The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gapin, L.
Right arrow Articles by Kanellopoulos, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gapin, L.
Right arrow Articles by Kanellopoulos, J.
The Journal of Immunology, 1998, 160: 1555-1564.
Copyright © 1998 by The American Association of Immunologists

Antigen Presentation by Dendritic Cells Focuses T Cell Responses Against Immunodominant Peptides: Studies in the Hen Egg-White Lysozyme (HEL) Model1

Laurent Gapin2, Yolanda Bravo de Alba2, Armanda Casrouge, Jean Pierre Cabaniols3, Philippe Kourilsky and Jean Kanellopoulos4

Laboratoire de Biologie Moléculaire du Gène, INSERM U277, Institut Pasteur, Paris, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
T lymphocyte responses to a protein Ag are restricted to a limited number of determinants and not to all peptides capable of binding to MHC class II molecules. This focusing of the immune response is defined as immunodominance and has been observed with numerous protein Ags. In the H-2d haplotype, hen egg-white lysozyme (HEL)-specific T lymphocytes react with I-Ed-restricted peptides derived from a single immunodominant (ID) region (HEL 103–117). Moreover, we have recently found that another region of HEL (HEL 7–31) binds to I-Ad molecules and is efficiently processed and presented by splenocytes. HEL7-31 is as tolerogenic as the ID region in HEL transgenic mice. The present report demonstrates that the subdominance of the HEL 7–31 region is not due to a defect in the T cell repertoire, since specific TCRs can be found in all BALB/c mice. We show that normal and lymphoma B cells present efficiently HEL regions 103–117 and 7–31, whereas dendritic cells favor the ID region only. These results suggest that dendritic cells play a major role in the focusing of the immune response against a few antigenic determinants, while B lymphocytes may diversify the T cell response by presenting a more heterogeneous set of peptide-MHC complexes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CD4+ T helper lymphocytes recognize MHC class II molecules associated with immunogenic peptides derived from intracellular processing of proteins by APCs. Among all the peptides generated by proteolytic cleavage, only those capable of binding to MHC class II molecules are potentially immunogenic. However, T cell responses are focused on a restricted number of determinants rather than on all presentable epitopes. This focusing of the immune response, defined as immunodominance, has been observed with various protein Ags (1, 2, 3, 4, 5, 6). Gammon et al. (7) have shown that in T cell responses against HEL, a hierarchy among immunogenic peptides exists. Several factors affecting the hierarchy of T cell determinants have been reviewed recently (8).

In the H-2d haplotype, HEL-specific T cell response is consistently focused against the single immunodominant (ID)5 determinant 103–117 presented by I-Ed MHC class II molecules (9, 10, 11, 12). In addition, after immunization with HEL, 15-mer peptides from HEL region 7–31 are also capable of stimulating weak responses in vitro in a small percentage of BALB/c mice (11, 13). Thus, HEL 7–31 is considered a subdominant (SD) region in these mice. Immunodominance of HEL region 103–117 in H-2d mice has been extensively studied by Sercarz’s group (7, 13, 14). It was proposed that during its unfolding, the HEL molecule was "captured" in the groove of I-Ed molecules via binding of its ID region. This region was then protected from proteolysis while other determinants, such as 7–31, were degraded (13). However, we have recently reported that HEL region 7–31 is presented efficiently by splenocytes to specific T cell hybridomas (11) and that it binds to I-Ad molecules (L. Gapin, unpublished observations). Furthermore, HEL 7–31 is as tolerogenic as the ID region in HEL transgenic mice (11). Taken together, these results suggest that subdominance of this epitope is not due to a general processing defect.

Alternative explanations to the subdominance of this region could be a defect 1) in the processing of this epitope by APCs involved in the initiation of immune responses or 2) in the T cell repertoire resulting from the presence of lower affinity and/or lower frequency clones.

We (15, 16, 17) and others (18, 19, 20, 21, 22, 23, 24, 25) have previously shown that T cells specific for ID determinants express TCRs with Vß-Jß rearrangements common to all mice or humans of the same MHC haplotype. These rearrangements were defined as public, while private ones were also observed, with Vß-Jß rearrangements different from one individual to the other (15, 19, 26).

Dissection of the mechanisms underlying immunodominance is essential for elucidating the rules that govern the T cell response in autoimmune diseases (27), vaccination (28), transplantation (29) or antitumor immune responses (30). Here, we have analyzed extensively the role of T cell repertoire and Ag processing by different APC populations in the subdominance of the 7–31 HEL determinant.

We first determined whether the subdominance of this determinant was due to the presence of a private repertoire instead of a public one. Our results show that the TCR recognizing this HEL region is highly homogeneous for both V{alpha}-J{alpha} and Vß-Jß rearrangements. Furthermore, these rearrangements are highly conserved and are found in all BALB/c mice. Hence, a defect in the T cell repertoire cannot be involved in the subdominance of this epitope.

We then compared the presentation of HEL regions 103–117 and 7–31 by different APCs. Indeed, it was shown recently that only dendritic cells (DC) presented antigenic complexes to MHC class II-restricted T cells following s.c. immunization of Ag emulsified in CFA (31). Thus, a limitation in the number of determinants presented by DC may focus T cell responses to immunodominant regions of antigenic proteins. Here, we show that normal and lymphoma B cells present both regions 103–117 and 7–31 efficiently, whereas DC favor the ID 103–117 region. These results suggest that DC play a major role in the focusing of the immune response against a few antigenic determinants, while B lymphocytes may diversify the T cell responses by presenting a more heterogeneous set of peptide-MHC complexes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

BALB/c By/Rj mice (H-2d), 8 to 12 wk of age, were purchased from Centre d’Elevage Robert Janvier (Laval, France) and maintained at the Pasteur Institute or Centre de Sélection et d’Elevage de Animaux de Laboratoire (Orleans, France) animal facilities.

Antigens

Molecular biology grade HEL protein was purchased from Appligene (Illkirch, France). The mutated form of HEL used in this study (HELµ) has been previously described (11). Briefly, three mutations were introduced into the HEL cDNA using PCR methodology. Positions 113 (N->A), 114 (R->H), and 116 (K->Q) of HEL were replaced by the homologous residues found in the mouse lysozyme sequence. Peptides with purity >70% were purchased from Neosystem Laboratories (Strasbourg, France). Mice were immunized in the hind footpads with 3.5 nmol of protein in PBS emulsified 1:1 with CFA. Nine days later, popliteal lymph nodes were collected, and lymph node cells (LNC) were cultured in a 5% CO2 incubator (5 x 105 cells/well) in FCS-free HL-1 medium (Ventrex Laboratories, Portland, ME) supplemented with 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin with 10 µM Ag for 4 days.

Cell lines and T cell hybridomas

The D2SC/1 H-2d is a DC line (generous gift from Dr. P. RicciardiCastagnoli, Cellular and Molecular Pharmacology Center, Milan, Italy) obtained by retroviral immortalization of BALB/c mouse spleen cells (32). Surface markers and the Ag presentation capacity of D2SC/1 have been published elsewhere (33, 34). All cells were grown in RPMI 1640 (Life Technologies, Cergy Pontoise France) supplemented with 100 U/ml penicillin, 100 mg/ml streptomycin, 10 mM L-glutamine, 1 mM sodium pyruvate, 50 µM ß2-ME, and 10% FCS at 37°C in 5% CO2. For the Ag presenting assays, cells were plated at a concentration of 3 x 105/ml and stimulated with 200 U/ml mouse rIFN-{gamma} (Genzyme Diagnostics, Cambridge, MA) and 2 ng/ml mouse rGM-CSF (Genzyme Diagnostics) for 48 h at 37°C. To harvest the differentiated and strongly adherent DC, cells were washed with PBS and trypsinized for 20 to 30 min at 37°C. The A20 (H-2d) B cell lymphoma line was also used as APC. The T cell hybridomas B9.1 specific for the ID peptide HEL 103–117 (12), and CABII.43, specific for the SD peptide HEL 7–31 (11), were used to detect presentation of these two epitopes after processing of HEL by different APC.

Antibodies

The Abs used in this study were: anti-CD3{epsilon}-FITC (PharMingen, San Diego, CA); anti-mouse CD45R/B220-phycoerythrin (PE) (PharMingen); polyclonal anti-mouse µIg (Interchim, Asnicres, France); anti-CD11c, N418 (a generous gift from J.-C. Guéry, INSERM U28, Toulouse, France); anti-DC 33D1 (American Type Culture Collection, Rockville, MD); and anti-I-Ab,d biotinylated (PharMingen). The CD32/CD16 Fc Block (PharMingen) was used to block nonspecific staining. Determination of B220- and N418-positive cells in the spleen was done by staining with anti-CD3{epsilon}-FITC, anti-CD45R/B220-PE, N418-biotin, and 33D1-biotin mAbs. Cell surface fluorescence was analyzed by flow cytometry using a FACScan (Becton Dickinson, San Jose, CA).

APC preparations

DC were prepared with minor modifications as described elsewhere (35). Briefly, splenocytes were obtained from 10 BALB/c mice after disrupting spleens and incubating stromal fragments for 45 min at 37°C with 400 U/ml collagenase type IV (Clostridium histolyticum, Sigma, Saint Quentin Fallavier, France). The cells were washed and incubated in petri dishes in complete medium 90 min at 37°C at a concentration of 2 x 107 cells/dish (Primaria culture dish, 100 x 20 mm, Becton Dickinson). Plates were then washed three times, and nonadherent cells were removed. Floating DC were recovered after overnight culture at 37°C. Contaminating B cells were removed by two rounds of depletion with anti-B220 Ab and sheep anti-rat Ig-coated Dynabeads M-450 (Dynal, Oslo, Norway) at a 40:1 bead:cell ratio. After a 30-min incubation at 0°C, the beads were removed magnetically. FACS analysis showed no B cell contamination in DC preparations.

B cells were purified from splenocytes using goat anti-mouse Ab-coated dishes. Plates (Optilux, 100 x 15 mm, Becton Dickinson) were pretreated with 6 ml of a 5 µg/ml solution of purified anti-µIg Abs, pH 9.5, 0.05 M Tris, 0.15 M NaCl buffer, for 18 h at 4°C. Plates were washed with PBS to remove excess Abs. Ten million SC were incubated for 70 min at 4°C in the plates with gentle swirling to redistribute cells. Nonadherent cells were harvested by washing gently six times with cold complete medium. Adherent cells were detached with a silicon rubber policeman. Purity of the B cell population was assessed by FACS analysis and found to be >=90%.

Hybridoma stimulation assays

The APC were incubated into 96-well tissue culture plate (105 cells/well) with HEL or HEL peptide and specific T cell hybridomas (105/well). After 24 h of culture, IL-2 secretion into the supernatant was measured by proliferation of IL-2-dependent CTLL-2 cells. Proliferation was assessed by [3H]TdR incorporation (1 µCi/ml). The cells were collected onto glass fiber filters with an automated multisample harvester (Skatron Instruments, Sterling, VA), and the radioactivity was measured with a beta counter (Beckman Instruments, Fullerton, CA). All assays were performed in triplicate.

Determination of ß- and {alpha}-chain sequences of TCR from T cell hybridomas

mRNA from T cell hybridomas was extracted using the Quick mRNA MicroPrep Kit (Pharmacia, Piscataway, NJ). RNAs were reverse transcribed into cDNA using a cDNA synthesis kit (Boehringer Mannheim, Mannheim, Germany). RNAs were denatured at 70°C for 10 min, then incubated with random primers (5 µM), dNTP (1 mM), RNasin (40 U; Promega, Madison, WI), and 2 U of AMV reverse transcriptase (from Boehringer Mannheim) at 43°C for 1 h, followed by incubation at 53°C for 10 min. PCR were conducted in 50 µl (1/60) of the cDNA with 2 U of Taq polymerase (Promega) in the supplier’s buffer. Sense oligonucleotides specific for each of the 23 Vß chains, the 19 V{alpha} chains, and antisense oligonucleotides for Cß and C{alpha} have been described (17, 22, 36). Forty cycles, each at 94°C for 30 s, 60°C for 45 s, and 72°C for 45 s were completed in a 9600 Perkin-Elmer Automate (Perkin-Elmer, Foster City, CA). PCR products were analyzed on a 2% agarose gel stained with ethidium bromide. Amplified ß and {alpha} cDNAs were then sequenced using the Sequenase PCR product sequencing kit (U.S. Biochemical Corp., Cleveland, OH) according to the manufacturer’s instructions.

T cell repertoire analysis with the Immunoscope

mRNA from LNC stimulated as described in the figure legends was extracted using the Quick mRNA MicroPrep Kit (Pharmacia) and reverse transcribed into cDNA using a cDNA synthesis kit (Boehringer Mannheim). PCR was conducted in 50 µl on 1/60 of the cDNA with 2 U of Taq polymerase (Goldstar; Eurogentec, Seraing, Belgium) in the supplier’s buffer. Each amplified product was then used as a template for elongation reaction with oligonucleotides labeled with a fluorescent tag (run-off reactions) as described (15, 17). Fluorescent primers used in this study are: Cß5', CTTGGGTGGAGTCACATTTCTC; Jß1.5, GAGTCCCCTCTCCAAAAAGCG; Jß2.7, CTAAAACCGTGAGCCTGGTGC; anti-(103–117) CDR3-specific, AAGCGGAGCCTGGTTGTTCCCTGTCCC;anti-(7–31) CDR3-specific, GAAGTACTGTTCATAACCCCCCAGTC; C{alpha}b, ACACAGCAGTGTCTGGGTTC; and J{alpha}49, CTGGACTCACTGTGAGCTTTGC. The fluorescent run-off products, corresponding to the elongation of V segment PCR products with various CDR3 sizes, were loaded on polyacrylamide gels and subjected to electrophoresis in an automated DNA sequencer. The CDR3 size distribution and signal intensities were then analyzed with Immunoscope software (37).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The V{alpha} and Vß T cell rearrangements against HEL region 7–31 are highly homogeneous

To characterize the TCR repertoire of T lymphocytes specific for HEL SD region 7–31, we used two strategies: 1) we produced T cell hybridomas specific for this region and sequenced their TCR {alpha}- and ß-chains; 2) we applied the immunoscope method, previously described (15, 16, 17, 37, 38), to detect amplified Vß and V{alpha} rearrangements.

First, we sequenced TCR {alpha}- and ß-chain transcripts from six independent T cell hybridomas that recognize region 7–31 in the context of MHC class II molecules. The V{alpha} and Vß nucleotide and amino acid sequences from each hybridoma are shown in Tables I and II, respectively. Among the six HEL 7–31-specific T cell hybridomas tested, four use a Vß8.2-Jß2.7 rearrangement with a CDR3 length of nine amino acid residues. Three of these four T cell hybrids have different nucleotide sequences and therefore derive from independent T cell clones. Importantly, six of the nine amino acid residues from the CDR3 Vß loops are highly conserved: G, R, G, Y, E, and Q. Furthermore, the V{alpha} rearrangements from the Vß8.2-Jß2.7 T cell hybrids are highly restricted to the V{alpha}13 region and to the homologous J{alpha}48 and J{alpha}49 segments. Six of the nine amino acid residues from the {alpha}-chain CDR3 sequences are conserved: S, E, Q, G, K, and L. Altogether, these results show that the TCR repertoire of HEL 7–31-specific hybridomas is highly homogeneous. Strong selection must occur during the immune response against the HEL 7–31 epitope, since amino acid residues from both {alpha} and ß CDR3 sequences are highly conserved even though nucleotide sequences from both V{alpha}-J{alpha} and Vß-Jß rearrangements are different.

Because of a possible bias in the hybridoma sampling, we could not ascertain whether this homogeneous TCR usage reflects the in vivo situation accurately. Thus, we determined whether the Vß8.2-Jß2.7 and V{alpha}13-J{alpha}49 rearrangements were present in T cell responses of BALB/c mice against HEL 7–31.

The Vß and V{alpha} rearrangements in T cells that respond against HEL region 7–31 are both public

We immunized several BALB/c mice with HEL in CFA and recalled their LNC in vitro with a mutant HEL (HELµ) that lacks the immunodominant region 103–117 (11). This protocol of immunization has previously been shown to be efficient for generating T lymphocytes specific for the HEL region 7–31 (11). In Figure 1Go, a typical experiment obtained with the LNC from one BALB/c mouse is shown. Briefly, the RNA extracted from in vitro HELµ- or PPD (control)-stimulated LNC was reverse transcribed into cDNA, and aliquots were amplified by PCR with Vß8.2 and Cß- or V{alpha}13 and C{alpha}-specific primers. The product from each PCR was then divided into five aliquots, which were hybridized with one of the dye-labeled oligonucleotides specific for Cß, Jß2.7, C{alpha}, or J{alpha} 49 and the CDR3-specific sequence of the Vß chain from a T cell hybridoma anti-SD peptide 7–31. A run-off reaction was performed, and the fluorescent run-off products were analyzed in an automated DNA sequencer. In C{alpha} or Cß run-off products, a typical Gaussian distribution was observed for HELµ- or PPD-stimulated lymphocytes (Fig. 1Go). However, with Jß 2.7- and CDR3-specific primers, the peak with a CDR3 of nine amino acids was clearly increased in response to HELµ. In contrast, no peaks were observed in the PPD control. This experiment shows that in response to region 7–31 (revealed by HELµ), T cells bearing a Vß8.2-Jß2.7 rearrangement with a characteristic CDR3 are expanded. Similarly, with the J{alpha}49-specific primer, a unique peak with a CDR3 of nine amino acids was detected in this response (Fig. 1Go).



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 1. Profiles of the fluorescent run-off products obtained with LNC of BALB/c mouse. One mouse was immunized with HEL in CFA, and LNC were harvested 9 days later and recalled in vitro with HELµ or PPD as a control. After 4 days in culture, RNAs from LNC were extracted and reverse transcribed, and the cDNAs were amplified with sense Vß8.2 or V{alpha}13 primers and antisense Cß- or C{alpha}-specific primers, respectively. Five fluorescent antisense-specific primers (as indicated in the left margin of this figure) were used for run-off reactions to reveal specific expansion. The intensity of fluorescence is represented in arbitrary units as a function of the size of the ssDNA fragments. In vitro recall with HELµ or PPD is shown in the left and right panels, respectively.

 
The V{alpha} rearrangements of TCRs from ID-specific T cell hybridomas are diverse

We have previously described the Vß repertoire of T cell hybridomas specific for the ID region of HEL presented by the I-Ed molecule. The Vß sequences of these T cell hybridomas have been published (15) and are shown in Table IIGo for comparison purposes only. To determine whether the V{alpha}-J{alpha} usage of this hybridoma collection is as restricted as the one that is used in response to HEL 7–31, we sequenced the V{alpha} chains from 11 hybridomas. As shown in Table IGo, the V{alpha}-J{alpha} usage is heterogeneous. Furthermore, hybridomas C6.2 and M3.13, which share the characteristic public rearrangement Vß8.2-Dß1.1-Jß1.5, use two different V{alpha} chains. Although the nonfunctional V{alpha} chain (39) from the fusion partner BW5147 of the M3.13 hybridoma has been amplified, the sequence of the M3.13-specific V{alpha} chain could not be determined, since none of our V{alpha} primers could amplify it. These data were reproducible on different functional M3.13 clones. Thus, we are confident that this result is significant and that the {alpha}-chain of this hybridoma belongs to a family that is not recognized by our primers. Among the 10 hybridomas bearing Vß8.2 chains, only 2 have CDR3 sequence homology (G8.25 and B11.1, cf. Table IIGo) but they use different V{alpha} segments (V{alpha}18 vs V{alpha}1). Altogether, these results show that the V{alpha} repertoire of TCR from ID-specific T cell hybridomas is diverse.


View this table:
[in this window]
[in a new window]
 
Table II. Amino acid sequences of Vß and V{alpha} CDR3 regions1

 

View this table:
[in this window]
[in a new window]
 
Table I. Nucleotide sequences of Vß and V{alpha} CDR3 regions1

 
HEL immunization primes T lymphocytes specific for both HEL regions 103–117 and 7–31

Next, we investigated the presence of HEL 7–31- and 103–117-specific TCR public repertoires in mice immunized with HEL and recalled in vitro with various Ags (Fig. 2Go). When HEL-primed LNC were stimulated in vitro with HEL, a major expansion with a CDR3 size of eight amino acids was observed with Jß1.5 and anti-(103–117) CDR3-specific primers (Fig. 2Go, f and n), whereas no responses to peptide 7–31 were detected with Jß2.7 and anti-(7–31) CDR3-specific primers (Fig. 2Go, j and r). However, after in vitro recall with HELµ, a peak increase with a CDR3 size of nine amino acids was seen with Jß2.7 primers (panel k), which was not observed after in vitro stimulation with HEL or PPD (panels j and l, respectively). Furthermore, with the CDR3-specific primer, a single peak was detected (panel s) in HELµ-stimulated cells only.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 2. Profiles of the fluorescent run-off products obtained from HEL-primed LNC of BALB/c mouse stimulated in vitro with HEL, HELµ, PPD, or control medium. After 4 days in culture, RNAs from LNC were extracted and reverse transcribed as described in Materials and Methods. The cDNAs were amplified with sense Vß8.2 and antisense Cß primers. Five fluorescent antisense primers were used for run-off reactions. Fluorescence intensity is shown in arbitrary units on the vertical axis. Size in amino acid residues of the CDR3 junctional region is indicated on the horizontal axis.

 
These experiments show that HEL immunization primes two populations of T cells. The ID-specific lymphocytes expand preferentially upon HEL recall in vitro, while the SD-specific lymphocytes grow only after subsequent in vitro challenge with HELµ, which lacks the HEL ID region. Given the evidence we had for a public repertoire against both HEL regions and for in vivo priming for both peptides, we decided to investigate the role of different APCs in the focusing of the response against only one of the two regions.

Dendritic or B cell lines generate different determinants from the same protein in vitro

DC have been shown to represent the predominant APC able to display Ag-presenting capacity after s.c. administration of Ag in adjuvant, supporting the hypothesis that DC rather than B cells are required for priming T cell-proliferative response in vivo (31). In addition, DC were described as the most efficient APC in presenting endogenous naturally processed ß2-microglobulin epitopes (40). We hypothesized that differential determinant selection of ID and SD could result from HEL processing and presentation by different APCs. To address this hypothesis, we compared T cell responses elicited following Ag processing and presentation by DC and B lymphocytes.

First, we analyzed the capacity of two H-2d APC lines, the D2SC/1 dendritic cell line and the A20 B lymphoma, to present HEL peptides to two specific T cell hybridomas. The B9.1 T cell hybridoma is specific for the ID determinant HEL 103–117 (12), and CABII.43 recognizes SD region HEL 7–31 (11). The D2SC/1 dendritic cell line needs rIFN-{gamma} and GM-CSF to express high levels of surface MHC class II molecules. The A20 B cell line has a constitutively high expression of MHC class II molecules on its surface. In both APC lines, the presence of MHC class II molecules was assessed by flow cytometry (data not shown). No differences in the levels of expression of I-Ad and I-Ed were observed between D2SC/1 cells treated with IFN{gamma} and GM-CSF and A20 lymphoma cells. Furthermore, B7.2 and CD40 molecules were found on both cell types, but in higher amounts on D2SC/1. Significant amount of B7.1 was detected only on D2SC/1 cells. Different concentrations of exogenous peptides or soluble HEL protein were used for presentation by the two APC lines.

Our results show a significant production of IL-2 by ID 103–117-specific T cell hybridoma B9.1 stimulated by the DC line D2SC/1 (Fig. 3GoA) and A20 B cells (Fig. 3GoB) exposed to either the HEL 103–117 peptide or native HEL (Fig. 3Go, A and B). Strikingly, the same activated DC line was able to present the subdominant determinant HEL 7–31 to specific CABII.43 T hybridoma cells when incubated with the corresponding peptide but not with whole HEL protein (Fig. 3GoC). In contrast, A20 B cells efficiently stimulated the IL-2 secretion of CABII.43 T cells in both cases (Fig. 3GoD). In the absence of protein or peptide, no T cell stimulation was observed. These results show that A20 B cells are able to present both HEL 103–117 and the HEL 7–31 determinants after processing of HEL, while the D2SC/1 DC line presents the HEL 103–117 but not the HEL 7–31 determinant after in vitro processing of the protein. It is important to note that the HEL 7–31-specific T cell hybridoma is optimally triggered at an HEL concentration, while the ID-specific hybridoma (B9.1) is stimulated at a 10-fold higher HEL concentration of 1 µM. Thus, the lack of presentation of the HEL 7–31 determinant by the D2SC/1 DC line cannot result from a lower sensitivity of detection of the SD-specific T cell hybridoma. The differential effect on T cell activation shows that both determinants, HEL 103–117 and HEL 7–31, are generated after in vitro processing of HEL by the B cell line, while only the HEL 103–117 determinant is generated by the DC line. This conclusion is in agreement with our previous findings (11) showing that BALB/c splenocytes present both determinants.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 3. Activation of HEL-specific T cell hybridomas by dendritic or B cell lines. The D2SC/1 DC stimulated with rIFN{gamma} and GM-CSF (A, B) or the A20 B cell line (C, D) were used to present HEL or synthetic peptides to two different T cell hybridomas directed against epitopes 103–117 or 7–31. The T cell hybridomas (105 cells/well) were cultured with APCs (105 cells/well) and incubated with increasing concentrations of synthetic peptides ({diamond}) or soluble HEL protein ({blacksquare}) for 24 h. IL-2 production reflecting T cell hybridoma activation was determined by adding culture supernatants to 104 CTL-L cells for an additional 24 h. [3H]TdR (1 µCi/well) was added during the last 8 h of culture. Data represent mean TdR incorporation (cpm) from triplicate cultures and are from one representative experiment of three conducted with similar results.

 
Splenic DC and B lymphocytes from BALB/c mice generate different determinants from the same protein in vitro

To determine whether the differential processing of HEL found with the two tumoral cell lines was similar with normal APCs, we investigated the relative capacity of purified splenic DC and B cells from naive BALB/c mice to present peptides derived from in vitro processing of HEL to specific T cell hybridomas. Our results (Fig. 4Go) show that splenic DC and B lymphocytes process and present the HEL-derived peptides in a fashion similar to D2SC/1 and A20 B cell lines, respectively. However, as splenic B cells are purified by panning on anti-Ig coated plates, it remains possible that fully resting B lymphocytes could display a different pattern of processing.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 4. Presentation of HEL to specific T cell hybridomas by dendritic and B cells isolated from BALB/c spleen cells. HEL peptides (10 µM) or soluble HEL protein (10 µM) were used to stimulate the two different T cell hybridomas directed against the 103–117 or 7–31 epitopes. Data represent mean TdR incorporation (cpm) from triplicate cultures; they are from one representative experiment of three performed with similar results. In B, the SDs for the histograms corresponding to DC-presenting HEL or HEL peptides are ± 1589 and ± 3739, respectively. These data points are too small to show up on the corresponding histograms.

 
In conclusion, after in vitro processing of HEL, splenic DC efficiently present the HEL 103–117 ID peptide but not the SD peptide HEL 7–31, while B cells are efficient in presenting both peptides (HEL 103–117 and HEL 7–31).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
These studies were undertaken to elucidate the factors that influence the immunodominance or subdominance of an antigenic determinant. We chose HEL as a model Ag, since in the H-2d haplotype only one region is ID, while another one behaves as a weak SD epitope. Strikingly, the SD epitope 1) is efficiently processed and presented by splenocytes and B lymphocytes to T cell hybridomas (11, 13), 2) binds to I-Ad molecules with an affinity comparable to other ID I-Ad-restricted peptides (L. Gapin, unpublished results), and 3) has been shown to be more tolerogenic than the ID epitope in HEL-transgenic mice (11). One explanation for the subdominance of HEL 7–31 is that there might be a defect in the T cell repertoire (i.e., lower affinity and/or lower frequency of clones). This defect might be due to the selection of private repertoires of lower affinity than the public ones, as has been suggested by us (15) and others (41). We therefore compared T cell responses and peptide presentation.

T cell responses

Two main conclusions emerge from our studies. First, the Vß-Jß and V{alpha}-J{alpha} rearrangements are public, since they are found in all mice tested. Second, these rearrangements are highly homogeneous. Several differences between the repertoires against HEL 103–117/I-Ed and 7–31/I-Ad complexes are striking. The public Vß8.2-Dß1.1-Jß1.5 rearrangement found in response to HEL103–117/I-Ed does not contain N additions, in contrast to the Vß8.2-Dß1.1-Jß2.7 segments of HEL7–31/I-Ad. The V{alpha}-J{alpha} rearrangements used in response to the SD epitope/I-Ad complexes are homogeneous, while various V{alpha}-J{alpha} segments were found in HEL 103–117/I-Ed-specific hybridomas. The public Vß8.2-Dß1.1-Jß1.5 rearrangement found in two anti-ID epitope hybridomas, which codes for the characteristic GTGNNQAP CDR3 sequence, pairs with different V{alpha}-J{alpha} segments. These findings suggest that the V{alpha}-J{alpha} segments have a much weaker contribution than the Vß chain to the recognition of the ID epitope/I-Ed complexes. On the contrary, the sequences encoding the CDR3{alpha} of anti-7–31 TCRs must be strongly selected for, since they contain N additions but yield identical or homologous protein sequences. Interestingly, it is worthwhile noting that in both CDR3ß and -{alpha}, there are N-encoded residues that are highly conserved (R in CDR3ß and E in CDR3{alpha}; Table IGo). These residues are most probably critical in the recognition of HEL 7–31/I-Ad complexes, since they are also found in the T cell hybridoma CABI.32, which uses different V-J rearrangements than the public TCRs. Thus, R and E are N-encoded in the CDR3 of Vß8.1-Jß1.5 and V{alpha}11-J{alpha}37, respectively (Table IIGo). It is important to note that the differences observed between the two sets of TCRs may be due to the structural constraints imposed by the selecting molecular complexes (i.e., HEL103–117/I-Ed vs HEL7–31/I-Ad).

The immunoscope method is a PCR-based technique that allows the measurements of the CDR3 lengths of the TCR {alpha}- and ß-chains. In naive mice, it has been shown previously that the V-J profiles give a typical bell-shaped distribution of the CDR3 lengths (17, 36). After immunization, specific clonal proliferations lead to a modification of some V-J profiles. In various antigenic models, expansions of one or a few peaks have been correlated with the appearance of specific T cell clones (15, 16, 17). The present work has shown that a public Vß8.2-Jß2.7 rearrangement of 9 amino acids is found in response to HEL 7–31/I-Ad complexes. The sensitivity of this method is inversely correlated with the frequency of the particular V-J combination in which the oligoclonal expansion occurs. For a poorly represented V-J combination, a higher signal to noise ratio can be achieved, yielding a higher sensitivity in the detection of specific expansions. Thus, it was previously found that for a Vß7-Jß2.4 rearrangement (17), a frequency of 1 in 5,000 specific T cells was detectable, while only 1 in 600 could be detected for the Vß8.2-Jß2.1 combination (17). However, the use of CDR3-specific primers increases the sensitivity of the method, since clonal frequencies of about 1 in 50,000 can be detected.

Peptide presentation

How is it then that T lymphocytes expressing the public TCRs against HEL 7–31 do not expand in response to HEL, while T cells specific for HEL 103–117 do? At least two hypotheses can be put forward: 1) the SD peptide/I-Ad complexes are unstable and thus unable to trigger efficiently T cells in the induction of an immune response; or 2) they are not produced efficiently during the processing of HEL by professional APCs involved in the induction of immune responses. The first hypothesis is unlikely in view of the results of Adams and Humphreys (42) who have shown that the half-life of biotinylated HEL 11–25/I-Ad complexes was >24 h, while surprisingly, the half-life of the ID HEL 106–117/I-Ed complexes was much shorter (6 h). On the contrary, our results strongly suggest that the second postulate is correct and that HEL peptides generated during the processing of HEL are different in DC and B lymphocytes. The latter are capable of presenting the ID peptide as well as the SD peptide. Conversely, DC generate mainly the ID peptide.

Heterogeneity in Ag processing by different APCs has been reported by Vidard et al. (43) who studied the processing of OVA by normal B lymphocytes, peritoneal macrophages, and total splenocytes. They have shown that B cells are unable to present as many OVA-derived T cell epitopes as macrophages or splenocytes. Furthermore, Michalek et al. (44) have shown that two genetically identical B lymphoma lines (A-20 and M-12) are capable of processing OVA differently. A-20 cells generate two epitopes, while M-12 presents predominantly one of them. In our studies, A-20 as well as M-12 (data not shown) and normal B cells were capable of presenting both ID and SD HEL peptides. Thus, the heterogeneity in processing appears to depend on the Ag used as well as on the APC type or differentiation stage.

Five nonexclusive mechanisms may explain why APCs process proteins differently. 1) The protease content of APCs is heterogeneous; this is supported by the work of Vidard et al. (43) who have shown that the protease inhibitor leupeptin affects differently the processing of OVA by B lymphocytes and splenocytes. The role of cytokines in the modulation of proteolytic activities was established by Froch et al. (45). They observed that bone marrow-derived macrophages treated by IFN-{gamma} or GM-CSF processed bovine insulin differently, due to an increased activity of thiol/serine proteases, resulting in proteolytic degradation of the imunogenic determinant. 2) The compartments where Ags are processed or where peptides are loaded are different in various APCs. Zhong et al. (46) have shown that different processing pathways are involved in the presentation of distinct HEL epitopes. Newly synthesized MHC class II molecules associated with the invariant chain (Ii) bind the HEL46–61 determinant, which has been generated in a lysosomal compartment containing elevated proteolytic activities and an optimal pH for its binding to I-Ak (46). On the contrary, the HEL34–45 and 116–129 peptides bind in an Ii-independent fashion to mature MHC class II molecules located in the endosomes. Interestingly, IFN-{gamma}-treated peritoneal macrophages and B cell blasts process HEL46–61 efficiently, whereas the other two epitopes are presented only by B cell blasts. The inefficient presentation by IFN-{gamma}-treated macrophages is probably related to complete digestion of HEL peptide 34–45 and 116–129 in these cells, since treatment by leupeptin or chloroquine partly restores the presentation of both determinants (46). In our experiments, the inefficient presentation of the SD peptide 7–31 by the DC is not due to IFN-{gamma} treatment, since a similar observation was made with DC isolated from normal BALB/c mice. 3) Ags are internalized through different pathways, which may vary from one APC to the other. Proteins have been shown to enter cells by macropinocytosis (47) and through lectin or mannose receptors (47, 48). Surface Ig can specifically concentrate an Ag inside B lymphocytes, increasing the chances of presenting a peptide produced in low amounts (49, 50, 51, 52, 53). Immune complexes capable of binding to FcR-positive cells may also address the antigenic protein to different pathways (54, 55, 56). 4) MHC class II molecules undergo a reversible conformational change at acidic pH. This modification is associated with an increased ability to bind peptides (57, 58). Thus, I-Ek, I-Ed, and I-Ak optimally bind peptides at pH 4.5 (58, 59, 60, 61, 62, 63). However, the I-Ad molecule undergoes a structural change at pH 7 to 7.5 and can bind peptides at neutral pH (58). Its binding capacity is optimal at pH 5.5 (59, 60, 64). Runnels et al. (58) speculated that loading of the I-Ad molecule may occur in a cellular compartment with a higher pH than for other MHC class II molecules. Thus, the ID and SD regions may interact in two different compartments with their MHC presenting molecules, I-Ed and I-Ad, respectively. (5) The murine MHC class II molecule H-2O is a lysosomal resident protein associated with H-2 M (65). Its expression is limited to B cells and thymic epithelium, without detectable expression in macrophages and DC (66, 67). It has been suggested that H-2O may regulate H-2 M function in B cells (65). DM catalyzes the removal of Ii-derived CLIP peptides from MHC class II-CLIP complexes (68, 69) and facilitates antigenic peptides loading (70, 71). Interestingly, it has been shown that HEL epitope 11–25 was Ii dependent (72, 73). Thus, it can be speculated that H-2O may enhance presentation of this epitope via the H-2 M function on CLIP removal in B cells and thymic epithelium. Since medullary thymic epithelium can efficiently induce CD4 T cell tolerance (74), this effective presentation may also fit our previous results showing that this region is very efficient at inducing T cell tolerance in HEL transgenic mice (11).

Physiologic relevance

The preferential presentation of the HEL ID determinant by DC is likely to result in the focusing of the immune response against this particular region. DC are more potent activators of naive T cells than any other known MHC class II-positive cells, including macrophages or B lymphocytes. This property of DC is probably due to the expression of high levels of MHC class II, adhesion, and CD80/86 molecules, as well as to the production of cytokines such as IL-12 (75). Furthermore, immunogenic fragments of exogenous proteins are preferentially found on DC after i.v. injection of Ag (76) or after s.c. administration of HEL in CFA (31, 77). In the latter case, DC and not B lymphocytes expressed the HEL ID determinant associated with I-Ed molecules. Our results show that DC do not efficiently present the SD epitope HEL 7–31. We also observe that HEL 7–31-specific T lymphocytes are primed by HEL immunization, because in vitro recall by HELµ reveals a specific response against this region, suggesting either that DC do present a small amount of HEL 7–31 undetectable by our T cell assay or that activated B lymphocytes that develop in lymph nodes present both the ID and SD epitopes. We cannot rule out the first hypothesis, but we favor the second one. Although the role of B cells as effective APCs for naive CD4+ T cells is still in debate, the following evidence lends support to our preference for the second hypothesis. Thus, reduced priming to protein Ags was observed in mice lacking B lymphocytes (78); and Ag-specific B cells are capable of concentrating and processing Ags as well as expressing B7.2 molecules as a consequence of cross-linking of their surface Ig receptors (78, 79, 80).

In conclusion, while DC may focus the immune responses against a limited number of antigenic determinants, we hypothesize that activated B cells on the contrary will diversify it, as suggested by Mamula et al. for the cytochrome c model (81, 82). In agreement with this proposal, we found that after multiple challenges with HEL, T cell responses spread to SD epitopes such as 7–31 (L. Gapin, unpublished observations). Further work is under way to determine precisely which subset of APCs is involved in the diversification of the T cell response to HEL and how general this phenomenon may be.


    Acknowledgments
 
The authors thank Dr. Anna Cumano, Vanessa Mallier, Dr. David Ojcius, Dr. Charles Elson, and Dr. Gilles Benichou for discussion and critical review of the manuscript.


    Footnotes
 
1 L.G. is supported by l’Association pour la Recherche contre le Cancer and Pasteur-Weizmann fellowships. Y.B.-d.A. is the recipient of a fellowship from La Société de Secours des Amis de la Science. This work was supported by grants from INSERM and l’Institut Pasteur. Back

2 Both authors have contributed equally to this work. Back

3 Present address: Immunology Branch, Department of Health and Human Services, National Cancer Institute-National Institutes of Health, Bethesda, MD. Back

4 Address correspondence and reprint requests to Dr. Jean Kanellopoulos, Laboratoire de Biologie Moléculaire du Gène, INSERM U277-Institut Pasteur, 28 rue du Dr Roux, 75724 Paris Cedex 15, France. E-mail address: Back

5 Abbreviations used in this paper: ID, immunodominant; HEL, hen egg-white lysozyme; SD, subdominant; DC, dendritic cells; LNC, lymph node cells; SC, spleen cells; GM-CSF, granulocyte-macrophage CSF; CDR3, complementarity-determining region 3; PPD, purified protein derivative; Ii, invariant chain; CLIP, class II-associated Ii chain peptide. Back

Received for publication May 15, 1997. Accepted for publication October 23, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Berkower, I., L. A. Matis, G. K. Buckenmeyer, F. R. N. Gurd, D. L. Longo, J. A. Berzofsky. 1984. Identification of distinct predominant epitopes recognized by myoglobin specific T cells under the control of different Ir genes and characterization of representative T cell clones. J. Immunol. 132:1370.[Abstract]
  2. Katz, M. E., R. M. Maizels, L. Wicker, A. Miller, E. Sercarz. 1982. Immunological focusing by the mouse major histocompatibility complex: mouse strains confronted with distantly related lysozymes confine their attention on a very few epitopes. Eur. J. Immunol. 12:535.[Medline]
  3. Finnegan, A., M. A. Smith, J. A. Smith, J. A. Berzofsky, D. H. Sachs, R. J. Hodes. 1986. The T cell repertoire for recognition of a phylogenetically distant protein antigen: peptide specificity and MHC restriction of staphylococcal nuclease-specific T cell clones. J. Exp. Med. 164:897.[Abstract/Free Full Text]
  4. Maizels, R. M., J. A. Clarke, M. A. Harvey, A. Miller, E. E. Sercarz. 1980. Epitope specificity of the T cell proliferative response to lysozyme: proliferative T cells react predominantly to different determinants from those recognized by B cells. Eur. J. Immunol. 10:509.[Medline]
  5. Shimonkevitz, R., S. Colon, J. W. Kappler, P. Marrack, H. M. Grey. 1984. Antigen recognition by H-2 restricted T cells. II. A tryptic ovalbumin peptide that substitutes for processed antigen. J. Immunol. 133:2067.[Abstract]
  6. Solinger, A. M., M. E. Ultee, E. Margoliash, R. H. Schwartz. 1979. T lymphocyte response to cytochrome c. I. Demonstration of a T cell heteroclytic proliferative response and identification of a topographic antigenic determinant on pigeon cytochrome c whose immune recognition requires two complementary immune response genes. J. Exp. Med. 150:830.[Abstract/Free Full Text]
  7. Gammon, G., H. M. Geysen, R. J. Apple, E. Pickett, M. Palmer, A. Ametani, E. E. Sercarz. 1991. T cell determinant structure: cores and determinant envelopes in three mouse major histocompatibility complex haplotypes. J. Exp. Med. 173:609.[Abstract/Free Full Text]
  8. Sercarz, E. E., P. V. Lehmann, A. Ametani, G. Benichou, A. Miller, K. Moudgil. 1993. Dominance and crypticity of T cell antigenic determinants. Annu. Rev. Immunol. 11:729.[Medline]
  9. Gammon, G., J. Klotz, D. Ando, E. E. Sercarz. 1990. The T cell repertoire to a multideterminant antigen: clonal heterogeneity of the T cell response, variation between syngeneic individuals, and in vitro selection of T cell specificities. J. Immunol. 144:1571.[Abstract]
  10. Cibotti, R., J. M. Kanellopoulos, J.-P. Cabaniols, O. Halle-Panenko, K. Kosmatopoulos, E. Sercarz, P. Kourilsky. 1992. Tolerance to a self-protein involves its immunodominant but does not involve its subdominant determinants. Proc. Natl. Acad. Sci. USA 89:416.[Abstract/Free Full Text]
  11. Gapin, L., J.-P. Cabaniols, R. Cibotti, D. M. Ojcius, P. Kourilsky, J. M. Kanellopoulos. 1997. Determinant selection for T-cell responses in HEL-transgenic mice: dissociation between immunogenicity and tolerogenicity. Cell. Immunol. 177:77.[Medline]
  12. Cabaniols, J. P., R. Cibotti, P. Kourilsky, K. Kosmatopoulos, J. M. Kanellopoulos. 1994. Dose-dependent T cell tolerance to an immunodominant self peptide. Eur. J. Immunol. 24:1743.[Medline]
  13. Apple, R., J. Clarke, J. Cogswell, G. Gammon, M. E. Katz, U. Krzych, R. Maizels, F. Manca, A. Miller, S. Nasseri, A. Oki, S. Wilbur, E. Sercarz. 1989. The causes and consequences of immunodominance at the T cell level. S. Smith-Gill, and E. Sercarz, eds. The Immune Response to Structurally Defined Proteins: The Lysozyme Model Adedine Press, Schenectady, NY.
  14. Cogswell, J. P., G. Gammon, S. Wilbur, N. Shastri, A. Miller, E. E. Sercarz. 1988. Ia-dependent selection of agretopes on the partially unfolded chicken lysozyme molecule affects subsequent processing pathways and the dominance of T cell determinants. L. B. Schook, ed. Antigen Presenting Cells 115. Liss, New York.
  15. Cibotti, R., J. P. Cabaniols, C. Pannetier, C. Delarbre, I. Vergnon, J. M. Kanellopoulos, P. Kourilsky. 1994. Public and private V beta T cell receptor repertoires against hen egg white lysozyme (HEL) in nontransgenic versus HEL transgenic mice. J. Exp. Med. 180:861.[Abstract/Free Full Text]
  16. Levraud, J. P., C. Pannetier, P. Langlade-Demoyen, V. Brichard, P. Kourilsky. 1996. Recurrent T cell receptor rearrangements in the cytotoxic T lymphocyte response in vivo against the p815 murine tumor. J. Exp. Med. 183:439.[Abstract/Free Full Text]
  17. Cochet, M., C. Pannetier, A. Regnault, S. Darche, C. Leclerc, P. Kourilsky. 1992. Molecular detection and in vivo analysis of the specific T cell response to a protein antigen. Eur. J. Immunol. 22:2639.[Medline]
  18. McHeyzer-Williams, M. G., M. M. Davis. 1995. Antigen-specific development of primary and memory T cells in vivo. Science 268:106.[Abstract/Free Full Text]
  19. Cerasoli, D. M., M. P. Riley, F. F. Shih, A. J. Caton. 1995. Genetic basis for T cell recognition of a major histocompatibility complex class II-restricted neo-self peptide. J. Exp. Med. 182:1327.[Abstract/Free Full Text]
  20. Lai, M.-Z., Y.-J. Jang, L.-K. Chen, M. L. Gefter. 1990. Restricted VDJ junctional regions in the T cell response to {lambda}-repressor: identification of residues critical for antigen recognition. J. Immunol. 144:4851.[Abstract]
  21. Sellins, K. S., J. S. Danska, V. Paragas, C. G. Fathman. 1992. Limited T cell receptor ß-chain usage in sperm whale myoglobin 110–121/E{alpha}dd response in H-2d congenic mouse strains. J. Immunol. 149:2323.[Abstract]
  22. Casanova, J.-L., J.-C. Cerottini, M. Matthes, A. Necker, H. Gournier, C. Barra, C. Widmann, H. MacDonald, F. Lemonnier, B. Malissen, J. Maryanski. 1992. H-2-restricted CTL’s specific for HLA display TcR limited diversity. J. Exp. Med. 176:439.[Abstract/Free Full Text]
  23. Maryanski, J. L., C. V. Jongeneel, P. Bucher, J. L. Casanova, P. R. Walker. 1996. Single-cell PCR analysis of TCR repertoires selected by antigen in vivo: a high magnitude CD8 response is comprised of very few clones. Immunity 4:47.[Medline]
  24. Lehner, P. J., E. C. Wang, P. A. Moss, S. Williams, K. Platt, S. M. Friedman, J. I. Bell, L. K. Borysiewicz. 1995. Human HLA-A0201-restricted cytotoxic T lymphocyte recognition of influenza A is dominated by T cells bearing the V beta 17 gene segment. J. Exp. Med. 181:79.[Abstract/Free Full Text]
  25. Argaet, V. P., C. W. Schmidt, S. R. Burrows, S. L. Silins, M. G. Kurilla, D. L. Doolan, A. Suhrbier, D. J. Moss, E. Kieff, T. B. Sculley, I. S. Misko. 1994. Dominant selection of an invariant T cell antigen receptor in response to persistent infection by Epstein-Barr virus. J. Exp. Med. 180:2335.[Abstract/Free Full Text]
  26. Turner, S. J., S. C. Cose, F. R. Carbone. 1996. TCR {alpha}-chain usage can determine antigen-selected TCR beta-chain repertoire diversity. J. Immunol. 157:4979.[Abstract]
  27. Fairchild, P. J., D. C. Wraith. 1996. Lowering the tone: mechanisms of immunodominance among epitopes with low affinity for MHC. Immunol. Today 17:80.[Medline]
  28. van der Most, R. G., A. Sette, C. Oseroff, J. Alexander, K. Murali-Krishna, L. L. Lau, S. Southwood, J. Sidney, R. W. Chesnut, M. Matloubian, R. Ahmed. 1996. Analysis of cytotoxic T cell responses to dominant and subdominant epitopes during acute and chronic lymphocytic choriomeningitis virus infection. J. Immunol. 157:5543.[Abstract]
  29. Benichou, G., R. C. Tam, L. R. B. Soares, E. V. Fedoseyeva. 1997. Indirect T-cell allorecognition: perspectives for peptide-based therapy in transplantation. Immunol. Today 18:67.[Medline]
  30. Huang, A. Y., P. H. Gulden, A. S. Woods, M. C. Thomas, C. D. Tong, W. Wang, V. H. Engelhard, G. Pasternack, R. Cotter, D. Hunt, D. M. Pardoll, E. M. Jaffee. 1996. The immunodominant major histocompatibility complex class I-restricted antigen of a murine colon tumor derives from an endogenous retroviral gene product. Proc. Natl. Acad. Sci. USA 93:9730.[Abstract/Free Full Text]
  31. Guéry, J. C., F. Ria, L. Adorini. 1996. Dendritic cells but not B cells present antigenic complexes to class II-restricted T cells after administration of protein in adjuvant. J. Exp. Med. 183:751.[Abstract/Free Full Text]
  32. Paglia, P., G. Girolomoni, F. Robbiati, F. Granucci, P. Ricciardi-Castagnoli. 1993. Immortalized dendritic cell line fully competent in antigen presentation initiates primary T cell responses in vivo. J. Exp. Med. 178:1893.[Abstract/Free Full Text]
  33. Lutz, M. B., F. Granucci, C. Winzler, G. Marconi, P. Paglia, M. Foti, C. U. Assmann, L. Cairns, M. Rescigno, P. Ricciardi-Castagnoli. 1994. Retroviral immortalization of phagocytic and dendritic cell clones as a tool to investigate functional heterogeneity. J. Immunol. Methods 174:269.[Medline]
  34. Lutz, M. B., C. U. Assmann, G. Girolomoni, P. Ricciardi-Castagnoli. 1996. Different cytokines regulate antigen uptake and presentation of a precursor dendritic cell line. Eur. J. Immunol. 26:586.[Medline]
  35. Vremec, D., M. Zorbas, R. Scollay, D. Saunders, C. F. Ardavin, L. Wu, K. Shortman. 1992. The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells. J. Exp. Med. 176:47.[Abstract/Free Full Text]
  36. Pannetier, C., M. Cochet, S. Darche, A. Casrouge, M. Zoller, P. Kourilsky. 1993. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor beta chains vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA 90:4319.[Abstract/Free Full Text]
  37. Pannetier, C., J.-P. Levraud, A. Lim, J. Even, P. Kourilsky. 1997. The Immunoscope approach for the analysis of T cell repertoire. J. R. Oksenberg, ed. The Antigen T Cell Receptor: Selected Protocols and Applications 287. Landes Bioscience, Austin, TX.
  38. Pannetier, C., J. Even, P. Kourilsky. 1995. T-cell repertoire diversity and clonal expansions in normal and clinical samples. Immunol. Today 16:176.[Medline]
  39. Letourneur, F., B. Malissen. 1989. Derivation of a T cell hybridoma variant deprived of functional T cell receptor {alpha} and ß chain transcripts reveals a nonfunctional {alpha}-mRNA of BW5147 origin. Eur. J. Immunol. 19:2269.[Medline]
  40. Guéry, J. C., L. Adorini. 1995. Dendritic cells are the most efficient in presenting endogenous naturally processed self-epitopes to class II-restricted T cells. J. Immunol. 154:536.[Abstract]
  41. de Campos-Lima, P.-O., V. Levitsky, M. P. Imreh, R. Gavioli, M. G. Masucci. 1997. Epitope-dependent selection of highly restricted or diverse T cell receptor repertoires in response to persistent infection by Epstein-Barr virus. J. Exp. Med. 186:83.[Abstract/Free Full Text]
  42. Adams, S., R. E. Humphreys. 1995. Invariant chain peptides enhancing or inhibiting the presentation of antigenic peptides by major histocompatibility complex class II molecules. Eur. J. Immunol. 25:1693.[Medline]
  43. Vidard, L., K. L. Rock, B. Benacerraf. 1992. Heterogeneity in antigen processing by different types of antigen-presenting cells: effect of cell culture on antigen processing ability. J. Immunol. 149:1905.[Abstract]
  44. Michalek, M. T., B. Benacerraf, K. L. Rock. 1989. Two genetically identical antigen-presenting cell clones display heterogeneity in antigen processing. Proc. Natl. Acad. Sci. USA 86:3316.[Abstract/Free Full Text]
  45. Frosch, S., U. Bonifas, A. B. Reske-Kunz. 1993. The capacity of bone marrow-derived macrophages to process bovine insulin is regulated by lymphokines. Int. Immunol. 5:1551.[Abstract/Free Full Text]
  46. Zhong, G., P. Romagnoli, R. N. Germain. 1997. Related leucine-based cytoplasmic targeting signals in invariant chain and major histocompatibility complex class II molecules control endocytic presentation of distinct determinants in a single protein. J. Exp. Med. 185:429.[Abstract/Free Full Text]
  47. Sallusto, F., M. Cella, C. Danieli, A. Lanzavecchia. 1995. Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: downregulation by cytokines and bacterial products. J. Exp. Med. 182:389.[Abstract/Free Full Text]
  48. Jiang, W., W. J. Swiggard, C. Heufler, M. Peng, A. Mirza, R. M. Steinman, M. C. Nussenzweig. 1995. The receptor DEC-205 expressed by dendritic cells and thymic epithelial cells is involved in antigen processing. Nature 375:151.[Medline]
  49. Lanzavecchia, A.. 1985. Antigen-specific interaction between T and B cells. Nature 314:537.[Medline]
  50. Rock, K. L., B. Benacerraf, A. K. Abbas. 1984. Antigen presentation by hapten-specific B lymphocytes. I. Role of surface immunoglobulin receptors. J. Exp. Med. 160:1102.[Abstract/Free Full Text]
  51. Davidson, H. W., C. Watts. 1989. Epitope-directed processing of specific antigen by B lymphocytes. J. Cell Biol. 109:85.[Abstract/Free Full Text]
  52. Simitsek, P. D., D. G. Campbell, A. Lanzavecchia, N. Fairweather, C. Watts. 1995. Modulation of antigen processing by bound antibodies can boost or suppress class II major histocompatibility complex presentation of different T cell determinants. J. Exp. Med. 181:1957.[Abstract/Free Full Text]
  53. Watts, C., A. Lanzavecchia. 1993. Suppressive effect of antibody on processing of T cell epitopes. J. Exp. Med. 178:1459.[Abstract/Free Full Text]
  54. Bonnerot, C., D. Lankar, D. Hanau, D. Spehner, J. Davoust, J. Salamero, W. H. Fridman. 1995. Role of B cell receptor Ig alpha and Ig beta subunits in MHC class II-restricted antigen presentation. Immunity 3:335.[Medline]
  55. Liu, K. J., V. S. Parikh, P. W. Tucker, B. S. Kim. 1993. Role of the B cell antigen receptor in antigen processing and presentation: involvement of the transmembrane region in intracellular trafficking of receptor/ligand complexes. J. Immunol. 151:6143.[Abstract]
  56. Mitchell, R. N., K. A. Barnes, S. A. Grupp, M. Sanchez, Z. Misulovin, M. C. Nussenzweig, A. K. Abbas. 1995. Intracellular targeting of antigens internalized by membrane immunoglobulin in B lymphocytes. J. Exp. Med. 181:1705.[Abstract/Free Full Text]
  57. Boniface, J. J., D. S. Lyons, D. A. Wettstein, N. L. Allbritton, M. M. Davis. 1996. Evidence for a conformational change in a class II major histocompatibility complex molecule occuring in the same pH range where antigen binding is enhanced. J. Exp. Med. 183:119.[Abstract/Free Full Text]
  58. Runnels, A. R., J. C. Moore, P. E. Jensen. 1996. A structural transition in class II major histocompatibility complex proteins at mildly acidic pH. J. Exp. Med. 183:127.[Abstract/Free Full Text]
  59. Jensen, P. E.. 1990. Regulation of antigen presentation by acidic pH. J. Exp. Med. 171:1779.[Abstract/Free Full Text]
  60. Jensen, P. E.. 1991. Enhanced binding of peptide antigen to purified class II major histocompatibility glycoproteins at acidic pH. J. Exp. Med. 174:1111.[Abstract/Free Full Text]
  61. Mouritsen, S., A. S. Hansen, B. L. Petersen, S. Buus. 1992. pH dependence of the interaction between immunogenic peptides and MHC class II molecules: evidence for an acidic intracellular compartment being the organelle of interaction. J. Immunol. 148:1438.[Abstract]
  62. Reay, P. A., D. A. Wettstein, M. M. Davis. 1992. pH dependence and exchange of high and low responder peptides binding to a class II molecule. EMBO J. 11:2829.[Medline]
  63. Sette, A., S. Southwood, D. Osullivan, F. C. A. Gaeta, J. Sidney, H. M. Grey. 1992. Effect of pH on MHC class II-peptide interactions. J. Immunol. 148:844.[Abstract]
  64. Tampe, R., H. M. McConnell. 1991. Kinetics of antigenic peptide binding to the class II major histocompatibility molecule I-Ad. Proc. Natl. Acad. Sci. USA 88:4661.[Abstract/Free Full Text]
  65. Liljedahl, M., T. Kuwana, W.-P. Fung-Leung, M. R. Jackson, P. A. Peterson, L. Karlsson. 1996. HLA-DO is a lysosomal resident which requires association with HLA-DM for efficient intracellular transport. EMBO J. 15:4817.[Medline]
  66. Wake, C. T., R. A. Flavell. 1985. Multiple mechanisms regulate the expression of murine immune response genes. Cell 42:623.[Medline]
  67. Karlsson, L., C. D. Surh, J. Sprent, P. A. Peterson. 1991. A novel class II MHC molecule with unusual tissue distribution. Nature 351:485.[Medline]
  68. Denzin, L. K., P. Cresswell. 1995. HLA-DM induces CLIP dissociation from MHC class II {alpha}ß dimers and facilitates peptide loading. Cell 82:155.[Medline]
  69. Sherman, M. A., D. A. Weber, P. E. Jensen. 1995. DM enhances peptide binding to class II MHC by release of invariant-chain derived peptide. Immunity 3:197.[Medline]
  70. Fling, S., B. Arp, D. Pious. 1994. HLA-DMA and HLA-DMB genes are both required for MHC class II/peptide complex formation in antigen presenting cells. Nature 368:554.[Medline]
  71. Morris, S., J. Shaman, M. Attaya, M. Amaya, S. Goodman, C. Bergman, J. Monaco, E. Mellins. 1994. An essential role for HLA-DM in antigen presentation by class II MHC molecules. Nature 368:551.[Medline]
  72. Stebbins, C. C., G. E. Loss, C. G. Elias, A. Chervonsky, A. J. Sant. 1995. The requirement for DM in class II-restricted antigen presentation and SDS-stable dimer formation is allele and species dependent. J. Exp. Med. 181:223.[Abstract/Free Full Text]
  73. Peterson, M., J. Miller. 1992. Antigen presentation enhanced by the alternatively spliced invariant chain gene product p41. Nature 357:596.[Medline]
  74. Salaün, J., A. Bandeira, I. Khazaal, F. Calman, M. Coltey, A. Coutinho, N. M. Le Douarin. 1990. Thymic epithelium tolerizes for histocompatibility antigens. Science 247:1471.[Abstract/Free Full Text]
  75. Steinman, R. M. 1991. The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 96.
  76. Steinman, R. M., J. W. Young. 1991. Signals arising from antigen-presenting cells. Curr. Opin. Immunol. 3:361.[Medline]
  77. Guéry, J.-C., F. Ria, F. Galbiati, S. Smiroldo, L. Adorini. 1997. The mode of protein antigen administration determines preferential presentation of peptide-class II complexes by lymph node dendritic or B cells. Int. Immunol. 1:9.
  78. Constant, S., N. Schweitzer, J. West, P. Ranney, K. Bottomly. 1995. B lymphocytes can be competent antigen-presenting cells for priming CD4+ T cells to protein antigens in vivo. J. Immunol. 155:3734.[Abstract]
  79. Ho, W. Y., M. P. Cooke, C. C. Goodnow, M. M. Davis. 1994. Resting and anergic B cells are defective in CD28-dependent costimulation of naive CD4+ T cells. J. Exp. Med. 179:1539.[Abstract/Free Full Text]
  80. Lenschow, D. J., A. I. Sperling, M. P. Cooke, G. Freeman, L. Rhee, D. C. Decker, G. Gray, L. M. Nadler, C. C. Goodnow, J. A. Bluestone. 1994. Differential up-regulation of the B7-1 and B7-2 costimulatory molecules after Ig receptor engagement by antigen. J. Immunol. 153:1990.[Abstract]
  81. Mamula, M. J., C. A. J. Janeway. 1993. Do B cells drive the diversification of immune responses?. Immunol. Today 14:151.[Medline]
  82. Roth, R., T. Nakamura, M. J. Mamula. 1996. B7 Costimulation and autoantigen specificity enable B cells to activate autoreactive T cells. J. Immunol. 157:2924.[Abstract]



This article has been cited by other articles:


Home page
J. Immunol.Home page
P. R. Menges, S. A. Jenks, E. K. Bikoff, D. R. Friedmann, Z. A. G. Knowlden, and A. J. Sant
An MHC Class II Restriction Bias in CD4 T Cell Responses toward I-A Is Altered to I-E in DM-Deficient Mice
J. Immunol., February 1, 2008; 180(3): 1619 - 1633.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Fazilleau, J.-P. Cabaniols, F. Lemaitre, I. Motta, P. Kourilsky, and J. M. Kanellopoulos
V{alpha} and V{beta} Public Repertoires Are Highly Conserved in Terminal Deoxynucleotidyl Transferase-Deficient Mice
J. Immunol., January 1, 2005; 174(1): 345 - 355.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Attanavanich and J. F. Kearney
Marginal Zone, but Not Follicular B Cells, Are Potent Activators of Naive CD4 T Cells
J. Immunol., January 15, 2004; 172(2): 803 - 811.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Lore, M. R. Betts, J. M. Brenchley, J. Kuruppu, S. Khojasteh, S. Perfetto, M. Roederer, R. A. Seder, and R. A. Koup
Toll-Like Receptor Ligands Modulate Dendritic Cells to Augment Cytomegalovirus- and HIV-1-Specific T Cell Responses
J. Immunol., October 15, 2003; 171(8): 4320 - 4328.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Kawahata, Y. Misaki, M. Yamauchi, S. Tsunekawa, K. Setoguchi, J.-i. Miyazaki, and K. Yamamoto
Peripheral Tolerance to a Nuclear Autoantigen: Dendritic Cells Expressing a Nuclear Autoantigen Lead to Persistent Anergic State of CD4+ Autoreactive T Cells After Proliferation
J. Immunol., February 1, 2002; 168(3): 1103 - 1112.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Y. Choi, Y. Yoshimura, G. J. Christianson, T. J. Sproule, S. Malarkannan, N. Shastri, S. Joyce, and D. C. Roopenian
Quantitative Analysis of the Immune Response to Mouse Non-MHC Transplantation Antigens In Vivo: The H60 Histocompatibility Antigen Dominates Over All Others
J. Immunol., April 1, 2001; 166(7): 4370 - 4379.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Shimizu, E. K. Thomas, M. Giedlin, and J. J. Mulé
Enhancement of Tumor Lysate- and Peptide-pulsed Dendritic Cell-based Vaccines by the Addition of Foreign Helper Protein
Cancer Res., March 1, 2001; 61(6): 2618 - 2624.
[Abstract] [Full Text]


Home page
CROBMHome page
M. Podmore, J.L. Ebersole, and D.F. Kinane
Immunodominant Antigens in Periodontal Disease: a Real or Illusive Concept?
Critical Reviews in Oral Biology & Medicine, January 1, 2001; 12(2): 179 - 185.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Laouini, A. Casrouge, S. Dalle, F. Lemonnier, P. Kourilsky, and J. Kanellopoulos
V{beta} T Cell Repertoire of CD8+ Splenocytes Selected on Nonpolymorphic MHC Class I Molecules
J. Immunol., December 1, 2000; 165(11): 6381 - 6386.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
N. K. Nanda and A. J. Sant
Dm Determines the Cryptic and Immunodominant Fate of T Cell Epitopes
J. Exp. Med., September 18, 2000; 192(6): 781 - 788.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
P. J. Delves and I. M. Roitt
The Immune System- Second of Two Parts
N. Engl. J. Med., July 13, 2000; 343(2): 108 - 117.
[Full Text] [PDF]


Home page
Int ImmunolHome page
W. Wienhold, G. Malcherek, C. Jung, S. Stevanovic, G. Jung, H. Schild, and A. Melms
An example of immunodominance: engagement of synonymous TCR by invariant CDR3{beta}
Int. Immunol., June 1, 2000; 12(6): 747 - 756.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. L. Matsuda, L. Gapin, B. C. Sydora, F. Byrne, S. Binder, M. Kronenberg, and R. Aranda
Systemic Activation and Antigen-Driven Oligoclonal Expansion of T Cells in a Mouse Model of Colitis
J. Immunol., March 1, 2000; 164(5): 2797 - 2806.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
G. Foucras, L. Gapin, C. Coureau, J. M. Kanellopoulos, and J.-C. Guery
Interleukin 4-Producing Cd4 T Cells Arise from Different Precursors Depending on the Conditions of Antigen Exposure in Vivo
J. Exp. Med., February 21, 2000; 191(4): 683 - 694.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Cambiaggi, S. Darche, S. Guia, P. Kourilsky, J.-P. Abastado, and E. Vivier
Modulation of T-Cell Functions in KIR2DL3 (CD158b) Transgenic Mice
Blood, October 1, 1999; 94(7): 2396 - 2402.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S.-K. Kim, M. Angevine, K. Demick, L. Ortiz, R. Rudersdorf, D. Watkins, and R. DeMars
Induction of HLA Class I-Restricted CD8+ CTLs Specific for the Major Outer Membrane Protein of Chlamydia trachomatis in Human Genital Tract Infections
J. Immunol., June 1, 1999; 162(11): 6855 - 6866.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. Coutinho-Silva, P. M. Persechini, R. D. C. Bisaggio, J.-L. Perfettini, A. C. T. D. S. Neto, J. M. Kanellopoulos, I. Motta-Ly, A. Dautry-Varsat, and D. M. Ojcius
P2Z/P2X7 receptor-dependent apoptosis of dendritic cells
Am J Physiol Cell Physiol, May 1, 1999; 276(5): C1139 - C1147.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. T. Carson, D. D. Desai, K. M. Vignali, and D. A. A. Vignali2
Cutting Edge: Immunoregulation of Th Cells by Naturally Processed Peptide Antagonists
J. Immunol., January 1, 1999; 162(1): 1 - 4.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Drakesmith, D. O'Neil, S. C. Schneider, M. Binks, P. Medd, E. Sercarz, P. Beverley, and B. Chain
In vivo priming of T cells against cryptic determinants by dendritic cells exposed to interleukin 6 and native antigen
PNAS, December 8, 1998; 95(25): 14903 - 14908.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
L. Gapin, Y. Fukui, J. Kanellopoulos, T. Sano, A. Casrouge, V. Malier, E. Beaudoing, D. Gautheret, J.-M. Claverie, T. Sasazuki, et al.
Quantitative Analysis of the T Cell Repertoire Selected by a Single Peptide-Major Histocompatibility Complex
J. Exp. Med., June 1, 1998; 187(11): 1871 - 1883.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Dai, S. Carmicle, N. K. Steede, and S. J. Landry
Structural Basis for Helper T-cell and Antibody Epitope Immunodominance in Bacteriophage T4 Hsp10. ROLE OF DISORDERED LOOPS
J. Biol. Chem., January 4, 2002; 277(1): 161 - 168.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Matsuda, L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, and M. Kronenberg
Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor beta repertoire and small clone size
PNAS, October 23, 2001; 98(22): 12636 - 12641.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gapin, L.
Right arrow Articles by Kanellopoulos, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gapin, L.
Right arrow Articles by Kanellopoulos, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS