The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murakami, M.
Right arrow Articles by Paul, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murakami, M.
Right arrow Articles by Paul, W. E.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 1998, 160: 2649-2654.
Copyright © 1998 by The American Association of Immunologists

Age-Dependent Appearance of NK1.1+ T Cells in the Livers of ß2-Microglobulin Knockout and SJL Mice

Masao Murakami1 and William E. Paul2

Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892


   Abstract
Top
 Abstract
Introduction
 Material and Methods
 Results
 Discussion
 References
 
NK1.1+ T cells, a specialized set of T cells that recognize CD1, are reportedly absent in young ß2-microglobulin-deficient (ß2m-knockout (KO)) and SJL mice. In this study, we show that a significant number of NK1.1+ T cells exist in the livers of older ß2m-KO and SJL mice, and that the number of liver NK1.1+ T cells increases as the animals age. The surface phenotypes of liver NK1.1+ T cells from ß2m-KO and SJL mice were similar to NK1.1+ T cells from C57BL/6 mice, except that the bulk of these cells were CD4-CD8-. After anti-CD3 injection in vivo, the cells promptly expressed IL-4 mRNA just as NK1.1+ T cells did in normal mice. Using L cells expressing CD1, liver NK1.1+ T cells from both ß2m-KO and SJL mice were stimulated to proliferate, although to a lesser degree than were such cells from C57BL/6 mice. Our studies show that some NK1.1+ T cells accumulate in the livers of older ß2m-KO and SJL mice, and that they appear to have functional properties similar to "normal" NK1.1+ T cells.


   Introduction
Top
 Abstract
 Introduction
Material and Methods
 Results
 Discussion
 References
 
Unlike conventional T cells, NK1.1+ T cells secrete large amounts of IL-4 upon initial stimulation in vivo (1, 2, 3) and display a unique phenotype characterized by the following pattern of surface marker expression: NK1.1+, IL-2Rß+, IL-2R{alpha}-, CD44high, CD3intermediate (CD3int),3 CD45RBlow, and CD62Llow (4, 5, 6). Moreover, NK1.1+ T cells preferentially use V{alpha}14 (7, 8, 9), associated with Vß8, Vß7, or Vß2, in their TCRs (10, 11). These cells were initially found and studied in the thymus and spleen (2, 3, 4), but the liver is now known to be rich in NK1.1+ T cells (4, 5, 12, 13). The positively selecting ligand for NK1.1+ T cells appears to be the conserved MHC class I-like molecule CD1 (14, 15, 16), which normally associates with ß2-microglobulin (ß2m) on the cell surface (17). Indeed, surface expression of CD1 is impaired, and the number of NK1.1+ T cells is undetectably low in the spleen and thymus of young mice homozygous for a disrupted ß2m gene (ß2m-KO mice) (18, 19) as well as in the spleen and thymus of CD1-KO mice (20, 21, 22). Prompt IL-4 production after primary stimulation of anti-CD3 injection does not occur in either ß2m-KO mice (23) or CD1-KO mice (20, 21, 22), further supporting the importance of NK1.1+ T cells in early IL-4 production.

A major deficiency of NK1.1+ T cells has also been reported in SJL mice, which display little or no prompt production of IL-4 after anti-CD3 injection (24). Similar to ß2m-KO mice, SJL mice display a marked diminution in IgE production after anti-IgD injection, suggesting that IL-4 production by NK1.1+ T cells plays a major role, directly or indirectly, in producing the IL-4 which is important in switching to this isotype (25). It should be noted, however, that CD1-KO mice do display IgE production in response to anti-IgD, although they have a striking deficit in thymic NK1.1+ T cells (20, 21, 22). The lack of NK1.1+ T cells in SJL mice may be due in part to a large deletion in the Vß genetic region of their TCRs that includes the genes for Vß8 (26). However, SWR mice with a similar Vß deletion do display NK1.1+ T cells and produce IL-4 in response to injection of anti-CD3 (24, 27). Recently, SJL mice have been reported to express cells that lack both NK1.1 and the capacity to produce IL-4 but express other properties of NK1.1+ T cells. The lack of expression of NK1.1 and the lack of IL-4 production have been reported to be independently controlled by distinct recessive genes (27).

Here we report that the defects in expression of IL-4-producing NK1.1+ T cells observed in young adult ß2m-KO and SJL mice are partially repaired in the livers of these mice as they age. We describe the features of the NK1.1+ T cells that appear in these older mice, and show that these cells are capable of producing IL-4 after anti-CD3 injection.


   Material and Methods
Top
 Abstract
 Introduction
 Material and Methods
Results
 Discussion
 References
 
Mice

ß2m-KO mice on a C57BL/6 background were bred and maintained in the animal facilities of National Institute of Allergy and Infectious Diseases, National Institutes of Health. C57BL/6 and SJL mice were obtained from the Division of Cancer Treatment, National Cancer Institute (Frederick, MD).

Cell preparation

To obtain hepatic mononuclear cells (MNC), mice were anesthetized with ether and sacrificed. Livers were removed, pressed through a 40-µm nylon cell strainer (Falcon, Lincoln Park, NJ), and suspended in PBS (0.1 M, pH 7.4). After one washing with PBS, MNC were isolated from hepatocytes and hepatic nuclei by Ficoll-Isopaque density gradient centrifugation (density of 1.090). To avoid selective cell loss during the gradient centrifugation, it was important to dilute the liver cell suspensions (i.e., 30 ml per liver) before overlaying the sample on the gradient cushion. MNC collected from the interface were then suspended in MEM. Spleen cells were also collected by the Ficoll-Isopaque method, while thymocytes were obtained by forcing the thymus through a nylon cell strainer.

Fluorescence analysis

For the detection of NK1.1+ T cells, MNC were stained by FITC-anti-CD3, -anti-CD4, or -anti-CD8 and by phycoerythrin (PE)-anti-NK1.1 after blocking FcR binding with the mAb 2.4G2. For further characterization of NK1.1+ T cells, three-color staining was done. Cy-Chrome-labeled anti-CD3 and PE-labeled anti-NK1.1 were used in combination with FITC-labeled anti-IL-2R{alpha}, anti-IL-2Rß, anti-Vß8, anti-CD62L, or anti-CD44. Fluorescence staining of 105 cells was performed at 4°C in 100 µl of PBS supplemented with 3% FCS and 0.5% NaN3. Fluorescence analysis was conducted using a FACScan Flow Cytometer (Becton Dickinson, Mountain View, CA). Conjugated mAbs were purchased from PharMingen (San Diego, CA).

Cell proliferation assay

NK1.1+CD3+ T cells and NK1.1-CD3+ T cells were freshly sorted from the livers of older ß2m-KO, SJL, and C57BL/6 mice. Cells (104) were mixed with 5 x 104 CD1-expressing L cells or control parental L cells that had been treated with 100 µg/ml mitomycin C for 1 h at 37°C to prevent them from overgrowing the culture. These mixtures were cultured in the presence of 20 U/ml IL-2 in a 96-well U-plate for 5 days. [3H]thymidine uptake during the last 48 h was measured.

Analysis of expression of IL-4

Using the guanidinium method as described (28), total RNA was prepared from the spleen and liver T cells of young and older C57BL/6, ß2m-KO, or SJL mice that had been injected i.v. with 1.33 µg of the anti-CD3 mAb 2C11 or with the same amount of PBS as a control. T cells were enriched from MNC using murine T cell enrichment columns (R&D Systems, Minneapolis, MN). For analysis of expression of IL-4 mRNA in spleen and liver T cells, mRNAs were amplified by a modified standard RT-PCR amplification procedure as described previously (3). Primers specific for murine IL-4 and ß-actin were as follows: IL-4: 5' primer (GAATGTACCAGCAGC) and 3' primer (CTCAGTACTACGAGTAATCCA); ß-actin: 5' primer (GATGACGATATCGCTGCGCTG) and 3' primer (GTACGACCAGAGGCATACAGG). After reverse transcription, samples were amplified for 30 cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C. After amplification, PCR products were separated by electrophoresis in 8% acrylamide gels and visualized by UV light illumination after ethidium bromide staining.


