| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Molecular Immunogenetics Section, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
On the basis of the allotypic specificities, VH regions of nearly all rabbit Igs can be placed serologically into one of three groups, namely, a, x, or y. Three VHa allotypes have been described. The a1, a2, and a3 allotypes have characteristic amino acid sequence differences in framework regions (FR) 1 (positions 5, 8, 10, 12, 13, 16, and 17) and 3 (positions 65, 67, 70, 71, 74, 75, 84, and 85) of the heavy chain VH (reviewed in Refs. 16 and 17). In the mid 80s, a mutation was described in rabbits that affected the expression of the VH genes. This mutant rabbit strain (Alicia) was derived from an a2 rabbit (18). Homozygous ali/ali rabbits exhibit altered expression of the VH genes as a result of a small deletion encompassing VH1a2, the 3'-most gene segment in the VH locus (8, 19). In homozygous ali/ali animals, the levels of a2 Ig in serum increase with age; in adult ali/ali rabbits, 20 to 50% of serum Igs and B cells bear a2 allotypic determinants.
Positive selection based on FR1 and FR3 sequences has been shown to play a role in the selective expansion of a2 allotype-bearing B cells in normal and ali/ali mutant rabbit appendix (20). In the VH mutant, at 6 wk of age, a few faintly staining clusters of a2+ cells are seen in appendix follicles. By 11 wk of age, more than half of the B cells in appendix follicles are stained by anti-a2 Abs. Positive selection may involve interactions of endogenous or exogenous superantigens with FR1 and FR3 VHa allotypic structures on the surface Ig of developing appendix B cells and lead to selective proliferation and survival (21, 22).
In ali/ali rabbits, VH1 and 
VH2
are absent due to a natural deletion (8). VH3 is also a
pseudogene. Previous studies of splenic mRNA from 2- to 8-wk-old
ali/ali rabbits suggested that the first functional gene
(VH4) or VH4-like genes had rearranged because
VH1a2-like sequences from 6-wk and older ali/ali
rabbits still had some residues that were typical of VH4
(4). A germ-line VH gene (12-1-6) was identified that
accounted for many of the alterations observed in several
ali/ali cDNA sequences (23). This gene sequence (GenBank
accession no. U18651) is almost identical to that of VH9
(GenBank accession no. U51029) (24) from another haplotype and we will
adopt this name that signifies its map order. The appearance of
sequences resembling that of VH1a2 in the spleen appeared
to result from contributions by VH9 or another similar gene
sequence via gene conversion-like alterations of the sequence of
rearranged VH4 (23). The aim of the present investigation
was to further define the molecular basis for the appearance of
VHa2 allotype-bearing B cells in mutant ali/ali
rabbits, which lack the VH1a2 gene segment by examination
of B cells in developing appendix. Our results demonstrate blocks of
gene conversion-like changes in heavy chain FR1 and FR3 from
a2+ B cells of young ali/ali rabbit appendix and
support the hypothesis that VH4 is the first gene segment
to undergo rearrangement. This is followed by diversification of FR and
CDR regions by segmental gene conversion-like events that utilize donor
sequences upstream of VH4.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Appendix was obtained from a 6-wk-old ali/ali mutant rabbit (ali-F-I haplotype) (animal no. 1NN231-2). Cell suspensions were prepared and incubated with affinity-purified polyclonal rabbit-anti-rabbit a2 allotype Ab (3) for 30 min on ice. After washing twice with PBS, the secondary FITC-conjugated Ab, goat anti-rabbit IgG, was added along with phycoerythrin-conjugated goat anti-rabbit IgM (Southern Biotechnology Associates, Birmingham, AL) and incubated again for 30 min. Cells were sorted on a FACStarPlus (Becton Dickinson, San Jose, CA) based on expression of surface IgM and a2 allotype. The two populations collected were IgM+ a2+ and IgM+ a2-.
mRNA extraction
Poly(A)+ RNA was obtained using the micro Fast Track Kit (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. To ensure that there was no genomic DNA contamination in the preparation, the RNA samples were treated with RNase-free DNase I (Boehringer Mannheim, Indianapolis, IN).
RT-PCR and cloning
mRNA was reverse transcribed and subsequently amplified with an
RNA PCR kit (Perkin Elmer, Norwalk, CT) according to the
manufacturer’s instructions except that the enzyme Pfu polymerase
(Stratagene, La Jolla, CA) was used instead of Taq DNA polymerase.
Reverse transcription was carried out using M3
(GGGGAATTCCAGAGTTGGAGATGACAGGCT) as the 3' primer
corresponding to the codons for amino acids 132–126 in the
CH1 domain of the Cµ heavy chain C region (4).
Hemi-nested PCR was performed in two rounds of 30 cycles each in a
Robocycler (Stratagene). The conditions in both rounds of PCR were:
denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and an
extension at 72°C for 2 min. The last cycle had an extension of 10
min at 72°C. The first round of amplification was performed by adding
the 5' primer (GGGGGAATTCGCTGTGCTCAAAGGTGTCCAG),
specific for the leader sequence of VH, to the reverse
transcription product. For the second round a JH consensus
primer (GGGAATTCGAGACGGTGACCAGGGTGCCT) internal to the
first round 3' primer was used. An EcoRI site (underlined)
was incorporated into each primer sequence to facilitate cloning. The
PCR products were purified with the QIAquick-spin PCR purification kit
(Qiagen, Chatworth, CA), digested with EcoRI followed by
inactivation of the enzyme by incubating at 72°C for 10 min. The band
of expected size (
400 base pairs (bp)) was purified from an agarose
gel with a QIAquick gel extraction kit (Qiagen), ligated into the
EcoRI site of the plasmid vector pUC18 using the Ready-to-go
pUC18 EcoRI/BAP + ligase (Pharmacia, Piscataway, NJ),
and transformed into Escherichia coli strain XL1-Blue MRF'
(Stratagene).
DNA sequence analyses
Plasmid DNA was recovered for sequencing from single colonies picked at random using the QIAwell 8 plus plasmid kit (Qiagen). The Prism Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) was used following the manufacturer’s instructions to sequence both strands using the M13 forward and reverse primers on an ABI model 373 automated sequencer (Applied Biosystems) (25). The sequence was analyzed by using Autoassembler version 1.3 (Applied Biosystems) and MacVector software versions 5.0 and 6.0 (Kodak Scientific Imaging Systems, Rochester, NY).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cells from the appendix of a 6-wk-old ali/ali rabbit
were sorted by flow cytometry based on the expression of surface IgM
and a2 allotype into IgM+ a2+ and
IgM+ a2- populations (Fig. 1
). Within the gates set for the sorting,
only 2.7% of the cells were IgM+ a2+ and
16.9% were IgM+ a2- (Fig. 1A).
Postsorting analyses revealed few, if any, a2- cells
within the a2+ gate but 15% could have been weakly
a2+ (Fig. 1B). Although only 30.5% of the
a2+ fraction fell within the originally set a2+
gate, 84% of the a2+ fraction stained weakly for a2 (Fig. 1C).
|
The VDJ portions of the expressed µ heavy chain were obtained
from the IgM+ a2+ and IgM+
a2- appendix cells by RT-PCR. PCR primers corresponding to
conserved sequences were used in a two-step amplification reaction in
which the second PCR relied on hemi-nesting with an internal conserved
JH primer at the 3' end of the intended DNA product. PCR
products were purified, subcloned, and clones were selected at random
for sequencing. These VDJ sequences were compared with the known rabbit
germ-line VH genes. The VDJ sequences that probably
reflected rearrangement of VH4, followed by gene
conversion-like events wherein blocks of sequences were mainly
contributed by VH5, VH6, VH7,
VH8, or VH9, were classified as
"a2+" sequences. The ones that were mainly contributed
by y33 or x32 sequences were considered to belong to the
"a2-" sequence group. Some VDJ sequences were probably
not functional because they had one or more defects such as stop
codons, frameshift mutations, or substitution of the critical cysteine
at position 92, which participates in the disulfide bond of the
VH domain. A total of 42 and 44 VDJ sequences were obtained
from the IgM+ a2+ and IgM+
a2- cells, respectively (Table I). Of these, 36 and 31 cDNAs were
classified as functional in the IgM+ a2+ and
IgM+ a2- population, respectively. The
majority (30/36) of functional cDNAs obtained from the IgM+
a2+ population reflected rearrangement of VH4
followed by gene conversion-like events involving VH5,
VH6, VH7, VH8, or VH9
as donors. By contrast, the majority (22/31) of the cDNAs from the
IgM+ a2- population were mainly contributed by
y33 sequences. The finding of 6/36 a2- sequences from the
IgM+ a2+ cells and 4/31 a2+
sequences from the IgM+ a2- cells is
consistent with the results of the postsorting analysis (see
Discussion). Each of the cDNAs reported represented a unique
VDJ rearrangement as indicated by the unique CDR3. We found one
duplicate: a pair of independently cloned sequences from the
IgM+ a2+ cell population.
|
). The nonfunctional sequences probably
result from a rearranged second allele in addition to the functional
expressed allele. a2+ cells rearrange VH4 and undergo diversification by gene conversion-like events
With one possible exception (P201), all the a2+ cloned
cDNAs appear to have been from cells that initially rearranged the
VH4 gene. In these VDJ sequences several different
DH, and 3 JH genes (JH2,
JH4, and JH6) were used. Figure 2 shows examples of cDNAs from
a2+ cells that probably rearranged VH4 and
subsequently underwent diversification by gene conversion-like events.
VH genes upstream of VH4 served as possible
sequence donors. Figure 2A shows a sequence (P109) that is
essentially identical to VH4 except for two changes: a
silent mutation at codon position 22 and a two-base change at codon 75
that leads to the replacement of leucine with glutamic acid. This
replacement is seen frequently in expressed VHa2 sequences
(15, 16). VH7 or VH9 are both possible donors
for this two-base change.
|
B). Here, the possible donor for the block
of sequence that is boxed is VH9 or a VH9-like
gene. The gene conversion-like changes in P104 led to several amino
acid residues in FR1 that correlate with the a2 allotype (16).
The rearranged VH4 can undergo more than one round of gene
conversion-like events. P232 (Fig. 2C) acquired a block in
FR1 that could have come from VH7, and the possible donor
for the block extending from CDR1 through FR2 and into CDR2 is
VH9.
In addition to introducing clustered changes in the rearranged gene,
gene conversion-like events may also introduce insertions and deletions
as exemplified by P111 (Fig. 2D) and P211 (Fig. 2E), respectively. In P111 there is an inserted codon at
position 54. P111 is another example of the acquisition of several
amino acid residues in FR1 that correlate with the a2 allotype (16). In
conclusion, sequences from a2+ cells provide evidence for
the rearrangement of VH4 and sequence alteration by gene
conversion-like mechanisms among cells developing VHa2-like
cell surface Ig.
a2+ cells have sequences in which VH9 is the most frequently used gene donor in gene conversion-like events
A summary of the donors that probably contributed stretches of
sequences to the rearranged VH4 during gene conversion-like
events in the a2+ ali B cells is shown in Figure 3. We aligned all the
functional VDJ sequences from a2+ cells with
VH4. Color coding and alignment of germ-line sequences of
five possible donor VH genes (present upstream of
VH4) with VH4 is also shown. The colored blocks
marked on the cDNA sequences from a2+ ali B
cells represent gene conversion-like events. From Figure 3 it is
evident that in a2+ cells, sequences reflecting use of
VH9 for gene conversion-like events are the most frequently
found. This is followed by VH7, VH5,
VH6, and VH8, which are also used as donors,
but less frequently. As previously suggested, mutations that may be due
to somatic hypermutation events can superimpose on the blocks of gene
conversion-like events (15). Examples are found in many of the
sequences including P102, P104, P111, P221, and P232.
|
B). A total of 10 out of 30 functional VDJ sequences
showed this gene conversion-like event. Possible donors for this gene
conversion-like event are VH7 or VH9. y33 is the most frequently rearranged gene in the a2- cells
Figure 4 summarizes the data from
all the functional a2- cDNAs from IgM+
a2- cells. The VH segments are
diagrammatically compared with germ-line y33 sequence
(top) and probable germ-line x32 and z (27) sequences
(bottom). Base changes are indicated by solid bars and
deletions by open bars. The nucleotide sequences of D and J regions and
the D-J usage are also shown in Figure 4. A total of 19 of 22 cDNAs
were y33-like. N224 and N128 were identical to germ-line y33 except for
2 and 3 nucleotide changes, respectively. N55 and N214 are y33-like
with resemblance to x32 in FR1. N124 was the only cDNA that was
predominantly x32-like. There was, however, a stretch in FR2 and part
of CDR2 that was similar to z sequence (27). N55, N214, and N124 are
functional cDNAs in that they can code for a protein that does not
appear to be defective.
|
. D5 is the most commonly used D
gene segment in this group. In none of these cDNAs were DQ52, D1a, or
D7 gene segments used. The same D gene segments were also not utilized
by the a2+ cells (Fig. 3B). A comparison of the
D gene usage in the a2+ and a2- cDNAs
indicated that the Df gene segment was used more frequently (5X) by
the a2+ vis-a-vis a2- cells (Figs. 3B and 4). Evidence for gene conversion-like events in the CDRs of VDJ sequences from a2+ and a2- cells
The gene conversion-like events that were reported in the previous
sections were accounted for by donor genes VH5 through
VH9. The examples in Figure 5
illustrate additional gene conversion-like amino acid replacements,
insertions, or deletions that affected CDR1 and CDR2. We found evidence
for gene conversion-like events in the CDRs of both a2+
(Fig. 5A) and a2- VDJ sequences (Fig. 5B). For most of these (P213, P101, N232, N120, N103, and
N6) we could find rabbit germ-line VH sequences in the
database that could have served as donors for these gene
conversion-like events. There were four instances (P111, N210, N220,
and N240) in which we did not find any germ-line rabbit VH
gene that could account for the gene conversion-like event. However,
other rabbit Ig heavy chain cDNAs shared the same insertion as in the
CDR2 of P111 or the same deletion as in the CDR1 of N210, N220, and
N240 (Fig. 5).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Postsorting results suggest that of the cells
that were gated for the IgM+ a2+ population,
some were weakly a2+. This weakly a2+
population may represent cells with surface Ig molecules that had some
residues that confer some a2+ character as recognized by
polyclonal anti-a2 Abs (Fig. 1). To become highly a2+
perhaps these weakly a2+ cells would have to undergo
additional rounds of gene conversion-like events and acquired
additional codons for amino acids characteristic of highly
a2+ Ig molecules.
We also observed six a2- sequences in the IgM+
a2+ population (Table I). This can be explained by the
results of the postsorting analysis. Postsorting analysis of the
IgM+ a2+ population suggested that 14% of the
cells were a2- (Fig. 1C). This is in good
agreement with the 16.6% (6 out of 36) a2- VDJ sequences
that we observed in the cells that were originally sorted for
IgM+ a2+ surface phenotype (Table I).
Similarly, the presence of 12.9% (4 out of 31) a2+
sequences in the IgM+ a2- population is in
accord with the estimated 15% of IgM+ a2-
sorted cells that were weakly a2+ (Fig. 1B).
VH4a2 is identical to VH1a2 in FR3. This raises
the question of whether our polyclonal anti-a2 Ab reacts with
VH4a2. It is likely that some of our anti-a2 Abs react
perhaps with low affinity because there are residues in the FR3 of
VH4a2 that are shared with VH1a2 and correlate
with a2 allotype (16). Evidence suggesting that this is likely to be
true are VDJ sequences like P109 that are almost identical to
VH4a2 (Fig. 2A). The reactivity with anti-a2
Ab probably increases as more residues (which correlate with a2
allotype) are acquired in the FR1 by gene conversion-like events.
Currently efforts are underway to express VH4 protein and
directly test whether anti-a2 Abs react with the VH4
product.
VDJ sequences from a2+ ali B cells show evidence for gene conversion-like events
There are several lines of evidence that suggest that the sequence
alterations observed in the IgM+ a2+ population
are due to gene conversion-like events. First, we are able to assign
probable donors for the blocks of sequence alteration that are seen in
the VDJ sequences; the blocks vary in size. Second, the long tracts of
multiple bp changes in the rearranged VH4 gene do not
appear to arise by the stepwise acquisition of single bp changes as no
intermediates were observed; there is evidence for more than one round
of gene conversion (Fig. 2C). Third, in addition to changes
involving sequence alteration, we also observed events involving
insertions and deletions (Fig. 2, D and E). If
the mechanism driving somatic diversification includes selection for
particular VH FR structures, then stringent selection of
somatic mutations could conceivably give us the same replacements of
allotype-associated amino acids in FR1. However, as shown in Figures 2 and 3, there are consistent bases at the third positions of the
replacement codons as well as silent changes in gene conversion-like
blocks that would be unlikely to be seen if somatic mutations were
directing the sequence changes. Gene conversion may not be the only
mechanism responsible for the changes we saw in the rearranged
VH genes. Some somatic hypermutation events were probably
superimposed on the blocks of gene conversion-like changes. Some of the
repeated single base changes at a given position in two or more
sequences (Fig. 3) may also have been due to gene conversions.
Structural motifs and gene conversion
We frequently observed a two-base change in FR3 that leads to the
substitution of glutamic acid (GAG) for leucine (CTG) at position 75. A
total of 10 out of 30 functional VDJ sequences showed this gene
conversion-like event (Fig. 3B). Possible donors for this
gene conversion-like event are VH7 or VH9. The
heptamer (CACGGTG) present 3 bp upstream of the GA may reflect a
hotspot for gene conversion-like activity as previously suggested by
Weinstein et al. (15). The replacement of Leu by Glu at codon position
75 may lead to a conformation of the Ig molecule that is preferentially
selected.
Evidence for rearrangement of germ-line VH4
The work of Boonthum and Knight (32) and Boonthum et al. (33)
strongly supports our hypothesis that in the IgM+
a2+ cells, VH4 is rearranged and
diversification of the rearranged gene resulted from gene
conversion-like events involving stretches of sequences donated by
VH genes present upstream of VH4 (Fig. 3).
Boonthum et al. studied a2+ hybridomas from adult
ali/ali rabbits. Based on comparisons of nucleotide
sequences of the rearranged VDJ and promoter regions with those of
known germ-line VH genes, they concluded that in 8 of 17
a2+ Ig-secreting hybridomas obtained from an aged
ali/ali rabbit VH4 was rearranged. They
suggested that 6 other VH genes were used to encode
a2+ Ig molecules. In this study, we noted only one sequence
(P201) (Fig. 3A) in which there was a possibility that the
initial rearranged gene could have been VH7. When we cloned
VH 12-1-6 (VH9) (23), we noted that a deletion
in the heptamer of the recombination signal sequence (RSS) led to
CACATGA separated from the nonamer by only 22 bp. The same defective
RSS is found in both VH7 and VH9. This could be
one reason why these VH genes rearrange infrequently, if at
all. In contrast to the 6-wk-old ali/ali rabbit in which it
appears that the VH4 gene rearranged in a2+
cells, in aged ali/ali rabbits Boonthum et al. suggested
that non-VH4 genes with a2+ character were
probably rearranged in some B cells. An alternate explanation for their
data could be that in some hybridomas rearrangement of VH4
was followed by a V gene replacement event that brought in upstream
promoter-region sequences. Because not all rabbit VH genes
have been identified, the possibility that other VH1a2-like
genes rearrange (3, 32, 33) cannot be ruled out.
Comparison of productive and nonproductive rearrangements
A total of 19 of the 86 VDJ sequences that were analyzed from the
IgM+ a2+ and IgM+ a2-
populations were found to be nonfunctional. There was no obvious
correlation between the CDR3 length and the presence of productive or
nonproductive rearrangements. Although the utilization of D gene
segments in all three RFs can increase Ab diversity, rabbit B cells
tend to prefer a certain RF depending upon the D gene segment under
consideration (34). In this study, one VDJ sequence (N233) was found to
be defective because of utilization of a nonpreferred RF that resulted
in introduction of in-frame stop codons rendering the rearrangement
nonproductive. The nonfunctional sequences probably reflect gene
rearrangements of the second allele. We cannot prove that some of these
are not due to PCR artifacts; indeed those listed as exceptions in
Table I could either be due to in vitro recombination events during PCR
or gene conversions in vivo. An example of this is N116, which is like
y33 from FR1 through FR2 and like VH4 from CDR2
through FR3.
In rabbit hybridomas that rearranged VH1, <10% of B cells rearranged VDJ genes on both alleles (35). We observed more defective sequences in the IgM+ a2- population compared with the IgM+ a2+ population. This observation raises the question of whether cells expressing a2- sequences more frequently have to rearrange both chromosomes. It may be that the likelihood of functional protein is lower in the case of a2- sequences. It is striking that germ-line VHy33 and z sequences encode 4 cysteines (at positions 21, 35, 50, and 79 according to the numbering system of Kabat et al. (26)) in addition to the usual cysteine 22 and cysteine 92 found in other VH genes. We found that these cysteines were retained in the rabbit y33 and z cDNAs reported here. The fact that these cysteines were conserved during the VH diversification process suggests that their presence is critical for the function and/or structure of the y33 and z molecules. Loss of a cysteine codon may usually result in a nonfunctional protein product. Although we considered VDJ sequences with a substitution at cysteine 92 as nonfunctional, there are a few exceptions in the literature (discussed in 36 . Even in the functional tyrosine 92-containing Ab ABPC48, Proba et al. showed that replacement of heavy chain cysteine 92 by tyrosine made a single chain Fv fragment significantly less stable (36).
In conclusion, this study provides an understanding, at the molecular level, of how young ali/ali rabbits increase the level of a2+ serum Ig and of B cells with surface Ig bearing a2 allotypic determinants. Our data suggest that in a2+ B cells from Alicia rabbits the VH4 gene is rearranged and undergoes one or more rounds of gene conversion-like events utilizing upstream VH genes as donors. As a result of these gene conversion-like events, the rearranged VH4 gene acquires amino acid residues in FR1 and FR3 that correlate with the a2 allotype making it more a2-like. Such B cells that express surface Ig with VHa2 allotypic specificities are preferentially expanded and positively selected in the appendix of young rabbits (20).
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Rose G. Mage, Laboratory of Immunology, Building 10; Room #11N311, 10 Center Drive–MSC 1892, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892-1892. E-mail address:
3 Abbreviations used in this paper: VH, immunoglobulin heavy chain variable region; FR, framework regions of the variable region of immunoglobulin; CDR, complementary determining region of the V region; RSS, recombination signal sequence; RF, reading frame; bp, base pairs; RT-PCR, reverse transcriptase-polymerase chain reaction.
Received for publication July 30, 1997. Accepted for publication October 17, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  G. Yang, H. Obiakor, R. K. Sinha, B. A. Newman, B. L. Hood, T. P. Conrads, T. D. Veenstra, and R. G. Mage Activation-induced deaminase cloning, localization, and protein extraction from young VH-mutant rabbit appendix PNAS, November 22, 2005; 102(47): 17083 - 17088. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-J. Rhee, P. J. Jasper, P. Sethupathi, M. Shanmugam, D. Lanning, and K. L. Knight Positive selection of the peripheral B cell repertoire in gut-associated lymphoid tissues J. Exp. Med., January 3, 2005; 201(1): 55 - 62. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. Esteves, D. Lanning, N. Ferrand, K. L. Knight, S.-K. Zhai, and W. van der Loo Allelic Variation at the VHa Locus in Natural Populations of Rabbit (Oryctolagus cuniculus, L.) J. Immunol., January 15, 2004; 172(2): 1044 - 1053. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zhu, A. Boonthum, S.-K. Zhai, and K. L. Knight B Lymphocyte Selection and Age-Related Changes in VH Gene Usage in Mutant Alicia Rabbits J. Immunol., September 15, 1999; 163(6): 3313 - 3320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kingzette, H. Spieker-Polet, P.-C. Yam, S.-K. Zhai, and K. L. Knight Trans-chromosomal recombination within the Ig heavy chain switch region in B lymphocytes PNAS, September 29, 1998; 95(20): 11840 - 11845. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
and
, respectively), which could have rearranged by inversion.
The homology in the reverse orientation is represented as a horizontal
bar over the sequence. The sequences have been deposited with the
GenBank with the accession numbers 