| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Departments of Pediatrics and Medicine, National Jewish Medical and Research Center, Denver, CO 80206;
Institut de Génétique et de Biologie Moléculaire et Cellulaire, Institut National de la Santé et de la Recherche Médicale, Centre National de la Recherche Scientifique, Université Louis Pasteur, C.U. de Strasbourg, Strasbourg, France;
Department of Pathology, Centre Médical Universitaire, Geneva, Switzerland;
§
Basel Institute for Immunology, Basel, Switzerland; and
¶
Departments of Medicine and Immunology, University of Colorado Health Sciences Center, Denver, CO 80262
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The genes encoded within H2z that contribute to
lupus in New Zealand hybrid mice are not known. Since the production of
pathogenic IgG autoantibodies and the development of lupus nephritis in
this model are CD4+ T cell dependent (12), it was
hypothesized that class II MHC genes, either Az or
Ez, are likely candidates. This hypothesis is
further supported by studies of NZB mice congenic for either
H2b or H2bm12 (13). Although the
difference in the MHCs of these strains is limited to three amino acids
in the I-Aß molecules, studies showed that NZB.H2bm12
mice developed severe disease similar to (NZB x
NZW)F1 mice, whereas NZB.H2b mice were similar
to NZB (H2d) and did not develop severe lupus
nephritis. Based on particular sequence homologies between
I-Aßbm12 and I-Eß, these (13) and other investigators
(14) postulated that expression of I-Ez or of mixed class
II molecules such as I-E
d/I-Eßz was most
likely to determine the contribution of H2z genes to
lupus in the (NZB x NZW)F1 model.
In the present study, we used transgenic mice expressing I-Ez to test the hypothesis that H2-Eaz (Eaz) and/or H2-Eb1z (Ebz) genes account for the H2z genetic contribution to lupus in the New Zealand hybrid model. Our analysis of backcross mice showed that unlike mice carrying H2z, mice inheriting the Eaz and Ebz transgenes do not demonstrate increased IgG autoantibody production or increased incidence of nephritis. In contrast, in the same transgenic backcross mice, inheritance of the endogenous H2b from the B6 strain and inheritance of a NZB locus on distal chromosome 1 (previously named Nba2) were strongly linked with the production of IgG autoantibodies.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Parental NZB/BINJ and C57BL/6J (designated B6) mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and were maintained in the animal care facility at the National Jewish Medical and Research Center (Denver, CO). All congenic, transgenic, F1, and backcross mice were bred and maintained at the National Jewish Medical and Research Center. Only female mice were studied for expression of disease.
B6 mice were made congenic for H2z by mating these
mice with NZW mice and backcrossing the progeny to B6. Inheritance of
H2z was monitored by immunofluorescence analysis of
I-Az expression and by screening for a simple sequence
length polymorphism in the TNF- gene (Tnfa)
(15). The congenic strain (designated B6.H2z) was made
homozygous for H2z after 12 generations. Congenic
mice were analyzed for the length of the NZW chromosome 17 interval
bred onto the recipient B6 strain. In relation to the MHC, analysis of
markers approximately 1 cM proximal to MHC on chromosome 17
(D17Mit16; 
18.2 cM from the centromere), within
the MHC (Tnfa (15) or H2zAlu repeat; 19 cM from the centromere), and about 4 cM distal
to MHC (D17Mit49 or D17Mit50; 23.2 cM
from the centromere) showed alleles inherited from NZW in the congenic
animals.
In preparation for the generation of transgenic mice, genomic fragments encoding the Eaz- and Ebz-coding regions were isolated from an NZW splenic DNA cosmid library (see below). Transgenic mice were generated in the laboratories of Diane Mathis and Christophe Benoist (Strasbourg, France) using methods previously described (16). B6 eggs were coinjected with Eaz and Ebz genomic DNA and reimplanted into foster mothers, and tails from the resulting offspring were analyzed by Southern blotting for integration of the injected DNA. Three founders were initially identified, of which one was found to have both Eaz and Ebz genes. This line was perpetuated by repeated backcrossing with B6 mice. Inheritance of the transgenes was determined by PCR analysis of genomic DNA. Primer sequences (5'-3') to detect the Ebz transgene were CTACAACCGGGAGGAGTGGG (forward) and TCCACCGCGGCCCGCCTTTG (reverse), and primer sequences to detect the Eaz transgene were AAGTGAAACTCAGATACTAA (forward) and CCAGGGCTCCAATTGTGGCC (reverse). Occasional offspring were also analyzed by immunofluorescence staining for expression of I-E on peripheral blood cells (see below). In the process of backcrossing, two sites of integration were identified, and these were separated during breeding to generate two transgenic lines, each with Eaz and Ebz genes. One of the lines was designated B6.Ez, and the other had lower copy numbers and relatively lower levels of I-E expression and was designated B6.Ezlo. Integration sites for each of these lines were not linked to MHC or to loci on distal chromosome 1 and were not studied further. Integration of the Ez genes had no noticeable effect on the health of the B6 recipients, and there was no evidence of autoimmune disease or autoantibody production in the transgenic strains.
Evaluation of renal disease and collection of tissue
Mice were studied from 4 to 12 mo of age and were evaluated for
proteinuria at bimonthly intervals using
tetrachlorophenol-tetrabromosulfophthalein paper (Chemstrip, Boehringer
Mannheim, Indianapolis, IN) as previously described (17). A scoring
system of 0 to 3+ was used, as follows: 0/trace, <30 mg/dl; 1+, 30
mg/dl; 2+, 100 mg/dl; and 3+, >300 mg/dl. A score of 2+ or greater
was considered indicative of severe proteinuria, and mice exhibiting
severe proteinuria on two or more successive occasions or at the final
evaluation before death were considered positive for renal disease. A
negative phenotype was ascribed to mice that did not exhibit
proteinuria during the 12 mo of follow-up, and these mice appeared
healthy at the time of death. A correlation between severe proteinuria
and death from renal failure was demonstrated previously (6), and a
strong correlation with histologic severity of glomerulonephritis has
been more recently confirmed (T. J. Vyse and B. L. Kotzin,
unpublished observations), supporting the validity of using high levels
of proteinuria as an indicator of severe and progressive
glomerulonephritis. Similar to past studies (3, 6, 17, 18), the
development of proteinuria also predicted early mortality in the
current study. For example, of the 14 (B6.H2z x
NZB)F1 x NZB backcross mice that developed proteinuria by
10 mo of age, 13 (93%) died by 12 mo of age. In contrast, none of the
69 mice in this cohort without proteinuria died during the 1-yr
observation period.
The tip of the tail from all backcross mice was excised at 4 mo of age. The liver and kidneys were collected at the time of death or elective sacrifice at 12 mo of age. All tissues were stored at -70°C, and DNA was extracted as previously described (19). The study mice were also bled (from the tail) at monthly intervals from the age of 5 mo. The blood was allowed to clot at room temperature, and the serum was stored at -20°C until analyzed for autoantibody levels.
Generation of NZW splenic DNA cosmid library
DNA extracted from NZW spleen cells was used to generate a
cosmid library as previously described (20). Splenic DNA was partially
digested with MboI to generate 35- to 45-kb fragments,
ligated into BamHI-digested pCV 107 cosmid vector, packaged
(Gigapack Gold, Stratagene, La Jolla, CA), and grown in
Escherichia coli. The library was plated at about 10,000
colonies/filter, and 4.1 x 105 total colonies were
screened. Probes were generated from mRNA expressed by LPS-stimulated B
cell blasts from NZW mice, PCR amplification of segments of the
Eaz and Ebz genes, and cloning of
PCR fragments into pEMBL. Before generation of the transgenic mice, the
selected cosmid clones (see Fig. 1
) were
shown to mediate expression of I-E after transfection into A20
cells.
|
Spleen cells from the different parental strains and backcross
mice were prepared and stained as previously described (21).
Fluoresceinated mAbs used included 10-2-16
(anti-I-Az (22); hybridoma cells obtained from
American Type Culture Collection, Rockville, MD), D3
(anti-I-Ab; provided by Dr. John Cambier, Denver, CO),
and 14-4-4s (anti-I-E (23); hybridoma cells obtained from
American Type Culture Collection). B cells were also double stained
using a biotinylated mAb to B220 (RA3-6B2; PharMingen, San Diego, CA)
followed by avidin-phycoerythrin (PharMingen). Fluorescence
intensity was analyzed on an EPICS C flow cytometer (Coulter
Electronics, Inc., Hialeah, FL). Viable mononuclear cells were gated by
scatter analysis, and 1 x 104 cells were collected
for each Ab combination.
Genomic mapping using simple sequence length polymorphisms (SSLP)
SSLP mapping was used to analyze the linkage of NZB loci on
distal chromosome 1 and the MHC with the development of nephritis and
IgG autoantibody production. Oligonucleotide primers for
D1Mit111 mapped 92 centiMorgans (cM) from the centromere on
chromosome 1 (designated 1; 92) and D1Mit221 (1; 102 cM)
were purchased from Research Genetics (Huntsville, AL), and primers for
Crp (1; 94 cM) and Tnfa (17; 19 cM) were
synthesized by the Molecular Resource Center at the National Jewish
Medical and Research Center using an Applied Biosystems model 392 DNA
synthesizer (Foster City, CA). Primer nucleotide sequences (internet:
http://www-genome.wi.mit.edu/), and the methods for SSLP screening and
mapping have been previously described (3). The positions of SSLP
markers (and genetic loci) are given in accordance with the Mouse
Chromosome Committee Reports obtained through the Encyclopedia of the
Mouse Genome, Mouse Genome Database, The Jackson Library (Bar Harbor,
ME; URL: http://www.informatics.jax.org).
Amplification of simple sequence repeats was achieved using PCR in a PTC-100 thermal cycler (MJ Research, Watertown, MA). Twenty-microliter reactions were conducted using 35 cycles consisting of 30 s at 94°C, 1 min at 55°C, and 30 s at 72°C. Ten to fifteen microliters of PCR product was loaded onto a 15% polyacrylamide gel and electrophoresed at 12 V/cm for 2 to 4 h. Gels were then visualized by ethidium bromide staining after transillumination. Polymorphisms were scored in comparison to results from parental PCR products.
Serologic assays
Abs to nuclear Ags were determined by ELISA as previously
described (3, 11, 24). Briefly, wells of Immulon II microtiter plates
(Dynatech Laboratories, Chantilly, VA) were coated with calf thymus
chromatin at 2.5 µg/ml in PBS, pH 7.2, and postcoated with 1 mg/ml
gelatin. Serum samples were diluted 1/300 in PBS with 0.5% Tween
supplemented with 5 mg/ml bovine 
-globulins (Sigma Chemical Co.) and
gelatin, and added to Ag-coated wells for 90 min. After washing, wells
were incubated with peroxidase-conjugated Ab for mouse IgG (Kirkegaard
and Perry, Gaithersburg, MD). After 90 min and washing, substrate was
added, and OD was determined with an automated spectrophotometer
(Dynatech Laboratories) at 405 nm. The dsDNA (plasmid pGEM dsDNA) was
biotinylated and bound to streptavidin-coated microtiter plates (24).
The assay was then performed as described above. All samples were also
assayed in wells coated with streptavidin as a control. Previous
studies have shown that this assay demonstrates minimal
cross-reactivity for Ab activity in sera containing only anti-ssDNA
Abs or for ssDNA-specific mAb (11). All assays were performed in
duplicate and were quantified against a standard curve obtained with
mAbs to the appropriate nuclear Ag as previously described
(3).
IgG subclass anti-chromatin autoantibody levels were assayed using the same anti-chromatin ELISA, but IgG subclass-specific second-step Abs were used as detecting reagents as previously described (11). Standard curves were obtained using the same (NZB x NZW)F1 control sera in each assay (11).
The production of autoantibodies to gp70 was quantitated as serum levels of gp70-anti-gp70 immune complexes (gp70 IC), since the relative excess of gp70 in serum makes free anti-gp70 Abs difficult to detect (25). These complexes were measured by ELISA after precipitation of the serum with polyethylene glycol (average m.w. = 6000) as previously described (26). The results are expressed as micrograms per milliliter of gp70 complexed with anti-gp70 Abs. Although gp70 is detectable in the serum of nearly all murine strains, only lupus-prone strains produce autoantibodies to gp70 and form gp70 IC (27).
For certain comparisons, mice were separated into groups based on their serum levels of a particular autoantibody. The cut-offs used to group mice in the current study were originally determined in (NZB x NZW)F1 x NZW backcross mice by dividing the frequency distribution of autoantibody levels on the basis of tertiles. This separation into autoantibody phenotypes identified one-third of mice with low/negative levels and one-third of mice with high levels for each autoantibody measured. Backcross mice with intermediate levels were defined as the middle third. The cut-offs for anti-chromatin, anti-dsDNA, and gp70 IC autoantibodies correlated well with low levels of production in NZW and nonautoimmune strains and high levels of production in (NZB x NZW)F1 mice (3).
Statistical analysis
The linkage of a particular locus with nephritis (categorized as
positive or negative) was quantified by 
2 analysis,
using a standard (2 x 2) contingency matrix (28). Evidence that
H2 or Nba2 was linked with autoantibody levels as
quantitative trait loci (QTL) was determined using the linkage program,
MAPMAKER/QTL (29, 30). The autoantibody levels were log10
transformed before analysis with MAPMAKER/QTL, because this tended to
normalize their frequency distribution and improve the accuracy of
MAPMAKER/QTL (30). It is emphasized that these analyses were directed
at MHC genes or at Nba2 and were not part of a genome-wide
screening for linked loci. The statistical threshold used for
significant linkage was p < 0.01, based on
recommendations that this cut-off be used to confirm linkage in a new
dataset (31).
In separate analyses, the frequency of nephritis was compared in B6.H2z backcross mice vs transgenic B6.Ez and B6.Ezlo backcross mice by Fisher’s exact test. The mean values for particular autoantibodies in different backcrosses were compared using Dunn’s nonparametric procedure of the Kruskal-Wallis test (two-tailed).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We hypothesized that class II MHC genes account for the genetic
contribution of H2z to the development of lupus-like
disease in (NZB x NZW)F1 mice. To study the effect of
I-Ez on disease expression, cosmid clones encoding the
Eaz and Ebz genes were isolated
from an NZW genomic library. Restriction maps of both clones are shown
in Figure 1
. B6 eggs were coinjected with both clones, and transgenic
mice with both Eaz and Ebz genes
were selected for further breeding and study. Two B6 lines were
subsequently generated and named B6.Ez and
B6.Ezlo based on relative copy number, relative levels of
Eaz and Ebz mRNA, and relative
levels of B cell surface expression of I-Ez. Because of
previous studies showing that excessive I-E expression can decrease the
frequency and the severity of lupus-like autoimmune disease (32, 33),
we focused on these two lines in which B cell expression was near
normal and lower than normal compared with that in
B6.H2z mice.
Figure 2 shows a comparison of
I-Ez expression on B cells in the different strains
analyzed. As shown in Figure 2, congenic B6.H2z mice
expressed both I-Aßz and I-E on B cells, as determined by
staining with mAbs 10–2.16 and 14-4-4s, respectively. In contrast, B
cells from B6 mice (H2b) were not stained by
either of these anti-class II Abs, since their I-Aßb
molecule was not detected by the 10-2.16 mAb and because they have no
I-E expression due to a defect in the Eab gene (34).
B cell surface expression of I-E in B6.Ez mice was nearly
equivalent to that in homozygous B6.H2z congenic mice,
whereas expression in B6.Ezlo mice was decreased but
clearly detectable. As expected, neither of the transgenic lines
expressed I-Az.
|
-chain and
does not distinguish surface molecules with I-Eßz from
I-Eßb (23). We were therefore concerned that I-E
expression in the transgenic lines may be secondary to pairing of the
I-Ez (encoded by the transgene) with I-Eßb
expressed in the B6 mice and that the Ebz transgene
might not be functionally expressed. To study this possibility, we
outcrossed the B6.Ez and B6.Ezlo strains to SWR
(H2q) mice, which express neither
Ea nor Eb gene products (35, 36).
(B6.Ez x SWR)F1 mice were then backcrossed to
SWR mice, and progeny were selected for the absence of expression of
I-Ab and also for the presence of the transgenes. These
mice must therefore be homozygous for H2q and not
have H2-encoded Ea or Eb genes.
Staining with mAb 14-4-4s (i.e., expression of I-E) in these backcross
mice was comparable to that shown in Figure 2 for the B6.Ez
and B6.Ezlo parental lines (data not shown), indicating
that both I-Ez and I-Eßz proteins are
functionally expressed in the transgenic strains. Analysis of backcross mice for the influence of I-Ez on disease expression
A backcross design was used to analyze the effect of transgenic I-E expression on the development of disease. Previous studies have shown that (B6.H2z x NZB)F1 mice do not develop severe renal disease (10). After backcrossing these F1 mice to NZB, a subset of (B6.H2z x NZB)F1 x NZB backcross mice demonstrated high levels of proteinuria and died from renal failure within 12 mo of age. This development of severe renal disease was strongly influenced by inheritance of the congenic interval encoding H2z (10). In the present studies, we used similar backcross combinations to analyze the effect of I-Ez expression on disease expression.
As shown in Figure 3, 88
(B6.H2z x NZB)F1 x NZB backcross mice were
followed for the development of severe proteinuria. Of the 43 backcross
mice that inherited H2z, 33% developed proteinuria
compared with 11% of the 45 H2z-negative backcross
mice (p < 0.001). We followed 77
(B6.Ez x NZB)F1 x NZB and 82
(B6.Ezlo x NZB)F1 x NZB backcross mice
concomitantly. In contrast to the H2z-positive
backcross mice, none of the 27 B6.Ez transgene-positive and
none of the 39 Ezlo transgene-positive backcross mice
developed proteinuria (p < 5 x
10-4, comparing the B6.H2z backcross to each
B6.Ez backcross separately by Fisher’s exact test;
p < 2 x 10-8, compared to both
B6.Ez backcrosses combined). Thus, unlike
H2z, Eaz and/or
Ebz were not associated with the development of
renal disease in the backcross mice. In the backcrosses of transgenic
B6 mice, disease expression in the transgene-negative groups was also
low and similar to that in H2z-negative progeny in
the B6.H2z backcross (Fig. 3). Also shown for comparison in
Figure 3 is the development of severe proteinuria in (NZB x
NZW)F1 x NZB backcross mice in relation to inheritance of
the NZW MHC (H2z; data taken from historical
controls (6)). Disease expression was much more marked in the
H2z-positive (NZB x NZW)F1 x NZB
than in the H2z-positive (B6.H2z x
NZB)F1 x NZB backcross mice. Since the only difference in
these crosses was the non-MHC NZW vs B6 background, these comparisons
show that the NZW background contains additional disease susceptibility
genes (or lacks disease-suppressive genes) compared with the B6
background.
|
We studied autoantibody production in the different backcrosses to
better understand why the B6.Ez backcrosses failed to
develop severe lupus nephritis. Figure 4
compares the serum levels of gp70 IC and IgG autoantibodies to those of
chromatin and dsDNA, which have been implicated in the pathogenesis of
nephritis in this murine model of lupus. The results show that a subset
of B6.Ez backcross mice did produce Abs to each of these
self Ags (Fig. 4 and Table I). For
example, using a cut-off (>4.6 U/ml) that defined high levels of
anti-chromatin Ab production in a previous analysis of (NZB x
NZW)F1 x NZW backcross mice (3), 12 (16%) of 75
B6.Ez backcross mice were positive at 7 mo of age.
Thirty-three percent of the B6.Ez backcross mice produced
at least intermediate levels of IgG anti-chromatin Abs, as
previously defined (3). As shown in Figure 4, mean levels of IgG
autoantibodies in the B6.Ez backcross mice were comparable
to levels in nonnephritic B6.H2z backcross mice, somewhat
lower than those in nephritic B6.H2z mice
(p < 0.01 for gp70 IC), and more significantly
lower than those in (NZB x NZW)F1 mice
(p < 0.03 for anti-chromatin,
p < 0.003 for anti-dsDNA, and p <
0.0001 for gp70 IC). When mice were grouped on the basis of elevated
levels of autoantibodies, B6.Ez backcross mice showed
comparable and lower percentages of positive mice compared with
nonnephritic and nephritic B6.H2z backcross mice,
respectively (Table I).
|
|
). At 7
mo of age, there were no significant differences in IgG1
anti-chromatin levels between the B6.Ez backcross and
the other groups of mice. There were also no significant differences in
IgG2a anti-chromatin levels when mean levels in B6.Ez
backcross mice were compared with those in either nephritic or
nonnephritic B6.H2z backcross groups (the difference
compared with (NZB x NZW)F1 mice was significant at
p < 0.002). In contrast, significantly lower
(p < 0.001) levels of IgG3 anti-chromatin
autoantibodies were apparent in the B6.Ez backcross mice
compared with the nephritic groups.
|
We used a QTL analysis to determine whether inheritance of the
Eaz and/or Ebz transgenes was
linked with the production of IgG autoantibodies (Table II). The results revealed no significant
linkage or trends toward linkage of the Ez
transgenes with any of the autoantibody traits analyzed. The QTL
analysis also indicated that there was no significant suppression of
autoantibody production. When transgene-positive mice were compared
with transgene-negative mice, no differences in mean (±SE) levels of
IgG anti-chromatin (2.57 ± 0.80 vs 1.92 ± 0.54 U/ml),
IgG anti-dsDNA (0.34 ± 0.13 vs 0.26 ± 0.12 U/ml), and
gp70 IC (1.13 ± 0.28 vs 1.85 ± 0.42 µg/ml) were apparent.
Furthermore, a similar percentage of mice in each group was positive
for autoantibody production. The lack of effect of
Ez on autoantibody production was not influenced by
inheritance of H2b/d vs H2d/d in
the backcross mice (data not shown). Therefore, competition from
I-Eßb chains for pairing of I-Eßz to
I-Ez chains was not responsible for the negative
findings.
|
shows that in contrast to
Ez genes, H2b showed surprising
linkage with nearly all the autoantibodies measured
(p < 1 x 10-5 for
anti-chromatin, p < 0.01 for anti-dsDNA, and
p < 0.01 for gp70 IC at 7 mo of age). The enhancing
influence of H2b on IgG anti-chromatin
production appeared to be selective for the IgG2a and IgG3 subclasses,
as no trend for linkage was apparent for IgG1 anti-chromatin Abs
(Table II).
In a previous linkage analysis of (B6.H2z x
NZB)F1 x NZB backcross mice, we found that one NZB locus
on distal chromosome 1 (previously named Nba2 for New
Zealand black autoimmunity 2) in combination with MHC
accounted for >90% of the genetic contribution to disease and IgG
autoantibody production (10, 11). We therefore analyzed linkage of
Nba2 with IgG autoantibody production in the current
(B6.Ez x NZB)F1 x NZB backcross (Table II).
This directed linkage analysis showed significant linkage for
Nba2 with serum levels of IgG anti-dsDNA at 7 mo of age
and with serum levels of IgG anti-chromatin, IgG anti-dsDNA,
and gp70 IC at 9 mo of age. When subclasses were analyzed, only IgG1
anti-chromatin Abs showed significant linkage at p
< 0.01.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The transgene-positive backcross mice analyzed in these studies
appeared to express I-Ez in a manner similar to that of the
H2z-bearing backcross mice studied as positive
controls. Thus, both Eaz and Ebz
genes were expressed, as determined by outcrossing transgenic mice to
the I-E- and I-Eß-negative SWR strain. Furthermore, the
B6.Ez transgenic mice and their backcross progeny expressed
quantitatively similar B cell surface levels of I-E compared with
B6.H2z mice and their backcross progeny. The
B6.Ezlo backcross, which also showed no linkage of disease
with inheritance of the transgene, was studied to avoid the potentially
suppressive influence of I-E overexpression on autoimmunity (32, 33, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51). It is emphasized that the transgenic strains were derived by
injection of genomic Ez clones with wild-type
promoter and enhancer elements. The pattern of expression in different
cell types and after various types of induction should therefore be
similar to that in wild-type H2z mice as previously
shown for other Ea transgenes (16); however, we formally
documented normal expression only on splenic B cells. The lack of
effect of Ez genes also indicates that mixed
haplotype I-Ed/I-Eßz molecules do not
explain the effect of H2z on disease in (NZB x
NZW)F1 mice as previously suggested (14).
I-Eßz molecules in the transgenic backcross mice, which
all express I-Ed molecules, should have been equally
likely to pair with I-Ed as in wild-type
H2z backcross mice. In addition, the lack of effect
of the transgene on lupus-like disease was not influenced by the
inheritance of H2b/d vs H2d/d and
therefore was not related to competition from I-Eßb for
pairing with I-E -chains.
Other studies have suggested that increased I-E expression can suppress
different types of autoimmune processes (42, 43, 44, 45, 46, 47, 48), including
autoantibody production and nephritis in the New Zealand hybrid (49),
BXSB (32, 33), and lpr murine models of lupus (50, 51).
Results from studies of murine lupus suggest that the effect is not
specific for one autoantibody but, instead, appears to involve
down-regulation of autoantibody production in general. Competition by
I-E-derived peptides resulting in decreased self-peptide
presentation on I-A molecules has been suggested as a possible
mechanism (32, 33). In our current studies, the development of lupus
nephritis appeared to be decreased by inheritance of the transgenes.
However, the difference between transgene-positive and
transgene-negative mice was not statistically significant, and there
was no trend for increased or decreased autoantibody production caused
by the presence of the transgene. Compared with previous studies, the
lack of any negative effect of the transgene may be related to the
normal expression levels achieved in the current crosses (32, 33).
Furthermore, since backcrossing was always performed with NZB mice,
which are H2d (I-Ed expressing), the
additional expression of I-Ez in transgene-positive mice
may have had little consequence. Most previous studies had investigated
the effects of I-E expression in an I-E-negative strain.
Studies have indicated that heterozygosity for H2z
and H2d is important for the full expression of
autoimmunity in the New Zealand hybrid model (3, 6, 7, 8, 9, 10, 11, 52, 53). Thus,
New Zealand hybrid or backcross mice that are H2d/z
have increased IgG autoantibody production and increased incidence of
nephritis compared with genetically similar mice homozygous for either
H2d or H2z haplotypes. More
recent studies have suggested that heterozygosity for H2
haplotypes other than H2d or H2z
may also enhance disease (18, 54, 55). For example, in an analysis of
(NZM x B6)F1 x NZM backcross mice (NZM is an
H2z-positive recombinant inbred of NZB and NZW
mice), inheritance of H2b from the B6 strain was
strongly linked with the production of autoantibodies and the
development of nephritis (54). Our analysis of autoantibody production
in the B6.Ez backcross shows that H2b/d
compared with H2d/d mice also have increased
production of IgG autoantibodies. The linkage of H2b
with IgG autoantibody production was apparent in the same mice that
showed no influence from the inheritance of the Ez
transgenes. The reason why a double dose of H2d or
H2z genes is associated with less disease compared
with that in H2 heterozygous states is unknown. Some
investigators have postulated that mixed haplotype class II molecules,
such as I-Ad/I-Aßz, or mixed isotype class
II molecules, such as I-Ed/I-Aßz, may
increase self recognition (14, 38, 55). However, it seems unlikely that
the disease-enhancing effect of multiple different haplotype
combinations are all explained by mixed class II molecules.
Although our results showed that H2b is similar to H2z in that both are linked with IgG autoantibody production, the two haplotypes were not comparable in the magnitude of their effect on autoantibody production or development of nephritis in these particular crosses. It is also possible that H2z encodes more than one lupus susceptibility gene, and that different genes underlie the contributions from different haplotypes. Levels of IgG3 autoantibody production in particular were increased in the B6.H2z compared with the B6.Ez backcross mice. Furthermore, since nephritis was only observed in the cross that involved H2z, the results imply that IgG3 autoantibodies may have greater pathogenic importance than the other subclasses. Studies analyzing pathogenic Abs in other murine models of lupus support the hypothesis that IgG3 autoantibodies may be particularly nephritogenic (56, 57, 58, 59, 60).
The linkage of H2b with IgG autoantibody production
in the current backcross analysis raises questions similar to those
that prompted the current studies. For example, is this effect mediated
by class II genes or by other genes encoded with the MHC? Although the
answer is unknown at this time, the autoantibody results provide
interesting insight. Thus, the effect of H2b did not
appear to be specific for one type of autoantibody. Increased serum
levels of IgG autoantibodies to chromatin and gp70 were both linked
with H2b. Furthermore, linkage was selective for the
IgG2a and IgG3 subclasses of IgG anti-chromatin autoantibodies.
Although class II MHC polymorphisms can alter Th subsets and therefore
IgG subclass production, polymorphisms within class III genes encoded
within the MHC may be more likely to account for the lack of Ag
specificity and subclass effects. In this regard, the Tnfa
gene has been previously proposed as a gene that may underlie the
H2z contribution to lupus in (NZB x
NZW)F1 mice (61). It is of interest that a restriction
fragment length polymorphism in the Tnfa gene, which was
shown to correlate with decreased TNF- production, is present in
H2b and H2z, but not in the
H2d haplotype (15, 62, 63, 64). Although cytokine genes
may be involved in the H2 contribution to disease,
especially because of the heterozygous effects of each haplotype, other
contributing genes seem likely.
In the analysis of B6.Ez backcross mice, a locus on distal
chromosome 1, named Nba2, was also shown to be linked with
the production of anti-chromatin and anti-DNA Abs, and a trend
was observed for linkage with anti-gp70 autoantibodies. It is
important to emphasize that the stringent statistical thresholds
proposed for a genome-wide screening (31) do not apply to the directed
linkage analysis of one non-MHC locus in the current study. In previous
genome-wide screenings of (B6.H2z x NZB)F1 x
NZB and (SM/J x NZB)F1 x NZW backcrosses,
Nba2 was shown to be strongly linked with the development of
nephritis and increased serum levels of IgG autoantibodies (10, 11, 18). A locus in a similar chromosomal location has been mapped in other
studies analyzing NZB and/or NZW genes (18, 53, 54). In the
B6.H2z backcross, Nba2 in conjunction with
H2z provided >90% of the genetic contribution to
nephritis and autoantibody production (10, 11). Nba2 is
situated between 92 and 97 cM from the centromere, and this region
encodes several candidate genes, including the low affinity Fc
receptor genes. Because Nba2 was linked with the coordinate
production of multiple autoantibodies and total IgG and IgG subclasses
levels (11), it was hypothesized that it functions as an immune
response gene. Similar traits were linked with Nba2 in the
current study, although the level of autoantibody production was less
pronounced, and the extent of linkage appeared to be less strong in the
current study. The effects of Nba2 also appear to be subject
to the influence of the MHC haplotype (10, 11), and the difference
between H2b and H2z in the
B6.Ez and B6.H2z crosses, respectively, may
have altered the influence of the Nba2 effect.
In summary, the current studies appear to exclude Eaz and/or Ebz genes in the contribution of H2z to nephritis and IgG autoantibody production in New Zealand hybrid mice. It remains possible, however, that a contribution of I-Ez to nephritis is dependent on other molecules encoded within H2z, but not H2b or H2d. Our results also show that H2b is similar to H2z, but has quantitatively less influence on disease expression in this model. Transgenic mice with Az genes have been generated, and studies are in progress to address the contribution of these class II genes to disease and autoantibody production. However, the current results suggest that other MHC genes, such as genes influencing the pattern of cytokine production, may be more important in the contribution to lupus-like disease in this model.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Brian L. Kotzin, Division of Basic Sciences, National Jewish Medical and Research Center, 1400 Jackson St., Denver, CO 80206. E-mail address:
3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; NZB, New Zealand Black; NZW, New Zealand White; SSLP, simple sequence length polymorphisms; gp70 IC, gp70-anti-gp70 immune complexes; QTL, quantitative trait locus.
Received for publication September 5, 1997. Accepted for publication November 25, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
chain. J. Exp. Med. 178:1189. chain transgene: protective role of I-E chain-derived peptides with a high affinity to I-Ab molecules. Eur. J. Immunol. 26:307.[Medline]
and Ae (Eß) Ia polypeptide chains in mice of different H-2 haplotypes. Immunogenetics 12:321.[Medline]
u and Eß u chain association: where lies the anomoly?. J. Immunol. 137:948.[Abstract]
-chain. Nature 345:727.[Medline]
transgene in B10 mice suppresses the development of myasthenia gravis. Immunogenetics 31:241.[Medline]
d class II molecule in (NZB x NZW)F1 mice detected by T cell clones. J. Immunol. 150:4777.[Abstract]
: relevance to genetic predisposition to systemic lupus erythematosus. Proc. Natl. Acad. Sci. USA 87:1233. in murine autoimmune ‘lupus’ nephritis. Nature 331:356.[Medline]
This article has been cited by other articles:
|
|
 |
|
  Y.-H. Cheung, N.-H. Chang, Y.-C. Cai, G. Bonventi, R. MacLeod, and J. E. Wither Functional Interplay between Intrinsic B and T Cell Defects Leads to Amplification of Autoimmune Disease in New Zealand Black Chromosome 1 Congenic Mice J. Immunol., December 15, 2005; 175(12): 8154 - 8164. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Gubbels, T. N. Jorgensen, T. E. Metzger, K. Menze, H. Steele, S. A. Flannery, S. J. Rozzo, and B. L. Kotzin Effects of MHC and Gender on Lupus-Like Autoimmunity in Nba2 Congenic Mice J. Immunol., November 1, 2005; 175(9): 6190 - 6196. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Subramanian, Y.-S. Yim, K. Liu, K. Tus, X. J. Zhou, and E. K. Wakeland Epistatic Suppression of Systemic Lupus Erythematosus: Fine Mapping of Sles1 to Less Than 1 Mb J. Immunol., July 15, 2005; 175(2): 1062 - 1072. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Wither, G. Lajoie, S. Heinrichs, Y.-C. Cai, N. Chang, A. Ciofani, Y.-H. Cheung, and R. MacLeod Functional Dissection of Lupus Susceptibility Loci on the New Zealand Black Mouse Chromosome 1: Evidence for Independent Genetic Loci Affecting T and B Cell Activation J. Immunol., August 15, 2003; 171(4): 1697 - 1706. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. SM. Rahman, S.-K. Tin, P.-N. L. Buenaventura, C.-H. Ho, E. P. H. Yap, R. Y. Y. Yong, and D.-R. Koh A Novel Susceptibility Locus On Chromosome 2 in the (New Zealand Black x New Zealand White)F1 Hybrid Mouse Model of Systemic Lupus Erythematosus J. Immunol., March 15, 2002; 168(6): 3042 - 3049. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Xie, S. Chang, P. Yang, C. Jacob, A. Kaliyaperumal, S. K. Datta, and C. Mohan Genetic Contributions of Nonautoimmune SWR Mice Toward Lupus Nephritis J. Immunol., December 15, 2001; 167(12): 7141 - 7149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Paisansinsup, A. N. Vallejo, H. Luthra, and C. S. David HLA-DR Modulates Autoantibody Repertoire, But Not Mortality, in a Humanized Mouse Model of Systemic Lupus Erythematosus J. Immunol., October 1, 2001; 167(7): 4083 - 4090. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Tucker, T. J. Vyse, S. Rozzo, C. L. Roark, S. Izui, and B. L. Kotzin Genetic Control of Glycoprotein 70 Autoantigen Production and Its Influence on Immune Complex Levels and Nephritis in Murine Lupus J. Immunol., August 1, 2000; 165(3): 1665 - 1672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Rozzo, T. J. Vyse, K. Menze, S. Izui, and B. L. Kotzin Enhanced Susceptibility to Lupus Contributed from the Nonautoimmune C57BL/10, But Not C57BL/6, Genome J. Immunol., May 15, 2000; 164(10): 5515 - 5521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Ibnou-Zekri, M. Iwamoto, M. E. Gershwin, and S. Izui Protection of Murine Lupus by the Ead Transgene Is MHC Haplotype-Dependent J. Immunol., January 1, 2000; 164(1): 505 - 511. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. J. Vyse, R. K. Halterman, S. J. Rozzo, S. Izui, and B. L. Kotzin Control of separate pathogenic autoantibody responses marks MHC gene contributions to murine lupus PNAS, July 6, 1999; 96(14): 8098 - 8103. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Rozzo, T. J. Vyse, C. S. David, E. Palmer, S. Izui, and B. L. Kotzin Analysis of MHC Class II Genes in the Susceptibility to Lupus in New Zealand Mice J. Immunol., March 1, 1999; 162(5): 2623 - 2630. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