   Results
Top
 Abstract
 Introduction
 Material and Methods
 Results
Discussion
 References
 
Preferential accumulation of NK1.1+ T cells in the livers of older ß2m-KO mice

To examine the effect of aging on the number of NK1.1+ T cells in ß2m-KO mice, we examined young (4-wk-old) and fully mature (8-mo-old) mice. The number of NK1.1+CD3+ T cells in the spleens of 8-mo-old ß2m-KO mice was <1%, similar to their frequency in 4-wk-old mice (Fig. 1GoA). However, a significant number of liver NK1.1+CD3+ T cells appeared in the 8-mo-old ß2m-KO mice. Indeed, the ratio of these NK1.1+ T cells to the total number of liver lymphocytes increased with age, reaching 11% at 8 mo of age (Fig. 1GoB). There was a comparable increase in the absolute number of NK1.1+ T cells; 1-mo-old ß2m-KO mice had 1.0 ± 0.4 x 104 NK1.1+ T cells, while 8-mo-old ß2m-KO mice had 4.2 ± 0.8 x 104 NK1.1+ T cells.



View larger version (37K):
[in this window]
[in a new window]
  		FIGURE 1. Liver CD4-,8-NK1.1+ T cells increase in older ß2m-KO mice. A, Spleen and liver MNC derived from 1- and 8-mo-old ß2m-KO and C57BL/6 mice were stained with PE-anti-NK1.1 and FITC-anti-CD3; liver MNC were also stained with PE-anti-NK1.1 and a combination of FITC-anti-CD4 and -anti-CD8. The number in each histogram indicates the percentage of gated cells of the NK1.1+CD3+ or NK1.1+CD4 and/or CD8+ phenotype. B, The percentages of NK1.1+CD3+ T cells and NK1.1+CD4-CD8- T cells among liver lymphocytes of ß2m-KO mice and C57BL/6 mice at ages 1, 4, and 8 mo are indicated. The percent of CD4-CD8-NK1.1+ T was calculated by subtracting the percentage of CD4 and/or CD8+NK1.1+ cells from that of NK1.1+CD3+ cells. n indicates the number of tested mice. Each value is shown as mean ± SD.

 
The majority of NK1.1+CD3+ T cells in the livers of older mice failed to express either CD4 or CD8. By contrast, in congenic normal C57BL/6 mice, only a modest increase in liver NK1.1+ T cells occurs with age (Fig. 1GoB), and this population comprises both CD4+CD8- and CD4-CD8- T cells.

Surface phenotype of liver NK1.1+ T cells in older ß2m-KO mice

We compared the expression of cell surface markers of liver NK1.1+ T cells from older ß2m-KO mice with that of NK1.1+ T cells from C57BL/6 mice. Liver NK1.1+ T cells obtained from older ß2m-KO mice were CD3low, CD44high, IL-2Rß+, and IL-2R{alpha}-, which was similar to that expressed in NK1.1+ T cells from young C57BL/6 mice (Fig. 2Go). Liver NK1.1+ T cells from ß2m-KO mice preferentially used Vß8 to a degree that was similar to that displayed in the liver NK1.1+ T cells of normal mice (Fig. 2Go).



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 2. Surface phenotypes of liver NK1.1+ T cells that appear in older ß2m-KO mice. Liver lymphocytes from 5-mo-old ß2m-KO mice and from 1-mo-old C57BL/6 mice were stained with PE-anti-NK1.1, Cy-Chrome-anti-CD3, and FITC-anti-CD44, -anti-IL-2R{alpha}, -anti-IL-2Rß, or -anti-Vß8 Abs. Surface phenotypes of NK1.1+CD3+ C57BL/6 cells were compared with those of NK1.1+CD3+ and NK1.1-CD3+ cells of older ß2m-KO mice. The numbers and brackets in the Vß8 histograms indicate the percentage of lymphocytes that are Vß8+.

 
Age-dependent accumulation of liver NK1.1+ T cells in SJL mice

We also examined the age-dependent appearance of NK1.1+ T cells in SJL mice. As in ß2m-KO mice, NK1.1+ T cells that were essentially undetectable in the spleen and liver of 1-mo-old mice accumulated in the livers of older SJL mice. The great majority of liver NK1.1+ T cells of older SJL mice were CD4-CD8-. NK1.1+ T cells were rare in the spleens (Fig. 3Go A) and thymi (data not shown) of older SJL mice. The phenotype of liver NK1.1+ T cells in old SJL mice was similar to that observed in other NK1.1+ T cells. These cells were CD3int, IL-2R{alpha}-, IL-2Rß+, and CD44bright (Fig. 3GoB). Vß8+ T cells were not detected in the liver NK1.1+ T cells of older SJL mice, which is to be expected, because these mice have a large deletion in the Vß region of the TCR gene complex that includes Vß8 (26).



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 3. NK1.1+ T cells appear in the livers of older SJL mice and express a surface phenotype similar to that of other NK1.1+ T cells. A, Lymphocytes from the livers and spleens of 7-mo-old SJL mice were stained and examined as in Figure 1GoA. B, Liver lymphocytes of 7-mo-old SJL mice were stained and analyzed as in Figure 2Go.

 
Response of NK1.1+ T cells to CD1

To determine whether liver NK1.1+ T cells from older ß2m-KO and SJL mice respond to CD1, we conducted cell proliferation assays of sorted NK1.1+ T cells using both L cells expressing CD1 (L-CD1) and parental L cells as stimulators. Liver NK1.1+ T cells from older ß2m-KO and SJL mice responded to L-CD1, but only about one-third as well as did liver NK1.1+ T cells from C57BL/6 mice (Fig. 4Go).



View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 4. Liver NK1.1+ T cells from older ß2m-KO and SJL mice react against L-CD1, but to a lesser degree than do liver NK1.1+ T cells from C57BL/6 mice. NK1.1+CD3+- and NK1.1-CD3+-sorted T cells (104) from the livers of 1-mo-old C57BL/6 mice or 8-mo-old ß2m-KO or SJL mice were cultured with 5 x 104 L-CD1 or L cells for 5 days. [3H]thymidine uptake during the last 2 days of culture was measured.

 
Prompt production of IL-4 in the livers of older ß2m-KO and SJL mice after anti-CD3 injection

An important question is whether the liver NK1.1+ T cells that appear in older ß2m-KO mice and SJL mice are functionally similar to the NK1.1+ T cells of normal mice. One characteristic function of "normal" NK1.1+ T cells is that they produce IL-4 promptly in response to the injection of anti-CD3 (3). We examined the induction of IL-4 mRNA in spleen and liver T cells from young and older ß2m-KO and SJL mice 90 min after anti-CD3 injection and compared it with the response of spleen and liver T cells from young C57BL/6 mice. Spleen and liver T cells from 5-wk-old normal mice that had been injected with anti-CD3 promptly expressed IL-4 mRNA, as analyzed by RT-PCR (Fig. 5Go). Previous studies have demonstrated that virtually all the IL-4 mRNA induced by anti-CD3 is due to NK1.1+ T cells (3, 23). IL-4 mRNA was not detected in spleens or livers of young ß2m-KO or SJL mice in response to injection of anti-CD3 (Fig. 4Go). By contrast, IL-4 mRNA was induced in the livers but not in the spleens of older ß2m-KO and SJL mice in response to anti-CD3.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 5. IL-4 mRNA expression by liver T cells from older ß2m-KO and SJL mice after injection of anti-CD3. Older ß2m-KO mice, young and older SJL mice, and young C57BL/6 mice were injected i.v. with 1.33 µg of anti-CD3 Ab (2C11). T cells were purified from spleens and livers and RNA was extracted 90 min later. IL-4 mRNA was amplified by RT-PCR.

 

   Discussion
Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
References
 
CD3int IL-2Rß+ T cells, which are known to be an important component of the liver T cell population (29, 30), reportedly express NK1.1 Ag (4). These liver NK1.1+ T cells are similar to NK1.1+ T cells in the spleen and thymus with regard to their surface phenotype, TCR usage, and their capacity to promptly produce IL-4 after injection of anti-CD3 (Fig. 4Go; 13 . Here, we show that liver NK1.1+ T cells accumulate to a modest extent in older C57BL/6 mice (Fig. 2Go), in keeping with prior work that demonstrated a comparable increase in the number of CD3int IL-2Rß+ T cells in the livers of aging BALB/c mice (30).

It has been previously demonstrated that both ß2m-KO and SJL mice have a defect in the number of NK1.1+ T cells in their spleens and thymi (12, 14, 18, 23). This defect of NK1.1+ T cells also exists in the livers of ß2m-KO mice (12, 13) and SJL mice (Fig. 4Go; 27 . The marked diminution in the number of NK1.1+ T cells in ß2m-KO mice can be explained by the absence, or striking reduction, in the expression of CD1, which is believed to be critical for positive selection of these cells; the lack of expression of NK1.1+ by T cells in SJL is genetically linked to the NKR-P1 gene complex (27). The failure of SJL T cells to promptly produce IL-4 in response to anti-CD3 challenge is reportedly controlled by an independent genetic locus (27).

In this study, we found that liver NK1.1+ T cells accumulate in older ß2m-KO and SJL mice. By 7 to 8 mo of age, they have reached a frequency of ~10% of liver MNC. These cells are phenotypically similar to the NK1.1+ T cells of normal mice. They are CD3int, IL-2Rß+, IL-2R{alpha}-, CD44high, and CD62Llow. The ß2m-KO NK1.1+ T cells also preferentially use Vß8 in their TCRs. Furthermore, liver T cells produce IL-4 promptly after injection of anti-CD3, strongly suggesting that liver NK1.1+ T cells from both ß2m-KO and SJL mice resemble NK1.1+ T cells in their cytokine-producing capacity.

The observation that 48% of the NK1.1+ T cells appearing in the liver of old ß2m-KO mice express Vß8, a percent comparable with the percent of Vß8+ cells among C57BL/6 NK1.1+ T cells, is enigmatic, since it had been assumed that the skewed TCR expression on these cells reflected selection by CD1 (4, 5). Similarly, NK1.1+ T cells from older ß2m-KO mice showed reactivity in vitro to L-CD1 but not L cells, implying that they have a degree of specificity for CD1. These results may be explained by the recent report that CD1 has a non-ß2m-associated form as well as ß2m-associated form (17); the former has been reported to be largely expressed in peritoneal B cells (31). If similar expression exists in a compartment in which NK1.1+ T cells undergo selection, it could explain both the reactivity of liver NK1.1+ T cells of ß2m-KO mice with CD1 and their skewed TCR expression.

Indeed, it is interesting to speculate on the possibility that the liver NK1.1+ T cells from ß2m-KO mice may represent a "primitive" cell type, in which positive selection or stimulated expansion may occur not in the thymus but does possibly occur in the peritoneum or liver under the stimulatory influence of B cells expressing non-ß2m-associated CD1.

The liver NK1.1+ T cells found in older ß2m-KO and SJL mice are almost all CD4-CD8-, while NK1.1+ T cells from other mouse strains are composed of both CD4+ and CD4-CD8- T cells. Although no clear functional differences between CD4+ and CD4-CD8-NK1.1+ T cells have been reported, it is possible that selection of CD4+NK1.1+ T cells may have a more stringent dependence upon CD1 expression than that of double-negative NK1.1+ T cells.


   Acknowledgments
 
We thank Cynthia Watson and Jane Hu-Li for their technical assistance and Ms. Shirley Starnes for helpful editorial assistance. L-CD1 cells were kindly provided by Dr. Hangjiong Chen.


   Footnotes
 
1 Masao Murakami is a Fellow of the Long Term Fellowship of the Human Science Fellowship Program (HSFP), Strasbourg, France. Back

2 Address correspondence and reprint requests to Dr. William. E. Paul, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, 10 Center Drive-MSC 1892, Bldg 10, Rm 11N311, Bethesda, MD 20892-1892. Back

3 Abbreviations used in this paper: CD3int, CD3intermediate; ß2m, ß2-microglobulin; KO mice, knockout mice; MNC, mononuclear cells; PE, phycoerythrin. Back

Received for publication July 3, 1997. Accepted for publication November 20, 1997.


   References
Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 References
 

  1. Arase, H., N. Arase, K. Nakagawa, R. A. Good, K. Onoe. 1993. NK1.1+CD4+CD8- thymocytes with specific lymphokine secretion. Eur. J. Immunol. 23:307.[Medline]
  2. Zlotnik, A., D. I. Godfrey, M. Fisher, T. Suda. 1992. Cytokine production by mature and immature CD4-CD8- T cells: {alpha}ß- T cells receptor + CD4-CD8- T cells produce IL-4. J. Immunol. 149:1211.[Abstract]
  3. Yoshimoto, T., W. E. Paul. 1994. CD4pos, NK1.1pos T cells promptly produce interleukin 4 in response to in vivo challenge with anti-CD3. J. Exp. Med. 179:1285.[Abstract/Free Full Text]
  4. MacDonald, H. R.. 1995. NK1.1+ T cell-{alpha}/ß+ cells: new clues to their origin, specificity, and function. J. Exp. Med. 182:63.
  5. Vicari, A. P., A. Zlotnik. 1996. Mouse NK1.1+ T cells, a new family of T cells. Immunol. Today 17:71.[Medline]
  6. Ballas, Z. K., W. Rasmussen. 1990. NK1.1+ thymocytes: adult murine CD4-CD8- thymocytes contain an NK1.1+, CD3+, CD5high, CD44high, TCR-Vß8+ subset. J. Immunol. 145:1039.[Abstract]
  7. Lantz, O., A. Bendelac. 1994. An invariant T cell {alpha} chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4-CD8- T cells in mice and humans. J. Exp. Med. 180:1097.[Abstract/Free Full Text]
  8. Koseki, H., H. Asano, T. Inaba, N. Miyashita, K. Moriwaki, K. F. Lindahl, Y. Mizutani, K. Imai, M. Taniguchi. 1991. Dominant expression of distinctive V{alpha}14+ T-cell antigen receptor {alpha} chain in mice. Proc. Natl. Acad. Sci. USA 88:7518.[Abstract/Free Full Text]
  9. Kakino, Y., R. Kanno, T. Ito, K. Higashino, M. Taniguchi. 1995. Predominant expression of V{alpha}14+TCR{alpha} chain in NK1.1+ T cell populations. Int. Immunol. 7:1157.[Abstract/Free Full Text]
  10. Fowlkers, B. J., A. M. Kruisbeek, H. Ton-That, M. A. Weston, J. E. Coligan, R. H. Schwartz, D. M. Pardoll. 1987. A novel population of T-cell receptor {alpha}ß-bearing thymocytes which predominantly express a single Vß gene family. Nature 329:251.[Medline]
  11. Arase, H., N. Arase, K. Ogasawara, R. Good, K. Onoe. 1992. An NK1.1+CD4+CD8- single-positive thymocyte subpopulation that expresses a highly skewed T-cell antigen receptor Vß8 family. Proc. Natl. Acad. Sci. USA 89:6506.[Abstract/Free Full Text]
  12. Ohteki, T., H. R. MacDonald. 1994. Major histocompatibility complex class I related molecules control the development of CD4+CD8- and CD4-CD8- subsets of natural killer1.1+ T cell receptor-{alpha}/ß+ cells in the liver of mice. J. Exp. Med. 166:577.[Abstract/Free Full Text]
  13. Emoto, M., Y. Emoto., S. H. E. Kaufmann. 1995. IL-4 producing CD4+TCR{alpha}ßint liver lymphocytes: influence of thymus, ß2-microglobulin and NK1.1 expression. Int. Immunol. 7:1729.[Abstract/Free Full Text]
  14. Bix, M., M. Coles, D. Raulet. 1993. Positive selection of Vß8+CD4-CD8- thymocytes by class I molecules expressed by hematopoetic cells. J. Exp. Med. 178:901.[Abstract/Free Full Text]
  15. Bendelac, A., N. Killeen, D. R. Littman, R. H. Schwartz. 1994. A subset of CD4+ thymocytes selected by MHC class I molecules. Science 263:1774.[Abstract/Free Full Text]
  16. Bendelac, A., O. Lantz, M. E. Quimby, J. W. Yewdell, J. R. Bennink, R. R. Brutkiewicz. 1995. CD1 recognition by mouse NK1.1+ T cells. Science 268:863.[Abstract/Free Full Text]
  17. Blumberg, R. S., D. Gerdes, A. Chott, S. A. Porcelli, S. P. Balk. 1995. Structure and function of the CD1 family of MHC-like cell surface proteins. Immunol. Rev. 147:5.[Medline]
  18. Bendelac, A., N. Killeen, D. R. Littman, R. H. Schwartz. 1994. A subset of CD4+ thymocytes selected by MHC class I molecules. Science 263:774.
  19. Coles, M. C., D. H. Raulet. 1994. Class I dependence of the development of CD4+CD8-NK1.1+ thymocytes. J. Exp. Med. 180:395.[Abstract/Free Full Text]
  20. Simley, S. T., M. H. Kaplan, M. J. Grusby. 1997. Immunoglobulin E production in the absence of interleukin-4-secreting CD1-dependent cells. Science 275:977.[Abstract/Free Full Text]
  21. Mediaratta, S. K., W. D. Martin, S. Hong, A. Boesteanu, S. Joyce, L. van Kaer. 1997. CD1d mutant mice are deficient in natural T cells that promptly produce IL-4. Immunity 6:469.[Medline]
  22. Chen, Y. H., N. M. Chiu, M. Mandal, N. Wang, C. R. Wang. 1997. Impaired NK1.1+ T cell development and early IL-4 production in CD1-deficient mice. Immunity 6:459.[Medline]
  23. Yoshimoto, T., A. Bendelac, C. Watson, J. Hu-Li, W. E. Paul. 1996. Role of NK1.1+ T cells in a Th-2 response and immunoglobulin E production. Science 270:1845.[Abstract/Free Full Text]
  24. Yoshimoto, T., A. Bendelac, J. Hu-Li, W. E. Paul. 1995. Defective IgE production by SJL mice is linked to the absence of CD4+NK1.1+ T cells that promptly produce interleukin 4. Proc. Natl. Acad. Sci. USA 92:11931.[Abstract/Free Full Text]
  25. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635.[Medline]
  26. Behlke, M. A., H. S. Chou, K. Huppi, D. Y. Loh. 1986. Murine T-cell receptor mutants with deletions of beta-chain variable region genes. Proc. Natl. Acad. Sci. USA 83:767.[Abstract/Free Full Text]
  27. Beutner, U., P. Launois, T. Ohteki, J. A. Louis, H. R. MacDonald. 1997. Natural killer-like T cells develop in SJL mice despite genetically distinct defects in NK1.1+ expression and in inducible interleukin-4 production. Eur. J. Immunol. 27:928.[Medline]
  28. Chomczynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  29. Iiai, T., H. Watanabe, S. Seki, K. Sugiura, K. Hirokawa, M. Utsuyama, H. Takahashi-Iawanaga, T. Iwanaga, T. Ohteki, T. Abo. 1992. Ontogeny and development of extrathymic T cells in mouse liver. Immunology 77:556.[Medline]
  30. Ohteki, T., R. Okuyama, S. Seki, T. Abo, K. Segiura, A. Kusumi, T. Ohmori, H. Watanabe, K. Kumagai. 1992. Age-dependent increase of thymic T cells in the liver and their appearance in the periphery of older mice. J. Immunol. 149:1562.[Abstract]
  31. Amano, M., S. Strober. 1997. Expression of ß2m-associated and non-associated forms of CD1 on murine B cells. J. Allergy Clin. Immunol. 99:134.[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
H. Y. Kim, M. Pichavant, P. Matangkasombut, Y. I. Koh, P. B. Savage, R. H. DeKruyff, and D. T. Umetsu
The Development of Airway Hyperreactivity in T-bet-Deficient Mice Requires CD1d-Restricted NKT Cells
J. Immunol., March 1, 2009; 182(5): 3252 - 3261.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y. I. Koh, H. Y. Kim, E. H. Meyer, M. Pichavant, O. Akbari, T. Yasumi, P. B. Savage, R. H. DeKruyff, and D. T. Umetsu
Activation of Nonclassical CD1d-Restricted NK T Cells Induces Airway Hyperreactivity in {beta}2-Microglobulin-Deficient Mice
J. Immunol., October 1, 2008; 181(7): 4560 - 4569.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
I. Tsunoda, L.-Q. Kuang, and R. S. Fujinami
Induction of Autoreactive CD8+ Cytotoxic T Cells during Theiler's Murine Encephalomyelitis Virus Infection: Implications for Autoimmunity
J. Virol., November 13, 2002; 76(24): 12834 - 12844.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
T. Dao, M. Exley, W. Z. Mehal, S. M. A. Tahir, S. Snapper, M. Taniguchi, S. P. Balk, and I. N. Crispe
Involvement of CD1 in Peripheral Deletion of T Lymphocytes Is Independent of NK T Cells
J. Immunol., March 1, 2001; 166(5): 3090 - 3097.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. S. Kim, J. Garcia, M. Exley, K. W. Johnson, S. P. Balk, and R. S. Blumberg
Biochemical Characterization of CD1d Expression in the Absence of beta 2-Microglobulin
J. Biol. Chem., April 2, 1999; 274(14): 9289 - 9295.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Angenieux, J. Salamero, D. Fricker, J.-P. Cazenave, B. Goud, D. Hanau, and H. de la Salle
Characterization of CD1e, a Third Type of CD1 Molecule Expressed in Dendritic Cells
J. Biol. Chem., November 22, 2000; 275(48): 37757 - 37764.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murakami, M.
Right arrow Articles by Paul, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murakami, M.
Right arrow Articles by Paul, W. E.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS