|
|
||||||||
Laboratoire de Biologie Moléculaire du Gène, INSERM U277, Institut Pasteur, Paris, France
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In the H-2d haplotype, HEL-specific T cell response is consistently focused against the single immunodominant (ID)5 determinant 103117 presented by I-Ed MHC class II molecules (9, 10, 11, 12). In addition, after immunization with HEL, 15-mer peptides from HEL region 731 are also capable of stimulating weak responses in vitro in a small percentage of BALB/c mice (11, 13). Thus, HEL 731 is considered a subdominant (SD) region in these mice. Immunodominance of HEL region 103117 in H-2d mice has been extensively studied by Sercarzs group (7, 13, 14). It was proposed that during its unfolding, the HEL molecule was "captured" in the groove of I-Ed molecules via binding of its ID region. This region was then protected from proteolysis while other determinants, such as 731, were degraded (13). However, we have recently reported that HEL region 731 is presented efficiently by splenocytes to specific T cell hybridomas (11) and that it binds to I-Ad molecules (L. Gapin, unpublished observations). Furthermore, HEL 731 is as tolerogenic as the ID region in HEL transgenic mice (11). Taken together, these results suggest that subdominance of this epitope is not due to a general processing defect.
Alternative explanations to the subdominance of this region could be a defect 1) in the processing of this epitope by APCs involved in the initiation of immune responses or 2) in the T cell repertoire resulting from the presence of lower affinity and/or lower frequency clones.
We (15, 16, 17) and others (18, 19, 20, 21, 22, 23, 24, 25) have previously shown that T cells specific for ID determinants express TCRs with Vß-Jß rearrangements common to all mice or humans of the same MHC haplotype. These rearrangements were defined as public, while private ones were also observed, with Vß-Jß rearrangements different from one individual to the other (15, 19, 26).
Dissection of the mechanisms underlying immunodominance is essential for elucidating the rules that govern the T cell response in autoimmune diseases (27), vaccination (28), transplantation (29) or antitumor immune responses (30). Here, we have analyzed extensively the role of T cell repertoire and Ag processing by different APC populations in the subdominance of the 731 HEL determinant.
We first determined whether the subdominance of this determinant was
due to the presence of a private repertoire instead of a public one.
Our results show that the TCR recognizing this HEL region is highly
homogeneous for both V
-J
and Vß-Jß rearrangements.
Furthermore, these rearrangements are highly conserved and are found in
all BALB/c mice. Hence, a defect in the T cell repertoire cannot be
involved in the subdominance of this epitope.
We then compared the presentation of HEL regions 103117 and 731 by different APCs. Indeed, it was shown recently that only dendritic cells (DC) presented antigenic complexes to MHC class II-restricted T cells following s.c. immunization of Ag emulsified in CFA (31). Thus, a limitation in the number of determinants presented by DC may focus T cell responses to immunodominant regions of antigenic proteins. Here, we show that normal and lymphoma B cells present both regions 103117 and 731 efficiently, whereas DC favor the ID 103117 region. These results suggest that DC play a major role in the focusing of the immune response against a few antigenic determinants, while B lymphocytes may diversify the T cell responses by presenting a more heterogeneous set of peptide-MHC complexes.
| Materials and Methods |
|---|
|
|
|---|
BALB/c By/Rj mice (H-2d), 8 to 12 wk of age, were purchased from Centre dElevage Robert Janvier (Laval, France) and maintained at the Pasteur Institute or Centre de Sélection et dElevage de Animaux de Laboratoire (Orleans, France) animal facilities.
Antigens
Molecular biology grade HEL protein was purchased from Appligene
(Illkirch, France). The mutated form of HEL used in this study (HELµ)
has been previously described (11). Briefly, three mutations were
introduced into the HEL cDNA using PCR methodology. Positions 113
(N
A), 114 (R
H), and 116 (K
Q) of HEL were replaced by the
homologous residues found in the mouse lysozyme sequence. Peptides with
purity >70% were purchased from Neosystem Laboratories (Strasbourg,
France). Mice were immunized in the hind footpads with 3.5 nmol of
protein in PBS emulsified 1:1 with CFA. Nine days later, popliteal
lymph nodes were collected, and lymph node cells (LNC) were cultured in
a 5% CO2 incubator (5 x 105
cells/well) in FCS-free HL-1 medium (Ventrex Laboratories, Portland,
ME) supplemented with 2 mM glutamine, 100 U/ml penicillin, and 100
µg/ml streptomycin with 10 µM Ag for 4 days.
Cell lines and T cell hybridomas
The D2SC/1 H-2d is a DC line (generous gift
from Dr. P. RicciardiCastagnoli, Cellular and Molecular
Pharmacology Center, Milan, Italy) obtained by retroviral
immortalization of BALB/c mouse spleen cells (32). Surface markers and
the Ag presentation capacity of D2SC/1 have been published elsewhere
(33, 34). All cells were grown in RPMI 1640 (Life Technologies, Cergy
Pontoise France) supplemented with 100 U/ml penicillin, 100 mg/ml
streptomycin, 10 mM L-glutamine, 1 mM sodium pyruvate, 50
µM ß2-ME, and 10% FCS at 37°C in 5% CO2. For the Ag
presenting assays, cells were plated at a concentration of 3 x
105/ml and stimulated with 200 U/ml mouse rIFN-
(Genzyme
Diagnostics, Cambridge, MA) and 2 ng/ml mouse rGM-CSF (Genzyme
Diagnostics) for 48 h at 37°C. To harvest the differentiated and
strongly adherent DC, cells were washed with PBS and trypsinized for 20
to 30 min at 37°C. The A20 (H-2d) B cell lymphoma line
was also used as APC. The T cell hybridomas B9.1 specific for the ID
peptide HEL 103117 (12), and CABII.43, specific for the SD peptide
HEL 731 (11), were used to detect presentation of these two epitopes
after processing of HEL by different APC.
Antibodies
The Abs used in this study were: anti-CD3
-FITC
(PharMingen, San Diego, CA); anti-mouse CD45R/B220-phycoerythrin
(PE) (PharMingen); polyclonal anti-mouse µIg (Interchim,
Asni
res, France); anti-CD11c, N418 (a generous gift from
J.-C. Guéry, INSERM U28, Toulouse, France); anti-DC 33D1
(American Type Culture Collection, Rockville, MD); and
anti-I-Ab,d biotinylated (PharMingen). The
CD32/CD16 Fc Block (PharMingen) was used to block nonspecific
staining. Determination of B220- and N418-positive cells in the spleen
was done by staining with anti-CD3
-FITC, anti-CD45R/B220-PE,
N418-biotin, and 33D1-biotin mAbs. Cell surface fluorescence was
analyzed by flow cytometry using a FACScan (Becton Dickinson, San Jose,
CA).
APC preparations
DC were prepared with minor modifications as described elsewhere (35). Briefly, splenocytes were obtained from 10 BALB/c mice after disrupting spleens and incubating stromal fragments for 45 min at 37°C with 400 U/ml collagenase type IV (Clostridium histolyticum, Sigma, Saint Quentin Fallavier, France). The cells were washed and incubated in petri dishes in complete medium 90 min at 37°C at a concentration of 2 x 107 cells/dish (Primaria culture dish, 100 x 20 mm, Becton Dickinson). Plates were then washed three times, and nonadherent cells were removed. Floating DC were recovered after overnight culture at 37°C. Contaminating B cells were removed by two rounds of depletion with anti-B220 Ab and sheep anti-rat Ig-coated Dynabeads M-450 (Dynal, Oslo, Norway) at a 40:1 bead:cell ratio. After a 30-min incubation at 0°C, the beads were removed magnetically. FACS analysis showed no B cell contamination in DC preparations.
B cells were purified from splenocytes using goat anti-mouse
Ab-coated dishes. Plates (Optilux, 100 x 15 mm, Becton Dickinson)
were pretreated with 6 ml of a 5 µg/ml solution of purified
anti-µIg Abs, pH 9.5, 0.05 M Tris, 0.15 M NaCl buffer, for
18 h at 4°C. Plates were washed with PBS to remove excess Abs.
Ten million SC were incubated for 70 min at 4°C in the plates with
gentle swirling to redistribute cells. Nonadherent cells were harvested
by washing gently six times with cold complete medium. Adherent cells
were detached with a silicon rubber policeman. Purity of the B cell
population was assessed by FACS analysis and found to be
90%.
Hybridoma stimulation assays
The APC were incubated into 96-well tissue culture plate (105 cells/well) with HEL or HEL peptide and specific T cell hybridomas (105/well). After 24 h of culture, IL-2 secretion into the supernatant was measured by proliferation of IL-2-dependent CTLL-2 cells. Proliferation was assessed by [3H]TdR incorporation (1 µCi/ml). The cells were collected onto glass fiber filters with an automated multisample harvester (Skatron Instruments, Sterling, VA), and the radioactivity was measured with a beta counter (Beckman Instruments, Fullerton, CA). All assays were performed in triplicate.
Determination of ß- and
-chain sequences of TCR from T cell
hybridomas
mRNA from T cell hybridomas was extracted using the Quick mRNA
MicroPrep Kit (Pharmacia, Piscataway, NJ). RNAs were reverse
transcribed into cDNA using a cDNA synthesis kit (Boehringer Mannheim,
Mannheim, Germany). RNAs were denatured at 70°C for 10 min, then
incubated with random primers (5 µM), dNTP (1 mM), RNasin (40 U;
Promega, Madison, WI), and 2 U of AMV reverse transcriptase (from
Boehringer Mannheim) at 43°C for 1 h, followed by incubation at
53°C for 10 min. PCR were conducted in 50 µl (1/60) of the cDNA
with 2 U of Taq polymerase (Promega) in the suppliers
buffer. Sense oligonucleotides specific for each of the 23 Vß chains,
the 19 V
chains, and antisense oligonucleotides for Cß and C
have been described (17, 22, 36). Forty cycles, each at 94°C for
30 s, 60°C for 45 s, and 72°C for 45 s were
completed in a 9600 Perkin-Elmer Automate (Perkin-Elmer, Foster City,
CA). PCR products were analyzed on a 2% agarose gel stained with
ethidium bromide. Amplified ß and
cDNAs were then sequenced using
the Sequenase PCR product sequencing kit (U.S. Biochemical Corp.,
Cleveland, OH) according to the manufacturers instructions.
T cell repertoire analysis with the Immunoscope
mRNA from LNC stimulated as described in the figure legends was
extracted using the Quick mRNA MicroPrep Kit (Pharmacia) and reverse
transcribed into cDNA using a cDNA synthesis kit (Boehringer Mannheim).
PCR was conducted in 50 µl on 1/60 of the cDNA with 2 U of
Taq polymerase (Goldstar; Eurogentec, Seraing, Belgium) in
the suppliers buffer. Each amplified product was then used as a
template for elongation reaction with oligonucleotides labeled with a
fluorescent tag (run-off reactions) as described (15, 17). Fluorescent
primers used in this study are: Cß5', CTTGGGTGGAGTCACATTTCTC;
Jß1.5, GAGTCCCCTCTCCAAAAAGCG; Jß2.7, CTAAAACCGTGAGCCTGGTGC;
anti-(103117) CDR3-specific,
AAGCGGAGCCTGGTTGTTCCCTGTCCC;anti-(731) CDR3-specific,
GAAGTACTGTTCATAACCCCCCAGTC; C
b,
ACACAGCAGTGTCTGGGTTC; and J
49, CTGGACTCACTGTGAGCTTTGC. The
fluorescent run-off products, corresponding to the elongation of V
segment PCR products with various CDR3 sizes, were loaded on
polyacrylamide gels and subjected to electrophoresis in an automated
DNA sequencer. The CDR3 size distribution and signal intensities were
then analyzed with Immunoscope software (37).
| Results |
|---|
|
|
|---|
and Vß T cell rearrangements against HEL region 731
are highly homogeneous
To characterize the TCR repertoire of T lymphocytes specific for
HEL SD region 731, we used two strategies: 1) we produced T cell
hybridomas specific for this region and sequenced their TCR
- and
ß-chains; 2) we applied the immunoscope method, previously described
(15, 16, 17, 37, 38), to detect amplified Vß and V
rearrangements.
First, we sequenced TCR
- and ß-chain transcripts from six
independent T cell hybridomas that recognize region 731 in the
context of MHC class II molecules. The V
and Vß nucleotide and
amino acid sequences from each hybridoma are shown in Tables
I and II,
respectively. Among the six HEL 731-specific T cell hybridomas
tested, four use a Vß8.2-Jß2.7 rearrangement with a CDR3 length of
nine amino acid residues. Three of these four T cell hybrids have
different nucleotide sequences and therefore derive from
independent T cell clones. Importantly, six of the nine amino acid
residues from the CDR3 Vß loops are highly conserved: G, R, G, Y, E,
and Q. Furthermore, the V
rearrangements from the Vß8.2-Jß2.7 T
cell hybrids are highly restricted to the V
13 region and to the
homologous J
48 and J
49 segments. Six of the nine amino acid
residues from the
-chain CDR3 sequences are conserved: S, E, Q, G,
K, and L. Altogether, these results show that the TCR repertoire of HEL
731-specific hybridomas is highly homogeneous. Strong selection must
occur during the immune response against the HEL 731 epitope, since
amino acid residues from both
and ß CDR3 sequences are highly
conserved even though nucleotide sequences from both V
-J
and
Vß-Jß rearrangements are different.
Because of a possible bias in the hybridoma sampling, we could not
ascertain whether this homogeneous TCR usage reflects the in vivo
situation accurately. Thus, we determined whether the Vß8.2-Jß2.7
and V
13-J
49 rearrangements were present in T cell responses of
BALB/c mice against HEL 731.
The Vß and V
rearrangements in T cells that respond against
HEL region 731 are both public
We immunized several BALB/c mice with HEL in CFA and recalled
their LNC in vitro with a mutant HEL (HELµ) that lacks the
immunodominant region 103117 (11). This protocol of immunization has
previously been shown to be efficient for generating T lymphocytes
specific for the HEL region 731 (11). In Figure 1
, a typical experiment obtained with the
LNC from one BALB/c mouse is shown. Briefly, the RNA extracted from in
vitro HELµ- or PPD (control)-stimulated LNC was reverse transcribed
into cDNA, and aliquots were amplified by PCR with Vß8.2 and Cß- or
V
13 and C
-specific primers. The product from each PCR was then
divided into five aliquots, which were hybridized with one of the
dye-labeled oligonucleotides specific for Cß, Jß2.7, C
, or J
49 and the CDR3-specific sequence of the Vß chain from a T cell
hybridoma anti-SD peptide 731. A run-off reaction was performed,
and the fluorescent run-off products were analyzed in an automated DNA
sequencer. In C
or Cß run-off products, a typical Gaussian
distribution was observed for HELµ- or PPD-stimulated lymphocytes
(Fig. 1
). However, with Jß 2.7- and CDR3-specific primers, the peak
with a CDR3 of nine amino acids was clearly increased in response to
HELµ. In contrast, no peaks were observed in the PPD control. This
experiment shows that in response to region 731 (revealed by HELµ),
T cells bearing a Vß8.2-Jß2.7 rearrangement with a characteristic
CDR3 are expanded. Similarly, with the J
49-specific primer, a unique
peak with a CDR3 of nine amino acids was detected in this response
(Fig. 1
).
|
rearrangements of TCRs from ID-specific T cell hybridomas
are diverse
We have previously described the Vß repertoire of T cell
hybridomas specific for the ID region of HEL presented by the
I-Ed molecule. The Vß sequences of these T cell
hybridomas have been published (15) and are shown in Table II
for
comparison purposes only. To determine whether the V
-J
usage of
this hybridoma collection is as restricted as the one that is used in
response to HEL 731, we sequenced the V
chains from 11 hybridomas.
As shown in Table I
, the V
-J
usage is heterogeneous. Furthermore,
hybridomas C6.2 and M3.13, which share the characteristic public
rearrangement Vß8.2-Dß1.1-Jß1.5, use two different V
chains.
Although the nonfunctional V
chain (39) from the fusion partner
BW5147 of the M3.13 hybridoma has been amplified, the sequence of the
M3.13-specific V
chain could not be determined, since none of our
V
primers could amplify it. These data were reproducible on
different functional M3.13 clones. Thus, we are confident that this
result is significant and that the
-chain of this hybridoma belongs
to a family that is not recognized by our primers. Among the 10
hybridomas bearing Vß8.2 chains, only 2 have CDR3 sequence homology
(G8.25 and B11.1, cf. Table II
) but they use different V
segments
(V
18 vs V
1). Altogether, these results show that the V
repertoire of TCR from ID-specific T cell hybridomas is diverse.
|
|
Next, we investigated the presence of HEL 731- and
103117-specific TCR public repertoires in mice immunized with HEL and
recalled in vitro with various Ags (Fig. 2
). When HEL-primed LNC were
stimulated in vitro with HEL, a major expansion with a CDR3 size of
eight amino acids was observed with Jß1.5 and anti-(103117)
CDR3-specific primers (Fig. 2
, f and n),
whereas no responses to peptide 731 were detected with Jß2.7 and
anti-(731) CDR3-specific primers (Fig. 2
, j and
r). However, after in vitro recall with HELµ, a
peak increase with a CDR3 size of nine amino acids was seen with
Jß2.7 primers (panel k), which was not
observed after in vitro stimulation with HEL or PPD
(panels j and l, respectively).
Furthermore, with the CDR3-specific primer, a single peak was detected
(panel s) in HELµ-stimulated cells
only.
|
Dendritic or B cell lines generate different determinants from the same protein in vitro
DC have been shown to represent the predominant APC able to display Ag-presenting capacity after s.c. administration of Ag in adjuvant, supporting the hypothesis that DC rather than B cells are required for priming T cell-proliferative response in vivo (31). In addition, DC were described as the most efficient APC in presenting endogenous naturally processed ß2-microglobulin epitopes (40). We hypothesized that differential determinant selection of ID and SD could result from HEL processing and presentation by different APCs. To address this hypothesis, we compared T cell responses elicited following Ag processing and presentation by DC and B lymphocytes.
First, we analyzed the capacity of two H-2d APC lines, the
D2SC/1 dendritic cell line and the A20 B lymphoma, to present HEL
peptides to two specific T cell hybridomas. The B9.1 T cell hybridoma
is specific for the ID determinant HEL 103117 (12), and CABII.43
recognizes SD region HEL 731 (11). The D2SC/1 dendritic cell line
needs rIFN-
and GM-CSF to express high levels of surface MHC class
II molecules. The A20 B cell line has a constitutively high expression
of MHC class II molecules on its surface. In both APC lines, the
presence of MHC class II molecules was assessed by flow cytometry (data
not shown). No differences in the levels of expression of
I-Ad and I-Ed were observed between D2SC/1
cells treated with IFN
and GM-CSF and A20 lymphoma cells.
Furthermore, B7.2 and CD40 molecules were found on both cell types, but
in higher amounts on D2SC/1. Significant amount of B7.1 was detected
only on D2SC/1 cells. Different concentrations of exogenous peptides or
soluble HEL protein were used for presentation by the two APC
lines.
Our results show a significant production of IL-2 by ID
103117-specific T cell hybridoma B9.1 stimulated by the DC line
D2SC/1 (Fig. 3
A) and
A20 B cells (Fig. 3
B) exposed to either the HEL
103117 peptide or native HEL (Fig. 3
, A and
B). Strikingly, the same activated DC line was able
to present the subdominant determinant HEL 731 to specific CABII.43 T
hybridoma cells when incubated with the corresponding peptide but not
with whole HEL protein (Fig. 3
C). In contrast, A20 B
cells efficiently stimulated the IL-2 secretion of CABII.43 T cells in
both cases (Fig. 3
D). In the absence of protein or
peptide, no T cell stimulation was observed. These results show that
A20 B cells are able to present both HEL 103117 and the HEL 731
determinants after processing of HEL, while the D2SC/1 DC line presents
the HEL 103117 but not the HEL 731 determinant after in vitro
processing of the protein. It is important to note that the HEL
731-specific T cell hybridoma is optimally triggered at an HEL
concentration, while the ID-specific hybridoma (B9.1) is stimulated at
a 10-fold higher HEL concentration of 1 µM. Thus, the lack of
presentation of the HEL 731 determinant by the D2SC/1 DC line cannot
result from a lower sensitivity of detection of the SD-specific T cell
hybridoma. The differential effect on T cell activation shows that both
determinants, HEL 103117 and HEL 731, are generated after in vitro
processing of HEL by the B cell line, while only the HEL 103117
determinant is generated by the DC line. This conclusion is in
agreement with our previous findings (11) showing that BALB/c
splenocytes present both determinants.
|
To determine whether the differential processing of HEL found with
the two tumoral cell lines was similar with normal APCs, we
investigated the relative capacity of purified splenic DC and B cells
from naive BALB/c mice to present peptides derived from in vitro
processing of HEL to specific T cell hybridomas. Our results (Fig. 4
) show that splenic DC and B lymphocytes
process and present the HEL-derived peptides in a fashion similar to
D2SC/1 and A20 B cell lines, respectively. However, as splenic B cells
are purified by panning on anti-Ig coated plates, it remains
possible that fully resting B lymphocytes could display a different
pattern of processing.
|
| Discussion |
|---|
|
|
|---|
T cell responses
Two main conclusions emerge from our studies. First, the Vß-Jß
and V
-J
rearrangements are public, since they are found in all
mice tested. Second, these rearrangements are highly homogeneous.
Several differences between the repertoires against HEL
103117/I-Ed and 731/I-Ad complexes are
striking. The public Vß8.2-Dß1.1-Jß1.5 rearrangement found in
response to HEL103117/I-Ed does not contain N
additions, in contrast to the Vß8.2-Dß1.1-Jß2.7 segments of
HEL731/I-Ad. The V
-J
rearrangements used in
response to the SD epitope/I-Ad complexes are homogeneous,
while various V
-J
segments were found in HEL
103117/I-Ed-specific hybridomas. The public
Vß8.2-Dß1.1-Jß1.5 rearrangement found in two anti-ID epitope
hybridomas, which codes for the characteristic GTGNNQAP CDR3 sequence,
pairs with different V
-J
segments. These findings suggest that
the V
-J
segments have a much weaker contribution than the Vß
chain to the recognition of the ID epitope/I-Ed complexes.
On the contrary, the sequences encoding the CDR3
of anti-731
TCRs must be strongly selected for, since they contain N
additions but yield identical or homologous protein sequences.
Interestingly, it is worthwhile noting that in both CDR3ß and -
,
there are N-encoded residues that are highly conserved (R in
CDR3ß and E in CDR3
; Table I
). These residues are most probably
critical in the recognition of HEL 731/I-Ad complexes,
since they are also found in the T cell hybridoma CABI.32, which uses
different V-J rearrangements than the public TCRs. Thus, R and E are
N-encoded in the CDR3 of Vß8.1-Jß1.5 and V
11-J
37,
respectively (Table II
). It is important to note that the differences
observed between the two sets of TCRs may be due to the structural
constraints imposed by the selecting molecular complexes (i.e.,
HEL103117/I-Ed vs HEL731/I-Ad).
The immunoscope method is a PCR-based technique that allows the
measurements of the CDR3 lengths of the TCR
- and ß-chains. In
naive mice, it has been shown previously that the V-J profiles give a
typical bell-shaped distribution of the CDR3 lengths (17, 36). After
immunization, specific clonal proliferations lead to a modification of
some V-J profiles. In various antigenic models, expansions of one or a
few peaks have been correlated with the appearance of specific T cell
clones (15, 16, 17). The present work has shown that a public
Vß8.2-Jß2.7 rearrangement of 9 amino acids is found in response to
HEL 731/I-Ad complexes. The sensitivity of this method is
inversely correlated with the frequency of the particular V-J
combination in which the oligoclonal expansion occurs. For a poorly
represented V-J combination, a higher signal to noise ratio can be
achieved, yielding a higher sensitivity in the detection of specific
expansions. Thus, it was previously found that for a Vß7-Jß2.4
rearrangement (17), a frequency of 1 in 5,000 specific T cells was
detectable, while only 1 in 600 could be detected for the
Vß8.2-Jß2.1 combination (17). However, the use of CDR3-specific
primers increases the sensitivity of the method, since clonal
frequencies of about 1 in 50,000 can be detected.
Peptide presentation
How is it then that T lymphocytes expressing the public TCRs against HEL 731 do not expand in response to HEL, while T cells specific for HEL 103117 do? At least two hypotheses can be put forward: 1) the SD peptide/I-Ad complexes are unstable and thus unable to trigger efficiently T cells in the induction of an immune response; or 2) they are not produced efficiently during the processing of HEL by professional APCs involved in the induction of immune responses. The first hypothesis is unlikely in view of the results of Adams and Humphreys (42) who have shown that the half-life of biotinylated HEL 1125/I-Ad complexes was >24 h, while surprisingly, the half-life of the ID HEL 106117/I-Ed complexes was much shorter (6 h). On the contrary, our results strongly suggest that the second postulate is correct and that HEL peptides generated during the processing of HEL are different in DC and B lymphocytes. The latter are capable of presenting the ID peptide as well as the SD peptide. Conversely, DC generate mainly the ID peptide.
Heterogeneity in Ag processing by different APCs has been reported by Vidard et al. (43) who studied the processing of OVA by normal B lymphocytes, peritoneal macrophages, and total splenocytes. They have shown that B cells are unable to present as many OVA-derived T cell epitopes as macrophages or splenocytes. Furthermore, Michalek et al. (44) have shown that two genetically identical B lymphoma lines (A-20 and M-12) are capable of processing OVA differently. A-20 cells generate two epitopes, while M-12 presents predominantly one of them. In our studies, A-20 as well as M-12 (data not shown) and normal B cells were capable of presenting both ID and SD HEL peptides. Thus, the heterogeneity in processing appears to depend on the Ag used as well as on the APC type or differentiation stage.
Five nonexclusive mechanisms may explain why APCs process proteins
differently. 1) The protease content of APCs is heterogeneous; this is
supported by the work of Vidard et al. (43) who have shown that the
protease inhibitor leupeptin affects differently the processing of OVA
by B lymphocytes and splenocytes. The role of cytokines in the
modulation of proteolytic activities was established by Froch et al.
(45). They observed that bone marrow-derived macrophages treated by
IFN-
or GM-CSF processed bovine insulin differently, due to an
increased activity of thiol/serine proteases, resulting in proteolytic
degradation of the imunogenic determinant. 2) The compartments where
Ags are processed or where peptides are loaded are different in various
APCs. Zhong et al. (46) have shown that different processing pathways
are involved in the presentation of distinct HEL epitopes. Newly
synthesized MHC class II molecules associated with the invariant chain
(Ii) bind the HEL4661 determinant, which has been generated in a
lysosomal compartment containing elevated proteolytic activities and an
optimal pH for its binding to I-Ak (46). On the contrary,
the HEL3445 and 116129 peptides bind in an Ii-independent fashion
to mature MHC class II molecules located in the endosomes.
Interestingly, IFN-
-treated peritoneal macrophages and B cell blasts
process HEL4661 efficiently, whereas the other two epitopes are
presented only by B cell blasts. The inefficient presentation by
IFN-
-treated macrophages is probably related to complete digestion
of HEL peptide 3445 and 116129 in these cells, since treatment by
leupeptin or chloroquine partly restores the presentation of both
determinants (46). In our experiments, the inefficient presentation of
the SD peptide 731 by the DC is not due to IFN-
treatment, since a
similar observation was made with DC isolated from normal BALB/c mice.
3) Ags are internalized through different pathways, which may vary from
one APC to the other. Proteins have been shown to enter cells by
macropinocytosis (47) and through lectin or mannose receptors (47, 48).
Surface Ig can specifically concentrate an Ag inside B lymphocytes,
increasing the chances of presenting a peptide produced in low amounts
(49, 50, 51, 52, 53). Immune complexes capable of binding to FcR-positive cells may
also address the antigenic protein to different pathways (54, 55, 56). 4)
MHC class II molecules undergo a reversible conformational change at
acidic pH. This modification is associated with an increased ability to
bind peptides (57, 58). Thus, I-Ek, I-Ed, and
I-Ak optimally bind peptides at pH 4.5 (58, 59, 60, 61, 62, 63). However,
the I-Ad molecule undergoes a structural change at pH 7 to
7.5 and can bind peptides at neutral pH (58). Its binding capacity is
optimal at pH 5.5 (59, 60, 64). Runnels et al. (58) speculated that
loading of the I-Ad molecule may occur in a cellular
compartment with a higher pH than for other MHC class II molecules.
Thus, the ID and SD regions may interact in two different compartments
with their MHC presenting molecules, I-Ed and
I-Ad, respectively. (5) The murine MHC class II molecule
H-2O is a lysosomal resident protein associated with H-2 M (65). Its
expression is limited to B cells and thymic epithelium, without
detectable expression in macrophages and DC (66, 67). It has been
suggested that H-2O may regulate H-2 M function in B cells (65). DM
catalyzes the removal of Ii-derived CLIP peptides from MHC class
II-CLIP complexes (68, 69) and facilitates antigenic peptides loading
(70, 71). Interestingly, it has been shown that HEL epitope 1125 was
Ii dependent (72, 73). Thus, it can be speculated that H-2O may enhance
presentation of this epitope via the H-2 M function on CLIP removal in
B cells and thymic epithelium. Since medullary thymic epithelium can
efficiently induce CD4 T cell tolerance (74), this effective
presentation may also fit our previous results showing that this region
is very efficient at inducing T cell tolerance in HEL transgenic
mice (11).
Physiologic relevance
The preferential presentation of the HEL ID determinant by DC is likely to result in the focusing of the immune response against this particular region. DC are more potent activators of naive T cells than any other known MHC class II-positive cells, including macrophages or B lymphocytes. This property of DC is probably due to the expression of high levels of MHC class II, adhesion, and CD80/86 molecules, as well as to the production of cytokines such as IL-12 (75). Furthermore, immunogenic fragments of exogenous proteins are preferentially found on DC after i.v. injection of Ag (76) or after s.c. administration of HEL in CFA (31, 77). In the latter case, DC and not B lymphocytes expressed the HEL ID determinant associated with I-Ed molecules. Our results show that DC do not efficiently present the SD epitope HEL 731. We also observe that HEL 731-specific T lymphocytes are primed by HEL immunization, because in vitro recall by HELµ reveals a specific response against this region, suggesting either that DC do present a small amount of HEL 731 undetectable by our T cell assay or that activated B lymphocytes that develop in lymph nodes present both the ID and SD epitopes. We cannot rule out the first hypothesis, but we favor the second one. Although the role of B cells as effective APCs for naive CD4+ T cells is still in debate, the following evidence lends support to our preference for the second hypothesis. Thus, reduced priming to protein Ags was observed in mice lacking B lymphocytes (78); and Ag-specific B cells are capable of concentrating and processing Ags as well as expressing B7.2 molecules as a consequence of cross-linking of their surface Ig receptors (78, 79, 80).
In conclusion, while DC may focus the immune responses against a limited number of antigenic determinants, we hypothesize that activated B cells on the contrary will diversify it, as suggested by Mamula et al. for the cytochrome c model (81, 82). In agreement with this proposal, we found that after multiple challenges with HEL, T cell responses spread to SD epitopes such as 731 (L. Gapin, unpublished observations). Further work is under way to determine precisely which subset of APCs is involved in the diversification of the T cell response to HEL and how general this phenomenon may be.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Both authors have contributed equally to this work. ![]()
3 Present address: Immunology Branch, Department of Health and Human Services, National Cancer Institute-National Institutes of Health, Bethesda, MD. ![]()
4 Address correspondence and reprint requests to Dr. Jean Kanellopoulos, Laboratoire de Biologie Moléculaire du Gène, INSERM U277-Institut Pasteur, 28 rue du Dr Roux, 75724 Paris Cedex 15, France. E-mail address: ![]()
5 Abbreviations used in this paper: ID, immunodominant; HEL, hen egg-white lysozyme; SD, subdominant; DC, dendritic cells; LNC, lymph node cells; SC, spleen cells; GM-CSF, granulocyte-macrophage CSF; CDR3, complementarity-determining region 3; PPD, purified protein derivative; Ii, invariant chain; CLIP, class II-associated Ii chain peptide. ![]()
Received for publication May 15, 1997. Accepted for publication October 23, 1997.
| References |
|---|
|
|
|---|
-repressor: identification of residues critical for antigen recognition. J. Immunol. 144:4851.[Abstract]
dAßd response in H-2d congenic mouse strains. J. Immunol. 149:2323.[Abstract]
-chain usage can determine antigen-selected TCR beta-chain repertoire diversity. J. Immunol. 157:4979.[Abstract]
and ß chain transcripts reveals a nonfunctional
-mRNA of BW5147 origin. Eur. J. Immunol. 19:2269.[Medline]
ß dimers and facilitates peptide loading. Cell 82:155.[Medline]
This article has been cited by other articles:
![]() |
P. R. Menges, S. A. Jenks, E. K. Bikoff, D. R. Friedmann, Z. A. G. Knowlden, and A. J. Sant An MHC Class II Restriction Bias in CD4 T Cell Responses toward I-A Is Altered to I-E in DM-Deficient Mice J. Immunol., February 1, 2008; 180(3): 1619 - 1633. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Fazilleau, J.-P. Cabaniols, F. Lemaitre, I. Motta, P. Kourilsky, and J. M. Kanellopoulos V{alpha} and V{beta} Public Repertoires Are Highly Conserved in Terminal Deoxynucleotidyl Transferase-Deficient Mice J. Immunol., January 1, 2005; 174(1): 345 - 355. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Attanavanich and J. F. Kearney Marginal Zone, but Not Follicular B Cells, Are Potent Activators of Naive CD4 T Cells J. Immunol., January 15, 2004; 172(2): 803 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Lore, M. R. Betts, J. M. Brenchley, J. Kuruppu, S. Khojasteh, S. Perfetto, M. Roederer, R. A. Seder, and R. A. Koup Toll-Like Receptor Ligands Modulate Dendritic Cells to Augment Cytomegalovirus- and HIV-1-Specific T Cell Responses J. Immunol., October 15, 2003; 171(8): 4320 - 4328. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kawahata, Y. Misaki, M. Yamauchi, S. Tsunekawa, K. Setoguchi, J.-i. Miyazaki, and K. Yamamoto Peripheral Tolerance to a Nuclear Autoantigen: Dendritic Cells Expressing a Nuclear Autoantigen Lead to Persistent Anergic State of CD4+ Autoreactive T Cells After Proliferation J. Immunol., February 1, 2002; 168(3): 1103 - 1112. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Y. Choi, Y. Yoshimura, G. J. Christianson, T. J. Sproule, S. Malarkannan, N. Shastri, S. Joyce, and D. C. Roopenian Quantitative Analysis of the Immune Response to Mouse Non-MHC Transplantation Antigens In Vivo: The H60 Histocompatibility Antigen Dominates Over All Others J. Immunol., April 1, 2001; 166(7): 4370 - 4379. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shimizu, E. K. Thomas, M. Giedlin, and J. J. Mulé Enhancement of Tumor Lysate- and Peptide-pulsed Dendritic Cell-based Vaccines by the Addition of Foreign Helper Protein Cancer Res., March 1, 2001; 61(6): 2618 - 2624. [Abstract] [Full Text] |
||||
![]() |
M. Podmore, J.L. Ebersole, and D.F. Kinane Immunodominant Antigens in Periodontal Disease: a Real or Illusive Concept? Critical Reviews in Oral Biology & Medicine, January 1, 2001; 12(2): 179 - 185. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Laouini, A. Casrouge, S. Dalle, F. Lemonnier, P. Kourilsky, and J. Kanellopoulos V{beta} T Cell Repertoire of CD8+ Splenocytes Selected on Nonpolymorphic MHC Class I Molecules J. Immunol., December 1, 2000; 165(11): 6381 - 6386. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Nanda and A. J. Sant Dm Determines the Cryptic and Immunodominant Fate of T Cell Epitopes J. Exp. Med., September 18, 2000; 192(6): 781 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Delves and I. M. Roitt The Immune System- Second of Two Parts N. Engl. J. Med., July 13, 2000; 343(2): 108 - 117. [Full Text] [PDF] |
||||
![]() |
W. Wienhold, G. Malcherek, C. Jung, S. Stevanovic, G. Jung, H. Schild, and A. Melms An example of immunodominance: engagement of synonymous TCR by invariant CDR3{beta} Int. Immunol., June 1, 2000; 12(6): 747 - 756. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Matsuda, L. Gapin, B. C. Sydora, F. Byrne, S. Binder, M. Kronenberg, and R. Aranda Systemic Activation and Antigen-Driven Oligoclonal Expansion of T Cells in a Mouse Model of Colitis J. Immunol., March 1, 2000; 164(5): 2797 - 2806. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Foucras, L. Gapin, C. Coureau, J. M. Kanellopoulos, and J.-C. Guery Interleukin 4-Producing Cd4 T Cells Arise from Different Precursors Depending on the Conditions of Antigen Exposure in Vivo J. Exp. Med., February 21, 2000; 191(4): 683 - 694. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Cambiaggi, S. Darche, S. Guia, P. Kourilsky, J.-P. Abastado, and E. Vivier Modulation of T-Cell Functions in KIR2DL3 (CD158b) Transgenic Mice Blood, October 1, 1999; 94(7): 2396 - 2402. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-K. Kim, M. Angevine, K. Demick, L. Ortiz, R. Rudersdorf, D. Watkins, and R. DeMars Induction of HLA Class I-Restricted CD8+ CTLs Specific for the Major Outer Membrane Protein of Chlamydia trachomatis in Human Genital Tract Infections J. Immunol., June 1, 1999; 162(11): 6855 - 6866. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Coutinho-Silva, P. M. Persechini, R. D. C. Bisaggio, J.-L. Perfettini, A. C. T. D. S. Neto, J. M. Kanellopoulos, I. Motta-Ly, A. Dautry-Varsat, and D. M. Ojcius P2Z/P2X7 receptor-dependent apoptosis of dendritic cells Am J Physiol Cell Physiol, May 1, 1999; 276(5): C1139 - C1147. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Carson, D. D. Desai, K. M. Vignali, and D. A. A. Vignali2 Cutting Edge: Immunoregulation of Th Cells by Naturally Processed Peptide Antagonists J. Immunol., January 1, 1999; 162(1): 1 - 4. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Drakesmith, D. O'Neil, S. C. Schneider, M. Binks, P. Medd, E. Sercarz, P. Beverley, and B. Chain In vivo priming of T cells against cryptic determinants by dendritic cells exposed to interleukin 6 and native antigen PNAS, December 8, 1998; 95(25): 14903 - 14908. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gapin, Y. Fukui, J. Kanellopoulos, T. Sano, A. Casrouge, V. Malier, E. Beaudoing, D. Gautheret, J.-M. Claverie, T. Sasazuki, et al. Quantitative Analysis of the T Cell Repertoire Selected by a Single Peptide-Major Histocompatibility Complex J. Exp. Med., June 1, 1998; 187(11): 1871 - 1883. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Dai, S. Carmicle, N. K. Steede, and S. J. Landry Structural Basis for Helper T-cell and Antibody Epitope Immunodominance in Bacteriophage T4 Hsp10. ROLE OF DISORDERED LOOPS J. Biol. Chem., January 4, 2002; 277(1): 161 - 168. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Matsuda, L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, and M. Kronenberg Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor beta repertoire and small clone size PNAS, October 23, 2001; 98(22): 12636 - 12641. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |