. Natl. Acad. Sci. USA 88:8510.[Abstract/Free Full Text]
  34. Emami, K. H., W. W. Navarre, S. T. Smale. 1995. Core promoter specificities of the Sp1 and VP16 transcriptional activation domains. Mol. Cell. Biol. 15:5906.[Abstract]
  35. Ernst, P., K. Hahm, N. Davis, M. F. Roussel, C. W. Turck, S. T. Smale. 1996. A potential for Elf-1 in terminal transferase gene regulation. Mol. Cell. Biol. 16:6121.[Abstract]
  36. Brown, T. A., S. L. McKnight. 1992. Specificities of protein-protein and protein-DNA interaction of GABP {alpha} and two newly defined ets-related proteins. Genes Dev. 6:2502.[Abstract/Free Full Text]
  37. Bassuk, A. G., J. M. Leiden. 1995. A direct physical association between ETS and AP-1 transcription factors in normal human T cells. Immunity 3:223.[Medline]
  38. John, S., C. M. Robbins, W. J. Leonard. 1996. An IL-2 response element in the human IL-2 receptor {alpha} chain promoter is a composite element that binds Stat5, Elf-1, HMG-I(Y) and a GATA family protein. EMBO J. 15:5627.[Medline]
  39. John, S., R. Marais, R. Child, Y. Light, W. J. Leonard. 1996. Importance of low affinity Elf-1 sites in the regulation of lymphoid-specific inducible gene expression. J. Exp. Med. 183:743.[Abstract/Free Full Text]
  40. Gegonne, A., R. Bosselut, R. A. Bailly, J. Ghysdael. 1993. Synergistic activation of the HTLV1 LTR Ets-responsive region by transcription factors Ets1 and Sp1. EMBO J. 12:1169.[Medline]
  41. Dittmer, J., A. Gegonne, S. D. Gitlin, J. Ghysdael, J. N. Brady. 1994. Regulation of parathyroid hormone-related protein (PTHrP) gene expression: Sp1 binds through an inverted CACCC motif and regulates promoter activity in cooperation with Ets1. J. Biol. Chem. 269:21428.[Abstract/Free Full Text]
  42. Wurster, A. L., G. Siu, J. M. Leiden, S. Hedrick. 1994. Elf-1 binds to a critical element in a second CD4 enhancer. Mol. Cell. Biol. 14:6452.[Abstract/Free Full Text]
  43. Markovitz, D. M., M. J. Smith, J. Hilfinger, M. C. Hannibal, B. Petryniak, G. J. Nabel. 1992. Activation of the human immunodeficiency virus type 2 enhancer is dependent on purine box and {kappa}B regulatory elements. J. Virol. 66:5479.[Abstract/Free Full Text]
  44. Wang, L., N. Bronstein, V. Hsu, M. Baniyash. 1995. Transcriptional regulation of the murine TCR {zeta} gene. Int. Immunol. 7:1627.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
C. L. Gorman, A. I. Russell, Z. Zhang, D. Cunninghame Graham, A. P. Cope, and T. J. Vyse
Polymorphisms in the CD3Z Gene Influence TCR{zeta} Expression in Systemic Lupus Erythematosus Patients and Healthy Controls
J. Immunol., January 15, 2008; 180(2): 1060 - 1070.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y.-T. Juang, L. Sumibcay, M. Tolnay, Y. Wang, V. C. Kyttaris, and G. C. Tsokos
Elf-1 Binds to GGAA Elements on the FcR{gamma} Promoter and Represses Its Expression
J. Immunol., October 1, 2007; 179(7): 4884 - 4889.
[Abstract] [Full Text] [PDF]

Home page
 Rheumatology (Oxford)Home page
K. Tenbrock, Y.-T. Juang, V. C. Kyttaris, and G. C. Tsokos
Altered signal transduction in SLE T cells
Rheumatology, October 1, 2007; 46(10): 1525 - 1530.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. Tenbrock, V. C. Kyttaris, M. Ahlmann, J. M. Ehrchen, M. Tolnay, H. Melkonyan, C. Mawrin, J. Roth, C. Sorg, Y.-T. Juang, et al.
The Cyclic AMP Response Element Modulator Regulates Transcription of the TCR {zeta}-Chain
J. Immunol., November 1, 2005; 175(9): 5975 - 5980.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H.-b. Ji, A. Gupta, S. Okamoto, M. D. Blum, L. Tan, M. B. Goldring, E. Lacy, A. L. Roy, and C. Terhorst
T Cell-specific Expression of the Murine CD3delta Promoter
J. Biol. Chem., November 27, 2002; 277(49): 47898 - 47906.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y.-T. Juang, K. Tenbrock, M. P. Nambiar, M. F. Gourley, and G. C. Tsokos
Defective Production of Functional 98-kDa Form of Elf-1 Is Responsible for the Decreased Expression of TCR {zeta}-Chain in Patients with Systemic Lupus Erythematosus
J. Immunol., November 15, 2002; 169(10): 6048 - 6055.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. C. Rodriguez, A. H. Zea, K. S. Culotta, J. Zabaleta, J. B. Ochoa, and A. C. Ochoa
Regulation of T Cell Receptor CD3zeta Chain Expression by L-Arginine
J. Biol. Chem., June 7, 2002; 277(24): 21123 - 21129.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y.-T. Juang, E. E. Solomou, B. Rellahan, and G. C. Tsokos
Phosphorylation and O-Linked Glycosylation of Elf-1 Leads to Its Translocation to the Nucleus and Binding to the Promoter of the TCR {zeta}-Chain
J. Immunol., March 15, 2002; 168(6): 2865 - 2871.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
F. Karantzoulis-Fegaras, H. Antoniou, S.-L. M. Lai, G. Kulkarni, C. D'Abreo, G. K. T. Wong, T. L. Miller, Y. Chan, J. Atkins, Y. Wang, et al.
Characterization of the Human Endothelial Nitric-oxide Synthase Promoter
J. Biol. Chem., January 29, 1999; 274(5): 3076 - 3093.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rellahan, B. L.
Right arrow Articles by Weissman, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rellahan, B. L.
Right arrow Articles by Weissman, A. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS