The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vyse, T. J.
Right arrow Articles by Kotzin, B. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vyse, T. J.
Right arrow Articles by Kotzin, B. L.
The Journal of Immunology, 1998, 160: 2757-2766.
Copyright © 1998 by The American Association of Immunologists

Contributions of Eaz and Ebz MHC Genes to Lupus Susceptibility in New Zealand Mice1

Timothy J. Vyse*, Stephen J. Rozzo*, Charles G. Drake*, Virginia B. Appel*, Marianne Lemeur{dagger}, Shozo Izui{ddagger}, Ed Palmer§ and Brian L. Kotzin2,*

* Departments of Pediatrics and Medicine, National Jewish Medical and Research Center, Denver, CO 80206; {dagger} Institut de Génétique et de Biologie Moléculaire et Cellulaire, Institut National de la Santé et de la Recherche Médicale, Centre National de la Recherche Scientifique, Université Louis Pasteur, C.U. de Strasbourg, Strasbourg, France; {ddagger} Department of Pathology, Centre Médical Universitaire, Geneva, Switzerland; § Basel Institute for Immunology, Basel, Switzerland; and Departments of Medicine and Immunology, University of Colorado Health Sciences Center, Denver, CO 80262


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Unlike parental New Zealand Black (NZB) or New Zealand White (NZW) mice, (NZB x NZW)F1 mice exhibit a lupus-like disease characterized by IgG autoantibody production and severe immune complex-mediated nephritis. In studies of the genetic susceptibility to disease in this F1 model, the NZW MHC (H2z) has been strongly linked with the development of disease, and it was hypothesized that class II MHC genes, particularly Ez genes, may underlie this genetic contribution. In the present study, we bred transgenic B6 mice expressing I-Ez or congenic B6 mice carrying H2z with NZB mice and used a backcross analysis to test the hypothesis that Eaz and/or Ebz genes account for the effect of H2z on disease. The genetic analysis of different backcross combinations showed that unlike mice carrying H2z, mice inheriting Ez transgenes do not demonstrate increased IgG autoantibody production or increased incidence of nephritis. Surprisingly, in the same transgenic backcross mice, inheritance of the endogenous H2b from the B6 strain was strongly linked with the production of IgG autoantibodies, but not with disease. Additional experiments suggested that the level of IgG3 autoantibody production, which is controlled by H2, may be important in the pathogenesis of renal disease. Contributions to autoantibody production were also detected from an NZB locus on distal chromosome 1 (previously named Nba2). Together, these studies provide new insight into the role of MHC in lupus-like autoimmunity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
New Zealand hybrid mice are among the best-studied models of human systemic lupus erythematosus (SLE).3 The female F1 progeny of New Zealand Black (NZB) and New Zealand White (NZW) mice spontaneously develop a severe immune complex glomerulonephritis and usually die from renal failure before 1 yr of age (1). The production of particular IgG antinuclear Abs, such as autoantibodies to dsDNA and to chromatin, and the production of IgG autoantibodies to the endogenous retroviral glycoprotein gp70 are believed to be most important in the pathogenesis of this lupus nephritis (1, 2, 3). Genes from both the NZB and NZW strains are important for disease (reviewed in 4 . In studies of the genetic contributions to disease in the F1 model, genes encoded within or closely linked to the MHC have been shown to be pivotal for the development of pathogenic autoantibody production and the development of severe lupus nephritis (5, 6, 7, 8). For example, in an analysis of (NZB x NZW)F1 x NZB backcross mice, the most important contribution from the NZW strain was closely linked to the MHC (H2z in NZW) (6, 9). Furthermore, in a recent analysis of (B6.H2z x NZB)F1 x NZB backcross mice, inheritance of H2z derived from the congenic B6.H2z strain was strongly linked to the development of severe nephritis and the production of pathogenic IgG autoantibodies (10, 11). Studies of NZB and NZW strains congenic for H2z and H2d, respectively, and their F1 hybrids have additionally supported the importance of heterozygous H2z expression in the development of severe lupus-like disease (7, 8).

The genes encoded within H2z that contribute to lupus in New Zealand hybrid mice are not known. Since the production of pathogenic IgG autoantibodies and the development of lupus nephritis in this model are CD4+ T cell dependent (12), it was hypothesized that class II MHC genes, either Az or Ez, are likely candidates. This hypothesis is further supported by studies of NZB mice congenic for either H2b or H2bm12 (13). Although the difference in the MHCs of these strains is limited to three amino acids in the I-Aß molecules, studies showed that NZB.H2bm12 mice developed severe disease similar to (NZB x NZW)F1 mice, whereas NZB.H2b mice were similar to NZB (H2d) and did not develop severe lupus nephritis. Based on particular sequence homologies between I-Aßbm12 and I-Eß, these (13) and other investigators (14) postulated that expression of I-Ez or of mixed class II molecules such as I-E{alpha}d/I-Eßz was most likely to determine the contribution of H2z genes to lupus in the (NZB x NZW)F1 model.

In the present study, we used transgenic mice expressing I-Ez to test the hypothesis that H2-Eaz (Eaz) and/or H2-Eb1z (Ebz) genes account for the H2z genetic contribution to lupus in the New Zealand hybrid model. Our analysis of backcross mice showed that unlike mice carrying H2z, mice inheriting the Eaz and Ebz transgenes do not demonstrate increased IgG autoantibody production or increased incidence of nephritis. In contrast, in the same transgenic backcross mice, inheritance of the endogenous H2b from the B6 strain and inheritance of a NZB locus on distal chromosome 1 (previously named Nba2) were strongly linked with the production of IgG autoantibodies.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

Parental NZB/BINJ and C57BL/6J (designated B6) mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and were maintained in the animal care facility at the National Jewish Medical and Research Center (Denver, CO). All congenic, transgenic, F1, and backcross mice were bred and maintained at the National Jewish Medical and Research Center. Only female mice were studied for expression of disease.

B6 mice were made congenic for H2z by mating these mice with NZW mice and backcrossing the progeny to B6. Inheritance of H2z was monitored by immunofluorescence analysis of I-Az expression and by screening for a simple sequence length polymorphism in the TNF-{alpha} gene (Tnfa) (15). The congenic strain (designated B6.H2z) was made homozygous for H2z after 12 generations. Congenic mice were analyzed for the length of the NZW chromosome 17 interval bred onto the recipient B6 strain. In relation to the MHC, analysis of markers approximately 1 cM proximal to MHC on chromosome 17 (D17Mit16; ~18.2 cM from the centromere), within the MHC (Tnfa (15) or H2zAlu repeat; ~19 cM from the centromere), and about 4 cM distal to MHC (D17Mit49 or D17Mit50; ~23.2 cM from the centromere) showed alleles inherited from NZW in the congenic animals.

In preparation for the generation of transgenic mice, genomic fragments encoding the Eaz- and Ebz-coding regions were isolated from an NZW splenic DNA cosmid library (see below). Transgenic mice were generated in the laboratories of Diane Mathis and Christophe Benoist (Strasbourg, France) using methods previously described (16). B6 eggs were coinjected with Eaz and Ebz genomic DNA and reimplanted into foster mothers, and tails from the resulting offspring were analyzed by Southern blotting for integration of the injected DNA. Three founders were initially identified, of which one was found to have both Eaz and Ebz genes. This line was perpetuated by repeated backcrossing with B6 mice. Inheritance of the transgenes was determined by PCR analysis of genomic DNA. Primer sequences (5'-3') to detect the Ebz transgene were CTACAACCGGGAGGAGTGGG (forward) and TCCACCGCGGCCCGCCTTTG (reverse), and primer sequences to detect the Eaz transgene were AAGTGAAACTCAGATACTAA (forward) and CCAGGGCTCCAATTGTGGCC (reverse). Occasional offspring were also analyzed by immunofluorescence staining for expression of I-E on peripheral blood cells (see below). In the process of backcrossing, two sites of integration were identified, and these were separated during breeding to generate two transgenic lines, each with Eaz and Ebz genes. One of the lines was designated B6.Ez, and the other had lower copy numbers and relatively lower levels of I-E expression and was designated B6.Ezlo. Integration sites for each of these lines were not linked to MHC or to loci on distal chromosome 1 and were not studied further. Integration of the Ez genes had no noticeable effect on the health of the B6 recipients, and there was no evidence of autoimmune disease or autoantibody production in the transgenic strains.

Evaluation of renal disease and collection of tissue

Mice were studied from 4 to 12 mo of age and were evaluated for proteinuria at bimonthly intervals using tetrachlorophenol-tetrabromosulfophthalein paper (Chemstrip, Boehringer Mannheim, Indianapolis, IN) as previously described (17). A scoring system of 0 to 3+ was used, as follows: 0/trace, <30 mg/dl; 1+, ~30 mg/dl; 2+, ~100 mg/dl; and 3+, >300 mg/dl. A score of 2+ or greater was considered indicative of severe proteinuria, and mice exhibiting severe proteinuria on two or more successive occasions or at the final evaluation before death were considered positive for renal disease. A negative phenotype was ascribed to mice that did not exhibit proteinuria during the 12 mo of follow-up, and these mice appeared healthy at the time of death. A correlation between severe proteinuria and death from renal failure was demonstrated previously (6), and a strong correlation with histologic severity of glomerulonephritis has been more recently confirmed (T. J. Vyse and B. L. Kotzin, unpublished observations), supporting the validity of using high levels of proteinuria as an indicator of severe and progressive glomerulonephritis. Similar to past studies (3, 6, 17, 18), the development of proteinuria also predicted early mortality in the current study. For example, of the 14 (B6.H2z x NZB)F1 x NZB backcross mice that developed proteinuria by 10 mo of age, 13 (93%) died by 12 mo of age. In contrast, none of the 69 mice in this cohort without proteinuria died during the 1-yr observation period.

The tip of the tail from all backcross mice was excised at 4 mo of age. The liver and kidneys were collected at the time of death or elective sacrifice at 12 mo of age. All tissues were stored at -70°C, and DNA was extracted as previously described (19). The study mice were also bled (from the tail) at monthly intervals from the age of 5 mo. The blood was allowed to clot at room temperature, and the serum was stored at -20°C until analyzed for autoantibody levels.

Generation of NZW splenic DNA cosmid library

DNA extracted from NZW spleen cells was used to generate a cosmid library as previously described (20). Splenic DNA was partially digested with MboI to generate 35- to 45-kb fragments, ligated into BamHI-digested pCV 107 cosmid vector, packaged (Gigapack Gold, Stratagene, La Jolla, CA), and grown in Escherichia coli. The library was plated at about 10,000 colonies/filter, and 4.1 x 105 total colonies were screened. Probes were generated from mRNA expressed by LPS-stimulated B cell blasts from NZW mice, PCR amplification of segments of the Eaz and Ebz genes, and cloning of PCR fragments into pEMBL. Before generation of the transgenic mice, the selected cosmid clones (see Fig. 1Go) were shown to mediate expression of I-E after transfection into A20 cells.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 1. Restriction maps of the H2-Ea (Ea) and H2-Eb1 (Eb) genes isolated from a NZW genomic library. The sizes of the genomic fragments are shown in kilobases. Sequence analysis of the coding regions showed identity withEau and Ebu genes as previously published by others (36–40). Enzyme abbreviations: Ba,BamHI; Bg, BglI; E, EcoRI; Hp,HpaI; K, KpnI; N, Nci; P,PvuII.

 
Analysis of B cell surface I-A and I-E expression

Spleen cells from the different parental strains and backcross mice were prepared and stained as previously described (21). Fluoresceinated mAbs used included 10-2-16 (anti-I-Az (22); hybridoma cells obtained from American Type Culture Collection, Rockville, MD), D3 (anti-I-Ab; provided by Dr. John Cambier, Denver, CO), and 14-4-4s (anti-I-E{alpha} (23); hybridoma cells obtained from American Type Culture Collection). B cells were also double stained using a biotinylated mAb to B220 (RA3-6B2; PharMingen, San Diego, CA) followed by avidin-phycoerythrin (PharMingen). Fluorescence intensity was analyzed on an EPICS C flow cytometer (Coulter Electronics, Inc., Hialeah, FL). Viable mononuclear cells were gated by scatter analysis, and 1 x 104 cells were collected for each Ab combination.

Genomic mapping using simple sequence length polymorphisms (SSLP)

SSLP mapping was used to analyze the linkage of NZB loci on distal chromosome 1 and the MHC with the development of nephritis and IgG autoantibody production. Oligonucleotide primers for D1Mit111 mapped 92 centiMorgans (cM) from the centromere on chromosome 1 (designated 1; 92) and D1Mit221 (1; 102 cM) were purchased from Research Genetics (Huntsville, AL), and primers for Crp (1; 94 cM) and Tnfa (17; ~19 cM) were synthesized by the Molecular Resource Center at the National Jewish Medical and Research Center using an Applied Biosystems model 392 DNA synthesizer (Foster City, CA). Primer nucleotide sequences (internet: http://www-genome.wi.mit.edu/), and the methods for SSLP screening and mapping have been previously described (3). The positions of SSLP markers (and genetic loci) are given in accordance with the Mouse Chromosome Committee Reports obtained through the Encyclopedia of the Mouse Genome, Mouse Genome Database, The Jackson Library (Bar Harbor, ME; URL: http://www.informatics.jax.org).

Amplification of simple sequence repeats was achieved using PCR in a PTC-100 thermal cycler (MJ Research, Watertown, MA). Twenty-microliter reactions were conducted using 35 cycles consisting of 30 s at 94°C, 1 min at 55°C, and 30 s at 72°C. Ten to fifteen microliters of PCR product was loaded onto a 15% polyacrylamide gel and electrophoresed at 12 V/cm for 2 to 4 h. Gels were then visualized by ethidium bromide staining after transillumination. Polymorphisms were scored in comparison to results from parental PCR products.

Serologic assays

Abs to nuclear Ags were determined by ELISA as previously described (3, 11, 24). Briefly, wells of Immulon II microtiter plates (Dynatech Laboratories, Chantilly, VA) were coated with calf thymus chromatin at 2.5 µg/ml in PBS, pH 7.2, and postcoated with 1 mg/ml gelatin. Serum samples were diluted 1/300 in PBS with 0.5% Tween supplemented with 5 mg/ml bovine {gamma}-globulins (Sigma Chemical Co.) and gelatin, and added to Ag-coated wells for 90 min. After washing, wells were incubated with peroxidase-conjugated Ab for mouse IgG (Kirkegaard and Perry, Gaithersburg, MD). After 90 min and washing, substrate was added, and OD was determined with an automated spectrophotometer (Dynatech Laboratories) at 405 nm. The dsDNA (plasmid pGEM dsDNA) was biotinylated and bound to streptavidin-coated microtiter plates (24). The assay was then performed as described above. All samples were also assayed in wells coated with streptavidin as a control. Previous studies have shown that this assay demonstrates minimal cross-reactivity for Ab activity in sera containing only anti-ssDNA Abs or for ssDNA-specific mAb (11). All assays were performed in duplicate and were quantified against a standard curve obtained with mAbs to the appropriate nuclear Ag as previously described (3).

IgG subclass anti-chromatin autoantibody levels were assayed using the same anti-chromatin ELISA, but IgG subclass-specific second-step Abs were used as detecting reagents as previously described (11). Standard curves were obtained using the same (NZB x NZW)F1 control sera in each assay (11).

The production of autoantibodies to gp70 was quantitated as serum levels of gp70-anti-gp70 immune complexes (gp70 IC), since the relative excess of gp70 in serum makes free anti-gp70 Abs difficult to detect (25). These complexes were measured by ELISA after precipitation of the serum with polyethylene glycol (average m.w. = 6000) as previously described (26). The results are expressed as micrograms per milliliter of gp70 complexed with anti-gp70 Abs. Although gp70 is detectable in the serum of nearly all murine strains, only lupus-prone strains produce autoantibodies to gp70 and form gp70 IC (27).

For certain comparisons, mice were separated into groups based on their serum levels of a particular autoantibody. The cut-offs used to group mice in the current study were originally determined in (NZB x NZW)F1 x NZW backcross mice by dividing the frequency distribution of autoantibody levels on the basis of tertiles. This separation into autoantibody phenotypes identified one-third of mice with low/negative levels and one-third of mice with high levels for each autoantibody measured. Backcross mice with intermediate levels were defined as the middle third. The cut-offs for anti-chromatin, anti-dsDNA, and gp70 IC autoantibodies correlated well with low levels of production in NZW and nonautoimmune strains and high levels of production in (NZB x NZW)F1 mice (3).

Statistical analysis

The linkage of a particular locus with nephritis (categorized as positive or negative) was quantified by {chi}2 analysis, using a standard (2 x 2) contingency matrix (28). Evidence that H2 or Nba2 was linked with autoantibody levels as quantitative trait loci (QTL) was determined using the linkage program, MAPMAKER/QTL (29, 30). The autoantibody levels were log10 transformed before analysis with MAPMAKER/QTL, because this tended to normalize their frequency distribution and improve the accuracy of MAPMAKER/QTL (30). It is emphasized that these analyses were directed at MHC genes or at Nba2 and were not part of a genome-wide screening for linked loci. The statistical threshold used for significant linkage was p < 0.01, based on recommendations that this cut-off be used to confirm linkage in a new dataset (31).

In separate analyses, the frequency of nephritis was compared in B6.H2z backcross mice vs transgenic B6.Ez and B6.Ezlo backcross mice by Fisher’s exact test. The mean values for particular autoantibodies in different backcrosses were compared using Dunn’s nonparametric procedure of the Kruskal-Wallis test (two-tailed).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Analysis of I-Ez expression in transgenic mice

We hypothesized that class II MHC genes account for the genetic contribution of H2z to the development of lupus-like disease in (NZB x NZW)F1 mice. To study the effect of I-Ez on disease expression, cosmid clones encoding the Eaz and Ebz genes were isolated from an NZW genomic library. Restriction maps of both clones are shown in Figure 1Go. B6 eggs were coinjected with both clones, and transgenic mice with both Eaz and Ebz genes were selected for further breeding and study. Two B6 lines were subsequently generated and named B6.Ez and B6.Ezlo based on relative copy number, relative levels of Eaz and Ebz mRNA, and relative levels of B cell surface expression of I-Ez. Because of previous studies showing that excessive I-E expression can decrease the frequency and the severity of lupus-like autoimmune disease (32, 33), we focused on these two lines in which B cell expression was near normal and lower than normal compared with that in B6.H2z mice.

Figure 2Go shows a comparison of I-Ez expression on B cells in the different strains analyzed. As shown in Figure 2Go, congenic B6.H2z mice expressed both I-Aßz and I-E on B cells, as determined by staining with mAbs 10–2.16 and 14-4-4s, respectively. In contrast, B cells from B6 mice (H2b) were not stained by either of these anti-class II Abs, since their I-Aßb molecule was not detected by the 10-2.16 mAb and because they have no I-E expression due to a defect in the Eab gene (34). B cell surface expression of I-E in B6.Ez mice was nearly equivalent to that in homozygous B6.H2z congenic mice, whereas expression in B6.Ezlo mice was decreased but clearly detectable. As expected, neither of the transgenic lines expressed I-Az.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 2. Expression of I-Az and I-E on B cells in B6, B6.H2z, B6.Ez, and B6.Ezlo strains. B cells were stained with biotinylated Abs to B220 (detected with avidin-phycoerythrin) and double stained with fluorescein-labeled Abs to I-Az (top histograms) or I-E (bottom histograms). Fluorescence intensity is shown as geographic plots on a four-decade scale. The percentage of cells in the top quadrants of each histogram is also shown.

 
The mAb used to detect I-E expression recognizes the I-E {alpha}-chain and does not distinguish surface molecules with I-Eßz from I-Eßb (23). We were therefore concerned that I-E expression in the transgenic lines may be secondary to pairing of the I-E{alpha}z (encoded by the transgene) with I-Eßb expressed in the B6 mice and that the Ebz transgene might not be functionally expressed. To study this possibility, we outcrossed the B6.Ez and B6.Ezlo strains to SWR (H2q) mice, which express neither Ea nor Eb gene products (35, 36). (B6.Ez x SWR)F1 mice were then backcrossed to SWR mice, and progeny were selected for the absence of expression of I-Ab and also for the presence of the transgenes. These mice must therefore be homozygous for H2q and not have H2-encoded Ea or Eb genes. Staining with mAb 14-4-4s (i.e., expression of I-E) in these backcross mice was comparable to that shown in Figure 2Go for the B6.Ez and B6.Ezlo parental lines (data not shown), indicating that both I-E{alpha}z and I-Eßz proteins are functionally expressed in the transgenic strains.

Analysis of backcross mice for the influence of I-Ez on disease expression

A backcross design was used to analyze the effect of transgenic I-E expression on the development of disease. Previous studies have shown that (B6.H2z x NZB)F1 mice do not develop severe renal disease (10). After backcrossing these F1 mice to NZB, a subset of (B6.H2z x NZB)F1 x NZB backcross mice demonstrated high levels of proteinuria and died from renal failure within 12 mo of age. This development of severe renal disease was strongly influenced by inheritance of the congenic interval encoding H2z (10). In the present studies, we used similar backcross combinations to analyze the effect of I-Ez expression on disease expression.

As shown in Figure 3Go, 88 (B6.H2z x NZB)F1 x NZB backcross mice were followed for the development of severe proteinuria. Of the 43 backcross mice that inherited H2z, 33% developed proteinuria compared with 11% of the 45 H2z-negative backcross mice (p < 0.001). We followed 77 (B6.Ez x NZB)F1 x NZB and 82 (B6.Ezlo x NZB)F1 x NZB backcross mice concomitantly. In contrast to the H2z-positive backcross mice, none of the 27 B6.Ez transgene-positive and none of the 39 Ezlo transgene-positive backcross mice developed proteinuria (p < 5 x 10-4, comparing the B6.H2z backcross to each B6.Ez backcross separately by Fisher’s exact test; p < 2 x 10-8, compared to both B6.Ez backcrosses combined). Thus, unlike H2z, Eaz and/or Ebz were not associated with the development of renal disease in the backcross mice. In the backcrosses of transgenic B6 mice, disease expression in the transgene-negative groups was also low and similar to that in H2z-negative progeny in the B6.H2z backcross (Fig. 3Go). Also shown for comparison in Figure 3Go is the development of severe proteinuria in (NZB x NZW)F1 x NZB backcross mice in relation to inheritance of the NZW MHC (H2z; data taken from historical controls (6)). Disease expression was much more marked in the H2z-positive (NZB x NZW)F1 x NZB than in the H2z-positive (B6.H2z x NZB)F1 x NZB backcross mice. Since the only difference in these crosses was the non-MHC NZW vs B6 background, these comparisons show that the NZW background contains additional disease susceptibility genes (or lacks disease-suppressive genes) compared with the B6 background.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 3. Development of lupus nephritis in backcross mice followed for >1 yr. All mice were followed concomitantly, except for the (NZB x NZW)F1 x NZB backcross mice (shown in dotted lines), which are historical controls, and the data for these mice have been previously reported (6). The central comparison is betweenH2z-positive mice in the (B6.H2z x NZB) x NZB backcross and Ez-transgene positive mice in both B6.Ez and B6.Ezlo backcrosses. WhenH2z-positive backcross mice are compared with allEz-positive backcross mice, the differences in disease frequency are statistically significant: * indicatesp < 0.01, ** indicates p < 2 x 10-5, and *** indicates p < 2 x 10-8.

 
Analysis of IgG autoantibody production in B6.Ezbackcross mice

We studied autoantibody production in the different backcrosses to better understand why the B6.Ez backcrosses failed to develop severe lupus nephritis. Figure 4Go compares the serum levels of gp70 IC and IgG autoantibodies to those of chromatin and dsDNA, which have been implicated in the pathogenesis of nephritis in this murine model of lupus. The results show that a subset of B6.Ez backcross mice did produce Abs to each of these self Ags (Fig. 4Go and Table IGo). For example, using a cut-off (>4.6 U/ml) that defined high levels of anti-chromatin Ab production in a previous analysis of (NZB x NZW)F1 x NZW backcross mice (3), 12 (16%) of 75 B6.Ez backcross mice were positive at 7 mo of age. Thirty-three percent of the B6.Ez backcross mice produced at least intermediate levels of IgG anti-chromatin Abs, as previously defined (3). As shown in Figure 4Go, mean levels of IgG autoantibodies in the B6.Ez backcross mice were comparable to levels in nonnephritic B6.H2z backcross mice, somewhat lower than those in nephritic B6.H2z mice (p < 0.01 for gp70 IC), and more significantly lower than those in (NZB x NZW)F1 mice (p < 0.03 for anti-chromatin, p < 0.003 for anti-dsDNA, and p < 0.0001 for gp70 IC). When mice were grouped on the basis of elevated levels of autoantibodies, B6.Ez backcross mice showed comparable and lower percentages of positive mice compared with nonnephritic and nephritic B6.H2z backcross mice, respectively (Table IGo).



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 4. IgG autoantibody production in B6.Ez backcross, B6.H2z backcross, and (NZB x NZW)F1 mice at 7 mo of age. B6.H2z backcross mice have also been divided into cohorts with and without nephritis. Each dot represents the value for an individual mouse, and mean levels for each group are shown. Serum samples from B6.H2z backcross mice were taken from a larger cohort of mice (10) in addition to those followed concomitantly for disease expression and shown in Figure 3Go. Cut-offs previously defined (3) (see Materials and Methods) to identify mice with high levels of IgG autoantibody production were 4.5 U/ml for anti-chromatin, 2.8 U/ml for anti-dsDNA, and 3.7 µg/ml for gp70 IC (see Table IGo). The mean ± SEM for the particular autoantibodies in (B6.Ez x NZB)F1x NZB mice, (B6.H2z x NZB)F1 x NZB mice without nephritis, (B6.H2z x NZB)F1 x NZB mice with nephritis, and (NZB x NZW)F1 mice, respectively, were as follows: IgG anti-chromatin, 2.24 ± 0.48, 1.50 ± 0.78, 3.44 ± 0.79, and 4.03 ± 0.71 U/ml; IgG anti-dsDNA, 0.29 ± 0.09, 0.37 ± 0.07, 1.13 ± 0.39, and 2.30 ± 0.07 U/ml; and gp70 IC, 1.59 ± 0.28, 1.04 ± 0.16, 3.17 ± 0.07, and 8.10 ± 1.80 µg/ml.

 

View this table:
[in this window]
[in a new window]
 
Table I. Categorization of backcross mice with respect to autoantibody production at 7 mo of age

 
We also studied the subclass of anti-chromatin Abs produced in the different groups of mice (Fig. 5Go). At 7 mo of age, there were no significant differences in IgG1 anti-chromatin levels between the B6.Ez backcross and the other groups of mice. There were also no significant differences in IgG2a anti-chromatin levels when mean levels in B6.Ez backcross mice were compared with those in either nephritic or nonnephritic B6.H2z backcross groups (the difference compared with (NZB x NZW)F1 mice was significant at p < 0.002). In contrast, significantly lower (p < 0.001) levels of IgG3 anti-chromatin autoantibodies were apparent in the B6.Ez backcross mice compared with the nephritic groups.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 5. IgG1, IgG2a, and IgG3 anti-chromatin autoantibody levels in B6.Ez backcross, B6.H2z backcross, and (NZB x NZW)F1 mice at 7 mo of age. The groups are otherwise as described in Figure 4Go. The mean ± SEM for the respective serologic traits in (B6.Ez x NZB)F1x NZB mice, (B6.H2z x NZB)F1 x NZB mice without nephritis, (B6.H2z x NZB)F1 x NZB mice with nephritis, and (NZB x NZW)F1 mice, respectively, were as follows: IgG1 anti-chromatin, 0.61 ± 0.23, 1.22 ± 0.26, 1.14 ± 0.37, and 1.47 ± 0.43 U/ml; IgG2a anti-chromatin, 1.39 ± 0.34, 1.22 ± 0.21, 1.82 ± 0.56, and 4.94 ± 1.05 U/ml; and IgG3 anti-chromatin, 0.39 ± 0.14, 1.62 ± 0.31, 2.92 ± 0.74, and 4.45 ± 1.54 U/ml.

 
Linkage analysis of Ez, H2b, and Nba2 with IgG autoantibody production in B6.Ez backcross mice

We used a QTL analysis to determine whether inheritance of the Eaz and/or Ebz transgenes was linked with the production of IgG autoantibodies (Table IIGo). The results revealed no significant linkage or trends toward linkage of the Ez transgenes with any of the autoantibody traits analyzed. The QTL analysis also indicated that there was no significant suppression of autoantibody production. When transgene-positive mice were compared with transgene-negative mice, no differences in mean (±SE) levels of IgG anti-chromatin (2.57 ± 0.80 vs 1.92 ± 0.54 U/ml), IgG anti-dsDNA (0.34 ± 0.13 vs 0.26 ± 0.12 U/ml), and gp70 IC (1.13 ± 0.28 vs 1.85 ± 0.42 µg/ml) were apparent. Furthermore, a similar percentage of mice in each group was positive for autoantibody production. The lack of effect of Ez on autoantibody production was not influenced by inheritance of H2b/d vs H2d/d in the backcross mice (data not shown). Therefore, competition from I-Eßb chains for pairing of I-Eßz to I-E{alpha}z chains was not responsible for the negative findings.


View this table:
[in this window]
[in a new window]
 
Table II. Linkage of Nba2, H2b, and Ez with IgG autoantibody production in (B6.Ez x NZB)F1 x NZB backcross mice

 
The design of the (B6.Ez x NZB)F1 x NZB backcross also allowed an analysis of the effect of H2b, inherited from the B6 background, on IgG autoantibody production. Table IIGo shows that in contrast to Ez genes, H2b showed surprising linkage with nearly all the autoantibodies measured (p < 1 x 10-5 for anti-chromatin, p < 0.01 for anti-dsDNA, and p < 0.01 for gp70 IC at 7 mo of age). The enhancing influence of H2b on IgG anti-chromatin production appeared to be selective for the IgG2a and IgG3 subclasses, as no trend for linkage was apparent for IgG1 anti-chromatin Abs (Table IIGo).

In a previous linkage analysis of (B6.H2z x NZB)F1 x NZB backcross mice, we found that one NZB locus on distal chromosome 1 (previously named Nba2 for New Zealand black autoimmunity 2) in combination with MHC accounted for >90% of the genetic contribution to disease and IgG autoantibody production (10, 11). We therefore analyzed linkage of Nba2 with IgG autoantibody production in the current (B6.Ez x NZB)F1 x NZB backcross (Table IIGo). This directed linkage analysis showed significant linkage for Nba2 with serum levels of IgG anti-dsDNA at 7 mo of age and with serum levels of IgG anti-chromatin, IgG anti-dsDNA, and gp70 IC at 9 mo of age. When subclasses were analyzed, only IgG1 anti-chromatin Abs showed significant linkage at p < 0.01.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present studies were designed to determine whether Eaz and/or Ebz genes account for the genetic contribution of H2z to lupus-like disease in New Zealand hybrid mice. Previous studies have shown that the ß1 exon sequences of these genes are identical with those reported for Eau and Ebu genes (14, 37, 38, 39, 40, 41). Based on various sequence homologies, it was predicted that these class II molecules would enhance the production of pathogenic IgG autoantibodies in the New Zealand model of lupus (13, 14, 38, 39). Our results, however, indicate that lupus-like disease in this model is not influenced by Eaz and/or Ebz genes.

The transgene-positive backcross mice analyzed in these studies appeared to express I-Ez in a manner similar to that of the H2z-bearing backcross mice studied as positive controls. Thus, both Eaz and Ebz genes were expressed, as determined by outcrossing transgenic mice to the I-E{alpha}- and I-Eß-negative SWR strain. Furthermore, the B6.Ez transgenic mice and their backcross progeny expressed quantitatively similar B cell surface levels of I-E compared with B6.H2z mice and their backcross progeny. The B6.Ezlo backcross, which also showed no linkage of disease with inheritance of the transgene, was studied to avoid the potentially suppressive influence of I-E overexpression on autoimmunity (32, 33, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51). It is emphasized that the transgenic strains were derived by injection of genomic Ez clones with wild-type promoter and enhancer elements. The pattern of expression in different cell types and after various types of induction should therefore be similar to that in wild-type H2z mice as previously shown for other Ea transgenes (16); however, we formally documented normal expression only on splenic B cells. The lack of effect of Ez genes also indicates that mixed haplotype I-E{alpha}d/I-Eßz molecules do not explain the effect of H2z on disease in (NZB x NZW)F1 mice as previously suggested (14). I-Eßz molecules in the transgenic backcross mice, which all express I-E{alpha}d molecules, should have been equally likely to pair with I-E{alpha}d as in wild-type H2z backcross mice. In addition, the lack of effect of the transgene on lupus-like disease was not influenced by the inheritance of H2b/d vs H2d/d and therefore was not related to competition from I-Eßb for pairing with I-E {alpha}-chains.

Other studies have suggested that increased I-E expression can suppress different types of autoimmune processes (42, 43, 44, 45, 46, 47, 48), including autoantibody production and nephritis in the New Zealand hybrid (49), BXSB (32, 33), and lpr murine models of lupus (50, 51). Results from studies of murine lupus suggest that the effect is not specific for one autoantibody but, instead, appears to involve down-regulation of autoantibody production in general. Competition by I-E{alpha}-derived peptides resulting in decreased self-peptide presentation on I-A molecules has been suggested as a possible mechanism (32, 33). In our current studies, the development of lupus nephritis appeared to be decreased by inheritance of the transgenes. However, the difference between transgene-positive and transgene-negative mice was not statistically significant, and there was no trend for increased or decreased autoantibody production caused by the presence of the transgene. Compared with previous studies, the lack of any negative effect of the transgene may be related to the normal expression levels achieved in the current crosses (32, 33). Furthermore, since backcrossing was always performed with NZB mice, which are H2d (I-Ed expressing), the additional expression of I-Ez in transgene-positive mice may have had little consequence. Most previous studies had investigated the effects of I-E{alpha} expression in an I-E{alpha}-negative strain.

Studies have indicated that heterozygosity for H2z and H2d is important for the full expression of autoimmunity in the New Zealand hybrid model (3, 6, 7, 8, 9, 10, 11, 52, 53). Thus, New Zealand hybrid or backcross mice that are H2d/z have increased IgG autoantibody production and increased incidence of nephritis compared with genetically similar mice homozygous for either H2d or H2z haplotypes. More recent studies have suggested that heterozygosity for H2 haplotypes other than H2d or H2z may also enhance disease (18, 54, 55). For example, in an analysis of (NZM x B6)F1 x NZM backcross mice (NZM is an H2z-positive recombinant inbred of NZB and NZW mice), inheritance of H2b from the B6 strain was strongly linked with the production of autoantibodies and the development of nephritis (54). Our analysis of autoantibody production in the B6.Ez backcross shows that H2b/d compared with H2d/d mice also have increased production of IgG autoantibodies. The linkage of H2b with IgG autoantibody production was apparent in the same mice that showed no influence from the inheritance of the Ez transgenes. The reason why a double dose of H2d or H2z genes is associated with less disease compared with that in H2 heterozygous states is unknown. Some investigators have postulated that mixed haplotype class II molecules, such as I-A{alpha}d/I-Aßz, or mixed isotype class II molecules, such as I-E{alpha}d/I-Aßz, may increase self recognition (14, 38, 55). However, it seems unlikely that the disease-enhancing effect of multiple different haplotype combinations are all explained by mixed class II molecules.

Although our results showed that H2b is similar to H2z in that both are linked with IgG autoantibody production, the two haplotypes were not comparable in the magnitude of their effect on autoantibody production or development of nephritis in these particular crosses. It is also possible that H2z encodes more than one lupus susceptibility gene, and that different genes underlie the contributions from different haplotypes. Levels of IgG3 autoantibody production in particular were increased in the B6.H2z compared with the B6.Ez backcross mice. Furthermore, since nephritis was only observed in the cross that involved H2z, the results imply that IgG3 autoantibodies may have greater pathogenic importance than the other subclasses. Studies analyzing pathogenic Abs in other murine models of lupus support the hypothesis that IgG3 autoantibodies may be particularly nephritogenic (56, 57, 58, 59, 60).

The linkage of H2b with IgG autoantibody production in the current backcross analysis raises questions similar to those that prompted the current studies. For example, is this effect mediated by class II genes or by other genes encoded with the MHC? Although the answer is unknown at this time, the autoantibody results provide interesting insight. Thus, the effect of H2b did not appear to be specific for one type of autoantibody. Increased serum levels of IgG autoantibodies to chromatin and gp70 were both linked with H2b. Furthermore, linkage was selective for the IgG2a and IgG3 subclasses of IgG anti-chromatin autoantibodies. Although class II MHC polymorphisms can alter Th subsets and therefore IgG subclass production, polymorphisms within class III genes encoded within the MHC may be more likely to account for the lack of Ag specificity and subclass effects. In this regard, the Tnfa gene has been previously proposed as a gene that may underlie the H2z contribution to lupus in (NZB x NZW)F1 mice (61). It is of interest that a restriction fragment length polymorphism in the Tnfa gene, which was shown to correlate with decreased TNF-{alpha} production, is present in H2b and H2z, but not in the H2d haplotype (15, 62, 63, 64). Although cytokine genes may be involved in the H2 contribution to disease, especially because of the heterozygous effects of each haplotype, other contributing genes seem likely.

In the analysis of B6.Ez backcross mice, a locus on distal chromosome 1, named Nba2, was also shown to be linked with the production of anti-chromatin and anti-DNA Abs, and a trend was observed for linkage with anti-gp70 autoantibodies. It is important to emphasize that the stringent statistical thresholds proposed for a genome-wide screening (31) do not apply to the directed linkage analysis of one non-MHC locus in the current study. In previous genome-wide screenings of (B6.H2z x NZB)F1 x NZB and (SM/J x NZB)F1 x NZW backcrosses, Nba2 was shown to be strongly linked with the development of nephritis and increased serum levels of IgG autoantibodies (10, 11, 18). A locus in a similar chromosomal location has been mapped in other studies analyzing NZB and/or NZW genes (18, 53, 54). In the B6.H2z backcross, Nba2 in conjunction with H2z provided >90% of the genetic contribution to nephritis and autoantibody production (10, 11). Nba2 is situated between 92 and 97 cM from the centromere, and this region encodes several candidate genes, including the low affinity Fc{gamma} receptor genes. Because Nba2 was linked with the coordinate production of multiple autoantibodies and total IgG and IgG subclasses levels (11), it was hypothesized that it functions as an immune response gene. Similar traits were linked with Nba2 in the current study, although the level of autoantibody production was less pronounced, and the extent of linkage appeared to be less strong in the current study. The effects of Nba2 also appear to be subject to the influence of the MHC haplotype (10, 11), and the difference between H2b and H2z in the B6.Ez and B6.H2z crosses, respectively, may have altered the influence of the Nba2 effect.

In summary, the current studies appear to exclude Eaz and/or Ebz genes in the contribution of H2z to nephritis and IgG autoantibody production in New Zealand hybrid mice. It remains possible, however, that a contribution of I-Ez to nephritis is dependent on other molecules encoded within H2z, but not H2b or H2d. Our results also show that H2b is similar to H2z, but has quantitatively less influence on disease expression in this model. Transgenic mice with Az genes have been generated, and studies are in progress to address the contribution of these class II genes to disease and autoantibody production. However, the current results suggest that other MHC genes, such as genes influencing the pattern of cytokine production, may be more important in the contribution to lupus-like disease in this model.


    Acknowledgments
 
The authors thank Drs. Diane Mathis and Christophe Benoist (Institut de Génétique et de Biologie Moléculaire et Cellulaire, Institut National de la Santé et de la Recherche Médicale, Centre National de la Recherche Scientifique, Université Louis Pasteur, Strasbourg, France) for help with generation of the transgenic mice and for critical review of the manuscript, and Ellen Roper for technical assistance with the autoantibody assays.


    Footnotes
 
1 This work was supported by Grant AR37070 from the National Institutes of Health, a grant from the Swiss National Foundation for Scientific Research, and a grant from the Ministry of Health and Welfare, Japan. Back

2 Address correspondence and reprint requests to Dr. Brian L. Kotzin, Division of Basic Sciences, National Jewish Medical and Research Center, 1400 Jackson St., Denver, CO 80206. E-mail address: Back

3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; NZB, New Zealand Black; NZW, New Zealand White; SSLP, simple sequence length polymorphisms; gp70 IC, gp70-anti-gp70 immune complexes; QTL, quantitative trait locus. Back

Received for publication September 5, 1997. Accepted for publication November 25, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Theofilopoulos, A. N.. 1992. Murine models of systemic lupus erythematosus. R. G. Lahita, ed. Systemic Lupus Erythematosus 121. Churchill Livingstone, New York.
  2. Izui, S., J. H. Elder, P. J. McConahey, F. J. Dixon. 1981. Identification of retroviral gp70 and anti-gp70 antibodies involved in circulating immune complexes in NZB x NZW mice. J. Exp. Med. 153:1151.[Abstract/Free Full Text]
  3. Vyse, T. J., C. G. Drake, S. J. Rozzo, E. Roper, S. Izui, B. L. Kotzin. 1996. Genetic linkage of IgG autoantibody production in relation to lupus nephritis in New Zealand hybrid mice. J. Clin. Invest. 98:1762.[Medline]
  4. Vyse, T. J., B. L. Kotzin. 1996. Genetic basis of systemic lupus erythematosus. Curr. Opin. Immunol. 8:843.[Medline]
  5. Knight, J. G., D. D. Adams. 1978. Three genes for lupus nephritis in NZB x NZW mice. J. Exp. Med. 147:1653.[Abstract/Free Full Text]
  6. Kotzin, B. L., E. Palmer. 1987. The contribution of NZW genes to lupus-like disease in (NZB x NZW)F1 mice. J. Exp. Med. 165:1237.[Abstract/Free Full Text]
  7. Hirose, S., G. Ueda, K. Noguchi, T. Okada, I. Sekigawa, H. Sato, T. Shirai. 1986. Requirement of H-2 heterozygosity for autoimmunity in (NZB x NZW)F1 hybrid mice. Eur. J. Immunol. 16:1631.[Medline]
  8. Hirose, S., K. Kinoshita, S. Nozawa, H. Nishimura, T. Shirai. 1990. Effects of major histocompatibility complex on autoimmune disease of H-2-congenic New Zealand mice. Int. Immunol. 2:1091.[Abstract/Free Full Text]
  9. Babcock, S. K., V. B. Appel, M. Schiff, E. Palmer, B. L. Kotzin. 1989. Genetic analysis of the imperfect association of H-2 haplotype with lupus-like autoimmune disease. Proc. Natl. Acad. Sci. USA 86:7552.[Abstract/Free Full Text]
  10. Rozzo, S. J., T. J. Vyse, C. G. Drake, B. L. Kotzin. 1996. Effect of genetic background on the contribution of NZB loci to autoimmune lupus nephritis. Proc. Natl. Acad. Sci. USA 93:15164.[Abstract/Free Full Text]
  11. Vyse, T. J., S. J. Rozzo, C. G. Drake, S. Izui, B. L. Kotzin. 1997. Control of multiple autoantibodies linked with a lupus nephritis susceptibility locus in New Zealand black mice. J. Immunol. 158:5566.[Abstract]
  12. Wofsy, D., W. E. Seaman. 1985. Successful treatment of autoimmunity in NZB/NZW F1 mice with monoclonal antibody to L3T4. J. Exp. Med. 161:378.[Abstract/Free Full Text]
  13. Chiang, B. L., E. Bearer, A. Ansari, K. Dorshkind, M. E. Gershwin. 1990. The bm12 mutation and autoantibodies to dsDNA in NZB. H-2bm12 mice. J. Immunol. 145:94.[Abstract]
  14. Nygard, N. R., D. M. McCarthy, J. Schiffenbauer, B. D. Schwartz. 1993. Mixed haplotypes and autoimmunity. Immunol. Today 14:53.[Medline]
  15. Jongeneel, C. V., H. Acha-Orbea, T. Blankenstein. 1990. A polymorphic microsatellite in the tumor necrosis factor alpha promoter identifies an allele unique to the NZW mouse strain. J. Exp. Med. 171:2141.[Abstract/Free Full Text]
  16. Le Meur, M., P. Gerlinger, C. Benoist, D. Mathis. 1985. Correcting an immune-response deficiency by creating Ea gene transgenic mice. Nature 316:38.[Medline]
  17. Drake, C. G., S. K. Babcock, E. Palmer, B. L. Kotzin. 1994. Genetic analysis of the NZB contribution to lupus-like autoimmune disease in (NZB x NZW)F1 mice. Proc. Natl. Acad. Sci. USA 91:4062.[Abstract/Free Full Text]
  18. Drake, C. G., S. J. Rozzo, H. F. Hirschfeld, N. P. Smarnworawong, E. Palmer, B. L. Kotzin. 1995. Analysis of the New Zealand Black contribution to lupus-like renal disease: multiple genes that operate in a threshold manner. J. Immunol. 154:2441.[Abstract]
  19. Sambrook, J., E. F. Fritsch, T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual 9.22.. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
  20. Sambrook, J., E. F. Fritsch, T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual 3.27.. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
  21. Rozzo, S. J., C. G. Drake, B. L. Chiang, M. E. Gershwin, B. L. Kotzin. 1994. Evidence for polyclonal T cell activation in murine models of systemic lupus erythematosus. J. Immunol. 153:1340.[Abstract]
  22. Oi, V. T., P. P. Jones, J. W. Goding, L. A. Herzenberg. 1978. Properties of monoclonal antibodies to mouse Ig allotypes, H-2, and Ia antigens. Curr. Top. Microbiol. Immunol. 81:115.[Medline]
  23. Ozato, K., N. Mayer, D. H. Sachs. 1980. Hybridoma cell lines secreting monoclonal antibodies to mouse H-2 and Ia antigens. J. Immunol. 124:533.[Abstract]
  24. Emlen, W., P. Jarusiripipat, G. Burdick. 1990. A new ELISA for the detection of double-stranded DNA antibodies. J. Immunol. Methods 132:91.[Medline]
  25. Izui, S., P. J. McConahey, A. N. Theofilopoulos, F. J. Dixon. 1979. Association of circulating retroviral gp70-anti-gp70 immune complexes with murine systemic lupus erythematosus. J. Exp. Med. 149:1099.[Abstract/Free Full Text]
  26. Izui, S., G. Lange. 1983. Enzyme-linked immunosorbent assay for detection of retroviral gp70 and gp70-anti-gp70 immune complexes in sera from SLE mice. Clin. Exp. Immunol. 71:45.
  27. Izui, S., P. J. McConahey, J. P. Clark, L. M. Hang, I. Hara, F. J. Dixon. 1981. Retroviral gp70 immune complexes in NZB x NZW F2 mice with murine lupus nephritis. J. Exp. Med. 154:517.[Abstract/Free Full Text]
  28. Rosner, B.. 1995. Hypothesis testing: categorical data. Fundamentals of Biostatistics 4th Ed.345. Wadsworth Publishing Co, Belmont.
  29. Paterson, A. H., E. S. Lander, J. D. Hewitt, S. Peterson, S. E. Lincoln, S. D. Tanksley. 1988. Resolution of quantitative traits into Mendelian factors by using a complete RFLP linkage map. Nature 335:721.[Medline]
  30. Lincoln, S. E., M. Daly, E. S. Lander. 1992. Mapping Genes Controlling Quantitative Traits with MAPMAKER/QTL 1.1 Whitehead Institute, Cambridge, MA.
  31. Lander, E., L. Kruglyak. 1995. Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nat. Genet. 11:241.[Medline]
  32. Merino, R., M. Iwamoto, L. Fossati, P. Muniesa, K. Araki, S. Takahashi, J. Huarte, K.-I. Yamamura, J.-D. Vassalli, S. Izui. 1993. Prevention of systemic lupus erythematosus in autoimmune BXSB mice by a transgene encoding I-E {alpha} chain. J. Exp. Med. 178:1189.[Abstract/Free Full Text]
  33. Iwamoto, M., N. Ibnou-Zekri, K. Araki, S. Izui. 1996. Prevention of murine lupus by an I-E {alpha} chain transgene: protective role of I-E {alpha} chain-derived peptides with a high affinity to I-Ab molecules. Eur. J. Immunol. 26:307.[Medline]
  34. Mathis, D. J., C. Benoist, II V. E. Williams, M. Kanter, H. O. McDevitt. 1983. Several mechanisms can account for defective Ea gene expression in different mouse haplotypes. Proc. Natl. Acad. Sci. USA 80:273.[Abstract/Free Full Text]
  35. Jones, P. P., D. B. Murphy, H. O. McDevitt. 1981. Variable synthesis and expression of E{alpha} and Ae (Eß) Ia polypeptide chains in mice of different H-2 haplotypes. Immunogenetics 12:321.[Medline]
  36. Begovich, A. B., T. H. Vu, P. P. Jones. 1990. Characterization of the molecular defects in the mouse Eß f and Eß q genes: implications for the origin of MHC polymorphism. J. Immunol. 144:1957.[Abstract]
  37. Ayane, M., L. Mengle-Gaw, H. O. McDevitt, C. Benoist, D. Mathis. 1986. E{alpha} u and u chain association: where lies the anomoly?. J. Immunol. 137:948.[Abstract]
  38. Schiffenbauer, J., D. M. McCarthy, N. R. Nygard, S. L. Woulfe, D. K. Didier, B. D. Schwartz. 1989. A unique sequence of the NZW I-E ß chain and its possible contribution to autoimmunity in the (NZB x NZW)F1 mouse. J. Exp. Med. 170:971.[Abstract/Free Full Text]
  39. Smith, L. R., A. N. Theofilopoulos. 1990. Sequence of I-E genes from autoimmune New Zealand White mice. Arthritis Rheum. 33:583.[Medline]
  40. Ogawa, S., H. Nishimura, M. Awaji, S. Nozawa, S. Hirose, T. Shirai. 1990. Nucleotide sequence analysis of MHC class II genes in autoimmune disease-prone (NZB x NZW)F1 mice. Immunogenetics 32:63.[Medline]
  41. Nishimura, H., H. Okamoto, S. Ogawa, S. Hirose, and T. Shirai. 1991. Ebz of NZW mice is identical with Ebu of B10. PL mice. Immunogenetics 33:413 (Lett.).
  42. Hanson, M. S., M. Cetkovic-Cvlje, V. K. Ramiya, M. A. Atkinson, N. K. MacLaren, B. Singh, J. F. Elliott, D. F. Serreze, E. H. Leiter. 1996. Quantitative thresholds of MHC class II I-E expressed on hemopoietically derived antigen-presenting cells in transgenic NOD/Lt mice determine level of diabetes resistance and indicate mechanism of protection. J. Immunol. 157:1279.[Abstract]
  43. Nishimoto, H., H. Kikutani, K. Yamamura, T. Kishimoto. 1987. Prevention of autoimmune insulitis by expression of I-E molecules in NOD mice. Nature 328:432.[Medline]
  44. Lund, T., L. O’Reilly, P. Hutchings, O. Kanagawa, E. Simpson, R. Gravely, P. Chandler, J. Dyson, J. K. Picard, A. Edwards, D. Kioussis, A. Cooke. 1990. Prevention of insulin-dependent diabetes mellitus in non-obese diabetic mice by transgenes encoding modified I-A ß-chain or normal I-E {alpha}-chain. Nature 345:727.[Medline]
  45. Böhme, D., B. Schubaur, O. Kanagawa, C. Benoist, D. Mathis. 1990. MHC-linked protection from diabetes dissociated from clonal deletion of T cells. Science 249:293.[Abstract/Free Full Text]
  46. Christadoss, P., C. S. David, M. Shenoy, S. Keve. 1990. Ek{alpha} transgene in B10 mice suppresses the development of myasthenia gravis. Immunogenetics 31:241.[Medline]
  47. Gonzalez-Gay, M. A., E. Zanelli, C. J. Krco, G. H. Nabozny, J. Hanson, M. M. Griffiths, H. S. Luthra, C. S. David. 1995. Polymorphism of the MHC class II Eb gene determines the protection against collagen-induced arthritis. Immunogenetics 42:35.[Medline]
  48. Gonzalez-Gay, M. A., E. Zanelli, S. D. Khare, C. J. Krco, M. M. Griffiths, H. S. Luthra, C. S. David. 1996. H2-A polymorphism contributes to H2-Eb-mediated protection in collagen-induced arthritis. Immunogenetics 44:377.[Medline]
  49. Hirose, S., D. Zhang, S. Nozawa, H. Nishimura, T. Shirai. 1994. The E-linked subregion of the major histocompatibility complex down-regulates autoimmunity in NZB x NZW F1 mice. Immunogenetics 40:150.[Medline]
  50. Cohen, P. L., E. Creech, D. Nakul-Aquaronne, R. McDaniel, S. Ackler, R. G. Rapoport, E. S. Sobel, R. A. Eisenberg. 1993. Antigen nonspecific effect of major histocompatibility complex haplotype on autoantibody levels in systemic lupus erythematosus-prone lpr mice. J. Clin. Invest. 91:2761.
  51. Creech, E. A., D. Nakul-Aquaronne, E. A. Reap, R. L. Cheek, P. A. Wolthusen, P. L. Cohen, R. A. Eisenberg. 1996. MHC genes modify systemic autoimmune disease: the role of the I-E locus. J. Immunol. 156:812.[Abstract]
  52. Maruyama, N., F. Furukawa, Y. Nakai, Y. Sasaki, K. Ohta, S. Ozaki, S. Hirose, T. Shirai. 1983. Genetic studies of autoimmunity in New Zealand mice. IV: Contribution of NZB and NZW genes to the spontaneous occurrence of retroviral gp70 immune complexes in (NZB x NZW)F1 hybrid and the correlation to renal disease. J. Immunol. 130:740.[Abstract]
  53. Kono, D. H., R. W. Burlingame, D. G. Owens, A. Kuramochi, R. S. Balderas, D. Balomenos, A. N. Theofilopoulos. 1994. Lupus susceptibility loci in New Zealand mice. Proc. Natl. Acad. Sci. USA 91:10168.[Abstract/Free Full Text]
  54. Morel, L., U. H. Rudofsky, J. A. Longmate, J. Schiffenbauer, E. K. Wakeland. 1994. Polygenic control of susceptibility to murine systemic lupus erythematosus. Immunity 1:219.[Medline]
  55. Gotoh, Y., H. Takashima, K. Noguchi, H. Nishimura, M. Tokushima, T. Shirai, M. Kimoto. 1993. Mixed haplotype Aßz/A{alpha}d class II molecule in (NZB x NZW)F1 mice detected by T cell clones. J. Immunol. 150:4777.[Abstract]
  56. Takahashi, S., M. Nose, J. Sasaki, T. Yamamoto, M. Kyogoku. 1991. IgG3 production in MRL/lpr mice is responsible for development of lupus nephritis. J. Immunol. 147:515.[Abstract]
  57. Erausquin, C., R. Merino, S. Izui, L. Fernandez-Sueiro, F. Saez, F. Fernandez, V. Rodriguez-Valverde, J. Merino. 1995. Therapeutic effect of early thymic irradiation in (NZB x NZW)F1 mice, associated with a selective decrease in the levels of IgG3 and gp70-anti-gp70 immune complexes. Cell. Immunol. 161:207.[Medline]
  58. Takahashi, S., L. Fossati, M. Iwamoto, R. Merino, R. Motta, T. Kobayakawa, S. Izui. 1996. Imbalance towards Th1 predominance is associated with acceleration of lupus-like autoimmune disease in MRL mice. J. Clin. Invest. 97:1597.[Medline]
  59. Santiago, M.-L., L. Fossati, C. Jacquet, W. Müller, S. Izui, L. Reininger. 1997. Interleukin-4 protects against a genetically linked lupus-like autoimmune syndrome. J. Exp. Med. 185:65.[Abstract/Free Full Text]
  60. Nakajima, A., S. Hirose, H. Yagita, K. Okumura. 1997. Roles of IL-4 and IL-12 in the development of lupus in NZB/W F1 mice. J. Immunol. 158:1466.[Abstract]
  61. Jacob, C. O., Z. Fronek, G. D. Lewis, M. Koo, J. A. Hansen, H. O. McDevitt. 1990. Heritable major histocompatibility complex class II-associated differences in production of tumor necrosis factor {alpha}: relevance to genetic predisposition to systemic lupus erythematosus. Proc. Natl. Acad. Sci. USA 87:1233.[Abstract/Free Full Text]
  62. Jacob, C. O., H. O. McDevitt. 1988. Tumour necrosis factor-{alpha} in murine autoimmune ‘lupus’ nephritis. Nature 331:356.[Medline]
  63. Gardner, S. M., B. A. Mock, J. Hilgers, K. E. Huppi, W. D. Roeder. 1987. Mouse lymphotoxin and tumor necrosis factor: structural analysis of the cloned genes, physical linkage, and chromosomal position. J. Immunol. 139:476.[Abstract]
  64. Müller, U., C. V. Jongeneel, S. A. Nedospasov, K. F. Lindahl, M. Steinmetz. 1987. Tumour necrosis factor and lymphotoxin genes map close to H-2D in the mouse major histocompatibility complex. Nature 325:265.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
Y.-H. Cheung, N.-H. Chang, Y.-C. Cai, G. Bonventi, R. MacLeod, and J. E. Wither
Functional Interplay between Intrinsic B and T Cell Defects Leads to Amplification of Autoimmune Disease in New Zealand Black Chromosome 1 Congenic Mice
J. Immunol., December 15, 2005; 175(12): 8154 - 8164.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. R. Gubbels, T. N. Jorgensen, T. E. Metzger, K. Menze, H. Steele, S. A. Flannery, S. J. Rozzo, and B. L. Kotzin
Effects of MHC and Gender on Lupus-Like Autoimmunity in Nba2 Congenic Mice
J. Immunol., November 1, 2005; 175(9): 6190 - 6196.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Subramanian, Y.-S. Yim, K. Liu, K. Tus, X. J. Zhou, and E. K. Wakeland
Epistatic Suppression of Systemic Lupus Erythematosus: Fine Mapping of Sles1 to Less Than 1 Mb
J. Immunol., July 15, 2005; 175(2): 1062 - 1072.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. E. Wither, G. Lajoie, S. Heinrichs, Y.-C. Cai, N. Chang, A. Ciofani, Y.-H. Cheung, and R. MacLeod
Functional Dissection of Lupus Susceptibility Loci on the New Zealand Black Mouse Chromosome 1: Evidence for Independent Genetic Loci Affecting T and B Cell Activation
J. Immunol., August 15, 2003; 171(4): 1697 - 1706.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Z. SM. Rahman, S.-K. Tin, P.-N. L. Buenaventura, C.-H. Ho, E. P. H. Yap, R. Y. Y. Yong, and D.-R. Koh
A Novel Susceptibility Locus On Chromosome 2 in the (New Zealand Black x New Zealand White)F1 Hybrid Mouse Model of Systemic Lupus Erythematosus
J. Immunol., March 15, 2002; 168(6): 3042 - 3049.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Xie, S. Chang, P. Yang, C. Jacob, A. Kaliyaperumal, S. K. Datta, and C. Mohan
Genetic Contributions of Nonautoimmune SWR Mice Toward Lupus Nephritis
J. Immunol., December 15, 2001; 167(12): 7141 - 7149.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Paisansinsup, A. N. Vallejo, H. Luthra, and C. S. David
HLA-DR Modulates Autoantibody Repertoire, But Not Mortality, in a Humanized Mouse Model of Systemic Lupus Erythematosus
J. Immunol., October 1, 2001; 167(7): 4083 - 4090.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. M. Tucker, T. J. Vyse, S. Rozzo, C. L. Roark, S. Izui, and B. L. Kotzin
Genetic Control of Glycoprotein 70 Autoantigen Production and Its Influence on Immune Complex Levels and Nephritis in Murine Lupus
J. Immunol., August 1, 2000; 165(3): 1665 - 1672.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. J. Rozzo, T. J. Vyse, K. Menze, S. Izui, and B. L. Kotzin
Enhanced Susceptibility to Lupus Contributed from the Nonautoimmune C57BL/10, But Not C57BL/6, Genome
J. Immunol., May 15, 2000; 164(10): 5515 - 5521.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Ibnou-Zekri, M. Iwamoto, M. E. Gershwin, and S. Izui
Protection of Murine Lupus by the Ead Transgene Is MHC Haplotype-Dependent
J. Immunol., January 1, 2000; 164(1): 505 - 511.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. J. Vyse, R. K. Halterman, S. J. Rozzo, S. Izui, and B. L. Kotzin
Control of separate pathogenic autoantibody responses marks MHC gene contributions to murine lupus
PNAS, July 6, 1999; 96(14): 8098 - 8103.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. J. Rozzo, T. J. Vyse, C. S. David, E. Palmer, S. Izui, and B. L. Kotzin
Analysis of MHC Class II Genes in the Susceptibility to Lupus in New Zealand Mice
J. Immunol., March 1, 1999; 162(5): 2623 - 2630.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vyse, T. J.
Right arrow Articles by Kotzin, B. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vyse, T. J.
Right arrow Articles by Kotzin, B. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS