|
|
||||||||
Department of Pathology, Harvard Medical School, Boston, MA 02115.
| Abstract |
|---|
|
|
|---|
X 174 and
nuclear protein-keyhole limpet hemocyanin) characterized by a reduction
in number and size of germinal centers and impaired retention of Ag by
follicular dendritic cells. To test the importance of C3 synthesized
locally within the lymphoid compartment during an immune response to
T-dependent Ag, we reconstituted C3-/- mice with
wild-type bone marrow of MHC-identical littermates. Engraftment not
only restored local C3 synthesis in the spleen, but also rescued the
impaired humoral response. The major source of C3 mRNA was
MOMA-2+ macrophages localized within the white pulp areas
of the spleen. Interestingly, C3 expression is apparently regulated as
C3 mRNA was not detected in splenic sections of nonimmune mice.
Furthermore, local C3 synthesis by donor macrophages reversed the
impaired Ag trapping by splenic follicular dendritic cells in
C3-deficient mice. | Introduction |
|---|
|
|
|---|
X 174, and their response was
characterized by a reduction in the number and size of germinal centers
(GCs)3 within splenic follicles (3). The nature of the
defect was found to lie at the B cells, as T cells were equally primed
in both complement-deficient mice and wild-type (WT)
littermates. In addition, mice with a disrupted Cr2 locus, which
results in disruption of both CD21 and CD35, showed a phenotype similar
to the C3-/- and C4-/- animals.
Cr2-/- mice had an impaired humoral response to soluble
T-dependent Ags such as bacteriophage
X 174 (4) or SRBC (5) that was
characterized by a reduction in the number and size of GCs (4). Direct
evidence that activation products of C3 enhance the B cell response has
been demonstrated by coupling of one, two, or three copies of C3d to
hen egg lysozyme (HEL) using a recombinant approach (6). HEL bearing
one, two, or three copies of C3d was 100-, 1,000-, and 10,000-fold more
immunogenic, respectively, than HEL alone, showing an inverse
correlation between the numbers of copies of C3d per HEL and the amount
of soluble HEL required for induction of a humoral response.
These results raise the question of what is the source of C3 for Ag
attachment. While the primary source of C3 in circulation is the liver
(7), extrahepatic synthesis has been reported and a variety of cell
types including monocytic cells (8), polymorphonuclear leukocytes (9),
umbilical vein endothelial cells (10), pulmonary alveolar type II
epithelial cells (11), intestinal (12) and proximal tubular epithelial
cells (13, 14), skin fibroblasts (15), epidermal keratinocytes (16),
and astroglioma cells (17) synthesize and secrete C3. In the spleen,
local C3 synthesis has been described in rat-into-mouse bone marrow
(BM) chimeras, where rat C3 was found in the spleen of these chimeric
mice (18). Synthesis of C3 in various organs can be directly
up-regulated by cytokines during an inflammatory response. For example,
IFN-
released by activated T cells can induce macrophages to secrete
proinflammatory cytokines, e.g., IL-1
and IL-6, that can up-regulate
the synthesis of C3 and other complement components and acute phase
proteins (19, 20). In addition, IFN-
can induce C3 synthesis
directly (21) as well as stabilize C3 mRNA (22). In the human kidney,
proximal tubular epithelial cells synthesize C3 in inflammatory disease
such as systemic lupus erythematosus (23). In normal mouse kidney, C3
mRNA levels are low, however, following LPS challenge C3 expression is
increased in cortical tubular epithelium (24). In aged (18 wk)
MRL/lpr/lpr mice, which develop lupus-like nephritis, C3
message was increased and localized to perivascular inflammatory cells
surrounding medium size arteries (24).
To investigate the role of C3 produced locally at lymphatic sites during an immune response to T-dependent Ag, we took advantage of recently developed mice in which the C3 locus was disrupted by gene targeting (25). C3-/- mice were reconstituted with BM of MHC-matched littermates. Engraftment not only restored local C3 synthesis but rescued both the impaired humoral response and retention of soluble T-dependent Ags by follicular dendritic cells (FDCs). Analysis of splenic sections of both immunized C3 BM chimeras and WT animals demonstrated a dramatic up-regulation of C3 synthesis by macrophages within the white pulp areas. Expression of C3 message was dependent on immunization with Ag as C3 mRNA was not found in nonimmune C3 BM chimeras or WT controls. We provide evidence that C3 synthesized by macrophages locally within the splenic lymphoid compartment can contribute sufficient C3 for complement enhancement of the humoral response.
| Materials and Methods |
|---|
|
|
|---|
C3-/- mice were constructed by gene targeting by homologous recombination in embryonic stem cells (25). BM cells of WT littermates were isolated by flushing femurs and tibias with cold medium (DMEM supplemented with 1% bovine calf serum) using a 26-gauge needle, followed by depletion of erythrocytes with lysis buffer (0.15 M NH4Cl, 10 mM KHCO3, and 0.1 mM EDTA) as described earlier (4). In brief, 5 x 106 BM cells were injected i.v. into lethally irradiated (2 x 650 rad) 6- to 8-wk-old C3-/--deficient mice. Mice were kept under barrier isolation conditions. Studies were performed according to institutional guidelines for animal use and care.
Immunization protocol and measurement of the immunologic response
C3-/- mice, C3 BM chimeras (4 to 6 wk post-transplantation) and WT littermates were immunized i.v. with 50 µg of soluble NP-KLH and challenged with an equal dose 3 wk later. Serum samples were taken each week after primary and secondary immunization and specific Ab production to NP was determined by ELISA according to standard protocols.
Measurement of serum C3
Analysis of C3 protein in the serum was performed by ELISA (sensitive to about 5 ng/ml) using a rat mAb to mouse C3 to capture C3 and a polyclonal rabbit anti-mouse C3 serum (Cappel, Organon Teknika Corp., West Chester, PA) for detection as described earlier (3).
Immunohistochemistry
Tissue sections were prepared for immunohistology as described (4). For two-color immunolabeling, splenic tissues were incubated with a panel of purified mAbs that recognize different monocyte-macrophage determinants such as MOMA-2 (26), ERTR-9 (27), MOMA-1 (28) (kindly provided by Dr. G. Kraal, Free University, Amsterdam, the Netherlands), 2F8 (29) (kindly provided by Dr. Siamon Gordon, University of Oxford, Oxford, U.K.), and 4F80 (PharMingen, San Diego, CA) followed by a sequential incubation step with biotinylated rabbit anti-rat IgG (Vector Laboratories, Burlingame, CA) and streptavidin-alkaline phosphatase (AP) (ExtrAvidin-AP, Sigma, St. Louis, MO). Tissue sections were counterstained with peanut agglutinin (PNA, EY Laboratory, San Mateo, CA) coupled to horseradish peroxidase (HRP). Three-color immunolabeling of splenic tissues was performed using either biotinylated mC3 mAbs, biotinylated FDC M-1 mAb, or biotinylated IgG-matched isotype control followed by an incubation step with streptavidin-AP. Labeled Ag (NP-BSA-biotin) was visualized using streptavidin-AP. Tissue sections were counterstained with PNA-conjugated HRP. Bound AP and HRP were then visualized using Fast Blue BB (Sigma) and 3-aminoethylcarbazole (Sigma, red color), respectively. Next slides were incubated in 0.2 M HCl for 5 min at room temperature to terminate the enzymatic reactions that had taken place previously without displacing the precipitates produced by HRP and AP. After washing once in water and PBS, sections were incubated consecutively with a FITC-labeled CD3 mAb (PharMingen) followed by an anti-FITC mAb (Boehringer Mannheim, Indianapolis, IN) coupled to AP. CD3-positive cells were visualized with Fast Red TR/Naphthol AS-MX (Sigma, pink color).
Isolation of RNA and PCR amplification of cDNA specific for C3 of total splenocytes purified MOMA-2+ splenic macrophages and B220+ splenic B cells
C3-/- mice, C3 BM chimeras, and WT mice were immunized two times with 50 µg of soluble NP-KLH as described, and on day 7 after the second immunization spleens were taken and splenic mononuclear cells were isolated as described (3). Splenocytes were incubated with either MOMA-2 mAbs or B220 mAbs (PharMingen), and cells were purified by positive magnetic immunoselection using goat anti-rat IgG-coated beads (Dynabeads M 450, Dynal, Oslo, Norway) at a final concentration of approximately 1 x 106 beads/1 x 106 cells. Purity of cells (macrophages 95% and B cells >97%) was confirmed by flow cytometry using mAbs specific for Mac-1 and CD19, respectively. Total cellular RNA was isolated from total splenocytes, purified MOMA-2+ macrophages, and B220+ B cells using Trizol reagent (Life Technologies, Gaithersburg, MD) according to the manufacturers protocol. Equal amounts of total RNA, quantified at 260 nm, were reverse transcribed into cDNA by first strand synthesis employing SuperScript preamplification system for first-strand cDNA synthesis (Life Technologies). The cDNA was directly amplified on a thermocycler (Amplitron II, Barnstead/Thermolyne, Dubuque, IA) using Taq DNA polymerase (Promega, Madison, WI) and oligonucleotide primer pairs specific for mC3 (sense: GGCTGACTCTGTGTGGGT; antisense: TCTCTGGTTCTTTCAACTCT) and mG3PDH (glyceraldehyde 3-phosphate dehydrogenase control amplimer set, Clontech, Palo Alto, CA; sense: TGAAGGTGTGAACGGATTTGGC; sense: CATGTAGGCCATGAGGTCCAC CAC). The amplification profile involved 40 cycles of denaturation at 95°C for 1 min, primer annealing at 52°C for 1 min, and primer extension at 72°C for 2 min. Aliquots of PCR-generated products were fractionated on 0.9% ethidium bromide-agarose gels and validated by the predicted size.
Generation of the mC3 RNA probe and in situ hybridization
The pBSTmC31-442 plasmid was constructed by cloning the cDNA of mC3 (30) into the NotI site of the pBluescript II KS+/- vector (Stratagene, La Jolla, CA) at position 670, digestion with KpnI (KpnI cuts the mC3 cDNA at position 442 and the pBluescript II KS+/- vector at position 759) and subsequent religation, leaving the first 442 bp of the ß-chain of mC3 cDNA in the plasmid. Antisense digoxigenin (DIG)-labeled mC3 transcripts were produced by linearizing the pBSTmC31-442 plasmid with NotI and transcribing with a T3 RNA polymerase. DIG-labeled sense transcripts were produced by linearizing the plasmid with EcoRI and transcribing with T7 RNA polymerase. DIG-labeled RNA probes were produced according to the instructions of the manufacturer (Genius System, Boehringer-Mannheim). RNase-free tissue sections were prepared and in situ hybridization was performed as described (31). To detect hybridized DIG-labeled RNA, tissues were preincubated in 2% rabbit serum in buffer 1 (100 mM Tris-HCL, pH 7.5, and 150 mM NaCl) for 20 min, and then incubated with sheep anti-DIG AP F(ab')2 (Boehringer-Mannheim), diluted 1:500 in buffer 1 containing rabbit serum, for 1 hr. The slides were rinsed once in buffer 1, followed by a 10-min rinse in buffer 2 (100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 50 mM MgCl2 (pH 9.5)), and finally in the substrate solution (containing 450 µg/ml of nitro blue tetrazolium salt and 175 µg/ml of 5-bromo-4-chloro-3-indolylphosphate toluidine salt (Boehringer Mannheim), and 1.25 mM levamisole (Sigma) in buffer 2 was added to the tissue. After sufficient substrate development that occurred during 16 to 48 h, slides were washed rigorously in Tris-EDTA (10 mM Tris-HCl (pH 8.0) and 1 mM EDTA (pH 8.0)), counterstained with methyl green (Sigma) according to standard protocols, and mounted with Permount. Cells producing C3 mRNA within the white pulp of the spleen detected by in situ hybridization were counted and the average number of positive cells per white pulp was calculated. Each symbol represents one individual mouse analyzed at the time point indicated.
Statistics
Students t test was used to evaluate differences between the Ab and GC responses of C3-/- vs WT controls and C3 BM chimeras vs WT controls. Differences were considered statistically significant when p < 0.05.
| Results |
|---|
|
|
|---|
To determine whether BM graft would rescue the impaired response
of C3-/- mice, deficient mice were lethally irradiated
and subsequently engrafted with BM of WT MHC-matched littermates. Four
to six weeks after transplant, chimeric mice were immunized with 50
µg of soluble NP-KLH i.v. at days 0 and 21 and were bled each week
following primary immunization. A total of 50 µg soluble NP-KLH was
given i.v. in the absence of adjuvants to avoid circumventing a role
for complement in the humoral response. As reported previously (3),
C3-/- mice fail to make a normal Ab response to
T-dependent Ags. C3 BM chimeras made a normal primary and secondary
immune response (Fig. 1
). Numbers of
germinal centers (GCs) (Table I
) were
comparable between chimeric mice and WT controls 7 days following
secondary immunization, indicating that the impaired immune response to
T-dependent Ag in C3-/- mice can be reconstituted by
engraftment with WT BM.
|
|
We used in situ hybridization, immunohistochemistry, and
reverse-transcribed PCR (RT-PCR) to investigate the location and the
type of C3-producing cells in the spleen. To detect cells expressing C3
mRNA DIG-labeled antisense and sense RNA probes specific for mC3 were
developed. When hybridized to splenic tissues from immunized WT mice,
the antisense C3 RNA probe strongly labeled cells within the white pulp
of the spleen (Fig. 2
a). As
expected, the C3 sense RNA probe did not hybridize (data not shown). In
splenic sections of immunized WT mice, cells expressing C3 message were
equally distributed within the T and B cell zone of the white pulp
(Fig. 2
a); however, not all cells appeared to express the
same level of C3 mRNA. A panel of mAbs that recognize different
monocyte-macrophage subsets (MOMA-1, MOMA-2, 2F8, 4F80, and ERTO-9)
(26, 27, 28, 29) was used to identify the cells producing C3. From the mAbs
used, only cells stained by MOMA-2 (Fig. 2
a) colocalize with
cells expressing C3 message (Fig. 2
d) within the T and B
cell zone of the splenic white pulp. MOMA-2 mAb has previously been
described to stain predominantly macrophages within the splenic white
pulp and the medulla of lymph nodes (26). As expected, the C3 antisense
RNA probe did not hybridize to splenic tissues of immunized
C3-/- mice (Fig. 2
b), although normal numbers
of MOMA-2+ macrophages were present (Fig. 2
e).
Interestingly, in the immunized C3 BM chimeras, C3-producing
MOMA-2+ macrophages were clustered within the follicles in
or near PNA+ GCs (Fig. 2
, c and f) in
contrast to that observed within WT mice.
|
|
|
Splenic tissues from WT, C3-/- mice, and C3 BM
chimeras were analyzed by three-color immunohistochemistry for the
presence of C3 (blue color) on day 7 after secondary immunization (Fig. 5
, a, b, and
c). Histologic sections were
counterstained with PNA (a marker for GC B cells) (crimson) and CD3
(distinguishes the T cell zone) (pink). Interestingly, dense deposits
of C3 were identified in the FDC-rich region of the GC of immune WT
mice (Fig. 5
a). Less intense staining for C3 was detected in
a dendritic pattern throughout the white pulp. As expected, C3 was not
detected in splenic tissues of immunized C3-/- mice (Fig. 5
b). C3 staining of immune C3 BM chimeras was similar but
less intense than observed for WT mice (Fig. 5
c).
|
| Discussion |
|---|
|
|
|---|
X 174 (2)
or NP-KLH (Fig. 1
Local C3 synthesis appears to be regulated, since C3 mRNA was not
detectable in nonimmune animals by either in situ hybridization (data
not shown) or by RT-PCR (Fig. 3
). However, immunization with a
T-dependent Ag induced detectable levels of C3 mRNA. C3 in the
peripheral blood of C3 chimeras could be observed following primary and
secondary immunization with soluble NP-KLH, indicating that bone
marrow-derived cells contributed to C3 in the peripheral blood.
Interestingly, C3 protein in the circulation (Fig. 4
a) and
C3 mRNA (Fig. 4
b) in spleens of C3 BM chimeras was higher
after the secondary than primary immunization. IFN-
released by
activated T cells can induce C3 synthesis (21) as well as stabilize C3
mRNA (22), and this would provide potential mechanisms for increased
synthesis of C3 by macrophages. Furthermore, IFN-
induces
macrophages to produce IL-6 and IL-1
, which enhances transcription
of C3 (19, 20). Support for a critical role of IFN-
in the
regulation of local C3 synthesis in the spleen comes from the
observation that more IFN-
-producing cells were found at day 3
following secondary immunization than on day 3 following primary
immunization (data not shown). Other cytokines that could potentially
regulate C3 expression are TNF-
, IL-1ß, IL-8 (35), and TGF-ß
(36). Evidence that specific immune events can induce up-regulation of
BM-derived cells to synthesize C3 has been reported. For example,
BM-derived cells can secrete significant levels of C3 locally following
transplantation, during a period characterized by inflammatory stimuli,
including graft-vs-host disease and infection (37). However, BM-derived
C3 was not detectable 6 wk following transplantation.
Previous studies have shown that transient depletion of C3 with
cobra venom factor (32, 33) or with anti-C3 mAb (38) inhibits
localization and retention of Ag on the surface of splenic FDCs. We
found that BM-derived cells can provide sufficient C3 for enhancement
of FDC uptake of Ag (Fig. 5
). Interestingly, Ag uptake by FDCs occurred
although the C3 BM chimeras had low levels of C3 (less than 20 ng/ml)
in the peripheral blood. One function of local C3 synthesis would be to
provide an increased concentration of C3 for covalent attachment to Ag
within the lymphoid compartment. Ag localization to FDCs is not a
passive process but is thought to involve active transport to the
surface of the FDC, a process that is delayed until the onset of Ab
production after immunization (39). In our model, sufficient Ag
retention by FDCs surfaces occurred despite low levels of C3 in the
circulation of C3 BM chimeras. A subset of homozygous C3-deficient
humans has been described that had a similar phenotype as our C3 BM
chimeras. Macrophages of these patients produced approximately 25% of
the normal rate of C3 when cultured in vitro (40) and serum contained
<1% of normal C3 concentration. Interestingly, their Ab response to
routine immunization was normal (41).
In summary, we have found that engraftment of C3-/- mice with WT BM can reconstitute the impaired immune response in C3-deficient mice. MOMA-2+ macrophages within the white pulp of the spleen were identified as the major cell type that produced C3, and synthesis appears to be regulated since C3 mRNA was not detected in nonimmune animals. Engraftment of WT BM into C3-/- mice also reversed the impaired trapping of Ag by FDCs in the spleen of C3-/- mice. Thus, our results demonstrate that C3 synthesized by macrophages locally within lymphoid tissues can contribute sufficient C3 for complement enhancement of the humoral response.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Michael C. Carroll, Department of Pathology, Harvard Medical School, Building D-2, Room 533, 200 Longwood Ave., Boston, MA 02115. ![]()
3 Abbreviations used in this paper: GC, germinal centers; WT, wild-type; HEL, hen egg lysozyme; PNA, peanut agglutinin; HRP, horseradish peroxidase; AP, alkaline phosphatase; DIG, digoxigenin; FDC, follicular dendritic cells; RT-PCR, reverse-transcribed PCR; NP, nuclear protein; KLH, keyhole limpet hemocyanin. ![]()
Received for publication July 23, 1997. Accepted for publication November 18, 1997.
| References |
|---|
|
|
|---|
and IL-1. J. Immunol. 144:3835.[Abstract]
enhances the biosynthesis of complement C3 and factor B by human kidney proximal tubular epithelial cells in vitro. Mol. Immunol. 33:847.[Medline]
and TNF-
through different pathways. J. Invest. Dermatol. 108:62.[Medline]
activates multiple pathways to regulate the expression of the genes for major histocompatibility class II I-Aß, tumor necrosis factor and complement component C3 in mouse macrophages. Eur. J. Immunol. 19:1103.[Medline]
up-regulates expression of complement components C3 and C4 by stabilization of mRNA. J. Immunol. 156:4429.[Abstract]
This article has been cited by other articles:
![]() |
K. Li, K. J. Anderson, Q. Peng, A. Noble, B. Lu, A. P. Kelly, N. Wang, S. H. Sacks, and W. Zhou Cyclic AMP plays a critical role in C3a-receptor-mediated regulation of dendritic cells in antigen uptake and T-cell stimulation Blood, December 15, 2008; 112(13): 5084 - 5094. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Brockman, A. Verschoor, J. Zhu, M. C. Carroll, and D. M. Knipe Optimal Long-Term Humoral Responses to Replication-Defective Herpes Simplex Virus Require CD21/CD35 Complement Receptor Expression on Stromal Cells J. Virol., July 15, 2006; 80(14): 7111 - 7117. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Peng, K. Li, H. Patel, S. H. Sacks, and W. Zhou Dendritic Cell Synthesis of C3 Is Required for Full T Cell Activation and Development of a Th1 Phenotype J. Immunol., March 15, 2006; 176(6): 3330 - 3341. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Farrar, W. Zhou, T. Lin, and S. H. Sacks Local extravascular pool of C3 is a determinant of postischemic acute renal failure FASEB J, February 1, 2006; 20(2): 217 - 226. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Test, J. K. Mitsuyoshi, and Y. Hu Depletion of Complement Has Distinct Effects on the Primary and Secondary Antibody Responses to a Conjugate of Pneumococcal Serotype 14 Capsular Polysaccharide and a T-Cell-Dependent Protein Carrier Infect. Immun., January 1, 2005; 73(1): 277 - 286. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Whipple, R. S. Shanahan, A. H. Ditto, R. P. Taylor, and M. A. Lindorfer Analyses of the In Vivo Trafficking of Stoichiometric Doses of an Anti-Complement Receptor 1/2 Monoclonal Antibody Infused Intravenously in Mice J. Immunol., August 15, 2004; 173(4): 2297 - 2306. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Verschoor, M. A. Brockman, M. Gadjeva, D. M. Knipe, and M. C. Carroll Myeloid C3 Determines Induction of Humoral Responses to Peripheral Herpes Simplex Virus Infection J. Immunol., November 15, 2003; 171(10): 5363 - 5371. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Banda, D. M. Kraus, M. Muggli, A. Bendele, V. M. Holers, and W. P. Arend Prevention of Collagen-Induced Arthritis in Mice Transgenic for the Complement Inhibitor Complement Receptor 1-Related Gene/Protein y J. Immunol., August 15, 2003; 171(4): 2109 - 2115. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Mabbott, J. Young, I. McConnell, and M. E. Bruce Follicular Dendritic Cell Dedifferentiation by Treatment with an Inhibitor of the Lymphotoxin Pathway Dramatically Reduces Scrapie Susceptibility J. Virol., June 15, 2003; 77(12): 6845 - 6854. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Pozdnyakova, H.-K. Guttormsen, F. N. Lalani, M. C. Carroll, and D. L. Kasper Impaired Antibody Response to Group B Streptococcal Type III Capsular Polysaccharide in C3- and Complement Receptor 2-Deficient Mice J. Immunol., January 1, 2003; 170(1): 84 - 90. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Reid, S. Woodcock, A. Shimabukuro-Vornhagen, W. G. Austen Jr., L. Kobzik, M. Zhang, H. B. Hechtman, F. D. Moore Jr., and M. C. Carroll Functional Activity of Natural Antibody is Altered in Cr2-Deficient Mice J. Immunol., November 15, 2002; 169(10): 5433 - 5440. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gadjeva, A. Verschoor, M. A. Brockman, H. Jezak, L. M. Shen, D. M. Knipe, and M. C. Carroll Macrophage-Derived Complement Component C4 Can Restore Humoral Immunity in C4-Deficient Mice J. Immunol., November 15, 2002; 169(10): 5489 - 5495. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Vinci, N. J. Lynch, C. Duponchel, T.-M. Lebastard, G. Milon, C. Stover, W. Schwaeble, and M. Tosi In Vivo Biosynthesis of Endogenous and of Human C1 Inhibitor in Transgenic Mice: Tissue Distribution and Colocalization of Their Expression J. Immunol., November 15, 2002; 169(10): 5948 - 5954. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Barrington, O. Pozdnyakova, M. R. Zafari, C. D. Benjamin, and M. C. Carroll B Lymphocyte Memory: Role of Stromal Cell Complement and Fc{gamma}RIIB Receptors J. Exp. Med., November 4, 2002; 196(9): 1189 - 1200. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Verschoor, M. A. Brockman, D. M. Knipe, and M. C. Carroll Cutting Edge: Myeloid Complement C3 Enhances the Humoral Response To Peripheral Viral Infection J. Immunol., September 1, 2001; 167(5): 2446 - 2451. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gomez-Guerrero, N. Duque, M. T. Casado, C. Pastor, J. Blanco, F. Mampaso, F. Vivanco, and J. Egido Administration of IgG Fc Fragments Prevents Glomerular Injury in Experimental Immune Complex Nephritis J. Immunol., February 15, 2000; 164(4): 2092 - 2101. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kopf, S. Herren, M. V. Wiles, M. B. Pepys, and M. H. Kosco-Vilbois Interleukin 6 Influences Germinal Center Development and Antibody Production via a Contribution of C3 Complement Component J. Exp. Med., November 16, 1998; 188(10): 1895 - 1906. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |