|
|
||||||||
CUTTING EDGE |


Departments of
*
Medicine,
Pathology, and
Preventive Medicine, University of Iowa College of Medicine, Iowa City, IA 52242 and
§
the Veterans Affairs Medical Center, Iowa City, IA 52246.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 mice (The Jackson Laboratory, Bar Harbor, ME) were sensitized to Schistosoma mansoni eggs (5000, i.p.) and challenged with schistosome egg Ag (SEA, 10 µg intranasal) (8). These eggs were purified from the livers of infected hamsters (9). SEA was prepared by homogenization and concentration of eggs (10).
Oligonucleotides
The CpG ODN consisted of 20 bases containing two CpG motifs (TCCATGACGTTCCTGACGTT). The control ODN was identical except that the CpG motifs are rearranged (TCCATGAGCTTCCTGAGTCT). ODN were produced by Oligos etc. (Wilsonville, OR) in a Good Manufacturing Practice facility and have undetectable levels of LPS. ODN (30 µg) were administered by i.p. injection.
Whole lung lavage
Following euthanasia, the trachea was cannulated and saline washings were collected. The lavages were processed for cell counts, and the supernatants were saved for further analysis.
Histopathologic examination
At the time of sacrifice, lungs were excised, fixed, and stained with hematoxylin and eosin.
Physiology
Airway hyperreactivity was measured by methacholine-induced airflow obstruction. Mice were placed into whole body plethysmographs (Buxco Electronics, Inc., Troy, NY), interfaced with computers using differential pressure transducers. Measurement was made of respiratory rate, tidal volume, and enhanced pause. Airway resistance is expressed as: Penh = [(Te/0.3 Tr) - 1] x [2Pef/3Pif], where Penh = enhanced pause, Te = expiratory time (seconds), Tr = relaxation time (seconds), Pef = peak expiratory flow (milliliters), and Pif = peak inspiratory flow (milliliters/second) (11). Increasing doses of methacholine were administered by nebulization (for 150 s), and Penh were calculated over the subsequent 3 min.
Cytokines
Murine IL-4, IL-12, and IFN-
were measured using a sandwich
ELISA (R&D, Minneapolis, MN). The IL-12 ELISA used a capture Ab
specific to the p70 heterodimer.
Measurement of IgE
Total serum IgE was measured using sandwich ELISA. B1E3 (rat IgG anti-murine IgE mAb) was the capture reagent, and biotin-conjugated EM95 (noncompeting rat IgG anti-murine IgE mAb) was used as detection reagent along with alkaline phosphatase-Streptavidin. Affinity-purified monoclonal IgE anti-TNP (A3B1) was used as a standard.
Statistics
Analysis of time course and dose-response curves was performed using ANOVA with post hoc Tukey tests. Pairs of groups were compared using Students t test. P values for significance were set at 0.05. Values for all measurements are expressed as the mean ± SEM. Statistical analysis was conducted using Systat 5 for the Macintosh.
| Results |
|---|
|
|
|---|
|
|
|
CpG ODN also affected lung cytokine release in this model. We first
examined the effects of CpG and control ODN alone and found that
administration of ODN did not affect lung lavage fluid levels of IL-4,
IL-12, or IFN-
at 1 or at 14 days after administration. IL-4 was
significantly increased in egg/SEA-treated mice relative to controls;
this was prevented by pretreatment with CpG ODN but with not control
ODN (Fig. 4
A). The IL-4
concentrations in the CpG ODN-treated mice were still elevated above
those of control mice. The loss of allergen-induced IL-4 expression in
the CpG-treated mice suggests that the Th2 response to allergen
exposure was abrogated. We next examined whether CpG treatment would
generate an Ag-induced Th1 response. Indeed, we found that both IFN-
and IL-12, Th1 cytokines, were induced by allergen inhalation in mice
primed with the allergen plus CpG ODN (Fig. 4
, B and
C); the induction of these cytokines was significant
(p < 0.05) relative to all other groups. These
studies indicate that if an Ag is encountered in the context of CpG
DNA, subsequent exposure to the Ag in the lung will lead to a Th1
rather than a Th2 response.
|
|
and IL-12 were induced in the mice treated with CpG ODN but not in the
mice treated with schistosome eggs and SEA alone, suggesting that
induction of Th1-type cytokine expression may be responsible for
preventing the eosinophilic airway inflammation. However,
the kinetics of expression of these two Th1 cytokines are quite
differentplasma IFN-
levels returned to baseline within 24 h
whereas IL-12 levels remained persistently elevated for >8 days
following a single injection of CpG ODN (data not shown). CpG ODN is
also effective in diminishing the eosinophilic response to
Ag even when given following initial sensitization. | Discussion |
|---|
|
|
|---|
and IL-12; and Th2, which are associated with a release of IL-4
and IL-5 (12). Bacterial infections are generally a strong trigger for
Th1 responses. Asthma is thought to result from the inappropriate
generation of Th2 responses to environmental Ags, resulting in acute
pulmonary inflammation (5, 13). The commitment to a Th1 or Th2 response is determined by a variety of factors, including the cytokine milieu in which the Ag is initially presented to specific lymphocytes. If an Ag is initially encountered with Th1 cytokines, then an Ag-driven Th1 response will likely develop. Recent epidemiologic studies suggest that childhood mycobacterial infections protect against later development of atopic conditions, including asthma (6). The incidence of asthma has been rising in industrialized countries in parallel with a decline in the incidence of childhood bacterial and mycobacterial infections (7). These data suggest the possibility that these infections induce a Th1 response and that in their absence, a default to a Th2 response may develop. In societies where childhood infection rates are low, a predisposition to Th2 responses may cause environmental allergies.
We demonstrate here that systemic administration of CpG DNA causes a Th1 rather than a Th2 immune response to schistosome eggs. This raises the possibility that childhood exposure to CpG DNA may restore a Th1 immune influence and reduce the incidence of asthma. Our studies also have implications for treatment of patients previously sensitized to allergens. Current immunotherapy protocols for asthma have little therapeutic effect (14), although immunotherapy can slightly reduce symptoms in selected patients with atopic conditions (15). The beneficial effects of immunotherapy are thought to be at least partly due to induction of Th1 cytokines (16). Our data demonstrating the prevention of eosinophilic airway inflammation in animals already sensitized to schistosome eggs suggest that the potent Th1-like effects of CpG ODN may promote immune desensitization to known allergens. The use of CpG ODN as an adjuvant may dramatically improve the utility of immunotherapy in asthma.
In some models of atopic disease, IL-12 administration can also lead to
reduced IL-4 and increased IFN-
in airway fluid with resultant
improvements in eosinophilia (17). However, the use of ODN
to protect against eosinophilic inflammation or atopic
disease carries several advantages over IL-12 administration. Clinical
trials of IL-12 have been associated with substantial morbidity and
even mortality (18). Moreover, in some animal models, IL-12
administration can actually worsen eosinophilic
inflammation (19). Furthermore, the Th1-promoting effect of IL-12 may
be insufficient to suppress a Th2 recall response (20), whereas CpG ODN
can prevent airway eosinophilia even after sensitization.
The apparent superior Th1 effect of CpG ODN may be due to the fact that
it triggers the sustained endogenous production of IL-12 for at least 8
days, while exogenous IL-12 has a relatively short half-life. Finally,
oligonucleotides are cheaper to formulate and far more stable than
cytokines. CpG ODN may be preferable to the therapeutic use of
cytokines, such as IL-12, for reasons of cost, stability, safety, and
prolonged expression of induced cytokines. These current studies
support the hypothesis that induction of Th1 cytokines by CpG ODN
protects against eosinophilic inflammation in asthma, and
they suggest that CpG ODN may be an effective novel method of inducing
protection against atopic disorders.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Joel N. Kline, Division of Pulmonary Medicine, University of Iowa Hospitals and Clinics, C33GH, Iowa City, IA 52242. E-mail address: ![]()
3 Abbreviations used in this paper: ODN, oligodeoxynucleotide; SEA, soluble schistosome egg antigen. ![]()
Received for publication November 26, 1997. Accepted for publication January 14, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Constabel, M. V. Stankov, C. Hartwig, T. Tschernig, and G. M. N. Behrens Impaired Lung Dendritic Cell Migration and T Cell Stimulation Induced by Immunostimulatory Oligonucleotides Contribute to Reduced Allergic Airway Inflammation J. Immunol., September 1, 2009; 183(5): 3443 - 3453. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kim, J. Y. Yang, K. Lee, K. H. Oh, M. Gi, J. M. Kim, D. J. Paik, S. Hong, and J. Youn Bacillus subtilis-specific poly-{gamma}-glutamic acid regulates development pathways of naive CD4+ T cells through antigen-presenting cell-dependent and -independent mechanisms Int. Immunol., August 1, 2009; 21(8): 977 - 990. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kool, M. van Nimwegen, M. A. M. Willart, F. Muskens, L. Boon, J. J. Smit, A. Coyle, B. E. Clausen, H. C. Hoogsteden, B. N. Lambrecht, et al. An Anti-Inflammatory Role for Plasmacytoid Dendritic Cells in Allergic Airway Inflammation J. Immunol., July 15, 2009; 183(2): 1074 - 1082. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mansson and L.-O. Cardell Role of atopic status in Toll-like receptor (TLR)7- and TLR9-mediated activation of human eosinophils J. Leukoc. Biol., April 1, 2009; 85(4): 719 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Tliba, Y. Amrani, and R. A. Panettieri Jr Is Airway Smooth Muscle the "Missing Link" Modulating Airway Inflammation in Asthma? Chest, January 1, 2008; 133(1): 236 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. W. J. Schroder and M. Arditi IEIIS Meeting minireview: The role of innate immunity in the pathogenesis of asthma: evidence for the involvement of Toll-like receptor signaling Innate Immunity, October 1, 2007; 13(5): 305 - 312. [Abstract] [PDF] |
||||
![]() |
U. Bhan, N. W. Lukacs, J. J. Osterholzer, M. W. Newstead, X. Zeng, T. A. Moore, T. R. McMillan, A. M. Krieg, S. Akira, and T. J. Standiford TLR9 Is Required for Protective Innate Immunity in Gram-Negative Bacterial Pneumonia: Role of Dendritic Cells J. Immunol., September 15, 2007; 179(6): 3937 - 3946. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Kline Eat Dirt: CpG DNA and Immunomodulation of Asthma Proceedings of the ATS, July 1, 2007; 4(3): 283 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Camateros, M. Tamaoka, M. Hassan, R. Marino, J. Moisan, D. Marion, M.-C. Guiot, J. G. Martin, and D. Radzioch Chronic Asthma-induced Airway Remodeling Is Prevented by Toll-like Receptor-7/8 Ligand S28463 Am. J. Respir. Crit. Care Med., June 15, 2007; 175(12): 1241 - 1249. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Flores, K. A. Diggs, L. M. Tait, and P. A. Morel IFN-{gamma} Negatively Regulates CpG-Induced IL-10 in Bone Marrow-Derived Dendritic Cells J. Immunol., January 1, 2007; 178(1): 211 - 218. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Inoue and Y. Aramaki Suppression of Skin Lesions by Transdermal Application of CpG-Oligodeoxynucleotides in NC/Nga Mice, a Model of Human Atopic Dermatitis J. Immunol., January 1, 2007; 178(1): 584 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Gauvreau, E. M. Hessel, L.-P. Boulet, R. L. Coffman, and P. M. O'Byrne Immunostimulatory Sequences Regulate Interferon-inducible Genes but not Allergic Airway Responses Am. J. Respir. Crit. Care Med., July 1, 2006; 174(1): 15 - 20. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Moisan, P. Camateros, T. Thuraisingam, D. Marion, H. Koohsari, P. Martin, M. L. Boghdady, A. Ding, M. Gaestel, M. C. Guiot, et al. TLR7 ligand prevents allergen-induced airway hyperresponsiveness and eosinophilia in allergic asthma by a MYD88-dependent and MK2-independent pathway Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L987 - L995. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bergeron and L.-P. Boulet Structural changes in airway diseases: characteristics, mechanisms, consequences, and pharmacologic modulation. Chest, April 1, 2006; 129(4): 1068 - 1087. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Leino, H. T. Alenius, N. Fyhrquist-Vanni, H. J. Wolff, K. E. Reijula, E.-L. Hintikka, M. S. Salkinoja-Salonen, T. Haahtela, and M. J. Makela Intranasal Exposure to Stachybotrys chartarum Enhances Airway Inflammation in Allergic Mice Am. J. Respir. Crit. Care Med., March 1, 2006; 173(5): 512 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Hessel, M. Chu, J. O. Lizcano, B. Chang, N. Herman, S. A. Kell, M. Wills-Karp, and R. L. Coffman Immunostimulatory oligonucleotides block allergic airway inflammation by inhibiting Th2 cell activation and IgE-mediated cytokine induction J. Exp. Med., December 5, 2005; 202(11): 1563 - 1573. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang-Hoover, P. Finn, and J. Stein-Streilein Modulation of Ovalbumin-Induced Airway Inflammation and Hyperreactivity by Tolerogenic APC J. Immunol., December 1, 2005; 175(11): 7117 - 7124. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fedulov, E. Silverman, Y. Xiang, A. Leme, and L. Kobzik Immunostimulatory CpG Oligonucleotides Abrogate Allergic Susceptibility in a Murine Model of Maternal Asthma Transmission J. Immunol., October 1, 2005; 175(7): 4292 - 4300. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Weigt, C. Nassenstein, T. Tschernig, P. F. Muhlradt, N. Krug, and A. Braun Efficacy of Macrophage-activating Lipopeptide-2 Combined with Interferon-{gamma} in a Murine Asthma Model Am. J. Respir. Crit. Care Med., September 1, 2005; 172(5): 566 - 572. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Gordon, F. Li, A. Nayyar, J. Xiang, and X. Zhang CD8{alpha}+, but Not CD8{alpha}-, Dendritic Cells Tolerize Th2 Responses via Contact-Dependent and -Independent Mechanisms, and Reverse Airway Hyperresponsiveness, Th2, and Eosinophil Responses in a Mouse Model of Asthma J. Immunol., August 1, 2005; 175(3): 1516 - 1522. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Patel, D. Xu, P. Kewin, B. Choo-Kang, C. McSharry, N. C. Thomson, and F. Y. Liew TLR2 Agonist Ameliorates Established Allergic Airway Inflammation by Promoting Th1 Response and Not via Regulatory T Cells J. Immunol., June 15, 2005; 174(12): 7558 - 7563. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Youn, M. Miller, K. J. Baek, J. W. Han, J. Nayar, S. Y. Lee, K. McElwain, S. McElwain, E. Raz, and D. H. Broide Immunostimulatory DNA Reverses Established Allergen-Induced Airway Remodeling J. Immunol., December 15, 2004; 173(12): 7556 - 7564. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Deng, T. A. Moore, M. W. Newstead, X. Zeng, A. M. Krieg, and T. J. Standiford CpG Oligodeoxynucleotides Stimulate Protective Innate Immunity against Pulmonary Klebsiella Infection J. Immunol., October 15, 2004; 173(8): 5148 - 5155. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Banerjee, K. J. Kelly, J. N. Fink, J. D. Henderson Jr., N. K. Bansal, and V. P. Kurup Modulation of Airway Inflammation by Immunostimulatory CpG Oligodeoxynucleotides in a Murine Model of Allergic Aspergillosis Infect. Immun., October 1, 2004; 72(10): 6087 - 6094. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hussain, V. V. Jain, P. O'Shaughnessy, T. R. Businga, and J. Kline Effect of Nitrogen Dioxide Exposure on Allergic Asthma in a Murine Model Chest, July 1, 2004; 126(1): 198 - 204. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Cho, M. Miller, K. J. Baek, J. W. Han, J. Nayar, M. Rodriguez, S. Y. Lee, K. McElwain, S. McElwain, E. Raz, et al. Immunostimulatory DNA Inhibits Transforming Growth Factor-{beta} Expression and Airway Remodeling Am. J. Respir. Cell Mol. Biol., May 1, 2004; 30(5): 651 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Ikeda, M. Miller, J. Nayar, L. Walker, J. Y. Cho, K. McElwain, S. McElwain, E. Raz, and D. H. Broide Accumulation of Peribronchial Mast Cells in a Mouse Model of Ovalbumin Allergen Induced Chronic Airway Inflammation: Modulation by Immunostimulatory DNA Sequences J. Immunol., November 1, 2003; 171(9): 4860 - 4867. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P. Ho, P. Fontoura, P. J. Ruiz, L. Steinman, and H. Garren An Immunomodulatory GpG Oligonucleotide for the Treatment of Autoimmunity via the Innate and Adaptive Immune Systems J. Immunol., November 1, 2003; 171(9): 4920 - 4926. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. V. Jain, T. R. Businga, K. Kitagaki, C. L. George, P. T. O'Shaughnessy, and J. N. Kline Mucosal immunotherapy with CpG oligodeoxynucleotides reverses a murine model of chronic asthma induced by repeated antigen exposure Am J Physiol Lung Cell Mol Physiol, November 1, 2003; 285(5): L1137 - L1146. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-J. Chiang, Y.-L. Ye, W.-L. Chen, Y.-L. Lee, N.-Y. Hsu, and B.-L. Chiang Ribavirin or CpG DNA Sequence-Modulated Dendritic Cells Decrease the IgE Level and Airway Inflammation Am. J. Respir. Crit. Care Med., September 1, 2003; 168(5): 575 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Silverman and J. M. Drazen Immunostimulatory DNA for Asthma: Better than Eating Dirt Am. J. Respir. Cell Mol. Biol., June 1, 2003; 28(6): 645 - 647. [Full Text] [PDF] |
||||
![]() |
R. K. Ikeda, J. Nayar, J. Y. Cho, M. Miller, M. Rodriguez, E. Raz, and D. H. Broide Resolution of Airway Inflammation following Ovalbumin Inhalation: Comparison of ISS DNA and Corticosteroids Am. J. Respir. Cell Mol. Biol., June 1, 2003; 28(6): 655 - 663. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nowak-Wegrzyn Future Approaches to Food Allergy Pediatrics, June 1, 2003; 111(6): 1672 - 1680. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang and A. M. Krieg Synergy between CpG- or non-CpG DNA and specific antigen for B cell activation Int. Immunol., February 1, 2003; 15(2): 223 - 231. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Anders, B. Banas, Y. Linde, L. Weller, C. D. Cohen, M. Kretzler, S. Martin, V. Vielhauer, D. Schlondorff, and H.-J. Grone Bacterial CpG-DNA Aggravates Immune Complex Glomerulonephritis: Role of TLR9-Mediated Expression of Chemokines and Chemokine Receptors J. Am. Soc. Nephrol., February 1, 2003; 14(2): 317 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Jiang, H. J. Baker, and B. F. Smith Mucosal Immunization with Helicobacter, CpG DNA, and Cholera Toxin Is Protective Infect. Immun., January 1, 2003; 71(1): 40 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-Y. Kim, H.-J. Myoung, J.-H. Kim, I.-S. Moon, T.-G. Kim, W.-S. Ahn, and J.-I. Sin Both E7 and CpG-Oligodeoxynucleotide Are Required for Protective Immunity against Challenge with Human Papillomavirus 16 (E6/E7) Immortalized Tumor Cells: Involvement of CD4+ and CD8+ T Cells in Protection Cancer Res., December 15, 2002; 62(24): 7234 - 7240. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Choudhury, J. S. Wild, R. Alam, D. M. Klinman, I. Boldogh, N. Dharajiya, W. J. Mileski, and S. Sur In Vivo Role of p38 Mitogen-Activated Protein Kinase in Mediating the Anti-inflammatory Effects of CpG Oligodeoxynucleotide in Murine Asthma J. Immunol., November 15, 2002; 169(10): 5955 - 5961. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kitagaki, V. V. Jain, T. R. Businga, I. Hussain, and J. N. Kline Immunomodulatory Effects of CpG Oligodeoxynucleotides on Established Th2 Responses Clin. Vaccine Immunol., November 1, 2002; 9(6): 1260 - 1269. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Rha, C. Taube, A. Haczku, A. Joetham, K. Takeda, C. Duez, M. Siegel, M. K. Aydintug, W. K. Born, A. Dakhama, et al. Effect of Microbial Heat Shock Proteins on Airway Inflammation and Hyperresponsiveness J. Immunol., November 1, 2002; 169(9): 5300 - 5307. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Kline, K. Kitagaki, T. R. Businga, and V. V. Jain Treatment of established asthma in a murine model using CpG oligodeoxynucleotides Am J Physiol Lung Cell Mol Physiol, July 1, 2002; 283(1): L170 - L179. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gursel, D. Verthelyi, I. Gursel, K. J. Ishii, and D. M. Klinman Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotide J. Leukoc. Biol., May 1, 2002; 71(5): 813 - 820. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nau and H. Eiffert Modulation of Release of Proinflammatory Bacterial Compounds by Antibacterials: Potential Impact on Course of Inflammation and Outcome in Sepsis and Meningitis Clin. Microbiol. Rev., January 1, 2002; 15(1): 95 - 110. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Renz and U. Herz The bidirectional capacity of bacterial antigens to modulate allergy and asthma Eur. Respir. J., January 1, 2002; 19(1): 158 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Plaut Immune-Based, Targeted Therapy for Allergic Diseases JAMA, December 19, 2001; 286(23): 3005 - 3006. [Full Text] [PDF] |
||||
![]() |
Z. K. Ballas, A. M. Krieg, T. Warren, W. Rasmussen, H. L. Davis, M. Waldschmidt, and G. J. Weiner Divergent Therapeutic and Immunologic Effects of Oligodeoxynucleotides with Distinct CpG Motifs J. Immunol., November 1, 2001; 167(9): 4878 - 4886. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shibata, I. Honda, J. P. Justice, M. R. Van Scott, R. M. Nakamura, and Q. N. Myrvik Th1 Adjuvant N-Acetyl-D-Glucosamine Polymer Up-Regulates Th1 Immunity but Down-Regulates Th2 Immunity against a Mycobacterial Protein (MPB-59) in Interleukin-10-Knockout and Wild-Type Mice Infect. Immun., October 1, 2001; 69(10): 6123 - 6130. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hertz, S. Mahalingam, I. Dalum, S. Klysner, J. Mattes, A. Neisig, S. Mouritsen, P. S. Foster, and A. Gautam Active Vaccination Against IL-5 Bypasses Immunological Tolerance and Ameliorates Experimental Asthma J. Immunol., October 1, 2001; 167(7): 3792 - 3799. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Gursel, M. Gursel, K. J. Ishii, and D. M. Klinman Sterically Stabilized Cationic Liposomes Improve the Uptake and Immunostimulatory Activity of CpG Oligonucleotides J. Immunol., September 15, 2001; 167(6): 3324 - 3328. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Mui, S. G. Raney, S. C. Semple, and M. J. Hope Immune Stimulation by a CpG-Containing Oligodeoxynucleotide Is Enhanced When Encapsulated and Delivered in Lipid Particles J. Pharmacol. Exp. Ther., September 1, 2001; 298(3): 1185 - 1192. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. H. Baek, S. J. Ha, and Y. C. Sung A Novel Function of Phosphorothioate Oligodeoxynucleotides as Chemoattractants for Primary Macrophages J. Immunol., September 1, 2001; 167(5): 2847 - 2854. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Britigan, T. S. Lewis, M. Waldschmidt, M. L. McCormick, and A. M. Krieg Lactoferrin Binds CpG-Containing Oligonucleotides and Inhibits Their Immunostimulatory Effects on Human B Cells J. Immunol., September 1, 2001; 167(5): 2921 - 2928. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chen, J. Zhang, S. A. Moore, Z. K. Ballas, J. P. Portanova, A. M. Krieg, and D. J. Berg CpG DNA induces cyclooxygenase-2 expression and prostaglandin production Int. Immunol., August 1, 2001; 13(8): 1013 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Bohle, L. Orel, D. Kraft, and C. Ebner Oligodeoxynucleotides Containing CpG Motifs Induce Low Levels of TNF-{{alpha}} in Human B Lymphocytes: Possible Adjuvants for Th1 Responses J. Immunol., March 15, 2001; 166(6): 3743 - 3748. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Verthelyi, K. J. Ishii, M. Gursel, F. Takeshita, and D. M. Klinman Human Peripheral Blood Cells Differentially Recognize and Respond to Two Distinct CpG Motifs J. Immunol., February 15, 2001; 166(4): 2372 - 2377. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-G. Zhu and J. S. Marshall CpG-containing oligodeoxynucleotides induce TNF-{alpha} and IL-6 production but not degranulation from murine bone marrow-derived mast cells J. Leukoc. Biol., February 1, 2001; 69(2): 253 - 262. [Abstract] [Full Text] |
||||
![]() |
C. L. S. George, H. Jin, C. L. Wohlford-Lenane, M. E. O'Neill, J. C. Phipps, P. O'Shaughnessy, J. N. Kline, P. S. Thorne, and D. A. Schwartz Endotoxin responsiveness and subchronic grain dust-induced airway disease Am J Physiol Lung Cell Mol Physiol, February 1, 2001; 280(2): L203 - L213. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Peng, H. Wang, X. Mao, K. T. HayGlass, and F. E. R. Simons CpG oligodeoxynucleotide vaccination suppresses IgE induction but may fail to down-regulate ongoing IgE responses in mice Int. Immunol., January 1, 2001; 13(1): 3 - 11. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-J. Huang, P. A. MacAry, P. Eynott, A. Moussavi, K. C. Daniel, P. W. Askenase, D. M. Kemeny, and K. F. Chung Allergen-Specific Th1 Cells Counteract Efferent Th2 Cell-Dependent Bronchial Hyperresponsiveness and Eosinophilic Inflammation Partly Via IFN-{{gamma}} J. Immunol., January 1, 2001; 166(1): 207 - 217. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Serebrisky, A. A. Teper, C.-K. Huang, S.-Y. Lee, T.-F. Zhang, B. H. Schofield, M. Kattan, H. A. Sampson, and X.-M. Li CpG Oligodeoxynucleotides Can Reverse Th2-Associated Allergic Airway Responses and Alter the B7.1/B7.2 Expression in a Murine Model of Asthma J. Immunol., November 15, 2000; 165(10): 5906 - 5912. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Meyer, K. T. Wilson, and S. P. James Modulation of Innate Cytokine Responses by Products of Helicobacter pylori Infect. Immun., November 1, 2000; 68(11): 6265 - 6272. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Miyazaki, G. Liu, L. Clark, and S. J. Ono Prevention of Acute Allergic Conjunctivitis and Late-Phase Inflammation with Immunostimulatory DNA Sequences Invest. Ophthalmol. Vis. Sci., November 1, 2000; 41(12): 3850 - 3855. [Abstract] [Full Text] |
||||
![]() |
G. J. Weiner The immunobiology and clinical potential of immunostimulatory CpG oligodeoxynucleotides J. Leukoc. Biol., October 1, 2000; 68(4): 455 - 463. [Abstract] [Full Text] |
||||
![]() |
S. W. Lee, M. K. Song, K. H. Baek, Y. Park, J. K. Kim, C. H. Lee, H.-K. Cheong, C. Cheong, and Y. C. Sung Effects of a Hexameric Deoxyriboguanosine Run Conjugation into CpG Oligodeoxynucleotides on Their Immunostimulatory Potentials J. Immunol., October 1, 2000; 165(7): 3631 - 3639. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hesse, A. W. Cheever, D. Jankovic, and T. A. Wynn NOS-2 Mediates the Protective Anti-Inflammatory and Antifibrotic Effects of the Th1-Inducing Adjuvant, IL-12, in a Th2 Model of Granulomatous Disease Am. J. Pathol., September 1, 2000; 157(3): 945 - 955. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. B. Lipford, T. Sparwasser, S. Zimmermann, K. Heeg, and H. Wagner CpG-DNA-Mediated Transient Lymphadenopathy Is Associated with a State of Th1 Predisposition to Antigen-Driven Responses J. Immunol., August 1, 2000; 165(3): 1228 - 1235. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. FUJIEDA, S. IHO, Y. KIMURA, H. YAMAMOTO, H. IGAWA, and H. SAITO Synthetic Oligodeoxynucleotides Inhibit IgE Induction in Human Lymphocytes Am. J. Respir. Crit. Care Med., July 1, 2000; 162(1): 232 - 239. [Abstract] [Full Text] |
||||
![]() |
H. Shirota, K. Sano, T. Kikuchi, G. Tamura, and K. Shirato Regulation of Murine Airway Eosinophilia and Th2 Cells by Antigen-Conjugated CpG Oligodeoxynucleotides as a Novel Antigen-Specific Immunomodulator J. Immunol., June 1, 2000; 164(11): 5575 - 5582. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Castro, D. D. Chaplin, M. J. Walter, and M. J. Holtzman Could Asthma Be Worsened by Stimulating the T-helper Type 1 Immune Response? Am. J. Respir. Cell Mol. Biol., February 1, 2000; 22(2): 143 - 146. [Full Text] |
||||
![]() |
H. Shirota, K. Sano, T. Kikuchi, G. Tamura, and K. Shirato Regulation of T-helper Type 2 Cell and Airway Eosinophilia by Transmucosal Coadministration of Antigen and Oligodeoxynucleotides Containing CpG Motifs Am. J. Respir. Cell Mol. Biol., February 1, 2000; 22(2): 176 - 182. [Abstract] [Full Text] |
||||
![]() |
Y. Shibata, L. A. Foster, J. F. Bradfield, and Q. N. Myrvik Oral Administration of Chitin Down-Regulates Serum IgE Levels and Lung Eosinophilia in the Allergic Mouse J. Immunol., February 1, 2000; 164(3): 1314 - 1321. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hartmann, R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I. Suparto, W. L. Rasmussen, M. Waldschmidt, D. Sajuthi, R. H. Purcell, et al. Delineation of a CpG Phosphorothioate Oligodeoxynucleotide for Activating Primate Immune Responses In Vitro and In Vivo J. Immunol., February 1, 2000; 164(3): 1617 - 1624. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hartmann and A. M. Krieg Mechanism and Function of a Newly Identified CpG DNA Motif in Human Primary B Cells J. Immunol., January 15, 2000; 164(2): 944 - 953. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Chiaramonte, M. Hesse, A. W. Cheever, and T. A. Wynn CpG Oligonucleotides Can Prophylactically Immunize Against Th2-Mediated Schistosome Egg-Induced Pathology by an IL-12-Independent Mechanism J. Immunol., January 15, 2000; 164(2): 973 - 985. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hansen, V. P. Yeung, G. Berry, D. T. Umetsu, and R. H. DeKruyff Vaccination with Heat-Killed Listeria as Adjuvant Reverses Established Allergen-Induced Airway Hyperreactivity and Inflammation: Role of CD8+ T Cells and IL-18 J. Immunol., January 1, 2000; 164(1): 223 - 230. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Sester, S. J. Beasley, M. J. Sweet, L. F. Fowles, S. L. Cronau, K. J. Stacey, and D. A. Hume Bacterial/CpG DNA Down-Modulates Colony Stimulating Factor-1 Receptor Surface Expression on Murine Bone Marrow-Derived Macrophages with Concomitant Growth Arrest and Factor-Independent Survival J. Immunol., December 15, 1999; 163(12): 6541 - 6550. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Parronchi, F. Brugnolo, F. Annunziato, C. Manuelli, S. Sampognaro, C. Mavilia, S. Romagnani, and E. Maggi Phosphorothioate Oligodeoxynucleotides Promote the In Vitro Development of Human Allergen-Specific CD4+ T Cells into Th1 Effectors J. Immunol., December 1, 1999; 163(11): 5946 - 5953. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Iho, T. Yamamoto, T. Takahashi, and S. Yamamoto Oligodeoxynucleotides Containing Palindrome Sequences with Internal 5'-CpG-3' Act Directly on Human NK and Activated T Cells to Induce IFN-{gamma} Production In Vitro J. Immunol., October 1, 1999; 163(7): 3642 - 3652. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hartmann, G. J. Weiner, and A. M. Krieg CpG DNA: A potent signal for growth, activation, and maturation of human dendritic cells PNAS, August 3, 1999; 96(16): 9305 - 9310. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Schwartz, C. L. Wohlford-Lenane, T. J. Quinn, and A. M. Krieg Bacterial DNA or Oligonucleotides Containing Unmethylated CpG Motifs Can Minimize Lipopolysaccharide-Induced Inflammation in the Lower Respiratory Tract Through an IL-12-Dependent Pathway J. Immunol., July 1, 1999; 163(1): 224 - 231. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sur, J. S. Wild, B. K. Choudhury, N. Sur, R. Alam, and D. M. Klinman Long Term Prevention of Allergic Lung Inflammation in a Mouse Model of Asthma by CpG Oligodeoxynucleotides J. Immunol., May 15, 1999; 162(10): 6284 - 6293. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Broide, J. Schwarze, H. Tighe, T. Gifford, M.-D. Nguyen, S. Malek, J. Van Uden, E. Martin-Orozco, E. W. Gelfand, and E. Raz Immunostimulatory DNA Sequences Inhibit IL-5, Eosinophilic Inflammation, and Airway Hyperresponsiveness in Mice J. Immunol., December 15, 1998; 161(12): 7054 - 7062. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. McCluskie and H. L. Davis Cutting Edge: CpG DNA Is a Potent Enhancer of Systemic and Mucosal Immune Responses Against Hepatitis B Surface Antigen with Intranasal Administration to Mice J. Immunol., November 1, 1998; 161(9): 4463 - 4466. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. W. Redford, A.-K. Yi, C. T. Ward, and A. M. Krieg Cyclosporin A Enhances IL-12 Production by CpG Motifs in Bacterial DNA and Synthetic Oligodeoxynucleotides J. Immunol., October 15, 1998; 161(8): 3930 - 3935. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |